Biochemical and anatomical evidence for specialized voltage-dependent calcium channel γ isoform expression in the epileptic and ataxic mouse, stargazer

PII: S 0 3 0 6 - 4 5 2 2 ( 0 1 ) 0 0 2 2 0 - 2

Neuroscience Vol. 105, No. 3, pp. 599^617, 2001 ß 2001 IBRO. Published by Elsevier Science Ltd Printed in Great Britain. All rights reserved 0306-4522 / 01 $20.00+0.00

www.elsevier.com/locate/neuroscience

BIOCHEMICAL AND ANATOMICAL EVIDENCE FOR SPECIALIZED VOLTAGE-DEPENDENT CALCIUM CHANNEL Q ISOFORM EXPRESSION IN THE EPILEPTIC AND ATAXIC MOUSE, STARGAZER A. H. SHARP,a;1 J. L. BLACK,III b;1;2 S. J. DUBEL,a S. SUNDARRAJ,a J.-P. SHEN,a A. M. R. YUNKER,a T. D. COPELANDc and M. W. MCENERYa;d * a

Department of Physiology and Biophysics, Case Western Reserve University, School of Medicine, 10900 Euclid Avenue, Cleveland, OH 44106-4970, USA b

c

Section of General Psychiatry, Division of Adult Psychiatry, Department of Psychiatry and Psychology, Mayo Clinic, Rochester, MN 55905, USA

ABL-Basic Research Program, NCI-Frederick Cancer Research and Development Center, Frederick, MD 21702, USA

d

Department of Neuroscience, Case Western Reserve University, School of Medicine, 10900 Euclid Avenue, Cleveland, OH 44106-4970, USA

AbstractöInherited forms of ataxia and absence seizures in mice have been linked to defects in voltage-dependent calcium channel subunits. However, a correlation between the sites of neuronal dysfunction and the impact of the primary lesion upon calcium channel subunit expression or function has not been clearly established. For example, the mutation in stargazer mice has pleiotropic consequences including synaptic alterations in cerebellar granule cells, hippocampal CA3/mossy ¢bers, and cortical neurons in layer V that, presumably, lead to ataxia and seizures. Genetic analysis of stargazer mice determined that the defective gene encodes a protein expressed in brain (Q2) with limited homology to the skeletal muscle L-type calcium channel Q1 subunit. Although additional Q isoforms have been subsequently identi¢ed primarily in neural tissue, little was known about the proteins they encode. Therefore, this study explored the distribution and biochemical properties of Q2 and other Q isoforms in wild-type and stargazer brain. We cloned human Q2, Q3, and Q4 isoforms, produced speci¢c anti-peptide antibodies to Q isoforms and characterized both heterologously expressed and endogenous Q. We identi¢ed regional speci¢city in the expression of Q isoforms by western analysis and immunohistochemistry. We report for the ¢rst time that the mutation in the stargazer gene resulted in the loss of Q2 protein. Furthermore, no compensatory changes in the expression of Q3 or Q4 protein were evident in stargazer brain. In contrast to other voltage-dependent calcium channel subunits, Q immunostaining was striking in that it was primarily detected in regions highly enriched in excitatory glutamatergic synapses and faintly detected in cell bodies, suggesting a role for Q in synaptic functions. Sites of known synaptic dysfunction in stargazer (the hippocampal CA3 region, dentate gyrus, and cerebellar molecular layer) were revealed as relying primarily upon Q2, as total Q isoform expression was dramatically decreased in these regions. Electron microscopy localized anti-Q antibody immunostaining to dendritic structures of hippocampal mossy ¢ber synapses, with enrichment at postsynaptic densities. To assess the association of native Q with voltage-dependent calcium channel or K-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptor subunits, Q isoforms (Q2, Q3 and Q4) were detergent solubilized from mouse forebrain. Antibodies against a highly conserved C-terminal epitope present in Q2, Q3 and Q4 immunoprecipitated voltage-dependent calcium channel subunits (K1B), providing the ¢rst in vivo evidence that Q and voltage-dependent calcium channels form stable complexes. Furthermore, both anti-Q2 antibodies and anti-K1B antibodies independently immunoprecipitated the AMPA receptor subunit, GluR1, from mouse forebrain homogenates.

1

These authors contributed equally to this study. To whom inquiries regarding the Q isoform cDNAs should be addressed. *Correspondence to: M.W. McEnery, Department of Physiology and Biophysics, Case Western Reserve University, School of Medicine, 10900 Euclid Avenue, Cleveland, OH 44106-4970, USA. Tel.: +1-216-368-3377; fax: +1-216-368-1693. E-mail address: [email protected] (M. W. McEnery). Abbreviations : K1A, 250-kDa subunit of the P/Q-type VDCC ; K1B, 230-kDa subunit of the N-type VDCC; K1C, 190^220-kDa subunit of the L-type VDCC ; K1G, 280-kDa subunit of the T-type VDCC ; K2/N, 160-kDa subunit of HVA VDCC ; L1^L4, 53^85-kDa subunits of HVA VDCC; Q2, 36-kDa protein encoded by stargazin gene; Q3, Q4 and Q5, structural homologues of Q2; AMPA, K-amino-3-hydroxy-5-methyl-4isoxazole propionic acid ; BCT, cerebellar basket cell terminal; CHAPS, 3-[(3-cholamido-propyl)-dimethyl-ammonio]-1-propanesulfonate; DAB, 3,3P-diaminobenzidine ; DHP, 1,4-dihydropyridine class of calcium channel blockers ; EDTA, ethylenediaminetetraacetic acid ; EGTA, ethylene glycol-bis(L-aminoethyl ether)-N,N,NP,NP-tetraacetic acid; EPSC, excitatory postsynaptic current ; GluR1, glutamate receptor, type 1 subunit; HEPES, 4-(2-hydroxyethyl)-1-piperazine ethane-sulfonic acid ; HVA VDCC, high voltage-activated VDCC which include L-, N-, P/Qand R-type; KLH, keyhole limpet hemocyanin ; L-type VDCC, dihydropyridine-sensitive VDCC ; LVA VDCC, low voltage-activated VDCC which include T-type VDCC ; NGS, normal goat serum; NPY, neuropeptide Y; N-type VDCC, g-conotoxin GVIA-sensitive VDCC ; P, postnatal day; PAGE, polyacrylamide gel electrophoresis ; PBS, phosphate-bu¡ered saline; PCR, polymerase chain reaction ; P/Q-type VDCC, g-conotoxin MVIIC-sensitive VDCC ; SDS, sodium dodecyl sulfate; TBS, Tris-bu¡ered saline ; VDCC, voltage-dependent calcium channel.

2

599

NSC 5065 10-8-01

Cyaan Magenta Geel Zwart

600

A. H. Sharp et al.

In summary, loss of Q2 immunoreactivity in stargazer is precisely localized so as to contribute to previously characterized synaptic defects. The data in this paper provide compelling evidence that Q isoforms form complexes in vivo with voltage-dependent calcium channels as well as AMPA receptors, are selectively and di¡erentially expressed in neuronal processes, and localize primarily to dendritic structures in the hippocampal mossy ¢ber region. ß 2001 IBRO. Published by Elsevier Science Ltd. All rights reserved. Key words: channelopathy, hippocampus, cerebellum, null mutation, antibodies.

in the stargazin/Q2 gene (GenBank accession number AF077739) was determined to be the insertion of a 6-kb early transposon into the intron between exon 2 and exon 3. Northern blot analysis suggested that the RNA encoding Q2 in the stargazer mouse was decreased and could be distinguished from the wild-type message both in its size and absence of the 3P downstream UTR (Letts et al., 1998). The impact of this mutation upon the expression of the Q2 protein, however, was not determined (Letts et al., 1998). Signi¢cant regionally restricted alterations were noted in stargazer brain which can be used as important landmarks for further investigation of the underlying disease process. In the cerebellum there was altered maturation of granule cells evidenced by an increased number of external granule cells at P15 and immature granule cells persisting into adulthood (Qiao et al., 1998). Furthermore, the cerebellar defects also included a selective decrease in brain-derived neurotrophic factor (BDNF) mRNA expression (Qiao et al., 1996) and decreased granule cell K-amino-3-hydroxy-4-isoxazole propionic acid (AMPA) receptor function (Hashimoto et al., 1999a). Impaired cerebellar synapse maturation was also observed in waggler, an allelic form of stargazer (Chen et al., 1999). In hippocampus, cellular and signaling defects were localized to the mossy ¢ber region of CA3 (Qiao and Noebels, 1993; Nahm and Noebels, 1998). However, the abnormal mossy ¢ber sprouting (Qiao and Noebels, 1993) and increased expression of neuropeptide Y (NPY) in hippocampal mossy ¢bers (Chafetz et al., 1995) both appeared to be subsequent to the onset of seizures in stargazer mice indicating that increased sprouting was not itself the origin of the seizure activity. In contrast to cerebellar granule cells, there was no apparent loss of AMPA receptor function in the hippocampal CA1 region (Hashimoto et al., 1999a) suggesting regional speci¢city to the defects that arose as the consequence of the Q2 mutation. In the cerebral cortex, stargazer layer V cortical pyramidal neurons evidenced increased excitability and inward recti¢cation (Di Pasquale et al., 1997) which were not associated with any altered morphology (Qiao et al., 1996). The question thus arose as to how the

Calcium entry into neurons functions as an essential second messenger coupling neuronal excitation to intracellular signaling events. The exquisite regulation of calcium entry is mediated via voltage-dependent calcium channels (VDCC) whose distribution, expression, and assembly are dynamically regulated in a cell-speci¢c (McEnery et al., 1997; Catterall et al., 1993; Hell et al., 1993; Sakurai et al., 1996; Westenbroek et al., 1992; Yokoyama et al., 1995) and developmental manner (McEnery et al., 1998a,b; Vance et al., 1998; Jones et al., 1997). VDCC comprise a diverse family of hetero-multimeric complexes assembled from K1 pore-forming protein and auxiliary K2/N and L subunits. The importance of VDCC expression to normal neuronal processes was underscored by genetic strains of mice that harbor speci¢c mutations in VDCC subunits: tottering, K1A (Fletcher et al., 1996); leaner, K1A (Fletcher et al., 1996); ducky, K2/N2 (Barclay and Rees, 1999); lethargic, L4 (Burgess et al., 1997); and stargazer, Q2 (Letts et al., 1998). All of these animals evidenced ataxia and absence seizures with characteristic spike-wave discharges (Fletcher et al., 1998). Importantly, with the exception of leaner (Herrup and Wilczynski, 1982), there was no neurodegeneration observed. The use of these animal models of inherited neurological diseases is anticipated to further our understanding of the mechanisms that control the dynamic regulation of expression of VDCC genes as well as illuminate the role of VDCC genes in both normal and abnormal neuronal functioning. Stargazer mice exhibit ataxia at 14 days postnatal (P14) with the onset of seizure activity at P17^18 (Noebels et al., 1990). The seizure activity in stargazer was more frequent and prolonged than those in tottering, leaner, ducky or lethargic, corresponding to 21% of the sampling period in stargazer (Noebels et al., 1990), suggesting drastic consequences that arise from the genetic defect. The genetic analysis of the mutation underlying the stargazer phenotype (Letts et al., 1998) identi¢ed a novel gene that encoded a 323 amino acid protein (originally termed stargazin) with a predicted molecular mass of 36 kDa (Table 1). Limited homology of stargazin to the skeletal muscle VDCC Q1 subunit (Jay et al., 1990) suggested that stargazin represented a new neuronal VDCC subunit gene (hence termed Q2). The mutation

Table 1. Experimental determination of molecular mass of Q protein isoforms (kDa) Isoform

Predicted mol. wt.

HEK293 cells+tuna (3urea)

HEK293 cells3tuna (3urea)

Mouse brain (3urea)

Mouse brain (+urea)

Q2 Q3 Q4

36.0 35.5 36.5

26 24 26

33^38 32^35 39^51

34 29 53

44 34 62

NSC 5065 10-8-01

Cyaan Magenta Geel Zwart

Regional distribution and biochemical properties of VDCC Q subunit isoforms

mutation in the Q2 gene rendered the CA3/mossy ¢bers, cerebellar granule cells and layer V of the cortex (Di Pasquale et al., 1997) in stargazer mouse susceptible to these seemingly disparate pathologies. E¡orts to understand the role of Q2 as a putative VDCC auxiliary subunit focused upon heterologous co-expression of Q2 with K1A, K2/N and L1a subunits (Letts et al., 1998). Q2 had a modest e¡ect upon the inactivation properties of the recombinant P/Q-type VDCC (Letts et al., 1998) but with a trend that paralleled the co-expression of Q1 with subunits that comprise the skeletal muscle dihydropyridine (DHP)-sensitive VDCC (Dascal et al., 1986; Singer et al., 1991). The scope of the involvement of Q to normal cellular processes was extended by the recent identi¢cation of additional Q isoforms: human Q2 (AF096322) (Letts et al., 1998; Black and Lennon, 1999), human Q3 (AF100346) (Black and Lennon, 1999) and mouse Q3, Q4, and Q5 (AF162692) (Klugbauer et al., 2000). Recently, a very extensive analysis of the impact of co-expression of these mouse Q isoforms (Q2, Q3, Q4 and Q5) on VDCC properties was reported by Klugbauer et al. (2000). These authors reported that Q2, Q3 and Q4 in£uenced the electrophysiological properties of high voltage-activated (HVA) VDCC K1A and K1C with the e¡ects of the Q5 restricted to the heterologously expressed K1G subunit of the low voltage-activated (LVA) VDCC family. The identi¢cation of the AMPA receptor defect in waggler (Chen et al., 1999) prompted recent e¡orts to understand the role of Q2 as a putative modulator of AMPA receptor function (Chen et al., 2000). These recent studies focused on the ability of exogenously expressed Q2 to rescue the loss of AMPA receptor-mediated currents in stargazer cerebellar granule cells (Chen et al., 2000). The results of this study identi¢ed putative roles of Q2 in both targeting AMPA receptors to the membrane as well as clustering them via postsynaptic density 95 (PSD-95) to synapses. Association of the native Q2 with AMPA receptor subunits was, however, not shown (Chen et al., 2000). While insights into the specialization of Q isoforms have emerged from heterologous expression studies, very little has been revealed of either the distribution or biochemical properties of Q proteins. Analysis of the coding region for Q2 revealed moderate homology (25%) to the Q subunit (Q1) of skeletal muscle DHP-sensitive L-type VDCC (Jay et al., 1990). The deduced primary sequence suggested that Q2 is a glycosylated, transmembrane-spanning protein, thus extending the homology between Q2 and skeletal muscle Q1 subunit. Fortunately, more information is now available on the role of endogenous Q1 from Q1 knock-out studies (Freise et al., 2000). The Q1 knock-out mouse was phenotypically normal. However, in this genetic model of Q1 dysfunction, Q1 modulated L-type VDCC properties in a manner that had not been previously revealed in heterologous expression studies. Speci¢cally, the loss of Q1 from the skeletal muscle L-type VDCC led to increased calcium £ux as a consequence of increased probability of opening

NSC 5065 10-8-01

601

with decreased steady-state inactivation rates (Freise et al., 2000). The electrophoretic behavior of Q2 was originally reported by Letts et al. (1998). However, the more recently described Q isoforms were not studied as individual proteins. Furthermore, while localization of the mRNA for Q2, Q3, Q4 and Q5 was reported (Klugbauer et al., 2000; Letts et al., 1998), the reports did not address the question as to whether the Q isoforms were localized to cell bodies, neuronal processes, or other neural structures. Our study investigates the pattern of expression and properties of Q endogenous isoforms to de¢ne biochemical and neuroanatomical features that discriminate among Q2, Q3 and Q4 in control and stargazer mice. Furthermore, using antibodies raised to Q subunit isoforms we herein localize endogenous Q to dendritic structures by immunoelectron microscopy and explore the association of Q isoforms with the N-type VDCC and 106-kDa subunit of glutamate receptor (GluR1). We herein o¡er novel biochemical evidence for the role of Q as a component common to VDCC and AMPA receptor complexes.

EXPERIMENTAL PROCEDURES

Materials and methods Stargazer (B6C3Fe-a/a-Cacng2stg) and control (strain B6EiC3H) were obtained from Jackson Labs (Bar Harbor, ME, USA). Transfectene reagent was obtained from Qiagen (Santa Clarita, CA, USA). All reagents were obtained from sources previously cited (Vance et al., 1998). Adult mice were killed in accordance with accepted university guidelines. All e¡orts were made to minimize both the su¡ering and the number of animals used. The brains were removed and immediately placed in 50 mM HEPES pH 7.4, 1 mM EGTA plus protease inhibitor cocktail (Vance et al., 1998). The tissues were homogenized with a polytron for 10 s and centrifuged at 18 000 rpm (48 000Ug) for 15 min. The membranes were resuspended in 50 mM HEPES pH 7.4 plus protease inhibitors at a resulting protein concentration of 20 mg/ml. For western blot analysis, all homogenates were stored in 320³C at concentrations of 2 mg/ ml in sample bu¡er: 5Usample bu¡er: 325 mM Tris pH 7.0, glycerol (25% v/v), mercaptoethanol (25% v/v), sodium dodecyl sulfate (SDS; 10%), in 100 Wl aliquots. The samples were not freeze-thawed. General methods have been described in detail (Vance et al., 1998). Characterization and puri¢cation of anti-peptide antibodies to VDCC subunits Antibodies were developed to the Q2, Q3 and Q4 subunits. The peptide used to generate anti-Q2-speci¢c antibodies (termed CW57) was CIQKDSKDSLHANTANRRTTPV; the peptide used to generate anti-Q2+Q3 antibodies (termed CW60) was NETSKKNEEVMTHSGLWRTC, and the peptide used to generate anti-Q2+Q3+Q4 antibodies (termed CW59) was CGGANRRTTPV (see Results). The N- or C-terminal cysteine in all cases functioned as the site for both the attachment of maleimide-activated keyhole limpet hemocyanin (KLH) and the attachment site for covalently coupling the peptides to the column support. The procedures for the preparation of the a¤nity resin and the puri¢cation of the anti-peptide antibodies from antisera have been described previously (Vance et al., 1998). The antibody to the L1b isoform (CW28) has been previously described (McEnery et al., 1997). The monoclonal antibody used

Cyaan Magenta Geel Zwart

602

A. H. Sharp et al.

in the detection of K1B (CC18) was a generous gift from Vanda Lennon (Mayo Clinic, Rochester, MN, USA) and has been used previously in our studies of immunoprecipitated K1B (Vance et al., 1999), and the polyclonal antibody to K1B (CW21) has been reported previously (Vance et al., 1999, 1998). The anti-GluR1 antibody was a kind gift of Richard Huganir (HHMI, Johns Hopkins University School of Medicine).

pcDNA3.1 (Invitrogen). Plasmid minipreps from several colonies were prepared and were sequenced to con¢rm the nucleotide sequence of Q4. Ultimately, Q2 and Q3 were also subcloned into pcDNA3.1 so that stably transfected mammalian systems could be used.

Computerized analysis of GenBank and MEDLINE databases

The amino acid homology for the Q1, Q2, Q3 and Q4 subunits was compared using the Wisconsin Package Version 9.1, Genetics Computer Group (GCG) program Pileup. Percentage identity was determined using the blastn comparison tool (Altschul et al., 1997).

We used the National Center for Biotechnology Information (NCBI) BLAST (Altschul et al., 1997) search program to look for human homologues for the recently published mouse Q2 sequence. Once the Q2 and Q3 sequences were con¢rmed as described below, we then returned to NCBI resources and used blastn and tblastn programs to search for additional homology matches. Polymerase chain reaction (PCR) ampli¢cation of the putative human Q2 and Q3 subunits We used data from the two partially sequenced regions of chromosome 22 (GenBank accession numbers Z83733 and AL022313), noted by Black and Lennon (1999) and Letts et al. (1998) to design primers for the 5P and 3P ends of the human Q2 homologue (g4+ATATATAGAATTCATGGGGCTGTTTGATCGAGGTGTTCAAATG, g43ATATATAGATATCTTATACGGGGGTGGTCCGGCGGTTGGCTGT, respectively). The forward and reverse primers contain EcoRI and EcoRV restriction enzyme recognition sites, respectively. We used these primers to PCR amplify sequences in a cDNA library prepared from adult human cerebellum (CLONTECH, Palo Alto, CA, USA). We puri¢ed the product using silica beads (GENECLEAN0, BIO 101, Vista, CA, USA), cut it using EcoRI and EcoRV restriction enzymes and, using a T4 ligase reaction, ligated it into the plasmid pcDNA 1.1 (Invitrogen Corp., Carlsbad, CA, USA) which had been previously cut with the same restriction enzymes and digested with alkaline phosphatase. Competent MC1061/P3 Escherichia coli bacteria were transformed and plated on Luria broth containing tetracycline, 10 Wg/ml, and carbenicillin, 50 Wg/ml. Colonies were streaked and plasmid minipreps were made (Qiagen). The Q3 product was obtained by PCR ampli¢cation of the human cerebellum cDNA library using primers designed for the 5P and 3P ends of the putative human Q3 subunit (g1+ATGAGGATGTGTGACAGAGGTATCCAGATGT, g13TCAGACGGGCGTGGTGCGCCTGTTGGCCGG, respectively) which was found in AC004125. This product was subcloned using a TA vector kit (Invitrogen). Competent TOP 10F|¨ E. coli bacteria (Invitrogen) were transformed and plated on Luria broth containing carbenicillin, 50 Wg/ml. Again, colonies were streaked and plasmid minipreps were made (Qiagen). Sequencing of the subcloned putative human Q2 and Q3 cDNAs was accomplished using a dye terminator reaction and an automated sequencer (PE Applied Biosystems, Foster City, CA, USA). Additional database searching with the Q2 and Q3 sequences yielded hits in AC005544 which were promising for another Q sequence but this sequence did not encode exon 1. Thus, a 5P RACE reaction was done using a proprietary human cerebellum cDNA library with adapter-ligated ends (CLONTECH) and a kit primer AP1 (CCATCCTAATACGACTCACTATAGGGC) with the primer G273 (ACGCCCACGGTCTCAGCCACA). This reaction yielded a smeared product of V700 bp on electrophoresis which was puri¢ed using silica beads (GENECLEAN0). Sequencing with the nested primers AP2 (ACTCACTATAGGGCTCGAGCGGC) and G283 (TTGTCTTCGTCCCGCTTGTCA) yielded the sequence for exon 1. Subsequently, primers G31+ (ATATATGATATCCCACCATGGTGCGATGCGACCGC) and G313 (TATATATGCGGCCGCTCACACAGGGGTCGTCCG), which contain EcoRV and NotI restriction enzyme sites, respectively, were used to produce products which were cut with the appropriate restriction enzymes so that the insert could be subcloned into

NSC 5065 10-8-01

Analysis of amino acid homology

Heterologous expression of Q2, Q3 and Q4 in HEK293 cells HEK cells were grown in Dulbecco's modi¢ed Eagle's medium (DMEM) plus 10% fetal calf serum and 1% penicillin/ streptomycin at 37³C. The cells were transfected at a plating density of approximately 50^60% con£uence. When transfecting 100 mm plates, Transfectene (Qiagen) was used according to described protocols in Qiagen manuals (60 Wl of Transfectene reagent was mixed with 2 Wg cDNA). Similarly, for the transfection of 35-mm plates, 0.4 Wg of DNA required the use of 10 Wl of Transfectene reagent. Tunicamycin, when present, was at a concentration of 10 Wg/ml and was added at the time of transfection. Exposure to Transfectene was for 24 h at 37³C after which time the media were removed and the cells were scraped into a 1.5-ml microfuge tube and placed on ice. The cells were centrifuged at 1000 rpm for 1 min in a microfuge. The cell pellet was resuspended and homogenized in approximately 600^800 ul of 50 mM HEPES pH 7.4+1 mM EDTA bu¡er with standard cocktail of protease inhibitors. The samples were then adjusted for equal protein/lane (150 Wg/lane for large gels; 30 Wg/lane for small gels) and loaded on a 12% SDS^polyacrylamide gel. Immunohistochemical localization in adult mouse brains Adult mice were deeply anesthetized with sodium pentobarbital and perfused transcardially with a small volume of phosphate-bu¡ered saline (PBS) (20 mM NaCl, 0.9% NaCl) followed by freshly prepared 4% paraformaldehyde in 0.1 M sodium phosphate (pH 7.3) for 5 min. Brains were removed and post¢xed for 2 h with the same ¢xative at 4³C. Tissue was cryoprotected by overnight incubation in 20% glycerol in PBS at 4³C. Brains were frozen with powdered dry ice and sectioned with a sliding microtome (30 micron thickness). Sections were used fresh or stored at 320³C in antifreeze solution described previously (Sharp et al., 1993). Brain sections were ¢rst rinsed in PBS and then treated by heating to 95³C in 10 mM sodium citrate bu¡er (pH 6.0). The use of heat treatment for the purpose of antigen recovery is routinely used in aldehyde-¢xed tissues (Jiao et al., 1999; Hansson et al., 1999; Pileri et al., 1997; Xiao et al., 1996; Janckila et al., 1996; Morgan et al., 1994; Kawai et al., 1994; Tenaud et al., 1994; Norton et al., 1994; Suurmeijer and Boon, 1993; Korin et al., 2000). This treatment also eliminated slow-developing background staining in Bergmann glia that was observed in the absence of primary antibody. All sections for use in a single experiment were treated together at the same time. Sections were washed in Tris-bu¡ered saline (TBS): 0.05 M Tris, pH 7.4, 0.9% NaCl, permeabilized with 0.3% Triton X-100 in TBS for 20 min and blocked by incubation for 30 min in 5% normal goat serum (NGS) in TBS. Sections were then incubated with primary antibodies in TBS with 1% NGS overnight at 4³C with gentle agitation. Control sections were incubated in the absence of primary antibody. Sections intended for direct comparison were processed identically side by side. Sections were stained using the Vectastain Elite avidin^biotin^peroxidase complex (ABC) reagents (Vector Laboratories, Burlingame, CA, USA) essentially as described previously (Nucifora et al., 1996; Sharp et al., 1999). Immunoreactivity was visualized using 3,3P-diaminobenzidine (DAB) as the chromogen. Sections were

Cyaan Magenta Geel Zwart

Regional distribution and biochemical properties of VDCC Q subunit isoforms

washed twice in TBS bu¡er and mounted onto Superfrost Plus glass microscope slides (Fisher Scienti¢c, Pittsburgh, PA, USA). Slide-mounted sections were washed in water, dehydrated in graded alcohols, cleared with Hemo-De (Fisher) and coverslipped with DPX mounting medium (Electron Microscopy Sciences, Fort Washington, PA, USA). Low magni¢cation images were collected via a Leica dissecting microscope using a Diagnostic Instruments Spot digital camera with Twain and Adobe Photoshop software. Higher magni¢cation images were collected via a Leitz DMRB light microscope using the same digital camera and software. Digital images of control and stargazer brains were collected in parallel and optimized in parallel for brightness and contrast using the Image-Adjust-Levels feature of Photoshop.

603

to incubate on ice for 1 h. After this time, 50 Wl of protein A-Sepharose 4B suspension (1 ml packed beads per 3.33 ml suspension) was added to each sample and left to rotate in the cold room overnight. The pellets were washed 3 times with 1 ml of 50 mM HEPES/EGTA. Addition of 10 Wl of 5Usample bu¡er was added to the protein A beads and the samples were resolved by SDS^polyacrylamide gel electrophoresis (PAGE) on a 4^17% gradient gel, transferred to nitrocellulose, and probed with a rat monoclonal anti-K1B subunit antibody (CC18) which we had previously used in other immunoprecipitation studies (Vance et al., 1999) or an antibody to the GluR1 subunit.

RESULTS

Electron microscopy Methods were similar to those described previously (Sharp et al., 1999, 1995). A deeply anesthetized mouse was perfused brie£y with 2% paraformaldehyde in 0.1 M sodium cacodylate bu¡er, pH 7.4 plus 0.2 mM CaCl2 , 0.2 mM MgCl2 , to clear blood, followed by 4% paraformaldehyde in 0.1 M sodium cacodylate bu¡er (pH 7.4), 1 mM MgCl2 and 1 mM CaCl2 for 10 min. The brain was removed and post¢xed for 2^4 h in the same ¢xative. Another mouse was perfused as above except that 0.05% glutaraldehyde was added to the 4% paraformaldehyde perfusion ¢xative solution (but not the post¢x solution). Addition of glutaraldehyde was found to slightly improve ultrastructural morphology and did not a¡ect the pattern of staining by CW59 other than slightly decreased staining intensity. Brains were sectioned with a vibratome at a thickness of 50 micron into cold HEPES-bu¡ered saline (20 mM HEPES, 0.9% NaCl, 1 mM CaCl2 and 0.5 mM MgCl2 , pH 7.4). Fresh vibratome sections were stained by the method used for light-level immunohistochemistry (above) with modi¢cations as follows. Permeabilization with Triton X-100 and heat treatment was omitted and sections were blocked by incubation in 100 mM glycine (pH 7.6 with Tris) for 40 min followed by 5% NGS in TBS for 40 min. Sections were incubated in primary antibody for 48 h. Immunoreactivity was visualized using DAB as the chromogen in the presence of 0.2% NiCl2 . Immunostained and control sections (no primary antibody) were washed once in TBS then ¢ve times for 5 min each in 100 mM sodium cacodylate (pH 7.4). Sections were osmicated by incubation in 1% OsO4 in 100 mM sodium cacodylate, pH 7.4 for 50 min on ice and then washed ¢ve times for 10 min each in 100 mM maleate bu¡er (pH 5.2), stained en block in 1% uranyl acetate for 1 h at room temperature and washed three times in water. Sections were then dehydrated in increasing concentrations of ethanol, in¢ltrated with Epon/Araldite and £at-embedded between sheets of Aclar (Ted Pella, Redding, CA, USA). Relevant brain regions were identi¢ed under a microscope, dissected out and glued to resin blocks for sectioning at 80 nm. Sections were collected onto Formvarcoated grids and viewed and photographed using a Zeiss EM 910 electron microscope at the Wadsworth Center Resource for the Visualization of Biological Complexity (Albany, NY, USA). Photographic negatives were digitized at high resolution and imported into Adobe Photoshop where exposures were adjusted using the Image-Adjust-Levels feature to optimize brightness and contrast. Immunoprecipitation of VDCC subunits from mouse brain homogenates Forebrains from adult mice were removed and placed immediately in 50 mM HEPES, pH 7.4 and 1 mM EGTA plus protease inhibitors and homogenized with a polytron and solubilized directly from washed membranes using 0.75% 3-[(3-cholamido-propyl)-dimethyl-ammonio]-1-propanesulfonate (CHAPS) at 0.75 mg/ml protein concentration, using a method previously described (McEnery et al., 1991). Following centrifugation, the solubilized preparation (200 Wl) was added to individual microfuge tubes plus 100 Wl of a¤nity-puri¢ed antibody to Q2, Q3 and Q4 (CW59), L1b (CW28), and K1B (CW21) and left

NSC 5065 10-8-01

The recent cloning of the human homologue to mouse Q2 subunit (Letts et al., 1998), the human Q2 and Q3 (Letts et al., 1998; Black and Lennon, 1999) and the mouse Q2, Q3, Q4 and Q5 illustrates the potential for structural diversity within the Q family. In this report, we present a new Q isoform, human Q4 that was cloned from a human cerebellar cDNA library. The alignment of the human Q isoforms (Q1, Q2, Q3 and Q4) is presented in Fig. 1. The percent amino acid identity between the various human isoforms was as follows: Q1 vs. Q2 = 25%; Q1 vs. Q3 = 24%; Q1 vs. Q4 = 23%; Q2 vs. Q3 = 74%; Q2 vs. Q4 = 59% and Q3 vs. Q4 = 57%. However, within the transmembrane-spanning domains, the extent of homology was higher. The percent identity among Q2, Q3 and Q4 was greater than between the skeletal muscle Q1 and the family of neuronal Q homologues. We strategically chose, using this sequence alignment, a panel of peptide epitopes to be used in the production of rabbit anti-peptide antibodies that would have specificity for Q2, Q2+Q3, and Q2+Q3+Q4. In each case, we targeted an epitope that would be anticipated to be present in the Q2 protein based upon the cDNA sequence so that Q2 could serve as a positive control for all antibodies that were generated. In addition, the cross-reactivity of these site-directed antibodies for multiple isoforms allows the level of expression of the individual Q isoforms to be directly compared to each other. This approach parallels our success in using a pan-generic anti-L subunit antibody (CW24) in the evaluation of various L subunit isoforms (Vance et al., 1998). CW57, the parent serum for antibodies termed CW57 and CW57S, was targeted towards a long C-terminal epitope (CIQKDSKDSLHANTANRRTTPV) that contained sequences present in Q2, Q3 and Q4. This peptide, which was very similar to the epitope used to generate anti-Q2-speci¢c antibodies in the study by Letts et al. (1998), gave rise, in our hands, to a¤nity-puri¢ed antibodies that reacted with all Q isoforms heterologously expressed in HEK293 cells rather than speci¢c to the Q2 (data not shown). To obviate this problem, we a¤nity puri¢ed Q2-speci¢c antibodies by incubating CW57 with a column containing a truncated version of the antigenic peptide (CIQKDSKDSLHANT) which corresponded to a sequence found only in Q2. The antibodies selective for the truncated peptide were termed CW57S. CW60 was generated against the region around the glycosylation site found in Q2 and Q3 (NETSKKNEEVMTHSGL-

Cyaan Magenta Geel Zwart

604

A. H. Sharp et al.

Fig. 1. Sequence homology of human Q isoforms. Comparison and consensus of the amino acid sequences deduced for the mouse (Wissenbach et al., 1998) and human skeletal muscle Q1 subunit (Powers et al., 1993; Iles et al., 1993) and putative Q2, Q3, and Q4 subunits (Black and Lennon, 1999; Klugbauer et al., 2000) of voltage-gated calcium channels [Wisconsin Package Version 9.1, Genetics Computer Group (GCG) Pileup]. Amino acids shown on the consensus line are present in at least three Q subunits. Shaded boxes represent consensus amino acids in all four Q subunits. All four genes are predicted to be membrane proteins with four membrane-spanning regions. There is a predicted glycosylation site in all four genes located on the extracellular portion between predicted transmembrane helices 1 and 2. The C-termini of all Q isoforms are highly divergent, but the terminal seven amino acids are conserved. The amino acids colored in green identify the epitope for CW60 (anti-Q2 and Q3), the amino acids colored in red identify the epitope for CW57S (anti-Q2) and the amino acids underlined at the C-terminus identify the epitope for CW59 (anti-Q2, Q3 and Q4).

WRTC). This epitope is not present in Q4. CW59 was generated against the last few amino acids at the C-terminus that would allow for the detection of Q2, Q3 and Q4 gene products (CGGANRRTTPV). The exogenous CGG was included for a cysteine for covalent coupling of the peptide to KLH and the a¤nity column matrix and the GG was included to increase the length of the peptide and thus rendered the peptide more immunogenic. We investigated the electrophoretic mobility of the three human Q isoforms heterologously expressed in

NSC 5065 10-8-01

HEK293 cells in the absence and presence of the N-glycosylation inhibitor, tunicamycin (Struck and Lennarz, 1977) using our panel of anti-Q antibodies anticipated to be speci¢c for Q2 (CW57S), cross-reactive towards Q2 and Q3 (CW60), or cross-reactive towards Q2, Q3 and Q4 (CW59). While the apparent molecular weight of Q2 expressed in the original characterization of the protein was suggested to change upon glycosylation of Q2 (amino acid 48), it was not demonstrated (Letts et al., 1998). In addition, the epitope used to raise antibody CW60 contained the putative N-glycosylation site (NETSK-

Cyaan Magenta Geel Zwart

Regional distribution and biochemical properties of VDCC Q subunit isoforms

605

Fig. 2. Antibodies to selective Q2 epitopes react preferentially with heterologously expressed Q2, Q3, and Q4. HEK293 cells were transfected as described (see Experimental procedures) with the individual Q isoform cDNAs. The cells were harvested into 50 mM HEPES and 1 mM EGTA pH 7.4 bu¡er plus protease inhibitors, and homogenized. The samples were resolved (150 Wg protein/lane) on a 12% polyacrylamide gel according to the Laemmli procedure, transferred to nitrocellulose, and blocked in 5% dried milk in TBS overnight in the cold room. The individual panels representing all Q isoforms (Q2, Q3, Q4) and experimental conditions (either the presence (+) or absence (3) of tunicamycin, TUN) were incubated with the designated a¤nity-puri¢ed anti-peptide antibodies and visualized by enhanced chemiluminescence. (A) CW57A (Q2-speci¢c antibody); (B) CW60 (Q2+Q3-speci¢c antibody) ; (C) CW59 (Q2+Q3+Q4-speci¢c antibody).

KNEEVMTHSGLWRTC). Therefore, it was of additional importance to determine if this site in Q3 (amino acid 48) was obscured from the CW60 antibody upon modi¢cation. The Q isoforms (Q2, Q3 and Q4) were expressed individually in HEK293 cells and analyzed in parallel by western blotting. As shown in Fig. 2A, when all three Q isoforms (Q2, Q3, and Q4) expressed in the absence or presence of tunicamycin were probed with CW57S, only the Q2 protein was detected (Fig. 2A). Western blot analysis of Q2 in the absence of tunicamycin (3) using CW57S detected a protein that migrates as a broad band between 33 and 38 kDa (Fig. 2A), consistent with N-linked glycosylation that was predicted from PROSITE analysis. The size of Q2 expressed in the presence of tunicamycin was approximately 26 kDa (lane 1). This rapid migration in the absence of carbohydrate residues was also observed for the skeletal muscle Q1 protein (Jay et al., 1990) as well as the Q3 and Q4 subunits (as shown in Fig. 2). No Q isoforms were detected in mock-

transfected HEK293 cells (Fig. 2, lane C in all panels). As shown in Fig. 2B, when all three Q isoforms (Q2, Q3 and Q4) were probed with CW60, only heterologously expressed Q2 and Q3 were detected (Fig. 2B), consistent with inclusion of this epitope (NETSKKNEEVMTHSGLWRTC) in those proteins and its exclusion from Q4 (Fig. 1). The apparent size of the Q3 protein expressed in the presence of tunicamycin migrated between 32 and 35 kDa. The di¡erential mobility of Q2 and Q3 persisted when cDNAs for Q2 and Q3 were cotransfected in HEK293 cells (data not shown). The approximate size of Q3 expressed in the presence of tunicamycin was approximately 24 kDa (Fig. 2B) smaller than its predicted primary sequence of 36 kDa. Q4 expressed in HEK293 cells was detected by CW59, which, as anticipated, also detected heterologously expressed Q2 and Q3 (Fig. 2C). The expression of Q4 in the presence of tunicamycin (26 kDa) clearly in£uenced the migration of Q4 (Table 1) compared to its predicted size (36.5 kDa). In the absence of tunicamycin, the Q4

Fig. 3. Western blot analysis of mouse tissues with anti-Q2 antibody (CW57S) indicates neural speci¢city of Q2 expression. Mouse tissues were removed and immediately placed in 50 mM HEPES/1 mM EGTA pH 7.4 plus protease inhibitors at a weight/volume ratio of 6 g/25 ml). The samples were homogenized with a polytron and the protein determined by a BCA method. The samples were resolved (30 Wg/lane for cerebellum, 150 Wg protein/lane for other samples) on a 12% polyacrylamide gel according to the Laemmli procedure, transferred to nitrocellulose, and blocked in 5% dried milk in TBS overnight in the cold room. The blot was incubated with CW57S and visualized by enhanced chemiluminescence. Brain regions are as indicated : cerebellum, Cb; forebrain, Fb; thymus, Thy; heart, Hrt; lung, Lg; skeletal muscle, Skm; liver, Lv; kidney, Kid ; testis, Ts.

NSC 5065 10-8-01

Cyaan Magenta Geel Zwart

606

A. H. Sharp et al.

Fig. 4. Q isoforms are di¡erentially localized in control mouse brain. Mice were killed, decapitated, and dissected into speci¢c regions. Filters containing representative samples (150 Wg/lane) resolved on a gradient polyacrylamide gel (4^17%) were probed with anti-Q antibodies : CW57S (A), CW60 (B) and CW59 (C). Brain regions are as indicated: midbrain, Mid ; striatum, Str; cerebral cortex, Ctx; hippocampus, Hip; thalamus, Thl; pons, PNS ; brainstem, Bs; cerebellum, Cb.

migrated as a broad band between 39 and 51 kDa that was larger than both Q2 and Q3 (Fig. 2C). This observation suggested a site for N-linked glycosylation of Q4, perhaps at one or both of the N in the sequence NGTNLT at aa 42^45. These results taken together and summarized in Table 1 veri¢ed that the cDNA clones for the human Q isoforms can be adequately expressed in HEK293 cells. In addition, the use of the heterologously expressed Q isoforms veri¢ed the selectivity and speci¢city of our anti-Q antibodies and makes possible our interpretation of western blot and immunohistochemical analyses of Q isoforms expressed in native tissues. We turned our attention to the endogenous expression of the Q isoforms in control mouse tissues. To determine the distribution of Q2 in control mice, CW57S was used in western blot analysis of neuronal and peripheral tissues. As shown in Fig. 3, Q2 was expressed in control mouse forebrain and cerebellum, but not detected in thymus, heart, lung, skeletal muscle, liver, or kidney. These results suggested that CW57S did not cross-react with either the skeletal muscle Q1 subunit or a comparable protein in either cardiac tissue or testis (Fig. 3). These results con¢rmed the previous northern blot ¢ndings (Letts et al., 1998; Klugbauer et al., 2000) that determined the neural speci¢city of Q2 expression. In addition, neither CW60 nor CW59 cross-reacted with any protein expressed in skeletal muscle, heart or testis (data not shown), and con¢rmed that Q3 and Q4 were not expressed in non-neuronal tissues (Klugbauer et al., 2000).

NSC 5065 10-8-01

The structural diversity in Q isoforms suggested a functional specialization that may be re£ected in their pattern of localization. To evaluate the regional distribution of the Q isoforms in control and stargazer mice, we conducted western blot analyses using CW57S, CW60, and CW59 (Fig. 4 and Table 1). Based upon the intensity of enhanced chemiluminescence staining determined from exposures of various times within the linear range of the ¢lm and the analyses of numerous blots, we could evaluate the relative abundance of speci¢c immunoreactive bands among isolated brain regions. The level of detection of Q2 protein among the various brain regions was highest in cerebellum and cortex, moderate in midbrain, thalamus, hippocampus, and striatum, and lowest in pons and brain stem (Fig. 4A). In contrast, Q3, which corresponds to the lower band in the broad signal detected by CW60, was detected in highest levels in cortex, moderate in midbrain and striatum, lowest in thalamus and hippocampus and not detected in cerebellum, pons, or brain stem (Fig. 4B). The relative distribution of Q4 was also evaluated (Fig. 4C). Q4 was highest in cortex, midbrain, hippocampus, and striatum and lowest in thalamus, pons, brainstem and cerebellum. It is noteworthy that individual component signals obtained by CW57S and CW60 were reiterated by CW59. Critical to our understanding of the molecular defect of the stargazer mouse was to determine the impact of the stargazer mutation on the level of expression of native Q2 protein. We therefore used our antibodies towards the Q isoforms to investigate the pattern of nor-

Cyaan Magenta Geel Zwart

Regional distribution and biochemical properties of VDCC Q subunit isoforms

607

Fig. 5. Western blot analyses of Q isoform expression in control and stargazer mice reveals loss of Q2 protein in stargazer. Western blot analysis of control (ctl) and stargazer (stg) cerebellar (Cb) homogenates and control and stargazer forebrain (Fb) homogenates were resolved on 12% SDS^polyacrylamide gels, transferred to nitrocellulose and probed with our panel of anti-Q antibodies. (A) CW57S (anti-Q2 antibody); (B) CW60 (anti-Q2+Q3 antibody); (C) CW59 (anti-Q2+Q3+Q4 antibody).

mal expression of Q2 compared with that of the stargazer mouse. In contrast to the results obtained using CW57S that demonstrated Q2 expression in the forebrain and cerebellum of control mice (Fig. 5A), both forebrain and cerebellar homogenates obtained from the stargazer mouse were devoid of Q2 (Fig. 5A). Importantly, using CW60 (Fig. 5B) and CW59 (Fig. 5C), we veri¢ed the loss of Q2 and, in addition, reveal the expression of Q3 (V28.6 kDa) that was detected by both of these antibodies in control and stargazer forebrain, but not cerebellum. CW60 was raised to an epitope present in exon 1 of Q2. No Q2 fragment corresponding to exons 1 and 2 (V11 kDa) was detected in western blots of stargazer brain. These results suggested that Q3 persists in stargazer forebrain in the absence of Q2. However, these ¢ndings do not eliminate the possibility that an unidenti¢ed Q isoform that cross-reacts with CW59 may also be present. The expression of Q4 was detected in forebrain of both control and stargazer, and was expressed in much lower abundance in cerebellar samples (Fig. 5C). These data suggested that, as a consequence of the loss of Q2 in stargazer, the total Q isoform content was profoundly reduced. However, there was persistent expression of Q3 and Q4 isoforms in stargazer forebrain. We sought to address whether the loss of Q2 in stargazer led to possible compensatory expression of non-mutated Q isoforms. The resolution of endogenous Q isoforms was explored further using a variation of an

NSC 5065 10-8-01

electrophoretic system that included 8 M urea in the 12% polyacrylamide gel (Swank and Munkres, 1971). The presence of urea during SDS^PAGE was used previously to resolve proteins that retained some secondary structure in the presence of 0.1% SDS (Kopecky et al., 1986; McEnery et al., 1984). When Q isoforms endogenous to control mice were analyzed in the presence of urea, Q2, Q3, and Q4 were clearly resolvable (Fig. 6). Furthermore, the patterns of expression of the Q isoforms which remain in stargazer were more clearly identi¢ed. A side-by-side analysis of CW60 reactivity in Fig. 6B suggested that the level of expression of Q3 (34 kDa) was unchanged in stargazer. Similarly, the level of expression of Q4 detected by CW59 (Fig. 6C) suggested that the level of expression of Q4 (62 kDa) was also unchanged. Taken together, analysis of Figs. 4, 5C and 6C suggested regional specificity in the expression of Q isoforms. This detailed western blot analysis using CW59 aided our analyses of the immunohistochemical distribution of Q isoforms in control and mutant mice. Using CW59, we revealed di¡erences in the regional and cellular distribution of Q2, Q3, and Q4 isoforms (Fig. 7A). In addition to identifying general trends that may be attributed to the family of Q isoforms, this analysis permitted insight into the speci¢c pattern of the non-mutated Q isoforms which persisted in stargazer (Fig. 7B). As shown in Fig. 7A, the Q subunits were most highly expressed in hippocampus, cortex, and cerebellum, and moderately expressed in

Cyaan Magenta Geel Zwart

608

A. H. Sharp et al.

Fig. 6. Q2, Q3 and Q4 are fully resolvable by SDS^PAGE in the presence of urea. Western blot analysis of control (ctl) and stargazer (stg) cerebellar (Cb) homogenates and control and stargazer forebrain (Fb) homogenates were resolved on 12% SDS^polyacrylamide gels+8 M urea, transferred to nitrocellulose and probed with our panel of anti-Q antibodies. (A) CW57S (anti-Q2 antibody); (B) CW60 (anti-Q2+Q3 antibody); (C) CW59 (anti-Q2+Q3+Q4 antibody).

striatum, olfactory tubercle, and anterior amygdala. Lower level of expression was evident in thalamus and brainstem. Staining for Q isoforms was clearly enriched in dendritic ¢elds of the hippocampus, layer 1 of the cortex and the molecular layer of the cerebellum (Fig. 7A). The use of pan-Q antibody CW59 in western blot analysis revealed the absence of Q2 in stargazer forebrain and cerebellum compared to control brain while Q3 and Q4 levels were unchanged (Figs. 5 and 6). These results suggested that loss of CW59 immunoreactivity in immunohistochemical analyses would likely re£ect the loss of Q2. As shown, decreases in CW59 staining in immunohistochemical analysis of stargazer were evident in comparison to control mice (Fig. 7A, B). Consistent with the data presented in Figs. 5 and 6 where the loss of Q2 accounted for a substantial decrease in CW59 immunoreactivity in cerebellum by western blot analysis, CW59 immunostaining of stargazer cerebellum was also greatly decreased compared to control. Again, consistent with western blot analyses that suggested co-expression of Q2, Q3 and Q4 in control cortex, striatum and midbrain (Fig. 4), these experiments indicated a partial reduction in the immunostaining in these regions using CW59 in stargazer (Fig. 7B). Control hippocampus and thalamus, as shown in Fig. 4, expressed predominantly Q2 and Q4 isoforms. Interestingly, CW59 immunostaining of stargazer hippocampus evidenced sub¢eld-selective

NSC 5065 10-8-01

decreases. However, major changes in CW59 immunostaining of stargazer thalamus were not evident compared to control in our sagittal sections. The levels of expression of Q isoforms in pons and brainstem, which evidenced low Q2 and Q4 content, were not changed. Q2-Defective mice lacked the fast component of excitatory postsynaptic currents (EPSCs) at mossy ¢ber to cerebellar granule cell synapses in stargazer (Hashimoto et al., 1999b) and waggler (Chen et al., 1999), and had reduced synaptic transmission at parallel ¢ber Purkinje cell synapses in waggler (Chen et al., 1999). In hippocampus, altered NPY expression and increased innervation of mossy ¢bers in hippocampus was noted (Chafetz et al., 1995; Qiao and Noebels, 1993; Nahm and Noebels, 1998). However, synaptic transmission to CA1 pyramidal cells (Scha¡er collateral projection) in stargazer was not altered (Hashimoto et al., 1999b). Therefore, it was of great importance to characterize the perturbations in the expression of Q isoforms in these two regions in stargazer. As shown in Fig. 8A, Q isoforms were widely distributed in the dendritic ¢elds of control hippocampus, with distinctions evident between the CA1 and CA3. The molecular layer of the dentate gyrus was also labeled. In contrast, the cell body layers throughout the hippocampus did not evidence high levels of Q expression. The

Cyaan Magenta Geel Zwart

Regional distribution and biochemical properties of VDCC Q subunit isoforms

609

Fig. 7. Expression of Q isoforms is altered in stargazer mouse. Sections from control (A) and stargazer (B) mouse brains were incubated with CW59 and stained using an indirect immunoperoxidase method. The size bar = 0.5 mm. Control mouse (A). The family of Q isoforms (Q2, Q3 and Q4) is highly expressed in the mouse hippocampus, cortex (enriched in cortical layer V), the olfactory tubercle, and throughout the striatum. Stargazer mouse (B). The expression of Q isoforms (likely Q3 and Q4) persists in stargazer. Note the relative abundance of anti-Q isoform staining in dendritic ¢elds relative to hippocampal pyramidal and granule cell bodies. AA, anterior amygdaloid area; BS, brain stem; Cb, cerebellum ; Ctx, cerebral cortex; G, granule cell layer of the cerebellum ; H, hippocampus; M, molecular layer of the cerebellum ; OT, olfactory tubercle; Str, striatum ; T, thalamus.

stratum lucidum and the hilus were also positive for Q expression. The pattern of immunoreactivity with CW59 was altered in the hippocampus of stargazer (Fig. 8B). While the expression of Q in the subiculum and the CA1 was largely unchanged compared to control, the level of expression of Q throughout the CA3 and the dentate was greatly diminished. As control hippocampus had been shown earlier (Fig. 4) to express predominantly Q2 and Q4 isoforms, and as we did not observe compensatory changes in the expression of Q3 and Q4 isoforms by western blot analysis of stargazer mice (Fig. 6), we concluded that the loss of CW59 staining in stargazer hippocampus corresponded to the loss of Q2. The residual Q that remained detectable in the CA1 region may be attributed to Q3, which was shown to be expressed in CA1 pyramidal cell bodies by in situ hybridization (Chen et al., 2000), or Q4 (Fig. 8B). We similarly explored the expression of Q isoforms in cerebellum. As shown in Fig. 8C, Q isoforms were densely expressed in the molecular layer of the cerebellum, in

NSC 5065 10-8-01

compact structures that were adjacent to the Purkinje cell layer [basket cell termini (BCT)], and throughout the granule cell layer. The Purkinje cell layer was, by comparison, less densely stained. Purkinje cells were determined to be intact by immunostaining with antiIP3R (antibodies against inositol 1,4,5-trisphosphate receptor, type 1) and anti-calbindin antibodies (data not shown). The pattern of immunoreactivity with CW59 was altered in the cerebellum of stargazer (Fig. 8D). The expression of Q in BCT was unchanged compared to control, with axonal processes evident as a consequence of the overall reduction in immunostaining in the granule cell layer. The level of expression of Q throughout the molecular layer of the cerebellum was greatly diminished and the expression of Q in the granule cell layer was reduced (Figs. 8C and 7B). Control cerebellum was shown to be a region that expressed primarily Q2 (Fig. 4), with Q4 isoforms also present (Figs. 5 and 6). We concluded that the loss of CW59 staining in stargazer cerebellum corresponded to the loss of Q2. How-

Cyaan Magenta Geel Zwart

610

A. H. Sharp et al.

Fig. 8. Expression of Q2 is much reduced in the CA3 region of stargazer hippocampus and absent from cerebellar cortex. Sections from control (A and C) and stargazer (B and D) mouse brains were incubated with CW59 and stained using an indirect immunoperoxidase method. (A) In the hippocampus of control mouse, staining is evident throughout the processes of the CA3, CA1 and dentate gyrus (DG) with lower levels of Q expression observed in the cell bodies. (B) In the hippocampus of stargazer mouse, CW59 staining is persistent in the CA1 region. However, the staining is greatly decreased in the CA3/mossy ¢ber region of stargazer. (C) In the cerebellum of control mouse, CW59 staining is present in the molecular layer (ML), the granule cell layer (GCL), and BCT. (D) In the cerebellum of stargazer mouse, CW59 is greatly reduced in the molecular layer and partially reduced in the granule cell layer. The staining of BCT beneath the Purkinje cell layer (PL) persisted. Scale bars = 0.5 mm (A, B), 0.1 mm (C, D). m, molecular layer of the dentate gyrus; p, pyramidal cell layer of the hippocampus; PL, Purkinje cell layer of the cerebellum ; S, subiculum ; sl, stratum lucidum of the hippocampus; so, stratum oriens of the hippocampus ; sr, stratum radiatum of the hippocampus.

ever, residual Q remained detectable in BCT and throughout the granule cell layer. To more thoroughly investigate the distribution of endogenous Q isoforms, we carried out immunoelectron microscopic analysis of hippocampal mossy ¢ber synapses of control mice (Fig. 9). The de¢ning asymmetric features of these synapses were evident. The presynaptic domain was clearly identi¢ed by the presence of V40^ 50 nm synaptic vesicles and prominent postsynaptic densities were present. Surprisingly, the pattern of expression of CW59-reactive Q isoforms suggested that Q were primarily localized to dendrites and at postsynaptic densities (Fig. 9A). However, staining localized to the presynaptic side of the active zone could not be discounted. In the absence of primary antibody, the dendritic staining was not detected, and the postsynaptic densities, while discernable, were not stained (Fig. 9B). The homology among Q1 and the novel Q isoforms, the neuron-speci¢c expression of Q2 (Letts et al., 1998; Klugbauer et al., 2000), and the e¡ects of Q2 co-expressed on recombinant HVA VDCC (Letts et al., 1998; Klugbauer et al., 2000) suggested Q2 associated directly with HVA VDCC. To test this possibility, we solubilized mouse forebrain with CHAPS as described (Vance et al., 1998) and used anti-peptide a¤nity-puri¢ed antibodies to

NSC 5065 10-8-01

L1b (CW28) and Q isoforms (CW59) to immunoprecipitate K1B subunits. Our choice to pursue K1B as a reporter of Q association with a HVA VDCC K1 was suggested by the recent results of Klugbauer et al. (2000) that extended the observation of Letts et al. (1998) and characterized the in£uence of Q on the electrophysiological properties of recombinant non-P/Q-type VDCC. Furthermore, pursuing the interaction between Q isoforms and the K1B o¡ered the technical advantage of using a monoclonal antibody to K1B in western blotting to assay the immunoprecipitated sample (Vance et al., 1999). As shown in Fig. 10, using CHAPS as the solubilizing detergent and resolving the sample on 12% SDS^PAGE in the presence of 8 M urea, we demonstrated that all three Q isoforms were soluble (Fig. 10A) with their relative recovery similar to that of L1b subunits (Fig. 10B). To determine if Q forms complex with N-type VDCC, we used anti-Q (CW59) and anti-L1b (CW28) in K1B immunoprecipitation assays (Fig. 10C, lane 1). As shown, K1B was immunoprecipitated by antibodies to Q isoforms (Fig. 10, lane 1) as well as antibodies to the auxiliary L1b (Fig. 10, lane 3). These results are the ¢rst to demonstrate an association between K1B and Q that persisted following detergent solubilization. This observation strengthens the hypothesis that Q functions as auxiliary subunit of HVA VDCC.

Cyaan Magenta Geel Zwart

Regional distribution and biochemical properties of VDCC Q subunit isoforms

Fig. 9. High resolution localization of Q isoforms in hippocampal mossy ¢ber synapses by immunoelectron microscopy. Comparison of results obtained with CW59 (A) to the control in which primary antibody (Ab) was omitted (B), indicate anti-Q immunoreactivity in dendrites (d) which form asymmetric synapses with large mossy ¢ber boutons (mfb). The immunoperoxidase reaction product was closely associated with plasma membrane, especially in the postsynaptic densities (arrowheads) which appear much darker than those in the control experiment. Round vesicular elements with diameter of V60^70 nm are stained within the dendrites. Scale bars = 1 Wm.

Fig. 10. (A) Solubilization of Q isoforms and their co-immunoprecipitation with VDCC (K1B) and GluR1 from solubilized mouse brain homogenates. Mouse forebrain was homogenized and solubilized with CHAPS detergent as previously described. Aliquots of starting material (lane 1), homogenate in the presence of CHAPS (lane 2) and solubilized material (lane 3) were resolved by SDS^PAGE on 12% polyacrylamide gels in the presence of 8 M urea, transferred to nitrocellulose and probed with anti-Q-generic antibodies (CW59). For (B), samples were treated as in (A) and plots were probed with anti-subunit antibodies, anti-L1B antibodies (CW28). Note the similar recovery of L1b and Q isoforms in the solubilized material. (C) The soluble material was incubated with anti-Q (CW59) antibodies (lane 1), no primary antibody (lane 2), or anti-L1b (CW28) (lane 3), and precipitated by Sepharose CL6B-protein A, and the washed pellets resolved by SDS^PAGE. A rat monoclonal antibody to the K1B subunit (CC18, a gift from Dr. Vanda Lennon) was used to detect the K1B subunit in the immunoprecipitated sample (Vance et al., 1999). (D) Anti-Q2 (CW57S) (lane 1), anti-L2 (lane 2) and anti-K1B (CW21) (lane 3) immunoprecipitated samples were also probed using an antibody speci¢c to the AMPA receptor subunits, GluR1.

NSC 5065 10-8-01

Cyaan Magenta Geel Zwart

611

612

A. H. Sharp et al.

The recent paper by Chen et al. (2000) demonstrated a complex formed between Q2 and AMPA receptor subunits in primary hippocampal neurons transfected with HA (in£uenza hemagglutinin epitope)-tagged Q2. However, the authors commented that they could not demonstrate a complex between Q2 and AMPA receptors in native brain extracts, as a consequence of the insolubility of Q2 (Chen et al., 2000). Using antibodies to Q2 (CW57S) in our immunoprecipitation assays, we demonstrated the co-immunoprecipitation of Q2 and GluR1 (Fig. 10D, lane 1). Furthermore, to probe for association of GluR1 and N-type VDCC K1B, we used our polyclonal antibody to K1B (CW21) as the immunoprecipitating antibody, and demonstrated recovery of GluR1 (Fig. 10D, lane 3).

DISCUSSION

Stargazer mice are among the best characterized animal models of inherited neurological diseases. Speci¢c sites of synaptic defects (Hashimoto et al., 1999b; Chen et al., 2000) and abnormal histological ¢ndings were noted (Chafetz et al., 1995; Qiao and Noebels, 1993; Nahm and Noebels, 1998). The identi¢cation of the genetic defect in stargazer, i.e. the insertion of a transposon into a gene that encoded a protein (termed Q2) with sequence homology to the auxiliary Q1 subunit of VDCC (Letts et al., 1998), placed the pathological features of the stargazer mouse under scrutiny in relation to VDCC. What relationships could be drawn between the pleiotropic defects in stargazer and the genetic defect in the Q2? We report, for the ¢rst time, that the genetic defect in stargazer results in the loss of Q2 protein expression (Figs. 5 and 6). As numerous Q2 homologues have been identi¢ed (Letts et al., 1998; Klugbauer et al., 2000; Burgess et al., 1999; and the present study), the objective of this study is the biochemical and immunohistochemical characterization of the family of neuronal Q isoforms (Q2, Q3 and Q4) in control and stargazer mice. In contrast to the skeletal muscle Q1 isoform that was identi¢ed via its association with the puri¢ed L-type VDCC, the identi¢cation of Q2 resulted from a detailed neurogenetic analysis of stargazer (Letts et al., 1998). The persistent association of Q1 with the skeletal muscle L-type VDCC K1S, K2/N, and L1a subunits throughout co-immunoprecipitation from detergent extracts and the e¡ect of Q1 upon the electrophysiological properties of heterologously expressed L-type VDCC K1C subunits (Suh-Kim et al., 1996; Wei et al., 1995, 1991) formulated the basis for thinking of Q1 as an auxiliary subunit of the HVA VDCC. The designation of the Q2 as a functional VDCC subunit was based upon (1) the slight shift in the steady-state inactivation when Q2 was co-expressed with the K1A, K2/N and L1A in BHK cells, a result which paralleled, but to a much lower extent, the e¡ect seen by Q1 on the cardiac K1C channel (Letts et al., 1998), (2) the similarity in the intron/exon organization of Q1 and the neuronal Q isoforms, and (3) the weak sequence homology as evidenced in Fig. 1. With additional Q isoforms available for structural analysis, the sequence alignment of the Q4 that was iden-

NSC 5065 10-8-01

ti¢ed in this study with the other Q isoforms o¡ers the opportunity to identify domains of these proteins that could be implicated in either convergent or divergent function (Fig. 1). The conservation of amino acids in the ¢rst 35 amino acids of all Q isoforms and the conserved hydrophobic amino acids in the membrane-spanning K helices suggest highly conserved functional domains. The divergence in the other cytoplasmic domains and the relatively shorter C-terminal domain which sets Q1 apart from the neuronal Q isoforms, suggested speci¢c roles for the individual Q isoforms that may occur via their speci¢c interaction with other membrane proteins, or with proteins that achieve membrane association through their binding to Q. In addition, new Q isoforms, e.g. Q5P (Burgess et al., 1999) and Q5 (Klugbauer et al., 2000), have recently been reported. The Q5 described by Klugbauer et al. (2000) in£uenced the electrophysiological properties of the LVA VDCC pore-containing subunit K1G when co-expressed in HEK293 cells. Hence, the divergence among the Q2 and Q5 isoforms could presumably suggest domains which mediate HVA VDCC- and LVA VDCC-speci¢c e¡ects. Notably, the last four amino acids of Q2, Q3 and Q4 (TTPV) encode a canonical PDZ domain binding site (Klugbauer et al., 2000). This domain was recently shown to be required for the Q2-dependent clustering of AMPA receptors at synapses (Chen et al., 2000). Similar to Q1 (Jay et al., 1990), the three neuronal Q isoforms (Q2, Q3 and Q4) are glycosylated in HEK293 cells as re£ected by the apparent decrease in their molecular weight in the presence of the N-linked glycosylation inhibitor, tunicamycin. It is interesting to note, however, that in the absence of tunicamycin, a small fraction of the total Q subunit isoform remains unglycosylated, suggesting that glycosylation of Q2, Q3 and Q4 does not proceed to completion in HEK293 cells (Fig. 2). This pattern of mobility that results from incomplete glycosylation, however, can be easily distinct from the relative pattern of mobility exhibited by the individual Q isoforms. In the careful analysis of Q2, Q3 and Q4 in HEK293 cells, we could reproducibly distinguish among the Q isoforms based upon their apparent molecular weight. Determining the di¡erential reactivity of heterologously expressed Q isoforms to our anti-Q antibodies was pivotal to our analyses of the di¡erent Q isoforms expressed endogenously in mouse tissues (Table 1). We thoroughly characterized the pattern of expression of endogenous Q2, Q3 and Q4 in two di¡erent electrophoretic systems to ascertain their relative level of expression in control and stargazer brain (Figs. 5 and 6). It should be pointed out that small, hydrophobic proteins often bind SDS in non-standard ways (Reynolds and Tanford, 1970) and glycosylated proteins with multiple predicted membrane-spanning domains often show anomalous migration by SDS^PAGE analysis. The retarded migration of Q4 in SDS^PAGE, both in the absence and presence of urea (Figs. 5 and 6), distinguished it from the other Q isoforms. Molecular studies are currently underway to determine the structural basis of this observation. The results summarized in Table 1 o¡er the most

Cyaan Magenta Geel Zwart

Regional distribution and biochemical properties of VDCC Q subunit isoforms

detailed comparison of exogenous and endogenous Q isoforms to date. As shown in Fig. 6, the loss of Q2 was veri¢ed using all three of our anti-Q antibodies and, interestingly, there were no apparent changes in the level of protein expression of non-mutated isoforms. These results suggest that compensatory changes in the levels of expression of non-mutated Q proteins did not occur in stargazer. In the earliest characterization of the distribution of Q isoforms, the cDNA encoding the Q1 protein was only identi¢ed in skeletal muscle (Jay et al., 1990). Subsequent to those studies, an isoform of Q had been identi¢ed in heart (Eberst et al., 1997) that was determined to be highly homologous to the skeletal muscle Q1. To reopen the possibility that Q2, Q3 and Q4 are distributed outside of nervous tissue, we probed western blots of numerous tissues that express L-type VDCC at high density and other peripheral tissues (Fig. 3). Our negative results reinforce the conclusion that Q2 (Fig. 3), and Q3 and Q4 (data not shown) are not expressed in non-neuronal tissues. These ¢ndings are consistent with recently reported northern analysis (Klugbauer et al., 2000). The absence of the Q2 from control mouse testis is a very interesting observation as male stargazer mice are sterile (Noebels et al., 1990; Blake et al., 2001). Hence, the relationship between the loss of Q2 and infertility in these animals remains to be determined. Previous studies that identi¢ed the distribution of Q isoform message by in situ hybridization reported Q2 was strongly detected in the cerebellum and moderately detected in the hippocampus, cerebral cortex, thalamus and olfactory bulb (Chen et al., 2000; Klugbauer et al., 2000). While these reports were consistent in the detection of Q2 in the Purkinje cells, the two reports di¡ered as to the expression of Q2 in cerebellar granule cells. The detection of Q3 in forebrain structures (cortex, olfactory bulb and caudate putamen) was observed by both groups (Chen et al., 2000; Klugbauer et al., 2000), but detection of Q3 in cerebellum di¡ered signi¢cantly between these reports. Chen et al. (2000) report detection of Q3 in Purkinje cell bodies and Golgi cell neurons, whereas Klugbauer et al. (2000) did not report the detection of Q3 in cerebellum. Our data extend these in situ experiments to identify the distribution of Q protein in control and stargazer brain. This report is the ¢rst to localize Q protein endogenous to control and stargazer mouse brain by immunohistochemistry. This study contributes the ¢rst indication that endogenous Q isoforms are detected primarily in synaptic regions, in contrast to cell body layers, where Q are faintly detected. It should be pointed out that the ¢rst report of the localization of Q2 by in situ methods (Letts et al., 1998) utilized a degenerate probe that would be expected to detect Q3 and Q4 as well as Q2. Q3 and Q4 had not been yet identi¢ed when those studies were performed. Consistent with the broad distribution of Q2 message (Chen et al., 2000; Klugbauer et al., 2000), immunohistochemical analysis of the loss of Q2 in stargazer brain indicated overall decreased CW59 staining in cerebellum, hippocampus, and cortex compared to control (Fig. 7). At higher resolution, we reveal loss of

NSC 5065 10-8-01

613

CW59 immunostaining that could not be anticipated from the in situ localization data of Q2 and Q3 in hippocampus (Chen et al., 2000; Klugbauer et al., 2000). Q2 and Q3 messages were shown to be expressed in dentate granule cells and hippocampal pyramidal cells (Chen et al., 2000), however, the loss of CW59 immunostaining in hippocampus is dramatically reduced in the molecular layer of the dentate, the CA3, and in the stratum lucidum. Altered NPY expression and increased innervation of mossy ¢bers in hippocampus have been noted, albeit subsequent to seizure activity (Chafetz et al., 1995; Qiao and Noebels, 1993; Nahm and Noebels, 1998). We suggest that the loss of Q2 from mossy ¢ber synapses contributes, by some unknown mechanism, to the vulnerability of this region. In contrast, CW59 staining persisted in the CA1 and we suggest that persistent expression of non-mutated Q in the CA1 may support normal synaptic activity such to explain the absence of a synaptic defect in hippocampal CA1 pyramidal cells of stargazer (Hashimoto et al., 1999b). The loss of CW59 immunoreactivity in the cerebellar molecular layer of stargazer mice is consistent with loss of Q2 whose message is known to be expressed in Purkinje cells (Chen et al., 2000; Klugbauer et al., 2000). The reduced synaptic transmission at parallel ¢ber Purkinje cell synapses in waggler (Chen et al., 1999) may be explained by the loss of Q2 from the molecular layer. The detection of CW59 immunostaining in the granule cell layer is decreased compared to control mice (Figs. 7 and 8), but not to the extent that we may have anticipated if Q2 was the predominant Q isoform expressed in this region. Therefore, we conclude that non-mutated Q isoforms, perhaps Q4, were expressed in the granule cell layer. Mossy ¢ber to cerebellar granule cell synapses were shown to be defective and lack the fast component of EPSCs in both stargazer (Hashimoto et al., 1999b) and waggler (Chen et al., 1999), but at this time, we cannot resolve a change in Q immunoreactivity that can be localized to this synapse. The summary of all available data (Chen et al., 2000; Klugbauer et al., 2000; and present paper) strongly indicates regions of mouse brain that have both unique and overlapping Q isoform expression. We hypothesize that the feature common to those regions that evidenced cellular and synaptic defects in stargazer resulted from their mutual reliance upon predominantly the Q2 isoform. Whether the Q isoforms that persist in stargazer in the absence of the Q2 o¡er some protective advantage to other neurons is another alternative to consider. Compensatory regulation of nonmutated Q isoforms in the stargazer mouse could indicate cellular mechanisms that coordinate and regulate Q isoform expression and, therefore, would o¡er further insight into the role of neuronal Q subunits in neurological diseases. However, at the level of analysis carried out in this study (Fig. 6), no subunit compensation was evident. The possibility that there is altered expression of Q isoforms in response to the primary defect in tottering (missense mutation in K1A) (Fletcher et al., 1996), the K1A knock-out (Fletcher et al., 2001), and lethargic mice (L4 null) (Burgess et al., 1997; McEnery et al., 1998a,b)

Cyaan Magenta Geel Zwart

614

A. H. Sharp et al.

are the subject of further investigation (Sharp et al., 2000). While reliance upon Q2 may be a common denominator for synaptic defects, the pleiotropic consequences that occur in stargazer as a result of the loss of Q2 (Chafetz et al., 1995; Qiao and Noebels, 1993; Nahm and Noebels, 1998; Qiao et al., 1996; Hashimoto et al., 1999a; Thompson et al., 1998; Qiao et al., 1998) are not readily explained. There is clear evidence, however, for dramatic decreases in excitatory transmission at a variety of synapses. These synaptic defects were identi¢ed at mossy ¢ber input onto cerebellar granule cell dendrites (Hashimoto et al., 1999a), excitatory synaptic transmission from parallel ¢bers to Purkinje cells (Chen et al., 1999) and climbing ¢bers to Purkinje cells (Hashimoto et al., 1999a). The overall trend observed in our immunostaining indicates that regions showing loss of Q staining in stargazer are regions enriched in glutamatergic synapses. It is intriguing to point out that the staining pattern of Q isoforms resembles closely that of the GluR1 AMPA receptor with enrichment in the cerebellar molecular layer, the hippocampus and olfactory nuclei (Blackstone et al., 1992; Petralia and Wenthold, 1992; Wenthold et al., 1992) suggesting a possible convergence of Q and AMPA receptor function. This intriguing possibility was ¢rst suggested by distinct cerebellar granule cell defects present in stargazer that are due to postsynaptic defects in AMPA receptor-mediated responses, but spare NMDA-mediated responses (Hashimoto et al., 1999a). This speci¢c AMPA receptor dysfunction is not paralleled by changes in either the level of GluR isoforms 1^4 protein or mRNA (Hashimoto et al., 1999a). The predominant localization of Q isoforms to neuronal processes and the low level of Q detected in cell bodies in control adult animals (Figs. 7 and 8) sharply contrasts with previous reports of VDCC K1 and L subunits which were localized to both cell bodies and neuronal processes (Chin et al., 1992; Hillman et al., 1991; Ludwig et al., 1997; Tanaka et al., 1995; Volsen et al., 1997). However, methods used to further intensify the CW59 immunohistochemical signal detected weak reactivity in the cell bodies of hippocampal pyramidal cells (data not shown). Furthermore, the immunohistochemical distribution of the Q isoforms in adult animals, as determined using CW59 (Figs. 7 and 8) does not directly coincide with the pattern of localization of any single isoforms of HVA K1 or L (Ludwig et al., 1997; Tanaka et al., 1995). In this study, we show for the ¢rst time co-immunoprecipitation of the K1B subunit using antibodies directed to Q isoforms (Fig. 10). Furthermore, we demonstrate a complex between AMPA receptor subunit GluR1 and Q2 as well as a complex between K1B and GluR1. These data are the ¢rst to suggest that roles of these novel, neuronal Q isoforms function as a consequence of their association with both subunits of VDCC and as well as AMPA receptors. Thus, the Q2 subunit has seemingly pleiotropic properties. Q2, when absent, results in reduced expression of

NSC 5065 10-8-01

AMPA receptors at cerebellar granule cell synapses (Hashimoto et al., 1999a). Furthermore, Q persistently interact with HVA VDCC (K1B) (Fig. 10) and, upon co-expression in heterologous systems, modify the voltage dependence of inactivation of recombinant HVA VDCC (Letts et al., 1998; Rousset et al., 2001; Klugbauer et al., 2000). In the most recent study, Q2, Q3, and Q4 were co-expressed in Xenopus laevis oocytes with K1A along with K2/N and di¡erent L isoform (Rousset et al., 2001). The results indicated that L and Q subunits together modulate VDCC activity by in£uencing a shift between two regulatory modes of P/Q-type VDCC inactivation (Rousset et al., 2001). The interpretation of this body of data suggests that Q2 serves to `couple' some aspect of HVA VDCC signaling to the expression or recruitment of functional AMPA receptors. The observation that Q isoforms in£uence the voltage dependence of inactivation of reconstituted VDCC (Klugbauer et al., 2000), suggests the hypothesis that ¢nely tuned calcium entry via VDCC may be an important stimulus for AMPA receptor recruitment (Luthi et al., 1999; O'Brien et al., 1998). However, a recent report examined AMPA receptor recruitment in the presence of cadmium, and noted no inhibitory e¡ect upon AMPA receptor recruitment. While this observation may discount the role of calcium entry via VDCC as a mediator of AMPA receptor recruitment, it does not discount the possibility that VDCC are structurally implicated in the process. The most important contribution that our study makes to our understanding of Q isoforms to neuronal mechanisms is our ¢nding that native Q (1) are distributed to neuronal processes in adult mouse brain, (2) associate with isoforms with both GluR1 and K1B in immunoprecipitation, (3) are primarily localized to dendritic structures, as revealed at mossy ¢ber synapses. The immunoelectron microscopic localization of endogenous Q isoforms to the postsynaptic density o¡ers in vivo support of the biochemical co-expression experiments of Chen et al. (2000) which followed the distribution and association of heterologously expressed Q2 in cerebellar granule and hippocampal neuronal cultures. However, in the immunogold labeling experiments they localized GluR1 as a reporter for exogenous Q2 expression, while herein, we identi¢ed the distribution of Q isoforms. The dendritic distribution of the CW59^immunoperoxidase reaction product (Fig. 9) was similar to that seen with anti-GluR1 (Bernard et al., 1997) and anti-EEAC1 antibodies (He et al., 2000). The immunoprecipitation of GluR1 by anti-Q2 antibodies and anti-K1B antibodies (Fig. 10) suggests their common interaction with Q subunits. If Q2 is implicated in rapid activity-dependent tra¤cking of AMPA receptors in synaptic plasticity as recently suggested (Chen et al., 2000), we suggest the CW59^immunoperoxidaselabeled structures we observed in dendrites may contribute to Q2-mediated tra¤cking of complexes containing AMPA receptors and VDCC to the plasma membrane.

Cyaan Magenta Geel Zwart

Regional distribution and biochemical properties of VDCC Q subunit isoforms

615

REFERENCES

Altschul, S.F., Madden, T.L., Scha¡er, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST : a new generation of protein database search programs. Nucleic Acids Res. 25, 3389^3402. Barclay, J., Rees, M., 1999. Mouse models of spike-wave epilepsy. Epilepsia 40 (Suppl. 3), 17^22. Bernard, V., Somogyi, P., Bolam, J.P., 1997. Cellular, subcellular, and subsynaptic distribution of AMPA-type glutamate receptor subunits in the neostriatum of the rat. J. Neurosci. 17, 819^833. Black, J.L., Lennon, V.A., 1999. Identi¢cation and cloning of putative human neuronal voltage-gated calcium channel gamma-2 and gamma-3 subunits: neurologic implications. Mayo Clin. Proc. 74, 357^361. Blackstone, C.D., Moss, S.J., Martin, L.J., Levey, A.I., Price, D.L., Huganir, R.L., 1992. Biochemical characterization and localization of a nonN-methyl-D-aspartate glutamate receptor in rat brain. J. Neurochem. 58, 1118^1126. Blake, J.A., Eppig, J.T., Richardson, J.E., Bult, C.J., Kadin, J.A., 2001. The Mouse Genome Database (MGD) : integration nexus for the laboratory mouse. Nucleic Acids Res. 29, 91^94. Burgess, D.L., Davis, C.F., Gefrides, L.A., Noebels, J.L., 1999. Identi¢cation of three novel Ca(2+) channel gamma subunit genes reveals molecular diversi¢cation by tandem and chromosome duplication. Genome Res. 9, 1204^1213. Burgess, D.L., Jones, J.M., Meisler, M.H., Noebels, J.L., 1997. Mutation of the Ca2‡ channel beta subunit gene Cchb4 is associated with ataxia and seizures in the lethargic (lh) mouse. Cell 88, 385^392. Catterall, W.A., de Jongh, K., Rotman, E., Hell, J., Westenbroek, R., Dubel, S.J., Snutch, T.P., 1993. Molecular properties of calcium channels in skeletal muscle and neurons. Ann. N. Y. Acad. Sci. 681, 342^355. Chafetz, R.S., Nahm, W.K., Noebels, J.L., 1995. Aberrant expression of neuropeptide Y in hippocampal mossy ¢bers in the absence of local cell injury following the onset of spike-wave synchronization. Brain Res. Mol. Brain Res. 31, 111^121. Chen, L., Bao, S., Qiao, X., Thompson, R.F., 1999. Impaired cerebellar synapse maturation in waggler, a mutant mouse with a disrupted neuronal calcium channel gamma subunit. Proc. Natl. Acad. Sci. USA 96, 12132^12137. Chen, L., Chetkovich, D.M., Petralia, R.S., Sweeney, N.T., Kawasaki, Y., Wenthold, R.J., Bredt, D.S., Nicoll, R.A., 2000. Stargazing regulates synaptic targeting of AMPA receptors by two distinct mechanisms. Nature 408, 936^943. Chin, H., Smith, M.A., Kim, H.L., Kim, H., 1992. Expression of dihydropyridine-sensitive brain calcium channels in the rat central nervous system. FEBS Lett. 299, 69^74. Dascal, N., Snutch, T.P., Lubbert, H., Davidson, N., Lester, H.A., 1986. Expression and modulation of voltage-gated calcium channels after RNA injection in Xenopus oocytes. Science 231, 1147^1150. Di Pasquale, E., Keegan, K.D., Noebels, J.L., 1997. Increased excitability and inward recti¢cation in layer V cortical pyramidal neurons in the epileptic mutant mouse Stargazer. J. Neurophysiol. 77, 621^631. Eberst, R., Dai, S., Klugbauer, N., Hofmann, F., 1997. Identi¢cation and functional characterization of a calcium channel gamma subunit. P£ugers Arch. 433, 633^637. Fletcher, C.F., Copeland, N.G., Jenkins, N.A., 1998. Genetic analysis of voltage-dependent calcium channels. J. Bioenerg. Biomembr. 30, 387^398. Fletcher, C.F., Lutz, C.M., O'Sullivan, T.N., Shaughnessy, J.D.J., Hawkes, R., Frankel, W.N., Copeland, N.G., Jenkins, N.A., 1996. Absence epilepsy in tottering mutant mice is associated with calcium channel defects. Cell 87, 607^617. Fletcher, C.F., Tottene, A., Lennon, V., Wilson, S.M., Dubel, S.J., Paylor, R., Hosford, D.A., Tessarollo, L., McEnery, M.W., Pietrobon, D., Copeland, N.G., Jenkins, N.A., 2001. Dystonia and cerebellar atrophy in Cacna1a null mice lacking P/Q calcium channel activity. EMBO J. 15, 1288^1290. Freise, D., Held, B., Wissenbach, U., Pfeifer, A., Trost, C., Himmerkus, N., Schweig, U., Freichel, M., Biel, M., Hofmann, F., Hoth, M., Flockerzi, V., 2000. Absence of the gamma subunit of the skeletal muscle dihydropyridine receptor increases L-type Ca2‡ currents and alters channel inactivation properties. J. Biol. Chem. 275, 14476^14481. Hansson, O., Petersen, A., Leist, M., Nicotera, P., Castilho, R.F., Brundin, P., 1999. Transgenic mice expressing a Huntington's disease mutation are resistant to quinolinic acid-induced striatal excitotoxicity. Proc. Natl. Acad. Sci. USA 96, 8727^8732. Hashimoto, K., Fukaya, M., Qiao, X., Sakimura, K., Watanabe, M., Kano, M., 1999a. Impairment of AMPA receptor function in cerebellar granule cells of ataxic mutant mouse stargazer. J. Neurosci. 19, 6027^6036. Hashimoto, K., Isomura, Y., Kato, N., 1999b. Occurrence of dentate granule cell LTP without proximal dendritic Ca2‡ increase. NeuroReport 10, 2509^2513. He, Y., Janssen, W.G., Rothstein, J.D., Morrison, J.H., 2000. Di¡erential synaptic localization of the glutamate transporter EAAC1 and glutamate receptor subunit GluR2 in the rat hippocampus. J. Comp. Neurol. 418, 255^269. Hell, J.W., Westenbroek, R.E., Warner, C., Ahlijanian, M.K., Prystay, W., Gilbert, M.M., Snutch, T.P., Catterall, W.A., 1993. Identi¢cation and di¡erential subcellular localization of the neuronal class C and class D L-type calcium channel alpha 1 subunits. J. Cell Biol. 123, 949^962. Herrup, K., Wilczynski, S.L., 1982. Cerebellar cell degeneration in the leaner mutant mouse. Neuroscience 7, 2185^2196. Hillman, D., Chen, S., Aung, T.T., Cherksey, B., Sugimori, M., Llinas, R.R., 1991. Localization of P-type calcium channels in the central nervous system. Proc. Natl. Acad. Sci. USA 88, 7076^7080. Iles, D.E., Segers, B., Weghuis, D.O., Suikerbuijk, R., Wieringa, B., 1993. Localization of the gamma-subunit of the skeletal muscle L-type voltage-dependent calcium channel gene (CACNLG) to human chromosome band 17q24 by in situ hybridization and identi¢cation of a polymorphic repetitive DNA sequence at the gene locus. Cytogenet. Cell Genet. 64, 227^230. Janckila, A.J., Lear, S.C., Martin, A.W., Yam, L.T., 1996. Epitope enhancement for immunohistochemical demonstration of tartrate-resistant acid phosphatase. J. Histochem. Cytochem. 44, 235^244. Jay, S.D., Ellis, S.B., McCue, A.F., Williams, M.E., Vedvick, T.S., Harpold, M.M., Campbell, K.P., 1990. Primary structure of the gamma subunit of the DHP-sensitive calcium channel from skeletal muscle. Science 248, 490^492. Jiao, Y., Sun, Z., Lee, T., Fusco, F.R., Kimble, T.D., Meade, C.A., Cuthbertson, S., Reiner, A., 1999. A simple and sensitive antigen retrieval method for free-£oating and slide-mounted tissue sections. J. Neurosci. Methods 93, 149^162. Jones, O.T., Bernstein, G.M., Jones, E.J., Juglo¡, D.G., Law, M., Wong, W., Mills, L.R., 1997. N-Type calcium channels in the developing rat hippocampus : subunit, complex, and regional expression. J. Neurosci. 17, 6152^6164. Kawai, K., Serizawa, A., Hamana, T., Tsutsumi, Y., 1994. Heat-induced antigen retrieval of proliferating cell nuclear antigen and p53 protein in formalin-¢xed, para¤n-embedded sections. Pathol. Int. 44, 759^764. Klugbauer, N., Dai, S., Specht, V., Lacinova, L., Marais, E., Bohn, G., Hofmann, F., 2000. A family of gamma-like calcium channel subunits. FEBS Lett. 470, 189^197. Kopecky, J., Houstek, J., Szarska, E., Drahota, Z., 1986. Electrophoretic behavior of the H‡ -ATPase proteolipid from bovine heart mitochondria. J. Bioenerg. Biomembr. 18, 507^519. Korin, H.W., Schwartz, M.R., Chirala, M., Younes, M., 2000. Optimized cyclin D1 immunoperoxidase staining in mantle cell lymphoma. Appl. Immunohistochem. Mol. Morphol. 8, 57^60.

NSC 5065 10-8-01

Cyaan Magenta Geel Zwart

616

A. H. Sharp et al.

Letts, V.A., Felix, R., Biddlecome, G.H., Arikkath, J., Maha¡ey, C.L., Valenzuela, A., Bartlett, F.S., Mori, Y., Campbell, K.P., Frankel, W.N., 1998. The mouse stargazer gene encodes a neuronal Ca2‡ -channel gamma subunit. Nat. Genet. 19, 340^347. Ludwig, A., Flockerzi, V., Hofmann, F., 1997. Regional expression and cellular localization of the alpha1 and beta subunit of high voltageactivated calcium channels in rat brain. J. Neurosci. 17, 1339^1349. Luthi, A., Chittajallu, R., Duprat, F., Palmer, M.J., Benke, T.A., Kidd, F.L., Henley, J.M., Isaac, J.T., Collingridge, G.L., 1999. Hippocampal LTD expression involves a pool of AMPARs regulated by the NSF-GluR2 interaction. Neuron 24, 389^399. McEnery, M.W., Buhle, E.L.J., Aebi, U., Pedersen, P.L., 1984. Proton ATPase of rat liver mitochondria. Preparation and visualization of a functional complex using the novel zwitterionic detergent 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate. J. Biol. Chem. 259, 4642^4651. McEnery, M.W., Copeland, T.D., Vance, C.L., 1998a. Altered expression and assembly of N-type calcium channel alpha1B and beta subunits in epileptic lethargic (lh/lh) mouse. J. Biol. Chem. 273, 21435^21438. McEnery, M.W., Haase, H., Vance, C.L., Dubel, S.J., Morano, I., Copeland, T.D., Choi, Y., 1997. Beta1B subunit of voltage-dependent Ca2‡ channels is predominant isoform expressed in human neuroblastoma cell line IMR32. FEBS Lett. 420, 74^78. McEnery, M.W., Snowman, A.M., Sharp, A.H., Adams, M.E., Snyder, S.H., 1991. Puri¢ed omega-conotoxin GVIA receptor of rat brain resembles a dihydropyridine-sensitive L-type calcium channel (published erratum appears in Proc. Natl. Acad. Sci. USA). Proc. Natl. Acad. Sci. USA 88, 11095^11099. McEnery, M.W., Vance, C.L., Begg, C.M., Lee, W.L., Choi, Y., Dubel, S.J., 1998b. Di¡erential expression and association of calcium channel subunits in development and disease. J. Bioenerg. Biomembr. 30, 409^418. Morgan, J.M., Navabi, H., Schmid, K.W., Jasani, B., 1994. Possible role of tissue-bound calcium ions in citrate-mediated high-temperature antigen retrieval. J. Pathol. 174, 301^307. Nahm, W.K., Noebels, J.L., 1998. Nonobligate role of early or sustained expression of immediate-early gene proteins c-fos, c-jun, and Zif/268 in hippocampal mossy ¢ber sprouting. J. Neurosci. 18, 9245^9255. Noebels, J.L., Qiao, X., Bronson, R.T., Spencer, C., Davisson, M.T., 1990. Stargazer: a new neurological mutant on chromosome 15 in the mouse with prolonged cortical seizures. Epilepsy Res. 7, 129^135. Norton, A.J., Jordan, S., Yeomans, P., 1994. Brief, high-temperature heat denaturation (pressure cooking): a simple and e¡ective method of antigen retrieval for routinely processed tissues. J. Pathol. 173, 371^379. Nucifora, F.C.J., Sharp, A.H., Milgram, S.L., Ross, C.A., 1996. Inositol 1,4,5-trisphosphate receptors in endocrine cells: localization and association in hetero- and homotetramers. Mol. Biol. Cell 7, 949^960. O'Brien, R.J., Kamboj, S., Ehlers, M.D., Rosen, K.R., Fischbach, G.D., Huganir, R.L., 1998. Activity-dependent modulation of synaptic AMPA receptor accumulation. Neuron 21, 1067^1078. Petralia, R.S., Wenthold, R.J., 1992. Light and electron immunocytochemical localization of AMPA-selective glutamate receptors in the rat brain. J. Comp. Neurol. 318, 329^354. Pileri, S.A., Roncador, G., Ceccarelli, C., Piccioli, M., Briskomatis, A., Sabattini, E., Ascani, S., Santini, D., Piccaluga, P.P., Leone, O., Damiani, S., Ercolessi, C., Sandri, F., Pieri, F., Leoncini, L., Falini, B., 1997. Antigen retrieval techniques in immunohistochemistry: comparison of di¡erent methods. J. Pathol. 183, 116^123. Powers, P.A., Liu, S., Hogan, K., Gregg, R.G., 1993. Molecular characterization of the gene encoding the gamma subunit of the human skeletal muscle 1,4-dihydropyridine-sensitive Ca2‡ channel (CACNLG), cDNA sequence, gene structure, and chromosomal location. J. Biol. Chem. 268, 9275^9279. Qiao, X., Chen, L., Gao, H., Bao, S., Hefti, F., Thompson, R.F., Knusel, B., 1998. Cerebellar brain-derived neurotrophic factor-TrkB defect associated with impairment of eyeblink conditioning in Stargazer mutant mice. J. Neurosci. 18, 6990^6999. Qiao, X., Hefti, F., Knusel, B., Noebels, J.L., 1996. Selective failure of brain-derived neurotrophic factor mRNA expression in the cerebellum of stargazer, a mutant mouse with ataxia. J. Neurosci. 16, 640^648. Qiao, X., Noebels, J.L., 1993. Developmental analysis of hippocampal mossy ¢ber outgrowth in a mutant mouse with inherited spike-wave seizures. J. Neurosci. 13, 4622^4635. Reynolds, J.A., Tanford, C., 1970. Binding of dodecyl sulfate to proteins at high binding ratios. Possible implications for the state of proteins in biological membranes. Proc. Natl. Acad. Sci. USA 66, 1002^1007. Rousset, M., Cens, T., Restituito, S., Barrere, C., Black, J.L., III, McEnery, M.W., Charnet, P., 2001. Functional roles of Q2, Q3 and Q4, three new Ca2‡ channel subunits, in P/Q-type Ca2‡ channel expressed in Xenopus oocytes. J. Physiol. 532, 583^593. Sakurai, T., Westenbroek, R.E., Rettig, J., Hell, J., Catterall, W.A., 1996. Biochemical properties and subcellular distribution of the BI and rbA isoforms of alpha 1A subunits of brain calcium channels. J. Cell Biol. 134, 511^528. Sharp, A.H., Ikusika, I., Sundarraj, S., Fletcher, C.F., Copeland, N.G., Jenkins, N.A., Copeland, T.D., McEnery, M.W., 2000. Altered expression and localization of calcium channel subunits in alpha1A knockout mice. Biophys. J. 80, 116a. Sharp, A.H., Loev, S.J., Schilling, G., Li, S.H., Li, X.J., Bao, J., Wagster, M.V., Kotzuk, J.A., Steiner, J.P., Lo, A., 1995. Widespread expression of Huntington's disease gene (IT15) protein product. Neuron 14, 1065^1074. Sharp, A.H., McPherson, P.S., Dawson, T.M., Aoki, C., Campbell, K.P., Snyder, S.H., 1993. Di¡erential immunohistochemical localization of inositol 1,4,5-trisphosphate- and ryanodine-sensitive Ca2‡ release channels in rat brain. J. Neurosci. 13, 3051^3063. Sharp, A.H., Nucifora, F.C.J., Blondel, O., Sheppard, C.A., Zhang, C., Snyder, S.H., Russell, J.T., Ryugo, D.K., Ross, C.A., 1999. Di¡erential cellular expression of isoforms of inositol 1,4,5-triphosphate receptors in neurons and glia in brain. J. Comp. Neurol. 406, 207^220. Singer, D., Biel, M., Lotan, I., Flockerzi, V., Hofmann, F., Dascal, N., 1991. The roles of the subunits in the function of the calcium channel. Science 253, 1553^1557. Struck, D.K., Lennarz, W.J., 1977. Evidence for the participation of saccharide-lipids in the synthesis of the oligosaccharide chain of ovalbumin. J. Biol. Chem. 252, 1007^1013. Suh-Kim, H., Wei, X., Birnbaumer, L., 1996. Subunit composition is a major determinant in high a¤nity binding of a Ca2‡ channel blocker. Mol. Pharmacol. 50, 1330^1337. Suurmeijer, A.J., Boon, M.E., 1993. Notes on the application of microwaves for antigen retrieval in para¤n and plastic tissue sections. Eur. J. Morphol. 31, 144^150. Swank, R.T., Munkres, K.D., 1971. Molecular weight analysis of oligopeptides by electrophoresis in polyacrylamide gel with sodium dodecyl sulfate. Anal. Biochem. 39, 462^477. Tanaka, O., Sakagami, H., Kondo, H., 1995. Localization of mRNAs of voltage-dependent Ca(2+)-channels: four subtypes of alpha 1- and betasubunits in developing and mature rat brain. Brain Res. Mol. Brain Res. 30, 1^16. Tenaud, C., Negoescu, A., Labat-Moleur, F., Legros, Y., Soussi, T., Brambilla, E., 1994. p53 immunolabeling in archival para¤n-embedded tissues: optimal protocol based on microwave heating for eight antibodies on lung carcinomas. Mod. Pathol. 7, 853^859.

NSC 5065 10-8-01

Cyaan Magenta Geel Zwart

Regional distribution and biochemical properties of VDCC Q subunit isoforms

617

Thompson, C.L., Tehrani, M.J., Barnes, E.M.J., Stephenson, F.A., 1998. Decreased expression of GABAA receptor alpha6 and beta3 subunits in stargazer mutant mice: a possible role for brain-derived neurotrophic factor in the regulation of cerebellar GABAA receptor expression? Brain Res. Mol. Brain Res. 60, 282^290. Vance, C.L., Begg, C.M., Lee, W.L., Dubel, S.J., Copeland, T.D., Sonnichsen, F.D., McEnery, M.W., 1999. N-type calcium channel/syntaxin/ SNAP-25 complex probed by antibodies to II-III intracellular loop of the alpha1B subunit. Neuroscience 90, 665^676. Vance, C.L., Begg, C.M., Lee, W.L., Haase, H., Copeland, T.D., McEnery, M.W., 1998. Di¡erential expression and association of calcium channel alpha1B and beta subunits during rat brain ontogeny. J. Biol. Chem. 273, 14495^14502. Volsen, S.G., Day, N.C., McCormack, A.L., Smith, W., Craig, P.J., Beattie, R.E., Smith, D., Ince, P.G., Shaw, P.J., Ellis, S.B., Mayne, N., Burnett, J.P., Gillespie, A., Harpold, M.M., 1997. The expression of voltage-dependent calcium channel beta subunits in human cerebellum. Neuroscience 80, 161^174. Wei, X., Pan, S., Lang, W., Kim, H., Schneider, T., Perez-Reyes, E., Birnbaumer, L., 1995. Molecular determinants of cardiac Ca2‡ channel pharmacology. Subunit requirement for the high a¤nity and allosteric regulation of dihydropyridine binding. J. Biol. Chem. 270, 27106^27111. Wei, X.Y., Perez-Reyes, E., Lacerda, A.E., Schuster, G., Brown, A.M., Birnbaumer, L., 1991. Heterologous regulation of the cardiac Ca2‡ channel alpha 1 subunit by skeletal muscle beta and gamma subunits. Implications for the structure of cardiac L-type Ca2‡ channels. J. Biol. Chem. 266, 21943^21947. Wenthold, R.J., Yokotani, N., Doi, K., Wada, K., 1992. Immunochemical characterization of the non-NMDA glutamate receptor using subunitspeci¢c antibodies. Evidence for a hetero-oligomeric structure in rat brain. J. Biol. Chem. 267, 501^507. Westenbroek, R.E., Hell, J.W., Warner, C., Dubel, S.J., Snutch, T.P., Catterall, W.A., 1992. Biochemical properties and subcellular distribution of an N-type calcium channel alpha 1 subunit. Neuron 9, 1099^1115. Wissenbach, U., Bosse-Doenecke, E., Freise, D., Ludwig, A., Murakami, M., Hofmann, F., Flockerzi, V., 1998. The structure of the murine calcium channel gamma-subunit gene and protein. Biol. Chem. 379, 45^50. Xiao, J.C., Adam, A., Ruck, P., Kaiserling, E., 1996. A comparison of methods for heat-mediated antigen retrieval for immunoelectron microscopy: demonstration of cytokeratin No. 18 in normal and neoplastic hepatocytes. Biotech. Histochem. 71, 278^285. Yokoyama, C.T., Westenbroek, R.E., Hell, J.W., Soong, T.W., Snutch, T.P., Catterall, W.A., 1995. Biochemical properties and subcellular distribution of the neuronal class E calcium channel alpha 1 subunit. J. Neurosci. 15, 6419^6432. (Accepted 24 April 2001)

NSC 5065 10-8-01

Cyaan Magenta Geel Zwart