BDNF transgene improves ataxic and motor behaviors in stargazer mice

BR A IN RE S E A RCH 1 1 60 ( 20 0 7 ) 4 7 –5 7

a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m

w w w. e l s e v i e r. c o m / l o c a t e / b r a i n r e s

Research Report

BDNF transgene improves ataxic and motor behaviors in stargazer mice Hongdi Meng, Sarah K. Larson, Rui Gao, Xiaoxi Qiao⁎ Department of Ophthalmology, Pharmacology & Neuroscience, Indiana University School of Medicine, 702 Rotary Circle, Indianapolis, IN 46202, USA

A R T I C LE I N FO

AB S T R A C T

Article history:

The stargazer (stg) mouse exhibits severe cerebellar ataxia, abnormal motor behavior, and

Accepted 18 May 2007

absence epilepsy. Selective failure of cerebellar brain-derived neurotrophic factor (BDNF)

Available online 2 June 2007

expression is one of the molecular defects in stg mutant. To determine the in vivo effect of BDNF replacement on cerebellar function, we generated a double mutant line of stg–BDNF

Keywords:

mice by crossbreeding BDNF-overexpressing transgenics with stg mutants. Significant

BDNF

upregulation of BDNF mRNA and protein levels was confirmed in the double mutant

Transgene

cerebellum. Gross examination showed less severe ataxia with normal cerebellar

Stargazer

cytoarchitecture in stg–BDNF mice than the original stg mice. Behavioral characterization

Cerebellar ataxia

of stg–BDNF mice revealed significantly improved performance in swimming test and

Motor behavior

footprint analysis compared to stg mice. These results provide in vivo evidence for the

Footprint analysis

correlation of the cerebellar BDNF levels to the ataxia and motor behaviors of stg mice. Published by Elsevier B.V.

1.

Introduction

Brain-derived neurotrophic factor (BDNF) is the most active member of the neurotrophin family in the mature central nervous system (CNS) with high expression levels in the hippocampus, neocortex and cerebellum (Hofer et al., 1990; Leibrock et al., 1989). In addition to its classical functions of promoting neuronal proliferation, differentiation, maturation, and survival during development (Schwartz et al., 1997; Segal et al., 1992), BDNF is also implicated in higher functions of the CNS, including synaptic transmission and long-term potentiation of mature neurons (Levine et al., 1995; Pozzo-Miller et al., 1999). While the severe defects of motor coordination in BDNF knockout mice clearly indicate the important role of BDNF in the vestibular–cerebellar system (Schwartz et al., 1997), the exact contribution of BDNF to cerebellar functional integrity is

⁎ Corresponding author. Fax: +1 317 278 1288. E-mail address: [email protected] (X. Qiao). 0006-8993/$ – see front matter. Published by Elsevier B.V. doi:10.1016/j.brainres.2007.05.048

not fully understood because of early death in BDNF knockout mice. BDNF and the receptor tyrosine kinase B (TrkB) signaling pathway play important roles in maintaining normal cerebellar function during development. Supporting evidence includes significant impairments in motor coordination in several lines of BDNF and TrkB receptor knockout mice (Ernfors et al., 1994; Jones et al., 1994; Klein, 1994; Otal et al., 2005; Schwartz et al., 1997; Smeyne et al., 1994). Conversely, early overexpression of BDNF appears to modulate developing synapses and lead to early GABAergic synapse maturation in the cerebellum (Bao et al., 1999). The stg mouse is a spontaneous recessive mutant mouse model characterized by severe ataxia, abnormal motor behavior, absence epilepsy, and severe impairment in the acquisition of classical eyeblink conditioning in adulthood

48

BR A IN RE S EA RCH 1 1 60 ( 20 0 7 ) 4 7 –57

(Noebels et al., 1990; Qiao et al., 1998; Qiao and Meng, 2003). We have previously identified a selective defect in BDNF expression in the cerebellum of stargazer (stg) mice (Qiao et al., 1996). These mice also have impaired α-amino-3-hydroxy-5-methyl4-isoxazole propionic acid (AMPA) receptor function in the cerebellum (Chen et al., 2000; Hashimoto et al., 1999). The gene mutated in stg mice encodes a calcium channel γ2 subunit, also named stargazin (Letts et al., 1998). Recent studies indicate that stargazin is a critical molecule for AMPA receptor function (Chen et al., 2000; Nicoll et al., 2006; Tomita et al., 2005; Vandenberghe et al., 2005). To date, there are three alleles of stargazin gene mutations that arose from different genetic backgrounds, namely stargazer, waggler (wag), and stg3J (stg3J). All of them exhibit the phenotype of ataxia and epilepsy (Letts, 2005). Significant reduction of BDNF expression was also found in the cerebellum of the waggler mutant (Bao et al., 1998; Chen et al., 1999). Although the exact mechanism and how much the BDNF defect contributes to stg phenotype are not completely clear, the severity of the ataxic phenotype appears to correlate with the levels of BDNF reduction, the stg mutant being the most severe one (Letts, 2005). The selective failure of BDNF expression in stg cerebellum provides a unique model of significant reduction of BDNF restricted to the cerebellum. As the cerebellar ataxia in stg alleles shares significant similarities with the behavioral defects on motor coordination in BDNF knockouts and developmentally delayed cerebellar granule cell migration and incomplete maturation in stg cerebellum also mimic findings reported in BDNF knockout mice (Bao et al., 1998; Meng et al., 2006; Qiao et al., 1998; Qiao and Meng, 2003), it seems probable that the stargazin mutation-induced BDNF defect may underlie the expression of cerebellar abnormalities in these mutants. To determine the role of BDNF expression in stg behaviors, we generated a double mutant (stg–BDNF) by crossbreeding BDNF-overexpressing transgenics (Croll et al., 1999) with stg homozygotes. Significant upregulation of BDNF

mRNA and protein levels was confirmed in the double mutant cerebellum. Behavioral evaluation revealed statistically significant partial reversal of ataxic phenotype and abnormal motor behaviors in the double mutants compared to the original stg mice.

2.

Results

2.1. Creation and gross characterization of stg–BDNF double mutant Homozygous BDNF transgenics (BDNF/BDNF) were crossbred with stg mutants (stg/stg). The F1 offspring (+/stg–+/BDNF) were then bred by brother and sister mating to create the double mutants. Genomic Southern blot (Fig. 1A) and PCR genotyping (Fig. 1B) were carried out in all F2 littermates. Approximately one-eighth of the litters were confirmed double mutants of stg homozygotes carrying at least one copy of the BDNF transgene. Animals have been backcrossed for at least 5 generations. As it was difficult to distinguish the homozygosity of the transgene, the double mutant (stg–BDNF) used in the rest of the experiments included both hetero- and homozygotes of the BDNF transgene (stg/stg–+/BDNF, stg/stg– BDNF/BDNF). For better genetic background comparison, we used stg homozygotes without the BDNF transgene produced from the crossbreeding as a positive control in the behavioral studies. In gross observation, the double mutants were viable. Their behavioral phenotypes resembled the major features seen in stg mice, but appeared less severe than that in the stargazer (Letts et al., 2003; Noebels et al., 1990; Qiao and Meng, 2003). A mild ataxic gait could be recognized around postnatal day 14 (P14), and persisted through adulthood. Abnormal head movement was only noticeable during vigorous locomotion in stg–BDNF mice. Muscular strength and tone were normal. Startle to auditory stimulation was intact. No spontaneous

Fig. 1 – Genotyping of the littermates from crossbreeding of stg and BDNF transgenic mice. (A) Southern blot analysis of the BDNF transgene in genomic DNA. The endogenous BDNF appeared as two bands (top) at ~ 10 kb, while the transgenic BDNF migrated at ~6.6 kb (lower band). BDNF: transgenic mice; +/+: non-transgenic wild-type mice. (B) PCR genotype of the stg mutation. The two-set-primer PCR amplified a 600-bp band from the wild-type allele and produced a 300-bp fragment from the stg mutant allele. Presence of both alleles yields two bands in heterozygous mice. +/stg: heterozygotes; stg/stg: homozygotes.

BR A IN RE S E A RCH 1 1 60 ( 20 0 7 ) 4 7 –5 7

49

locomotor activity bears a resemblance to that reported in BDNF transgenic mice (Croll et al., 1999).

2.2.

Normal cytoarchitecture in adult stg–BDNF mice

Light microscopic examination of H&E-stained paraffin brain sections from adult stg–BDNF mice revealed overall normal brain morphology. In the cerebellum, the pattern of cerebellar foliation appeared normal in stg–BDNF mice (Fig. 2A). No major cytoarchitectural abnormalities were apparent in the stg– BDNF cerebellum. All neuron types had migrated successfully to their proper positions, and cross-sections through the stg– BDNF cerebellar cortex revealed the well-defined laminar cortical structure found in normal cerebellum with a single layer of Purkinje cells aligned between the molecular and granule cell layers (Fig. 2B). No gross changes in the thickness of the cerebellar cortex, the density of granule neurons, the size of the underlying white matter, or the appearance of the deep nuclei of stg–BDNF cerebellum were observed in H&Estained sections. The results are consistent with the relative normal gross morphology described in the cerebellum of adult stg (Bao et al., 1998; Qiao et al., 1996) and BDNF (Croll et al., 1999) mice under light microscopy.

Fig. 2 – Light micrographs of H&E-stained paraffin sections of the cerebellum from adult stg–BDNF mouse. (A) The sagittal section indicated normal pattern of foliation in stg–BDNF cerebellum. Magnification: × 11. (B) Higher magnification (×75) shows a normal single layer of Purkinje cells (PCL) aligned between the molecular layer (ML) and granule cell layer (GCL). Neither the thickness of the cerebellar cortex or underlying white matter nor the density of granular neurons appeared to be altered in stg–BDNF cerebellum compared with wild-type control mice (data not shown).

behavioral seizure was noticed. In addition, stg–BDNF mice appear to be more hyperactive spending more time mobile than the wild-type or stg mice. Such increased general

2.3. Significant elevation of BDNF mRNA and protein levels in stg–BDNF cerebellum It has been shown that BDNF mRNA overexpression is widespread throughout the brain including cerebellum in BDNF transgenic mice driven by a human β-actin promoter (Croll et al., 1999; Qiao et al., 2001). To verify successful elevation of BDNF in the cerebellum of adult double mutant mice, the levels of BDNF mRNA expression were measured by in situ hybridization and real-time RT–PCR. As shown in Fig. 3, BDNF in situ hybridization revealed substantially increased BDNF mRNA signals in the adult stg–BDNF brain compared to wild-type and stg mice. The overall expression pattern in the double mutant resembled to that of the BDNF transgenics (Croll et al., 1999; Qiao et al., 2001). The elevated levels of BDNF mRNA in stg–BDNF cerebellum were evident from

Fig. 3 – The expression pattern of BDNF mRNA in adult wild-type (+/+) (A), stg/stg (B), and stg–BDNF (C) mice. Autoradiographs of in situ hybridization revealed a substantial increase of BDNF mRNA signals throughout the whole brain of the stg–BDNF mutant compared to the wild-type and stg mice. The elevated levels of BDNF mRNA in stg–BDNF cerebellum were evident from increased silver grain intensity over the cerebellar granule cell layer which was significantly higher than that of the stg cerebellum.

50

BR A IN RE S EA RCH 1 1 60 ( 20 0 7 ) 4 7 –57

increased silver grain intensity over the cerebellar granule cell layer which was higher than that of the stg cerebellum (Figs. 3B, C). BDNF mRNA levels in the cerebellum of wild-type, stg, BDNF, and stg–BDNF mice were also quantitatively measured by real-time RT–PCR. Consistent with our previous finding (Bao et al., 1998; Qiao et al., 1996), the levels of BDNF mRNA were significantly lower in stg cerebellum, and were over twofolds higher in BDNF transgenic than that in the wild-type (Fig. 4A) (F = 8.75, df = 11, p < 0.01). Crossing of BDNF transgenics with stg mutants resulted in restoration of cerebellar BDNF mRNA levels similar to wild-type levels (p > 0.05). Although data variability was higher in both the BDNF transgenic and stg–BDNF groups than that in the wild-type and stg groups, most likely caused by mixing of the homo- and heterozygote

of the BDNF transgene, the elevation of BDNF mRNA levels in stg–BDNF cerebellum was still statistically significant (p = 0.028) compared with BDNF levels in stg cerebellum. The results confirm the successful upregulation of BDNF mRNA levels in stg–BDNF cerebellum. To determine BDNF protein levels in the cerebellum of double mutant mice, Western blot analysis was carried out using an antibody specific for mature BDNF. As shown in Fig. 4B, the antibody recognized a 14-kDa BDNF band in cerebellar tissues of different mouse strains corresponding to a positive control sample. Mature BDNF protein level in stg cerebellum was noticeably much less than that in the cerebellum of wildtype, double mutant, and BDNF transgenic mice (F = 11.2, df = 15, p < 0.001) (Fig. 4B). Densitometric analyses revealed that BDNF protein levels in stg cerebellum were about 23% of the wild-type levels, consistent with our previous report of ELISA study showing that BDNF protein levels are significantly reduced in the cerebellum of stg mice (Qiao et al., 1998). In agreement with the initial report that the addition of BDNF transgene resulted in an overall 28% increase of BDNF protein levels in the transgenics (Croll et al., 1999), our immunoblot analysis detected an 43% increase of BDNF protein levels in the transgenic cerebellum. Further more, introducing BDNF transgene into stg strain led to substantial elevation of BDNF protein levels in stg–BDNF cerebellum, which represented nearly an 8-fold increase (7.9 ± 4.8) compared with BDNF protein levels in stg mice (Fig. 4C) (p < 0.001). Taken together, these results confirmed that both BDNF mRNA and protein levels in stg–BDNF cerebellum were significantly elevated and comparable to those in the wildtype cerebellum.

Fig. 4 – BDNF mRNA (A) and protein (B, C) levels in the cerebellum of wild-type (+/+), stargazer (stg/stg), BDNF overexpression transgenic (BDNF), and double mutant (stg–BDNF) mice. (A) BDNF mRNA levels in the cerebellum were measured by real-time RT–PCR. Relative quantity was calculated by Comparative CT method, computed as the ratio of BDNF mRNA versus GAPDH mRNA signals, and then normalized as fold of wild-type control values. The levels of BDNF mRNA in stg–BDNF cerebellum were significantly elevated in comparison with the low levels in stg cerebellum, and were within the equivalent range of the levels in wild-type cerebellum. (B) Representative Western blot of cerebellar homogenates from different mouse strains probed with antibody against BDNF, and then tubulin as an internal control. The intensity of mature BDNF band in stg cerebellum was much less than that in the wild-type. BDNF level in stg–BDNF cerebellum was substantially increased compared to that in stg mice. (C) Densitometric analyses of four independent experiments confirmed that a 7.9-fold increase of BDNF protein levels in stg–BDNF cerebellum was statistically significant (p < 0.001) compared with BDNF levels in stg mice. The signal intensities were quantified and normalized as the ratio of specific BDNF band versus tubulin signals. Results were presented as percentage of wild-type control values. All experiments were repeated at least three times. *p < 0.05; #p < 0.001 comparison between stg–BDNF and stg groups.

BR A IN RE S E A RCH 1 1 60 ( 20 0 7 ) 4 7 –5 7

51

2.4. Partially improved motor performance in adult stg–BDNF mice To determine the effects of elevation of cerebellar BDNF expression on mouse behavior, motor coordination and balance in stg–BDNF mice were quantified by stationary rod test, and swimming test. The overall performance of these tests reflects the functional integrity of cerebellum in coordinating motor activities. In stationary rod performance, when placed on the rod, the wild-type mice moved around in the flanked area without losing balance. The mutant mice either froze or fell off within a few seconds. The maximum cut-off latency for the mice to balance on the rod was 180 s. The results of the balance test on the stationary rod were significantly different (F = 5863.8, df = 23, p < 0.001) between wild-type mice with stg, and stg–BDNF mice (Fig. 5A). However, the test did not show much difference (p > 0.05) between the stg and stg–BDNF mutants. The swimming test is a sensitive measurement of active movement coordination. When placed in water, wild-type mice could swim with ease for over 1 min, the cutoff time of the test (Fig. 5B). In contrast, stg mice showed severely disturbed righting responses with wild underwater tumbling motions as described before (Bao et al., 1998; Qiao et al., 1996). All stg mutants required immediate rescue to prevent drowning. Motor performance in the double mutants was significantly improved (p = 0.019) compared to the stg mice. Although the swim time in both mutant groups were still statistically shorter (F = 144.4, df = 11, p < 0.001) than the wild-type, the stg– BDNF mice were able to coordinate movements three times longer than the stg mice (mean ± S.D.: stg–BDNF = 13.33 ± 4.04 s; stg = 4.4 ± 2.69 s) (Fig. 5B).

2.5.

Partially improved ataxic gait in adult stg–BDNF mice

To evaluate the cerebellar ataxia in stg–BDNF mice, footprint analysis was employed to characterize the gait. Fig. 6 shows the representative footprints obtained from wild-type, stg and stg–BDNF mice. The wild-type mice had a normal narrowbased stance with steady close proximity forelimb (red) and hindlimb (black) footprints. In contrast, stg mice displayed a markedly wide-based stance with frequent off line stumbling as indicated by wide separation of forelimb and hindlimb footprints. The footprint pattern in stg–BDNF mice appeared to be wide, but steady when compared with that in the stg mice. For quantitative comparison of the footprint pattern in different genotype groups, three sets of parameters including base width, stride length, and overlap width were measured as described before (Carter et al., 2001). The data are summarized in Fig. 7. For the base width measurements (Fig. 7A), the wildtype group showed a normal pattern of slightly wider hindlimb base (1.9 ± 0.2) than the forelimb base (1.3 ± 0.1) with narrow variability for both front (CV = 8%) and hind (CV = 11%) limbs indicating little variation and steady gait. The wild-type mice also had the smallest width between the paws while walking among the three genotype groups (F2,35 = 4.47, p < 0.05). Although the mean forelimb and hindlimb base width showed similar trends of increased width in both stg and stg–BDNF mice, the pattern was quite different. First, only the difference

Fig. 5 – Comparison of motor performance of adult wild-type (+/+), stargazer (stg/stg), and double mutant (stg–BDNF) mice on the stationary balance rod (A) and swimming test (B). Both stg and stg–BDNF mutants failed the stationary balance rod test. There was no significant difference among the two mutant lines. Although the mean time to swim in both stg and stg–BDNF mice was significant shorter than that in the wild-type, the double mutant performed significantly better than the stg/stg on the swimming test. *:p < 0.01 compared to the wild-type; #:p < 0.05 compared to stg/stg. n = 3 for the number of mice per group, n = 3 for the number of trials.

between the stg–BDNF and wild-type groups was statistically significant (p < 0.05). Second, large variation of the base width in the stg mice (Front: CV = 30%, Hind: CV = 54%) reflected their most unsteady stumbling gait among the three groups. In contrast, the much smaller variability in stg–BDNF mice (Front: CV = 21%, Hind: CV = 10%) was evident in the even pace while moving (stg–BDNF vs. stg: Front: no difference, Hind: p < 0.05). The much smaller coefficient of the base width variation in stg–BDNF mice indicated much less within subject variability

52

BR A IN RE S EA RCH 1 1 60 ( 20 0 7 ) 4 7 –57

Both front and hind stride measurements revealed that each mutant strain was significantly different (F 2,35 = 111.8, p < 0.001) from the wild-type, with wild-type showing a longer stride length (Fig. 7B). Although there was a trend of longer stride in the stg–BDNF group compared to the stg mutants, the difference was not statistically significant (p > 0.05). Overlap width analysis showed that distances in both mutant groups were significantly wider (p < 0.05) than that in the wild-type mice (Fig. 7C). Although statistical analysis of the overlap width found no significant difference (p > 0.05) between stg and stg–BDNF mice, the mean overlap width in the stg–BDNF group was slightly lower than that in the stg mice. Again, the within subject variability in the double mutants was less (CV = 15%) than that in the stg mice (CV = 18%). Taken together, the footprint test showed that stg–BDNF mice still have a clinical ataxic gait like the predecessor stg

Fig. 6 – Representative photographs of footprints from wild-type (+/+), stargazer (stg/stg), and double mutant (stg–BDNF) mice. The wild-type mice had a narrow-based stance with steady close proximity forelimb (red color) and hindlimb footprints (black color). In contrast, stg footprints were featured with markedly wide-based stance, frequent off line stumbling (arrow), small stride, and separated forelimb and hindlimb prints. The footprint pattern in stg–BDNF mice showed obvious signs of improvement compared to that in the stg mice with steady gaits and close forelimb and hindlimb prints.

than that in stg mutants. The results suggest that although the base width of stg–BDNF mice is wider than normal, it has a steadier gait than the stg mutant. Fig. 7 – Footprint analyses of base width (A), stride length (B), and overlap width (C) in wild-type (+/+), stargazer (stg/stg), and double mutant (stg–BDNF) mice. (A) The wild-type group showed a normal pattern of slightly wider hindlimb base than the forelimb base with minimal variation. While the means of forelimb and hindlimb base width in stg, and stg–BDNF mice were both higher than that in the wild-type, a significant difference was the variation of the base width between the two mutant lines. A much smaller coefficient variation in stg–BDNF mice (Front: CV = 21%, Hind: CV= 10%) than that in stg mice (Front: CV = 30%, Hind: CV = 54%) was evident reflecting significantly improved gait steadiness in the double mutant. (B) The front and hind stride measurements in both mutants were significantly shorter than those in the wild-type. Although there was a trend of slight increased stride in the stg–BDNF group, the difference was not statistically significant (p > 0.05). (C), There was no significant improvement on the high overlap width measurement in the double mutant compared to the original stg mice. *p < 0.05 compared to the wild-type. n = 3 for the number of mice per strain and n = 3 for the number of trials.

BR A IN RE S E A RCH 1 1 60 ( 20 0 7 ) 4 7 –5 7

mutant, with significantly wider base width for both front and hind feet, and bigger overlap width for both left and right feet in comparison to those in the wild-type mice. Front and hind stride distances in stg–BDNF mice also lag behind the wildtype significantly. However, stg–BDNF mice have significantly less variation in all three parameters especially in base width compared to stg mice. The variation scale in the double mutant is in the same range of that in the wild-type indicating a consistent steady gait.

3.

Discussion

We have generated a double mutant line of stg–BDNF mice by crossbreeding BDNF transgenic mice with stg mice to determine the role of BDNF expression defect in the abnormal behavior in stg mice. The levels of BDNF mRNA and protein in the cerebellum of these double mutant mice were significantly elevated and comparable to those in the wild-type cerebellum. Initial screening indicated that these mice had steadier gait and a more even pace while moving. Similar to the original BDNF transgenics, stg–BDNF mice were slightly hyperactive. Behavioral evaluation revealed that stg–BDNF mice performed better than stg mice in a swimming test and on some of the parameters in footprint analysis, indicating partially improved coordination and movement ability. These results suggest that the levels of BDNF in the cerebellum are correlated negatively with the severity of ataxic motor behavior in stg mice. It supports the notion that normal BDNF expression is important for adult cerebellar function and normal behavioral phenotypes.

3.1.

BDNF in stg phenotype

The accumulating data indicate that the levels of BDNF in the cerebellum potentially affect the ataxic and motor behaviors. Severe impaired motor coordination occurs in the BDNF and TrkB knockout mice (Ernfors et al., 1994; Jones et al., 1994; Klein, 1994; Otal et al., 2005; Schwartz et al., 1997; Smeyne et al., 1994). Similar cerebellar ataxia was described in stargazer and waggler mice with significant reduction in cerebellar BDNF expression (Qiao et al., 1996; Bao et al., 1998). In the present in vivo BDNF replacement study, although it did not completely reverse the behavioral defects, addition of the BDNF transgene in stg mice did partially attenuated the severity of abnormal motor phenotype and ataxic gait. It indicates that the BDNF defect indeed contributes to the cerebellar ataxia in these mice. Partial reversal from ataxic behaviors could be due to several possibilities. First, there are potential defects in the TrkB signaling pathway secondary to the primary stargazin gene mutation. We have previously reported that although the levels of TrkB receptor expression were normal, ligandinduced TrkB signal transduction was clearly impaired with a very minimal response in the stg cerebellum (Bao et al., 1998; Qiao et al., 1998). Second, the stargazin mutation may affect other molecules or pathways and impairs behavioral phenotypes. One such example is the disrupted AMPA receptor function in stg cerebellar granule cells (Chen et al., 2000; Hashimoto et al., 1999; Tomita et al., 2005). Although we know

53

that AMPA receptors are critical in a variety of synaptic functions including synaptogenesis, synaptic maturation, and synaptic plasticity (Cathala et al., 2005; Nicoll et al., 2006), the exact role of AMPA receptor defects in the etiology and mechanism of cerebellar ataxia is not clear. AMPA receptor activation could elicit diverse cellular responses other than upregulation of BDNF. Third, due to the highly conserved BDNF gene sequence across all mammalians, it is technically challenging to distinguish the homo- and heterozygous BDNF transgene. The varying zygosity of the transgene with relatively low animal numbers could explain the high individual variability of BDNF expression at mRNA and protein levels and therefore probably contributed to the between subject variation of the behavioral measures in the double mutants. Finally, early and sustained overexpression of BDNF in the brain may modify different components of the circuitry and alter the functional outcome. These BDNF overexpression transgenic mice do show learning impairments and hyperexcitability (Croll et al., 1999). Another consideration is the influence of genetic background. Although the original stg strain, from C57BL/6J × C3HeB/FeJ-a/a, shares 50% of the background genes with BDNF transgenics, completely ruled out the influence would require over 20 generations of backcrosses. Therefore, the overall effects of BDNF overexpression on behavioral phenotype in the double mutant may be adversely affected in several different ways. Additional experiments are necessary to clarify any potential impact of these factors. On the other hand, the vestibular system is an important component in vestibular–cerebellar phenotype in stg mice, and BDNF is critical for the integrity of vestibular system function. It has been reported that some of the abnormal motor phenotype in stg mice bore a resemblance to the vestibular dysfunction induced by vestibular toxins, and that the behavioral phenotype has been associated with histological abnormalities in the vestibular sensory epithelium (Khan et al., 2004). Therefore, the abnormal vestibular function likely contributes to the motor phenotype of stg mice. At the same time, the improved performance in swimming test displayed in stg–BDNF mice could be due to the correction of vestibular dysfunction in the original stg mice. Acoustic startle response is another indicator closely associated with vestibular function. We have previously reported normal acoustic startle response (Noebels et al., 1990), and normal cortical evoked responses to a 1-kHz tone at 80 dB in stg mice (Qiao et al., 1998). However, researchers have also found that stg mice lacked an acoustic startle reflex with normal threshold for the auditory brainstem responses (Khan et al., 2004). While our gross examination of the startle to auditory stimulation appeared to be intact in the stg–BDNF double mutant, it is difficult to conclude how much of the phenotype reversal is attributable to the addition of BDNF gene in the acoustic and vestibular system. Indeed, both BDNF and TrkB receptors are expressed in the inner ear system, and play an important role in synaptogenesis during development (Montcouquiol et al., 1998, 2000).

3.2.

BDNF in neuronal function

A noticeable feature of BDNF knockouts as well as stg mice is severe functional defects correlated with relatively mild

54

BR A IN RE S EA RCH 1 1 60 ( 20 0 7 ) 4 7 –57

morphological changes in the cerebellum. This is likely due to the effects of BDNF on cerebellar neuron maturation rather than proliferation and differentiation during development. It has been well documented that BDNF regulates synaptic activity. Knockout of the BDNF gene impairs both basal synaptic transmission and long-term potentiation in the hippocampus, and some of the electrophysiological and biochemical deficits can be reversed by incubating the slices with BDNF in vitro (Korte et al., 1995; Patterson et al., 1996; Pozzo-Miller et al., 1999). In addition, the BDNF knockout mice exhibit prominent synaptic fatigue and marked decrease in several synaptic proteins (Pozzo-Miller et al., 1999). In the cerebellum of stg mice, profiling the levels of several synaptic proteins revealed selective reduction of BDNF-sensitive synaptic proteins including synaptobrevin and synaptophysin (Meng et al., 2006). The pattern resembles that found in the BDNF knockouts (Pozzo-Miller et al., 1999). Altered synaptic protein distribution is correlated with subtle changes in synaptic ultrastructure in stg cerebellum (Meng et al., 2006; Richardson and Leitch, 2005). It is possible that partial reversal of the ataxic phenotype can be attributed to restored synapse formation and maturation, and improved synaptic transmission in the cerebellum of stg–BDNF mice. It is well known that BDNF can regulate multiple aspects of neuronal functions in different ways. Long-term in vivo elevation of BDNF may also affect neuronal function extraordinarily. In BDNF transgenic mice, the transgene expression is driven by a β-actin promoter. It led to a wide expression of the transgene in various tissues including brain, heart, lung and muscle at high levels (Croll et al., 1999). Long-term overexpression of BDNF in the brain was associated with learning deficits and increased excitability in these transgenics (Croll et al., 1999). Also, BDNF overexpression has been linked to a long-term increase in myelin formation in the peripheral nervous system in BDNF transgenic mice (Tolwani et al., 2004). Therefore, the excess amount and broader spectrum of BDNF transgene expression might exert novel effects in the nervous system. The changes of BDNF transgene expression in other tissues and their influences on ataxia and motor behaviors of stg–BDNF mutants remain to be further investigated.

3.3.

Stargazin in cerebellar ataxia

Stargazin is a critical factor in regulating cerebellar BDNF expression. Among three identified stg alleles which arose independently from different strains, two (stg and stgwag) have obvious ataxia and selective cerebellar BDNF expression defect (Bao et al., 1998; Qiao et al., 1998). No information is available so far regarding cerebellar BDNF levels in the third allele, stg3J, which is a mild allele with barely noticeable abnormal phenotype. Despite the clear correlation, the signaling pathway for stargazin regulation of cerebellar BDNF expression is not clear. One potential mechanism is through the AMPA receptor. The stargazin gene mutation disrupted the AMPA receptor function and AMPA receptor synaptic targeting in the cerebellar granule cells (Chen et al., 2000; Hashimoto et al., 1999). The detailed roles of AMPA receptor defects in the etiology and mechanism of cerebellar ataxia remain unclear. It has been

reported that both expression and release of BDNF in the hippocampus and cerebellum are enhanced by neuronal activity and excitatory synaptic transmission (Canossa et al., 1997; Figurov et al., 1996; Goodman et al., 1996; Isackson et al., 1991; Lindholm et al., 1993; Patterson et al., 1992; Zafra et al., 1990). AMPA receptor-mediated synaptic response is an essential component of synaptic activity. The impaired AMPA receptor function identified in stg and stgwag cerebellar granule cells (Chen et al., 2000; Hashimoto et al., 1999; Qiao et al., 1996) could disrupt activitydependent regulation of BDNF expression in the cerebellum. Also, there are ataxia and severely impaired acquisition of eyeblink conditioning in stg mice. Therefore, it is enticing to attribute impaired motor coordination to the signal imbalance or deafferentation of the stg cerebellar cortex. The improved behavioral phenotype in stg–BDNF mice might be due to bypassing some of the AMPA receptor defects in this signaling process. Additional studies are necessary to test the hypothesis directly. In summary, our data in the present investigation revealed that long-term overexpression of BDNF could improve ataxic gait and behavioral phenotype in stg–BDNF mice. This is demonstrated by the diminished gait ataxia, better performance in the swimming test and steady foot placement in ambulation. However, the incomplete reversal of the behavioral phenotype in the double mutant also suggests that failure of BDNF expression may not be the sole biological defect which impairs the neuronal function in the stg cerebellum. Other mechanisms mediated by either stargazin or stargazin/AMPA receptor, independent of the BDNF signaling pathway may be involved in maintaining the integrity of cerebellar circuitry. Additional experiments are necessary to further explore these hypotheses.

4.

Experimental procedures

4.1.

Animals

Mutant stg mice (C3B6Fe+, stg/stg) were obtained from breeding colonies of the Jackson Laboratory (Bar Harbor, ME). Heterozygous males (+/stg) and females (+/stg) were mated to produce homozygous mutants (stg/stg). Genotyping confirmed wild-type littermates (+/+) from the same breeding colony were served as wild-type control. Mice with overexpression of BDNF (BDNF) due to germline insertion of a human BDNF transgene driven by a β-actin promoter in the C57BL/6J × F2CBA strain were provided by Regeneron Pharmaceuticals (Tarrytown, NY) (Croll et al., 1999). All mice were maintained in the animal facility at Indiana University School of Medicine on a 12 h on/12 h off light/dark cycle with food and water available ad libitum. Adult age-matched male mice at 2–4 months of age were used in all the studies. The experiments were carried out in accordance with the National Institutes of Health guidelines for the care and use of laboratory animals. The animal protocols were approved by the Indiana University Animal Care and Use committee. All efforts were made to ensure that both animal numbers and suffering were minimized while producing reliable scientific data.

BR A IN RE S E A RCH 1 1 60 ( 20 0 7 ) 4 7 –5 7

4.2.

Genotyping

Genomic Southern blot was utilized to detect the BDNF transgene using a standard protocol. Briefly, genomic DNA was isolated from mouse tail. After overnight digestion with restriction enzyme BamH1, equal amounts of DNA samples were separated by electrophoresis on a 0.8% agarose gel and transferred to a nylon membrane. Hybridization reaction was performed using a random prime 32P-labeled BDNF probe. The probe identifies a ∼6.6 kb transgenic band and a ∼10 kb endogenous band. PCR genotyping was used for stg allele identification. Two sets of primers, (1) Forward: 5′-GCCTTGATCAGAGTAACTGTC, Reverse: 5′-CATTTCCTGTCTCATCCTTTG; and (2) Forward: 5′ACTGTCACTCTATCTGGAATC, Reverse: 5′-CATTTCCTGTCTCATCCTTTG, were used to detect a ∼600 bp band of wild-type stargazin allele and a ∼300 bp band of an stg allele specific to the mutational insertion fragment (Letts et al., 1998; Vandenberghe et al., 2005).

4.3.

Histology

Two pairs of adult +/+, stg/stg, and stg–BDNF mice were overdosed with sodium pentobarbital and transcardially perfused with 0.9% saline, followed by 10% buffered formalin. The brains were removed from the skull and postfixed for at least 24 h at 4 °C. Tissues were processed for paraffin embedding. Sections were cut on a microtome at 6 μm thickness and stained with Allen's hematoxylin and eosin (H&E).

4.4.

In situ hybridization

35

S-labeled sense and antisense ribonucleotide probes were synthesized using the Riboprobe Gemini System (Promega, Madison, WI). Mouse brain was dissected out following decapitation and freezing on dry ice. After sectioning at 14 μm in a cryostat at − 20 °C, tissues were fixed with 4% paraformaldehyde in 0.1 M PBS for 20 min. The brain sections were pretreated with 0.25% acetic anhydride and 0.1 M triethanolamide for 10 min, and dehydrated until dry. Tissue sections were then incubated at 55 °C overnight with the probe solution containing 5 × 106 cpm/ml 35S-labeled riboprobes, 50% formamide, 10% dextran sulfate, 300 mM NaCl, 0.5 mg/ml yeast RNA, 10 μM DTT, 0.02% Ficoll, 0.02% polyvinyl pyrrolidone, 0.02% BSA, and 1 mM EDTA in 10 mM Tris–HCl (pH 8.0). Following hybridization, the slides were rinsed in 4× SSC (SSC: 150 mM NaCl and 15 mM NaAc), digested with 20 g/ml RNase A at 37 °C for 30 min, washed through descending concentrations of SSC to 0.1× SSC at 60–65 °C. The slides were then dehydrated in ethanol, dried and exposed to X-ray film for 3– 5 days. After exposure to emulsion for several weeks, sections were counterstained with hematoxylin.

4.5.

RNA isolation

Total RNA was isolated from different regions of mouse brain using RNA/DNA/protein isolation TRI reagent solution (SigmaAldrich, St. Louis, MO) according to the manufacture's protocol. Briefly, tissue samples of cortex, hippocampus and cerebellum were dissected, homogenized in TRI reagent

55

solution, suspended in a 1:5 volume of chloroform, and centrifuged at 12,000×g for 15 min. The RNA contained in the aqueous phase was transferred to new tubes and precipitated with isopropanol. The samples were then centrifuged at 12,000×g for 10 min to pellet the RNA. After washing the pellet with 75% cold ethanol, the resulting RNA pellet was dissolved in RNAsecure solution (Ambion, Austin, TX).

4.6.

Real-time RT–PCR

After treating with DNase I (Invitrogen, Carlsbad, CA), 2 μg of total RNA were reverse-transcribed into cDNA using TaqMan Reverse Transcription Reagents (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. The sequences of the PCR primers and that of the probe were selected from the Exon V of the mouse BDNF gene (GenBank Accession No. AY057907) with Beacon Designer 2 software (Premier Biosoft International, Palo Alto, CA). The sequences of the forward and reverse primers were 5′-GTCCACGGACAAGGCAACTT and 5′-CCAGTGATGTCGTCGTCAGAC, respectively. The TaqMan probe selected between the primers was fluorescence labeled at the 5′ end with 6-carboxyfluorescein (FAM) as the reporter dye and at the 3′ end with 6carboxytetramethyl-rhodamine (TAMRA) as the quencher dye (5′FAM-CCTACCCAGGTCTGCGGACCCATG-TAMRA). Using an ABI PRISM 7700 instrument (Perkin-Elmer Biosystems, Boston, MA), PCR of BDNF was performed with TaqMan Universal PCR master mixture, primers, TaqMan probe, and 30–50 ng cDNA. The primers and VIC probe for rodent GAPDH (Applied Biosystems) were used as an internal control. PCR reactions were carried out in a 96-well plate under the following conditions: initial 50 °C for 2 min, 95 °C for 10 min, then 50 cycles of 95 °C for 15 s and at 60 °C for 1 min. Controls without RT (RT−) or template (NTC) were also included in each run. The validation experiment indicates approximately equal efficiency of the BDNF and GAPDH amplification. A comparative CT method was chosen for relative BDNF expression analysis. Results are normalized as percentage of wild-type control values.

4.7.

BDNF immunoblot analysis

Cerebellar tissues of 4-month-old wild-type, stg/stg, stg–BDNF, and BDNF transgenic mice (n = 3, respectively) were homogenized in RIPA buffer with protease inhibitor mixture. Protein levels were determined using a Bio-Rad Protein Assay kit. Equal amounts of protein samples were then separated by 12% SDS– PAGE, and transferred to a PVDF membrane by a semi-dry transfer cell (Bio-Rad Laboratories, Hercules, CA). After blocking with a Tris buffer solution (TBS) containing 0.1% Tween-20 and 5% non-fat milk, blots were probed overnight with a primary rabbit polyclonal antibody for BDNF (1:1000, sc-20981; Santa Cruz Biotechnology, Santa Cruz, CA). Blots were then incubated with peroxidase conjugated anti-rabbit secondary antibody (Pierce, Rockford, IL) in TBS with 0.1% Tween-20 and 5% non-fat milk for 1 h at room temperature. The reactive bands were visualized by a SuperSignal Substrate (Pierce, Rockford, IL). The chemiluminescence signals were recorded using a ChemDoc XRS imaging system (Bio-Rad Laboratories, Hercules, CA). To control for loading variations, blots were stripped and reprobed

56

BR A IN RE S EA RCH 1 1 60 ( 20 0 7 ) 4 7 –57

with α-tubulin antibody (1:1000; Sigma, St. Louis, MO) as an internal control. Positive control SH-SY5Y cell lysate was purchased from Santa Cruz. For quantification, densities of immunoreactive bands were measured using Quantity One software (Bio-Rad Laboratories, Hercules, CA), and the ratio of specific BDNF signals versus tubulin was calculated.

4.8.

Stationary rod test

Adult +/+, stg/stg, and stg–BDNF mice (n ≥ 3/group) were tested for their ability to balance on a stationary rod during a 60-s time trial. The plastic rod was 3.75 cm in diameter and 32.5 cm long and placed 20 cm off the ground above a padded surface. At the midpoint of the rod was a 7.5-cm area flanked by two vertical barriers measured at 11.25 cm high to prevent jumping or horizontal movement along the rod. Soft foam bedding was placed under the rod to prevent injury in the case of a fall. During the test, the mouse was positioned in the middle of the balance rod, and the amount of time they were able to hold on the rod before falling was recorded up to a maximum of 60 s. The mean latency on the rod for each mouse was obtained over six trials.

4.9.

Swimming test

Mouse motor coordination ability during swimming was also tested in three genotype groups. A plastic tank (length: 46 cm, width 38 cm, height 13 cm) filled with 10 cm of warm water maintained at 25–30 °C was used. The mouse was placed individually into the center of the tank, and the righting response in water during a 60-s period was obtained. Mice unable to keep their head above water for 10 s failed the test. As the mutants often require quick rescue after a failed test, the method was modified by placing each mutant in a slottedfloor cylinder and then lowed into the water tank. The slottedfloor cylinder was lifted for a timely drain of the water when judged necessary. At least three mice from each genotype were used and a total of three trials performed on each mouse with one trial per day. The mean latency was calculated for each group.

4.10.

Footprint test

The procedure for footprint analysis was modified from a standard protocol described before (Carter et al., 2001). To obtain the footprints, the adult mouse's paws were coated with non-toxic colored inks and the mouse was allowed to walk down a narrow runway that is covered with white paper. The apparatus for the footprint test was an open-top runway with an enclosed cage at the end for the mice to enter. The runway length was 51.25 cm long and the width was 11.25 cm. Furthermore, the open-top runway was flanked by two walls at each side that were 10.62 cm high. The mice were acclimatized to the environment for at least 60 min, and were allowed at least one practice run before coating the paws. To ease the measurements, front and hind paws were coated with different colors of red and black, respectively. At least three mice from each genotype were used and a total of three trials performed on each mouse with one trial per day. Once the footprints had dried, the following parameters were measured:

base width, overlap width, forelimb stride, and hindlimb stride. The means of each parameter were calculated for each group.

4.11.

Statistical analysis

All data were expressed as mean ± S.D. Statistical significance was determined by either one-way ANOVA for stationary rod test and swimming test or two-way ANOVA for footprint test to compare measurements between groups. A 3 × 2 (group × limb) mixed factorial ANOVA was used to analyze the base width, and stride distance. One-way ANOVA was used for multiple comparisons between groups for analysis of BDNF mRNA and protein levels. Post-hoc tests for multiple comparisons are done by LSK and Student–Newman–Keuls test. The mean difference is significant at the 0.05 level. The coefficient of variation (CV) is calculated as the ratio of the standard deviation to the means, multiplying by 100 to reflect the subject variability within groups. Student's t-test was used for comparison of CV value between groups.

Acknowledgments This work was supported by the American Heart Association Grant 0435331Z (X.Q.), LEQSF-RD-A-18, an intramural IUPUI Biomedical Research Grant (X.Q.), and an unrestricted grant from Research to Prevent Blindness, Inc. The authors thank Dr. David Knight and Ms. Betty Uyesugi for help on manuscript preparation. REFERENCES

Bao, S., Chen, L., Qiao, X., Knusel, B., Thompson, R.F., 1998. Impaired eye-blink conditioning in waggler, a mutant mouse with cerebellar BDNF deficiency. Learn. Mem. 5, 355–364. Bao, S., Chen, L., Qiao, X., Thompson, R.F., 1999. Transgenic brain-derived neurotrophic factor modulates a developing cerebellar inhibitory synapse. Learn. Mem. 6, 276–283. Canossa, M., Griesbeck, O., Berninger, B., Campana, G., Kolbeck, R., Thoenen, H., 1997. Neurotrophin release by neurotrophins: implications for activity-dependent neuronal plasticity. Proc. Natl. Acad. Sci. U. S. A. 94, 13279–13286. Carter, R.J., Morton, A.J., Dunnett, S.B., 2001. Motor coordination and balance in rodents. Current Protocols in Neuroscience. Vol. 8. John Wiley & Sons, Inc., New York, pp. 1–14. Cathala, L., Holderith, N.B., Nusser, Z., Digregorio, D.A., Cull-Candy, S.G., 2005. Changes in synaptic structure underlie the developmental speeding of AMPA receptor-mediated EPSCs. Nat. Neurosci. 8, 1310–1318. Chen, L., Bao, S., Qiao, X., Thompson, R.F., 1999. Impaired cerebellar synapse maturation in waggler, a mutant mouse with a disrupted neuronal calcium channel gamma subunit. Proc. Natl. Acad. Sci. U. S. A. 96, 12132–12137. Chen, L., Chetkovich, D.M., Petralia, R.S., Sweeney, N.T., Kawasaki, Y., Wenthold, R.J., Bredt, D.S., Nicoll, R.A., 2000. Stargazin regulates synaptic targeting of AMPA receptors by two distinct mechanisms. Nature 408, 936–943. Croll, S.D., Suri, C., Compton, D.L., Simmons, M.V., Yancopoulos, G.D., Lindsay, R.M., Wiegand, S.J., Rudge, J.S., Scharfman, H.E., 1999. Brain-derived neurotrophic factor transgenic mice exhibit passive avoidance deficits, increased seizure severity and in vitro hyperexcitability in the hippocampus and entorhinal cortex. Neuroscience 93, 1491–1506.

BR A IN RE S E A RCH 1 1 60 ( 20 0 7 ) 4 7 –5 7

Ernfors, P., Lee, K.F., Jaenisch, R., 1994. Mice lacking brain-derived neurotrophic factor develop with sensory deficits. Nature 368, 147–150. Figurov, A., Pozzo-Miller, L.D., Olafsson, P., Wang, T., Lu, B., 1996. Regulation of synaptic responses to high-frequency stimulation and LTP by neurotrophins in the hippocampus. Nature 381, 706–709. Goodman, L.J., Valverde, J., Lim, F., Geschwind, M.D., Federoff, H.J., Geller, A.I., Hefti, F., 1996. Regulated release and polarized localization of brain-derived neurotrophic factor in hippocampal neurons. Mol. Cell. Neurosci. 7, 222–238. Hashimoto, K., Fukaya, M., Qiao, X., Sakimura, K., Watanabe, M., Kano, M., 1999. Impairment of AMPA receptor function in cerebellar granule cells of ataxic mutant mouse stargazer. J. Neurosci. 19, 6027–6036. Hofer, M., Pagliusi, S.R., Hohn, A., Leibrock, J., Barde, Y.A., 1990. Regional distribution of brain-derived neurotrophic factor mRNA in the adult mouse brain. EMBO J. 9, 2459–2464. Isackson, P.J., Huntsman, M.M., Murray, K.D., Gall, C.M., 1991. BDNF mRNA expression is increased in adult rat forebrain after limbic seizures: temporal patterns of induction distinct from NGF. Neuron 6, 937–948. Jones, K.R., Farinas, I., Backus, C., Reichardt, L.F., 1994. Targeted disruption of the BDNF gene perturbs brain and sensory neuron development but not motor neuron development. Cell 76, 989–999. Khan, Z., Carey, J., Park, H.J., Lehar, M., Lasker, D., Jinnah, H.A., 2004. Abnormal motor behavior and vestibular dysfunction in the stargazer mouse mutant. Neuroscience 127, 785–796. Klein, R., 1994. Role of neurotrophins in mouse neuronal development. FASEB J. 8, 738–744. Korte, M., Carroll, P., Wolf, E., Brem, G., Thoenen, H., Bonhoeffer, T., 1995. Hippocampal long-term potentiation is impaired in mice lacking brain-derived neurotrophic factor. Proc. Natl. Acad. Sci. U. S. A. 92, 8856–8860. Leibrock, J., Lottspeich, F., Hohn, A., Hofer, M., Hengerer, B., Masiakowski, P., Thoenen, H., Barde, Y.A., 1989. Molecular cloning and expression of brain-derived neurotrophic factor. Nature 341, 149–152. Letts, V.A., 2005. Stargazer – a mouse to seize! Epilepsy Curr. 5, 161–165. Letts, V.A., Felix, R., Biddlecome, G.H., Arikkath, J., Mahaffey, C.L., Valenzuela, A., Bartlett II, F.S., Mori, Y., Campbell, K.P., Frankel, W.N., 1998. The mouse stargazer gene encodes a neuronal Ca2+-channel gamma subunit. Nat. Genet. 19, 340–347. Letts, V.A., Kang, M.G., Mahaffey, C.L., Beyer, B., Tenbrink, H., Campbell, K.P., Frankel, W.N., 2003. Phenotypic heterogeneity in the stargazin allelic series. Mamm. Genome 14, 506–513. Levine, E.S., Dreyfus, C.F., Black, I.B., Plummer, M.R., 1995. Brain-derived neurotrophic factor rapidly enhances synaptic transmission in hippocampal neurons via postsynaptic tyrosine kinase receptors. Proc. Natl. Acad. Sci. U. S. A. 92, 8074–8077. Lindholm, D., Dechant, G., Heisenberg, C.P., Thoenen, H., 1993. Brain-derived neurotrophic factor is a survival factor for cultured rat cerebellar granule neurons and protects them against glutamate-induced neurotoxicity. Eur. J. Neurosci. 5, 1455–1464. Meng, H., Walker, N., Su, Y., Qiao, X., 2006. Stargazin mutation impairs cerebellar synaptogenesis, synaptic maturation and synaptic protein distribution. Brain Res. 1124, 197–207. Montcouquiol, M., Valat, J., Travo, C., Sans, A., 1998. A role for BDNF in early postnatal rat vestibular epithelia maturation: implication of supporting cells. Eur. J. Neurosci. 10, 598–606. Montcouquiol, M.E., Sans, N.A., Travo, C., Sans, A., Valat, J., 2000. Detection and localization of BDNF in vestibular nuclei during the postnatal development of the rat. NeuroReport 11, 1401–1405.

57

Nicoll, R.A., Tomita, S., Bredt, D.S., 2006. Auxiliary subunits assist AMPA-type glutamate receptors. Science 311, 1253–1256. Noebels, J.L., Qiao, X., Bronson, R.T., Spencer, C., Davisson, M.T., 1990. Stargazer: a new neurological mutant on chromosome 15 in the mouse with prolonged cortical seizures. Epilepsy Res. 7, 129–135. Otal, R., Martinez, A., Soriano, E., 2005. Lack of TrkB and TrkC signaling alters the synaptogenesis and maturation of mossy fiber terminals in the hippocampus. Cell Tissue Res. 319, 349–358. Patterson, S.L., Grover, L.M., Schwartzkroin, P.A., Bothwell, M., 1992. Neurotrophin expression in rat hippocampal slices: a stimulus paradigm inducing LTP in CA1 evokes increases in BDNF and NT-3 mRNAs. Neuron 9, 1081–1088. Patterson, S.L., Abel, T., Deuel, T.A., Martin, K.C., Rose, J.C., Kandel, E.R., 1996. Recombinant BDNF rescues deficits in basal synaptic transmission and hippocampal LTP in BDNF knockout mice. Neuron 16, 1137–1145. Pozzo-Miller, L.D., Gottschalk, W., Zhang, L., McDermott, K., Du, J., Gopalakrishnan, R., Oho, C., Sheng, Z.H., Lu, B., 1999. Impairments in high-frequency transmission, synaptic vesicle docking, and synaptic protein distribution in the hippocampus of BDNF knockout mice. J. Neurosci. 19, 4972–4983. Qiao, X., Meng, H., 2003. Nonchannel functions of the calcium channel gamma subunit: insight from research on the stargazer mutant. J. Bioenerg. Biomembr. 35, 661–670. Qiao, X., Hefti, F., Knusel, B., Noebels, J.L., 1996. Selective failure of brain-derived neurotrophic factor mRNA expression in the cerebellum of stargazer, a mutant mouse with ataxia. J. Neurosci. 16, 640–648. Qiao, X., Chen, L., Gao, H., Bao, S., Hefti, F., Thompson, R.F., Knusel, B., 1998. Cerebellar brain-derived neurotrophic factor-TrkB defect associated with impairment of eyeblink conditioning in Stargazer mutant mice. J. Neurosci. 18, 6990–6999. Qiao, X., Suri, C., Knusel, B., Noebels, J.L., 2001. Absence of hippocampal mossy fiber sprouting in transgenic mice overexpressing brain-derived neurotrophic factor. J. Neurosci. Res. 64, 268–276. Richardson, C.A., Leitch, B., 2005. Phenotype of cerebellar glutamatergic neurons is altered in stargazer mutant mice lacking brain-derived neurotrophic factor mRNA expression. J. Comp. Neurol. 481, 145–159. Schwartz, P.M., Borghesani, P.R., Levy, R.L., Pomeroy, S.L., Segal, R.A., 1997. Abnormal cerebellar development and foliation in BDNF−/− mice reveals a role for neurotrophins in CNS patterning. Neuron 19, 269–281. Segal, R.A., Takahashi, H., McKay, R.D., 1992. Changes in neurotrophin responsiveness during the development of cerebellar granule neurons. Neuron 9, 1041–1052. Smeyne, R.J., Klein, R., Schnapp, A., Long, L.K., Bryant, S., Lewin, A., Lira, S.A., Barbacid, M., 1994. Severe sensory and sympathetic neuropathies in mice carrying a disrupted Trk/NGF receptor gene. Nature 368, 246–249. Tolwani, R.J., Cosgaya, J.M., Varma, S., Jacob, R., Kuo, L.E., Shooter, E.M., 2004. BDNF overexpression produces a long-term increase in myelin formation in the peripheral nervous system. J. Neurosci. Res. 77, 662–669. Tomita, S., Adesnik, H., Sekiguchi, M., Zhang, W., Wada, K., Howe, J.R., Nicoll, R.A., Bredt, D.S., 2005. Stargazin modulates AMPA receptor gating and trafficking by distinct domains. Nature 435, 1052–1058. Vandenberghe, W., Nicoll, R.A., Bredt, D.S., 2005. Stargazin is an AMPA receptor auxiliary subunit. Proc. Natl. Acad. Sci. U. S. A. 102, 485–490. Zafra, F., Hengerer, B., Leibrock, J., Thoenen, H., Lindholm, D., 1990. Activity dependent regulation of BDNF and NGF mRNAs in the rat hippocampus is mediated by non-NMDA glutamate receptors. EMBO J. 9, 3545–3550.