Beneficial effects of a host gut-derived probiotic, Bacillus pumilus, on the growth, non-specific immune response and disease resistance of juvenile golden pompano, Trachinotus ovatus

Journal Pre-proof Beneficial effects of a host gut-derived probiotic, Bacillus pumilus, on the growth, non-specific immune response and disease resistance of juvenile golden pompano, Trachinotus ovatus

Shubin Liu, Shifeng Wang, Yan Cai, Erchao Li, Zhuling Ren, Yue Wu, Weiliang Guo, Yun Sun, Yongcan Zhou PII:

S0044-8486(19)31164-0

DOI:

https://doi.org/10.1016/j.aquaculture.2019.734446

Article Number:

734446

Reference:

AQUA 734446

To appear in:

Aquaculture

Received Date:

10 May 2019

Accepted Date:

02 September 2019

Please cite this article as: Shubin Liu, Shifeng Wang, Yan Cai, Erchao Li, Zhuling Ren, Yue Wu, Weiliang Guo, Yun Sun, Yongcan Zhou, Beneficial effects of a host gut-derived probiotic, Bacillus pumilus, on the growth, non-specific immune response and disease resistance of juvenile golden pompano, Trachinotus ovatus, Aquaculture (0), https://doi.org/10.1016/j.aquaculture.2019.734446

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

Journal Pre-proof

Beneficial effects of a host gut-derived probiotic, Bacillus pumilus, on the growth, non-specific immune response and disease resistance of juvenile golden pompano, Trachinotus ovatus

Shubin Liua,b, Shifeng Wanga,b*, Yan Caia, Erchao Lia, Zhuling Rena,b, Yue Wua,b, Weiliang Guoa,b, Yun Suna,b, Yongcan Zhoua,b*

a

State Key Laboratory of Marine Resource Utilization in South China Sea, Hainan

University, China b

Hainan Provincial Key Laboratory for Tropical Hydrobiology and Biotechnology,

College of Marine Science, Hainan University, Haikou, Hainan, 570228, PR China

*

Corresponding to Dr. Shifeng Wang, Email: shifeng_15@163. com. Dr. Yongcan Zhou, Email: [email protected]

Journal Pre-proof Abstract A potential host-derived probiotic, Bacillus pumilus A97, was successfully screened from 434 isolates from the intestines of healthy adult Trachinotus ovatus based on in vitro assays of non-haemolytic activity, extracellular enzyme activity, inhibitory activity against pathogens (Vibrio or Streptococcus), tolerance to gastrointestinal stress and bile salts, cell surface hydrophobicity, autoaggregation, biofilm formation and antibiotic susceptibility. Dietary supplementation with B. pumilus A97 (1.0×108 CFU·g-1) for 56 days significantly improved the weight gain, specific growth rate, feed efficiency and non-specific immune responses of T. ovatus (P<0.05). The mRNA levels of toll-like receptor 8 (TLR8) in the intestines and toll-like receptor 9 (TLR9) in the kidneys of T. ovatus were significantly upregulated (P<0.05). Higher survival rates post-Vibrio ponticus-challenge was found in T. ovatus fed an A97 diet than in the control fish. All the results suggest that B. pumilus A97 has great potential as an effective dietary probiotic for improving the growth, immune status and disease resistance of T. ovatus.

Keywords: Gut-derived probiotics; Bacillus pumilus; golden pompano; Vibrio ponticus

Journal Pre-proof 1. Introduction In the past decade, the occurrence of various diseases has been the major concern for intensive aquaculture (Cordero et al, 2016). Traditionally, antibiotic applications and chemical disinfectants are commonly used to solve these problems (Burridge et al, 2010). However, it has been found that the use of antibiotics or chemicals in aquatic animals can lead to problems, such as the spread of drug-resistant pathogens, food safety and environmental pollution (Rattanavichai et al, 2015; Zhang et al, 2014). Thus, it is urgent to find alternatives to antibiotics or chemical disinfectants for environmentally friendly aquaculture development in the future. Probiotics are considered as novel functional ingredients that can be applied to benefit nutrition, development, health, or even the well-being of farmed aquatic animals (Andani et al, 2012; Cai et al, 2019; Han et al, 2015). However, not all probiotics can achieve the expected outcomes in aquatic animals, since an ideal probiotic should colonize, establish and multiply in the host gut (Lazado et al, 2015). Until now, because higher percentages of the commercial probiotics in current aquaculture practices are derived from terrestrial animals, ineffective or minimally effective results are commonly reported for aquaculture (Giri et al, 2013; Beck et al, 2015; Doan et al, 2016; Tovar-Ramirez et al, 2010; Daruosh et al, 2018). The commercial B. pumilus is a novel probiotic Bacillus species in aquaculture, but its terrene-derivedproperties

had

restrained

its

popularization

and

application

(Kuebutornye et al, 2019). The reasons for the ineffectiveness or minimal effectiveness of these terrestrial probiotics in fish may be the low intestinal

Journal Pre-proof colonization capacity of probiotics, the unfavourable growth conditions and the resistance of the fish to foreign probiotics (Lazado et al, 2015). Briefly, the physiological activities of microorganisms are optimum when in their natural habitat. Host-derived probiotics can precisely avoid the above problems, and thus deserve greater attention in the development of aquaculture probiotics. Golden pompano, Trachinotus ovatus, is an economically important warm-water marine fish species worldwide (Tutman et al, 2004). In past years, golden pompano aquaculture has developed rapidly and widely across Asia (Tan et al, 2017; Wang et al, 2019; Zhou et al, 2015). With the expansion of intensive aquaculture, diseases occur more frequently in T. ovatus, which has caused considerable economic losses; thus, effective modulation methods should be developed to change the current situation (Do Huu et al, 2016; Tu et al, 2017; Wang et al, 2013). Although probiotics have been used universally for the prevention of disease outbreaks (Dawood & Koshio, 2016; Hoseinifar et al, 2016) and for the improvement of growth and health status in aquatic animals (Bency et al, 2015; Liu et al, 2017), little information on this topic has been reported for T. ovatus, and information on the beneficial effects of T. ovatus-derived probiotics is even more scarce. Therefore, a highly effective T. ovatus-derived potential probiotic, B. pumilus A97, was successfully screened from 434 isolates from the intestines of healthy adult T. ovatus based on in vitro assays of non-haemolytic activity, extracellular enzyme activity, inhibitory activity against pathogens, tolerance to gastrointestinal stress and bile salts, cell surface hydrophobicity, autoaggregation, biofilm formation and

Journal Pre-proof antibiotic susceptibility. In addition, the probiotic effects of the dietary supplementation of B. pumilus A97 obtained from T. ovatus were further evaluated from the aspects of growth, immune status and disease resistance of T. ovatus. 2. Materials and methods 2.1 Probiotics assay Eighteen adult T. ovatus were used for intestinal probiotic assays, among which ten T. ovatus (477.61±80.74 g) were from a local farm in Danzhou, Hainan, China and eight T. ovatus (276.28± 39.60 g) were obtained from Haikou, Hainan, China. The fish were first anaesthetized with tricaine methanesulfonate (Sigma, St. Louis, MO, USA). The skins of the fish were then sterilized using 70% ethanol to eliminate bacterial contamination (Del'Duca et al, 2013). Next, the guts of 18 fish were immediately removed with a sterile tweezer and mixed together at 4℃. Briefly, one gram of each gut sample was added to 9 mL sterile phosphate buffer saline (PBS) (pH 7.4), and the mixtures were homogenized by a glass tissue grinder and serially diluted 10:1, plated on marine broth 2216E and nutrient broth medium, then incubated under aerobic conditions at 30℃ with shaking at 200 rpm for 24 h. Colonies of single, dominant types were selected and re-streaked onto marine agar to obtain pure cultures after incubation for 24 h at 30℃. The isolates with different phenotypes were chosen for further testing. Meanwhile, the isolates were stored in 25% (v/v) glycerol at −80℃ for further experiments. A total of 434 isolates were obtained from the 18 fish gut samples. For further evaluation of probiotic properties, ten potential probiotics with non-haemolysis,

Journal Pre-proof higher protease activity, amylase activity and better antagonism against pathogens were chosen. Based on a comprehensive assessment of the tolerance to simulated gastrointestinal stress, autoaggregation, cell hydrophobicity and biofilm formation, one potential T. ovatus-derived probiotic was identified from the 434 isolates. Haemolytic activity tests of the obtained isolates were conducted as described by Argyri et al (2013). The production of extracellular amylase and protease were tested using the agar well diffusion method (Cai et al, 2019). The antagonistic activities of isolates against the targeted fish pathogens (Vibrio harvey KR003733.1, V. ponticus KY295939.1, V. alginolyticus JX221045.1, and Streptococcus agalactiae MH071375) were studied by the nutrient broth medium agar well diffusion method (Bency et al, 2015). Tolerance to simulated gastrointestinal stress was evaluated as previously described (Charteris et al, 1998; Maragkoudakis et al, 2006). Autoaggregation between cell membranes and the interacting surface was assessed according to the method described by Del Re et al (2000). The cell hydrophobicity of the selected strains was measured according to a slightly modified method from Patel et al (2009), which the cell suspension and solvent were both decreased from 10 mL to 2 mL and the separating time was lengthened from 30 minutes to 60 minutes. Biofilm formation on the cell surfaces was assessed according to the method described by Guo et al (2016). 2.2 Identification of optimal putative probiotics The isolates were examined using phenotypic traits as reported by MacFaddin (1984). The morphological and biochemical characteristics of the selected probiotic

Journal Pre-proof isolates were tested based on Bergey's Manual of Systematic Bacteriology. All tests were performed at 30ºC for 48 h. The genetic identification was conducted using 16S rRNA sequencing. The obtained sequences were subjected to BLAST searches of the NCBI GenBank database as described by Altschul et al (1990). The phylogenetic tree was constructed by a neighbour-joining (NJ) method using MEGA software (Version 6.0) (Tamura et al, 2011). 2.3 Bacterial growth curves, antibiotic susceptibility and safety of the isolates Bacterial growth curves were measured using an automatic growth curve analyser (Bioscreen C MBR, Bioscreen, Finland). The isolates were cultured in a nutrient broth medium to an OD600≈0.8, and 20 μL of the bacterial culture and 20 μL sterile PBS (negative control) were each mixed with 180 μL of a nutrient broth medium and placed into a 96-well plate (Bioscreen, Finland, Honeycomb). The samples were cultured at 30℃ with shaking at 200 rpm. The bacterial densities were determined based on the OD600, and measured hourly for 48 h. Antibiotic susceptibility was determined by disk diffusion according to the guidelines of the Clinical and Laboratory Standards Institute (NCCLS, 2001). Susceptibility tests of the isolates against 36 antibiotics were determined by the disc diffusion method in a nutrient broth medium. Susceptibility to antimicrobials was measured after 24 h of incubation and measurement of the mean inhibition zone diameter. To determine the safety of selected probiotic strains, their virulence was examined by experimentally infecting healthy T. ovatus (5.84 g ± 1.41 g). The health

Journal Pre-proof status of T. ovatus was inspected by examination of behavioral signs (swimming and feeding responses) and observation of body surface (no wound and complete fins). Until to sampling, the fish did not experience antibiotic treatment or vaccinated and any physiological stress (Pérez et al, 2019). Thirty fishes were intraperitoneally (i.p.) inoculated (0.1 mL per fish) with the selected probiotic strain (approximately 1.0×108 CFU·mL-1). The same number of fishes was injected with the same amount of sterile PBS as the control group. The fish were monitored daily to detect any adverse clinical signs, and the mortality rate was recorded for 15 days after inoculation. 2.4 Evaluation of probiotic effects of A97 in diet for T. ovatus 2.4.1 Growth trial Two hundred and ten healthy juvenile T. ovatus (5.95 g ± 1.69 g) were randomly divided into two groups, each in triplicate. Fish fed with only the commercial feed served as the control (commercial diet + sterile PBS), while fish in the treatment group were fed an A97-supplemented diet (commercial diet + A97). For probiotic-supplemented diet preparation, strain A97 was first grown in a nutrient broth medium at 30℃ in a rotary shaker for 24 h. Bacterial cells were harvested by centrifugation, washed and re-suspended in sterile PBS before being added to the basal diet and air-dried at 26℃ for 24 h to obtain approximately 1 × 108 CFU·g−1 of feed. The supplemented feed was stored at 4℃ until use. The vitality of A97 in the supplemented diet was evaluated by plate counting on nutrient broth medium agar, and the results showed that the number of live bacteria decreased approximately 3% after each week of storage. Therefore, a new probiotic-supplemented diet was

Journal Pre-proof prepared weekly to guarantee the vitality of A97. The growth trial lasted eight weeks. At the end of the trial, growth performance was assessed in terms of weight gain (WG), specific growth rate (SGR) and feed efficiency (FE). The calculations were as follows (Liu et al, 2017): WG=Wt-W0; SGR=100 (lnWt - lnW0)/t; and FE= (Wt - W0) /FI, where Wt is the weight of fish at day t, W0 is the initial weight of fish, t is the duration of feeding (in days), and FI is the feed intake (g). 2.4.2 Immune status evaluation 2.4.2.1 Biochemical and molecular parameters assays Ten fishes were collected from each tank after 56 days of feeding and samples of serum and tissue were collected for analysis. Fish were anaesthetized with tricaine methanesulfonate (Sigma, St. Louis, MO, USA). The serum was collected by centrifugation for serum immune responses, and the heads, kidneys and intestines were excised for qRT-PCR following the method of Wei et al (2017). Serum alkaline phosphatase activity, acid phosphatase activity, lysozyme activity, total protein, catalase activity and superoxide dismutase activity were measured according to the manufacturer's instructions (Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu, China). Total RNA was extracted from all tissue samples using the Mini BEST Universal RNA Extraction Kit (TaKaRa, Dalian, China). The agarose gel (2.0%) electrophoresis and spectrophotometric (A260:280 nm ratio) analysis were used to assess RNA quality and quantity, respectively. Then, cDNA was synthesized using the Prime Script TMII1st Strand cDNA Synthesis Kit (Takara, Dalian, China). The qRT-PCR

Journal Pre-proof reactions were performed in an Eppendorf Mastercycler (Y229237G, Eppendorf, Germany) using the SYBR® Premix qRT-PCR Kit (Takara, Dalian, China), as described by Sun et al (2017). Beta-2-microglobulin (B2M) was selected as the housekeeping gene according to Sun et al (2017). The expression levels of TLR8 and TLR9 were analysed using primers TLR8F1/TLR8R1 and TLR9F1/TLR9R1, as described in previous publications (Table 3) (Wei et al, 2017; Sun et al, 2017). The experiment was independently performed three times. 2.4.2.3 Challenge tests At the end of 56 days, twenty fish in each tank (three tanks per group) were intraperitoneally (i.p.) inoculated (0.1 mL) with V. ponticus HAINUV01 at LD50 (1.75×102 CFU·g-1 fish) as described by Liu et al (2018). No feed was given to the fish during the challenge test. Mortality was monitored for 168 h after the challenge, and all dead and surviving T. ovatus were examined for bacteria to verify the presence of the pathogen. 2.4.2.4 Gut histology The mid-intestine tissues from the fish were fixed in paraformaldehyde (4%) solution, then dehydrated in ethanol, cleaned in toluene, equilibrated in xylene, and embedded in paraffin to form solid wax blocks. Then, the embedded intestine was sectioned with a rotary microtome at approximately 6 μm thickness and stained with haematoxylin and eosin. The tissue slices were stained with haematoxylin and eosin (H&E) (Martoja & Martoja-Pierson, 1967). Villus length, villus width and intestinal wall thickness (mucosa width) were measured using image analysis application

Journal Pre-proof software (Sigma Scan Pro5, SPSS INC) following Bullerwell et al (2016). 2.5 Statistical analysis All data were subjected to analysis of variance using SPSS 20.0 for Windows (SPSS Inc., 20.0, Chicago, IL, USA). Independent-samples T test was used to examine differences in growth performances, challenge tests, immune parameters and relative gene expression. Data throughout the manuscript are expressed as the means ± S.E. (standard error) with superscript letters indicating differences between groups. A significance level of P<0.05 was employed in all cases. 3. Results 3.1 Characterization of the host derived Bacillus pumilus A97 One potential T. ovatus derived probiotic, A97, was obtained out of 434 isolates (Fig. 1A) through the analysis of haemolysis, extracellular enzyme activities, antagonistic activity, tolerance to simulated gastrointestinal stress, autoaggregation, cell hydrophobicity and biofilm formation. A97 had the highest protease activity and the second highest amylase activity compared with the other isolates (Fig. 1B and Fig. 1C), and could excellently inhibit V. ponticus, V. harveyi, V. alginolyticus and S. agalactiae. Higher hydrophobicity with xylene (45.05%), chloroform (46.63%), ethyl acetate (45.38%), higher autoaggregation at 87.88% over 24 h, and more prominent biofilm formation (0.128) at OD570 were also observed with A97 compared with the other isolates (Fig. 1D). At pH 2 and pH 3, the viabilities of A97 after 4 h were 3.21% and 41.86%, respectively. A97 exhibited a higher survivability of 3.57% at pH 6.8 and 152.86% at pH 8.0, after 4 h of incubation (Fig. 1E).

Journal Pre-proof A97 had 99.1% homology to B. pumilus strain ATCC 27142 and to B. pumilus strain ATCC 7061 (Fig. 2A). The logarithmic phase lasted 4-20 h, and the stagnate phase lasted from 20 h to 36 h for A97 (Fig. 2B). A97 required Na+ ions for growing from 2% (w/v) NaCl to 8% (w/v) NaCl (Table 1). The A97 strain was negative for the methyl red test and positive for the Voges-Proskauer reaction. No hydrolytic activities were detected on the following: peptone, xylose, maltose, lactose, mannitol, arabinose and malonate. The A97 strain could not decompose Simmons citrate, phenylalanine, hydrothion or urea. However, the A97 strain commonly utilized carbon sources, namely, glucose, sucrose, amylum and gelatin. A negative response was obtained for the glucose aerogenesis test. No growth was obtained below 5ºC or beyond 50ºC. No pathological signs/disease symptoms or mortalities were induced by A97 through intraperitoneal (i.p.) injection of T. ovatus. A97 showed resistance to only 4 commonly used antibiotics out of 36 tested candidates, while showing high susceptibility to 29 antibiotics (Table 2). 3.2 Probiotic evaluation of dietary A97 in T. ovatus 3.2.1 Growth performance The weight gain, specific growth rate, feed efficiency and survival rate of T. ovatus fed an A97 diet were significantly higher compared to those of the control fish (P<0.05) (Fig. 3) 3.2.2 Antioxidant capacity and immunity Acid phosphatase activity, alkaline phosphatase activity, superoxide dismutase and catalase in fish serum of the treatment group were significantly lower than those

Journal Pre-proof of the control group (P<0.05, Fig. 4A, Fig. 4B, Fig. 4E and Fig. 4F), whereas the lysozyme activity (Fig. 4C) and the total protein (Fig. 4D) of fish fed an A97 diet were significantly higher than those of the fish fed the control diet (P<0.05). Intestinal TLR8 mRNA levels (Fig. 4G) and kidney TLR9 mRNA levels (Fig. 4H) significantly increased in T. ovatus fed A97 compared with the levels in fish fed the control diet (P<0.05). 3.2.3 Gut histology T. ovatus fed the A97 diet had significantly decreased mucosal widths compared to those in the control fish (Fig. 5) but had significantly increased villus lengths and villus widths when compared to the control fish (P<0.05). 3.2.4 Disease resistance test After being challenged with V. ponticus HAINUV01 for 168 h, the survival rates of T. ovatus fed the probiotic diet were significantly higher than those of the control fish (P<0.05) (Fig. 6), and the V. ponticus HAINUV01 could be re-isolated as single colonies from the spleens and livers of the moribund or dead fish. 4. Discussion Until now, probiotics isolated from fish intestines have mainly included Bacillus (Reda et al, 2018; Zhou et al, 2019), Lactobacillus (Mohammadian et al, 2019; Lee et al, 2017) and Pediococcus (Huang et al, 2014). Bacillus probiotics have been supplemented extensively in fish diets, especially in the past five years (Ratchanu et al, 2018; Kavitha et al, 2018; Ramesh et al, 2015); it not only improves digestive absorption (Liu et al, 2017; Fan et al, 2018; Zheng et al, 2019) but also inhibits the

Journal Pre-proof growth of pathogenic microorganisms (Zhou et al, 2019; Sugita et al, 1998; Wu et al, 2014). A great number of Bacillus strains have been shown to provide benefits to the hosts (Merrifield et al, 2010; Ringø et al, 2010), yet few of these strains originated in fish. In this study, in vitro experiments indicated that the strain B. pumilus A97 had the highest protease and amylase activities among the screened isolates. The strain A97 inhibited the growth of V. harvey, V. ponticus and S. agalactiae and V. alginolyticus. In addition, A97 had the ability to survive and grow at low pH and in high concentrations of bile conditions, as well as the ability to adhere to intestinal epithelial cells. Moreover, A97 had a higher sensitivity to antibiotics and caused no deaths to T. ovatus by i.p. injection; therefore, A97 was safe for the environment and for aquaculture animals (Lazado et al, 2015). Recent studies reported that B. pumilus has been applied to Epinephelus coioides (Yang et al, 2019), Oreochromis niloticus (Srisapoome & Areechon, 2017) and Pangasianodon hypophthalmus (Thy et al, 2017), but there was a lack of studies about B. pumilus in T. ovatus. The genus Bacillus has been widely used as a probiotic in aquaculture (Dawood, & Koshio, 2016; Nayak, 2010). Many studies have shown that Bacillus spp. can enhance growth performance and non-specific immunity in various species of fish, such as O. niloticus (Liu et al, 2017), Pangasius bocourti (Ratchanu et al, 2018), Carassius auratus (Yi et al, 2018), and so on. Probiotics with exoenzymatic activities can effectively improve the host growth performance, such as percent weight gain and feed efficiency (Liu et al, 2017). However, we cannot confirm whether the improve of growth performance was caused by exoenzymatic from probiotics or by the

Journal Pre-proof strengthened secretion from cells stimulated by probiotics in the mid-gut, or by a combination of the two factors (Lazado et al, 2015). The mechanism needs to be further elucidated. Zhang et al (2014) and Ratchanu et al (2018) indicated that dietary supplementation with the genus Bacillus can not only enhance growth but also improve disease resistance and immunity of aquatic animals. There is little research regarding dietary probiotics on T. ovatus; only Zhang et al (2014) reported that dietary administration of the probiotic B. subtilis (5.62×107 CFU·g-1) and the prebiotic fructooligosaccharide (0.2%) significantly improved the growth performance of T. ovatus (10.32±0.46 g) after 56 days, which the SGR was 2.21±0.03%, the FE was 1.47±0.03% and the survival rate was 90.56±2.78%. According to the results in this experiment, the strain B. pumilus A97 in WG (297.64±25.51%), FE (1.24±0.16%) and SGR (2.46±0.12%) of T. ovatus were all significantly higher than in the control group (P<0.05). Therefore, the fish growth could be improved significantly by using the dietary administration of B. pumilus A97 to T. ovatus. Serum parameters are frequently considered as health condition parameters of fish and are useful for determining the health status of the fish in the immune response to dietary supplements (Yue et al, 2015). Lysozyme is a cationic enzyme that attacks the peptidoglycan of bacterial cell walls and acts as a non-specific innate immunity molecule against the incursion of detrimental bacteria (Peixoto et al, 2018). Many researchers have shown that dietary usage of Bacillus spp. can promote the lysozyme activity in aquatic animals, yet it exerts no effects on the alkaline phosphatase activity and acid phosphatase activity in the aquatic animal (Liu et al,

Journal Pre-proof 2017; Ratchanu, et al, 2018). Similarly, in this study, among the three non-specific immune parameters, only the lysozyme activity of the B. pumilus A97 group significantly increased compared to the control group. However, the alkaline phosphatase activity and acid phosphatase activity of the B. pumilus A97 group were significantly lower than those of the control. The majority of acid phosphatase activity is situated in cell lysosomes. Increase of acid phosphatase activity was often the results of cell membrane lysis, in which acid phosphatase was released as responses cells to damage (Kong et al, 2012). A high alkaline phosphatase activity was viewed by the immune system as danger signals and can strongly induce inflammatory responses (Lallès, 2019). Therefore, relatively low levels of acid phosphatase and alkaline phosphatase activities might indicate a comparatively low level of cell damage and inflammatory status. As is known, the intestine is an important immune organ for defence against pathogens (Ma et al, 2018). Moreover, the decrease in superoxide dismutase and catalase in fish is possibly due to the reserving of superoxide anion levels or convertibility to singlet oxygen and hydroxyl radicals based on methyl catalysation to promote phagocytic activity, thus killing pathogenic strains (Ighodaro & Akinloye, 2018). Similarly, Liu et al (2012) reported that dietary Lac. plantarum also induced a decrease in superoxide dismutase activity after 4 weeks. Son et al (2009) also demonstrated that the superoxide dismutase activities were significantly decreased after treatment with Lac. plantarum for 4 weeks. Differences in superoxide dismutase activities as a result of probiotics might be related to the bacterial strain, dosage, and duration of administration (Ejtahed et al, 2012). The

Journal Pre-proof antioxidative effect of some probiotic strains is determined by their inhibition of ascorbate autoxidation, scavenging of free radicals, and metal ion chelation (Wang et al, 2006). The intestinal barrier serves as an important defense, but there are limited published reports available on the effects of probiotics on intestinal morphology of aquaculture species (Pirarat et al, 2008; Daniels et al, 2010; Lazado et al, 2014). The intestinal mucosa width, villus length, villus width in animals could be improved by probiotics. In present study, mucosa width, villus length, villus width was affected by dietary supplementation of B. pumilus A97. Pirarat et al (2008) exhibited that fed L. rhamnosus diet showed a significant increase in villus length compared to the control diet in O. niloticus. Similarly, Daniels et al. (2010) reported that the villus length and villus width in European lobster larvae and post-larvae receiving probiotic supplemented diets was observed significant increases. However, Sparus aurata fed B. subtillis indicated a significant reduction in villus length compared to fish fed the control diet (Cerezuela et al., 2012). Based on experimental results of intestinal histology and disease resistance test, pathogenic bacteria and endotoxins may be prevented from transferring into the body by A97 supplementation. Therefore, B. pumilus A97 might play an important role in protecting intestinal integrity and architecture. In addition to serum immunological indicators, the expression of immune genes also reflects the health level of the body. Pathogen recognition occurs in response to a broad array of conserved pathogen-associated molecular patterns (PAMPs) expressed

Journal Pre-proof by the pathogen (Meylan et al, 2006). Toll-like receptors (TLRs) are one group of pattern-recognizing receptors (PRRs) that have been identified in animals. To date, TLRs are well studied and are conserved from insects to mammals. TLR8 and TLR9 belong to a TLR family of intracellular TLRs involved in the recognition of microbial nucleic acids (Wei et al, 2017). For example, TLR8 recognizes bacterial and viral single-stranded RNA (ssRNA), while TLR9 recognizes unmethylated CpG DNA of viral or bacterial DNA (Merrifield & Ringo, 2014). In present study, with the dietary supplementation of B. pumilus A97, TLR8 mRNA levels in the intestines significantly increased, and TLR9 mRNA levels significantly increased in the kidneys. Therefore, the strain B. pumilus A97 can improve the disease resistance of juvenile golden pompano. In conclusion, the present study screened a promising probiotic B. pumilus A97 from the intestines of healthy T. ovatus based on multiple probiotic characteristics in vitro. Then, in vivo feeding experiments demonstrated that dietary supplementation of B. pumilus A97 at 1.0×108 CFU·g-1 could effectively enhance the growth, immune responses and disease resistance against V. ponticus in T. ovatus. Our results indicated that B. pumilus A97 possesses high potential to become an effective probiotic in T. ovatus aquaculture.

Journal Pre-proof References Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local aligment search tool. J. Mol. Biol. 215, 403-410. Andani, H.R.R., Tukmechi, A., Meshkini, S., Sheikhzadeh, N., 2012. Antagonistic activity of two potential probiotic bacteria from fish intestines and investigation of their effects on growth performance and immune response in rainbow trout (Oncorhynchus mykiss). J. Appl. Ichthyol. 28, 728-734. Argyri, A.A., Zoumpopoulou, G., Kimon, A.G., Karatzas, K.A., Tsakalidou, E., Nychas, G.J., Panagou, E., Tassou, C., 2013. Selection of potential probiotic lactic acid bacteria from fermented olives by in vitro tests. Food Microbiol. 33, 282-291. Beck, B.R., Kim, D., Jeon, J., Lee, S.M., Kim, H.K., Kim, O.J., Lee, J.I., Suh, B.S., Do, H.K., Lee, K.H., Holzapfel, W.H., Hwang, J.Y., Kwon, M.G., Song, S.K., 2015. The effects of combined dietary probiotics Lactococcus lactis BFE920 and Lactobacillus plantarum FGL0001 on innate immunity and disease resistance in olive flounder (Paralichthys olivaceus). Fish & Shellfish Immunology 42, 177-183. Bency, T., Ramesh, D., Ramkumar, S., Natarajaseenivasan, K., Anbarasu, K., 2015. Characterization of Bacillus spp. from the gastrointestinal tract of Labeo rohita towards to identify novel probiotics against fish pathogens. Appl. Biochem. Biotechnol. 175, 340-353. Bullerwell, C.N., Collins, S.A., Lall, S.P., Anderson, D.M., 2016. Growth

Journal Pre-proof performance, proximate and histological analysis of rainbow trout fed diets containing Camelina sativa seeds, meal (high-oil and solvent-extracted) and oil. Aquaculture 452, 342-350. Burridge, L., Weis, J.S., Cabello, F., Pizarro, J., Bostick, K., 2010. Chemical use in salmon aquaculture: A review of current practices and possible environmental effects. Aquaculture 306, 7-23. Cai, Y., Yuan, W., Wang, S.F., Guo, W.L., Li, A., Wu, Y, Chen, X., Ren, Z.L., Zhou, Y.C., 2019. In vitro screening of putative probiotics and their dual beneficial effects: To white shrimp (Litopenaeus vannamei) postlarvae and to the rearing water. Aquaculture 498, 61-71. Cerezuela, R., Guardiola, F.A., Meseguer, J., Esteban, M.Á., 2012. Enrichment of gilthead seabream (Sparus aurata L.) diet with microalgae: effects on the immune system. Fish Physiol. Biochem. 38, 1729–1739. Charteris, W.P., Kelly, P.M., Morelli, L., Collins, J.K., 1998. Development and application of an in vitro methodology to determine the transit tolerance of potentially probiotic Lactobacillus and Bifidobacterium species in the upper human gastrointestinal tract. J. Appl. Microbiol. 84 (5), 759-768. Cordero, H., Morcillo, P., Meseguer, J., Cuesta, A., Esteban, M.A., 2016. Effects of Shewanella putrefaciens on innate immunity and cytokine expression profile upon high stocking density of gilthead seabream specimens. Fish & Shellfish Immunology 51, 33-40. Daniels, C.L., Merrifield, D.L., Boothroyd, D.P., Davies, S.J., Factor, J.R., Arnold,

Journal Pre-proof K.E., 2010. Effect of dietary Bacillus spp. and mannan oligosaccharides (MOS) on European lobster (Homarus gammarus L.) larvae growth performance, gut morphology and gut microbiota. Aquaculture 304, 49–57. Daruosh, A.A., Elahe, S., Hojatollah, J., Mehdi, S., Mahsa, N.S., Angel, I.C.C., 2018. Efficacy of two commercial and indigenous probiotics, Bacillus subtilis and Bacillus licheniformis on growth performance, immuno-physiology and resistance response of juvenile white shrimp (Litopenaeus vannamei). Aquaculture 496, 43-49. Dawood, M.A.O., Koshio, S., 2016. Recent advances in the role of probiotics and prebiotics in carp aquaculture: a review. Aquaculture 454, 243-251. Del'Duca, A., Cesar, D.E., Diniz, C.G., Abreu, P.C., 2013. Evaluation of the presence and efficiency of potential probiotic bacteria in the gut of tilapia (Oreochromis niloticus) using the fluorescent in situ hybridization technique. Aquaculture 388– 391, 115-121. Del Re, B., Sgorbati, B., Miglioli, M., Palenzona, D., 2000. Adhesion, autoaggregation and hydrophobicity of 13 strains of Bifidobacteriumlongum. Lett. Appl. Microbiol. 31 (6), 438-442. Do Huu, H., Sang, H.M., Thanh Thuy, N.T., 2016. Dietary β-glucan improved growth performance, Vibrio counts, haematological parameters and stress resistance of pompano fish, Trachinotus ovatus Linnaeus, 1758, Fish & Shellfish Immunology 54, 402-410. Doan, H., Doolgindachbaporn, S., Suksri, A., 2016. Effect of Lactobacillus plantarum

Journal Pre-proof and Jerusalem artichoke (Helianthus tuberosus) on growth performance, immunity and disease resistance of Pangasius catfish (Pangasius bocourti, Sauvage 1880). Aquac. Nutr. 22, 444–456. Ejtahed, H.S., Mohtadi-Nia, J., Homayouni-Rad, A., Niafar, M., Asghari-Jafarabadi, M., Mofid, V., 2012. Probiotic yogurt improves antioxidant status in type 2 diabetic patients. Nutrition 28, 539-543. Fan, Y., Liu, L., Zhao, L., Wang, X., Wang, D., Huang, C., Zhang, J., Ji, C., Ma, Q., 2018. Influence of Bacillus subtilis ANSB060 on growth, digestive enzyme and aflatoxin residue in Yellow River carp fed diets contaminated with aflatoxin B1. Food and Chemical Toxicology 113, 108-114. Giri, S.S., Sukumaran, V., Oviya, M., 2013. Potential probiotic Lactobacillus plantarum VSG3 improves the growth, immunity, and disease resistance of tropical freshwater fish, Labeo rohita. Fish & Shellfish Immunology 34, 660-666. Guo, X., Chen, D., Peng, K., Cui, Z., Zhang, X., Li, S., Zhang, Y., 2016. Identification and characterization of Bacillus subtilis from grass carp (Ctenopharynodon idellus) for use as probiotic additives in aquatic feed. Fish & Shellfish Immunology 52, 74-84. Han, B., Long, W.Q., He, J.Y., Liu, Y.J., Si, Y.Q., Tian, L.X., 2015. Effects of dietary Bacillus licheniformison growth performance, immunological parameters, intestinal morphology and resistance of juvenile Nile tilapia (Oreochromis niloticus) to challenge infections. Fish & Shellfish Immunology 46, 225-231.

Journal Pre-proof Huang, J., Wu, Y., Chi, S., 2014. Dietary supplementation of Pediococcus pentosaceus enhances innate immunity, physiological health and resistance to Vibrio anguillarum in orange-spotted grouper (Epinephelus coioides). Fish & Shellfish Immunology 39, 196-205. Hoseinifar, S.H., Ringø, E., Shenavar, M.A., Esteban, M.A., 2016. Probiotic, prebiotic and synbiotic supplements in sturgeon aquaculture: a review. Rev. Aquac. 8, 89-102. Ighodaro, O.M., Akinloye, O.A., 2018. First line defence antioxidants-superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX): Their fundamental role in the entire antioxidant defence grid. Alexandria Journal of Medicine. 54 (4), 287-293. Kavitha, M., Raja, M., Perumal, P., 2018. Evaluation of probiotic potential of Bacillus spp. isolated from the digestive tract of freshwater fish Labeo calbasu (Hamilton, 1822). Aquaculture Reports 11, 59-69. Kong, X.H., Wang, S.P., Jiang, H.X., Nie, G.X., Li, X.J., 2012. Responses of acid/alkaline phosphatase, lysozyme, and catalase activities and lipid peroxidation to mercury exposure during the embryonic development of goldfish Carassius auratus. Aquatic Toxicology 120–121, 119-125. Kuebutornye, F.K.A., Abarike, E.D., Lu, Y., 2019. A review on the application of Bacillus as probiotics in aquaculture. Fish & Shellfish Immunology 87, 820-828. Lazado, C.C., Cai, P., C.M.A., 2014. Atlantic cod in the dynamic probiotics research in aquaculture. Aquaculture 424–425, 53–62.

Journal Pre-proof Lazado, C.C., Caipang, C.M.A., Estante, E.G., 2015. Prospects of host-associated microorganisms in fish and penaeids as probiotics with immunomodulatory functions. Fish & Shellfish Immunology 45, 2-12. Lallès, J.P., 2019. Biology, environmental and nutritional modulation of skin mucus alkaline phosphatase in fish: A review. Fish & Shellfish Immunology 89, 179-186. Lee, S., Katya, K., Park, Y., Won, S., Seong, M., Hamidoghli, A., Bai, S.C., 2017. Comparative evaluation of dietary probiotics Bacillus subtilis WB60 and Lactobacillus plantarum KCTC3928 on the growth performance, immunological parameters, gut morphology and disease resistance in Japanese eel, Anguilla japonica. Fish & Shellfish Immunology 61, 201-210. Liu, C,H., Chiu, C,H., Wang, S,W., Cheng, W., 2012. Dietary administration of the probiotic, Bacillus subtilis E20, enhances the growth, innate immune responses, and disease resistance of the grouper, Epinephelus coioides. Fish & Shellfish Immunology 33 (4) 699-706. Liu, H., Wang, S., Cai, Y., Guo, X., Cao, Z., Zhang, Y., Liu, S., Yuan, W., Zhu, W., Zheng, Y., Xie, Z., Guo, W., Zhou, Y., 2017. Dietary administration of Bacillus subtilis HAINUP40 enhances growth, digestive enzyme activities, innate immune responses and disease resistance of tilapia, Oreochromis niloticus. Fish & Shellfish Immunology 60, 326-333. Liu, S., Li, E., Cai, Y., Wang, S., Ren, Z., Li, Q., Guo, W., Wu, Y., Zhou, Y., 2018. Isolation, identification and pathogenicity characterization of Vibrio ponticus

Journal Pre-proof from the golden pompano Trachinotus ovatus. Aquaculture 496, 285-290. Ma, Q., Li, L., Le, J., Lu, D., Qiao, F., Zhang, M., Du, Z., Li, D., 2018. Dietary microencapsulated oil improves immune function and intestinal health in Nile tilapia fed with high-fat diet. Aquaculture 496, 19-29. MacFaddin, J.F., 1984. Biochemical Tests for Identification of Medical Bacteria. 2nd Ed, Waverly Press Inc., Baltimore, MD. Martoja, R., Martoja-Pierson, M., 1967. Initiation aux techniques de l'histologie animale. Elsevier Masson. 345 p. Maragkoudakis, P.A., Zoumpopoulou, G., Miaris, C., Kalantzopoulos, G., Pot ,B., Tsakalidou, E., 2006. Probiotic potential of Lactobacillus strains isolated from dairy products. Int. Dairy J. 16 (3), 189-199. Merrifield, D.L., Dimitroglou, A., Foey, A., Davies, S., Baker, R.T.M., Bøgwald, J., Castex, M., Ringø, E., 2010. The current status and future focus of probiotic and prebiotic applications for salmonids. Aquaculture 302, 1-18. Merrifield D.L., Ringo, E., 2014. Aquaculture Nutrition: Gut Health, Probiotics and Prebiotics. Aquaculture Nutritio. Meylan, E., Tschopp, J., Karin, M., 2006. Intracellular pattern recognition receptors in the host response. Nature 442, 39-44. Mohammadian, T., Nasirpour, M., Tabandeh, M.R., Heidary, A.A., Ghanei-Motlagh, R., Hosseini, S.S., 2019. Administrations of autochthonous probiotics altered juvenile rainbow trout Oncorhynchus mykiss health status, growth performance and resistance to Lactococcus garvieae, an experimental infection. Fish &

Journal Pre-proof Shellfish Immunology 86, 269-279. National Committee for Clinical Laboratory Standards. Performance standard for antimicrobial susceptibility testing, Document M100-S11, Wayne, PA: NCCLS. 2001. Nayak, S.K., 2010. Probiotics and immunity: a fish perspective. Fish & shellfish Immunology 29, 2-14. Pirarat, N., Ponpornpisit, A., Rodkhum, C., Chansue, N., 2008. Lactobacillus rhamnosus GG, a potential human-derived probiotic candidate for tilapia (Oreochromis niloticus) culture. In: Proceedings The 15th Congress of FAVA, 27–30 October. Bangkok, Thailand. pp. 141–142. Patel, A.K., Ahire, J.J., Pawar, S.P., Chaudhari, B.L., Chincholkar, S.B., 2009. Comparative accounts of probiotic characteristics of Bacillus spp. isolated from food wastes. Food Research International 42, 505-510. Pérez, T., Alba, C., Aparicio, M., Andrés, J., Quiteria, J.A.R.S, Rodríguez, J.M., Gibello, A., 2019. Abundant bacteria in the proximal and distal intestine of healthy Siberian sturgeons (Acipenser baerii). Aquaculture 506, 325-336. Peixoto, M. J., Domingues, A., Batista, S., Gonçalvesac, J.F.M., Gomesd, A.M., Cunhaef, S., Valenteac, L.M.P., Costasac, B., Ozórioa, R.O.A., 2018. Physiopathological responses of sole (Solea senegalensis) subjected to bacterial infection and handling stress after probiotic treatment with autochthonous bacteria. Fish & Shellfish Immunology 83, 348-358. Ramesh, D., Vinothkanna, A., Rai, A.K., Vignesh, V.S., 2015. Isolation of potential

Journal Pre-proof probiotic Bacillus spp. and assessment of their subcellular components to induce immune responses in Labeo rohita against Aeromonas hydrophila. Fish & Shellfish Immunology 45, 268-276. Ratchanu, M., Kulwade, K., Sompong, D., Takahiro, N., Miki, N., Kenji, S., Saowanit, T., 2018. Evaluation of probiotic Bacillus aerius B81e isolated from healthy hybrid catfish on growth, disease resistance and innate immunity of Pla-mong Pangasius bocourti. Fish & Shellfish Immunology 73, 1-10. Rattanavichai, W., Chen, Y.N., Chang, C.C., Cheng, W., 2015. The effect of banana (Musa acuminata) peels hot-water extract on the immunity and resistance of giant freshwater prawn, Macrobrachium rosenbergii via dietary administration for a long term: activity and gene transcription. Fish & Shellfish Immunology 46, 378-386. Reda, R.M., El-Hady, M.A., Selim, K.M., El-Sayed, HM, 2018. Comparative study of three predominant gut Bacillus strains and a commercial, B. amyloliquefaciens, as probiotics on the performance of, Clarias gariepinus. Fish & Shellfish Immunology 80, 416-425. Ringø, E., Olsen, R.E., Gifstad, TØ., Dalmo, R.A., Amlund, H., Hemre, G.I., Bakk, A.M., 2010. Prebiotics in aquaculture: a review. Aquacult Nutr. 16, 117-36. Son, V,M., Chang, C,C., Wu, M,C., Guu, Y,K., Chiu, C,H., Cheng, W., 2009. Dietary administration of the probiotic, Lactobacillus plantarum, enhanced the growth, innate immune responses, and disease resistance of the grouper Epinephelus coioides. Fish & Shellfish Immunology 26 (6) 91-698.

Journal Pre-proof Srisapoome, P., Areechon, N., 2017. Efficacy of viable Bacillus pumilus isolated from farmed fish on immune responses and increased disease resistance in Nile tilapia (Oreochromis niloticus): Laboratory and on-farm trials. Fish & Shellfish Immunology 67, 199-210. Sugita, H., Hirose, Y., Matsuo, N., Deguchi, Y., 1998. Production of antibacterial substances by Bacillus sp. strain NM 12, an intestinal bacterium of Japanese coastal fish. Aquaculture 165, 269-280. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kuma,r S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Tan, X., Sun, Z., Huang, Z., Zhou, C., Lin, H., Tan, L., Xun, P., Huang, Q., 2017. Effects of dietary hawthorn extract on growth performance, immune responses, growth and immune-related genes expression of juvenile golden pompano (Trachinotus ovatus) and its susceptibility to Vibrio harveyi infection. Fish & Shellfish Immunology 70, 656-664. Thy, H.T.T., Tri, N.N., Quy, O.M., Fotedar, R., Kannika, K., Unajak, S., Areechon, N., 2017. Effects of the dietary supplementation of mixed probiotic spores of Bacillus amyloliquefaciens 54A, and Bacillus pumilus 47B on growth, innate immunity and stress responses of striped catfish (Pangasianodon hypophthalmus). Fish & Shellfish Immunology 60, 91-399. Tovar-Ramirez, D., Mazurais, D., Gatesoupe, J.F., Quazuguel, P., Cahu, C.L.,

Journal Pre-proof Zambonino-Infante, J.L., 2010. Dietary probiotic live yeast modulates antioxidant enzyme activities and gene expression of sea bass (Dicentrarchus labrax) larvae. Aquaculture 300, 142-147. Tu, Z., Li, H., Xiang, Z., Sun, Y., Zhou, Y., 2017. Complete genome sequence and comparative genomics of the golden pompano (Trachinotus ovatus) pathogen, Vibrio harveyi strain QT520. Peerj 5, e4127. Tutman, P., Glavic, N., Kožul, V., Skaramuca, B., glamuzina, B., 2004. Preliminary information on feeding and growth of pompano, Trachinotus Ovatus (Linnaeus, 1758) (Pisces; Carangidae) in Captivity. Aquaculture International 12, 387-393. Wang, J., Gatlin III, D.M., Li, L., Yun, W., Jin, N., Lin, H., Zhou, C., Huang, Z., Yu, W., Guo, Y., 2019. Dietary chromium polynicotinate improves growth performance and feed utilization of juvenile golden pompano (Trachinotus ovatus) with starch as the carbohydrate. Aquaculture 505, 405-411. Wang, R., Feng, J., Su, Y., Yu, L., Wang, J., 2013. Studies on the isolation of Photobacterium damselae subsp. piscicida from diseased golden pompano (Trachinotus ovatus Linnaeus) and antibacterial agents sensitivity. Veterinary Microbiology 162, 957-963. Wei, Y., Hu, S., Sun, B., Zhang, Q., Qiao, G., Wang, Z., Shao, R., Huang, G., Qi, Z., 2017. Molecular cloning and expression analysis of toll-like receptor genes (TLR7, TLR8 and TLR9) of golden pompano (Trachinotus ovatus). Fish & Shellfish Immunology 63, 270-276. Wu, H., Sun, L., Li, C., Li, Z., Zhang, Z., Wen, X., Hu, Z., Zhang, Y., Li, S., 2014.

Journal Pre-proof Enhancement of the immune response and protection against Vibrio parahaemolyticus by indigenous probiotic Bacillus strains in mud crab (Scylla paramamosain). Fish & Shellfish Immunology 41, 156-162. Wang, Y., Yu, R., Chou, C., 2006. Antioxidative activities of soymilk fermented with lactic acid bacteria and bifidobacteria. Food Microbiol. 23, 128-135. Sun, Y., Chen, X., Xu, Y., Liu, Q., Jiang, X., Wang, S., Guo, W., Zhou, Y., 2017. Thymosin β4 is involved in the antimicrobial immune response of Golden pompano, Trachinotus ovatus. Fish & Shellfish Immunology 69, 90-98. Yang, H., Sun, Y., Hu, X., Ye, J., Lu, K., Hu, L., Zhang, J., 2019. Bacillus pumilus SE5 originated PG and LTA tuned the intestinal TLRs/MyD88 signaling and microbiota in grouper (Epinephelus coioides). Fish & Shellfish Immunology 88, 266-271. Yi, Y., Zhang, Z., Zhao, F., Liu, H., Yu, L., Zha, J., Wang, G., 2018. Probiotic potential of Bacillus velezensis JW: Antimicrobial activity against fish pathogenic bacteria and immune enhancement effects on Carassius auratus. Fish & Shellfish Immunology 78, 322-330. Yue, Y., Zou, Z., Zhu, J., Li, D., Xiao, W., Han, J., Yang, H., 2015. Effects of dietary arginine on growth performance, feed utilization, haematological parameters and nonspecific immune responses of juvenile Nile tilapia (Oreochromis niloticus L.). Aquac. Res. 46, 1801-1809. Zhang, Q., Yu, H., Tong, T., Tong, W., Dong, L., Xu, M., Wang, Z., 2014. Dietary supplementation of Bacillus subtilis and fructooligosaccharide enhance the

Journal Pre-proof growth, non-specific immunity of juvenile ovate pompano, Trachinotus ovatus and its disease resistance against Vibrio vulnificus. Fish & Shellfish Immunology 38, 7-14. Zheng, C., Cai, X, Huang, M., Mkingule, I., Sun, C., Qian, S., Wu, Z., Han, B., Fei, H., 2019. Effect of biological additives on Japanese eel (Anguilla japonica) growth performance, digestive enzymes activity and immunology. Fish & Shellfish Immunology 84, 704-710. Zhou, C., Lin, H., Huang, Z., Wang, J., Wang, Y., Yu, W., 2015. Effects of dietary soybean isoflavones on non-specific immune responses and hepatic antioxidant abilities and mRNA expression of two heat shock proteins (HSPs) in juvenile golden pompano Trachinotus ovatus under pH stress. Fish & Shellfish Immunology 47, 1043-1053. Zhou, S., Song, D., Zhou, X., Mao, X., Zhou, X., Wang, S., Wei, J., Huang, Y., Wang, W., Xiao, S.M., Qin, Q., 2019. Characterization of Bacillus subtilis from gastrointestinal tract of hybrid Hulong grouper (Epinephelus fuscoguttatus × E. lanceolatus) and its effects as probiotic additives. Fish & Shellfish Immunology 84, 1115-1124.

Journal Pre-proof Acknowledgements This study was funded by the National Natural Science Foundation of China (No. 31860739 and No. 31560725). The authors are also grateful to Jiaqing Tang, Qiming Li, Youfei Xiong, Pingjing Chen, He Liu and Fangzhen Fu.

Journal Pre-proof Figure legends Figure 1 Evaluation of putative probiotics A97 in vitro. A) The result of haemolytic, enzyme production and antagonistic tests for the 434 isolates. B) The protease and amylase activities of putative probiotics A97. C) The antagonistic activity of A97 against pathogens (V. harvey KR003733.1, V. ponticus KY295939.1, V. alginolyticus JX221045.1, and S. agalactiae MH071375). D) The adhesive ability of A97, including autoaggregation, cell hydrophobicity and biofilm formation. Xyl is xylene, Chl is chloroform, and Eth is ethyl acetate. The right Y axis is the coordinate axis for biofilm formation. E) Tolerance of A97 to simulated gastric fluid (pH 2.0 and 3.0) and to simulated intestinal fluid (pH 6.8 and 8.0) for 2 and 4 h. Figure 2 A) Neighbour-joining phylogenetic tree showing the positions of A97, B. pumilus ATCC 27142 and B. pumilus ATCC 7061 among the related taxa based on 16S rRNA secondary structure information. Bootstrap values (based on 1,000 replications). B) The bacterial growth curve of B. pumilus A97, measured hourly for 50 h (n = 6). Each bar represents the mean value with the standard error (S.E.). Figure 3 Growth performance of T. ovatus fed with or without a probiotic B. pumilus A97 supplemented diet at the end of 56 days of the feeding trial. A) weight gain rate, B) specific growth rate, C) feed efficiency and D) survival rate. Each bar represents the mean value with the standard error (S.E.). (*) indicates significant differences （P<0.05）relative to the control. Figure 4 Immune responses of T. ovatus after being administered B. pumilus A97 for 56 days. A) acid phosphatase, B) alkaline phosphatase, C) lysozyme activities, D)

Journal Pre-proof total protein, E) superoxide dismutase and F) catalase activities. Relative expression of G) TLR8 in the intestines and H) TLR9 in the kidneys of golden pompano fed with or without the probiotic B. pumilus A97 (1.0×108 CFU·g-1) for 56 days. Values are presented as the mean ± S.E., bars with asterisk (*) are significantly different (P<0.05). Figure 5 Light microscopy of the midgut morphology of juvenile golden pompano fed with or without probiotic B. pumilus A97 (1.0×108 CFU·g-1) for 56 days. A) Intestine histological section of control group, 100×, scale bar: 100 μm. B) Intestine histological section of A97 group, 100×, scale bar: 100 μm. C) Intestine histological section of control group, 200×, scale bar: 50 μm. D) Intestine histological section of A97 group, 200×, scale bar: 50 μm. E) Histological measurement of midgut samples of juvenile T. ovatus fed experimental diets supplemented with A97 for 56 days (n=6). Values are presented as the mean ± S.E., asterisks (*) indicate the significant differences (P<0.05). Figure 6 The cumulative survival rates of T. ovatus injected with V. ponticus HAINUV01 and PBS (n=3) with values are presented as the mean ± S.E.: the cumulative mortalities of T. ovatus injected with the V. ponticus HAINUV01 at LD50 (1.75×102 CFU·g-1 fish) for 168 h. After the pathogenicity test, the survival rate of A97 groups was 59.65%, compared with 23.68% for the control groups.

Journal Pre-proof Table 1 Physiological and biochemical characteristics of A97 (n=3) Physiobiochemical indicator

A97

B. pumilus

Physiobiochemical indicator

A97

B. pumilus

Peptone

-

-

Urea

-

-

Simmons Citrate

-

-

Glucose

⊕

⊕

Phenylalanine

-

-

2% NaCl

+

+

Semi-Solid Agar

-

-

4% NaCl

+

+

Hydrothion

-

-

7% NaCl

+

+

Xylose

-

-

10% NaCl

+

+

Maltose

-

-

Malonate

-

-

Lactose

-

-

Amylum

+

+

Mannitol

-

-

Gelatin

+

+

Sucrose

+

+

Voges-Proskauer

+

+

Arabinose

-

-

Methyl Red Test

-

-

+, all strains tested positive; –, all strains tested negative; ⊕: all strains produced acid without gas.

Journal Pre-proof Table 2 Susceptibility of A97 to 36 antibiotics (n=3). Zone Suscepti Antibiotic diameters Antibiotic bility (mm) Bacitracin 8.07±0.21 R Augmentin Aztreonam 8.06±0.24 R Erythrocin Azithromycin Polymyxin B 14.64±0.56 R Oxacillin Midecamycin 17.55±0.35 R Streptomycin Nalidixic acid 12.88±0.83 I Rifampicin Mezlocillin 19.35±0.45 I Ampicillin Penicillin 11.32±0.48 I Tetracycline Trimethoprim 26.61±0.61 S Chloramphenicol 31.63±0.35 Cotrimoxazole S Ciprofloxacin 28.39±0.44 S Furazolidone Ofloxacin Cefepime 31.48±0.37 S Neomycin Cefotaxime 25.92±0.31 S Kanamycin Azlocillin 23.97±0.72 S Tobramycin Piperacillin 23.61±0.77 S Gentamicin Florfenicol 26.87±0.08 S Vancomycin Ceftriaxone 20.09±0.32 S Enrofloxacin 30±0.80 S Cefradine Ofloxacin Ceftazidime 29.52±0.35 S

Zone diameters (mm) 27.84±0.48 28.04±0.64 22.59±0.34 25.68±0.67 25.59±0.50 22.54±0.42 18.52±0.32 29.25±0.14 22.8±0.23 19.76±0.13 26.25±0.25 32.5±0.53 22.74±0.09 26.88±0.51 30.41±0.36 31.04±0.54 37.08±0.39 24.5±0.58

Suscepti bility S S S S S S S S S S S S S S S S S S

Note: R is resistant, S is sensitive, and I is intermediate. Susceptibility criteria are those published in NCCLS (2001) tables.

Journal Pre-proof Table 3 The information of primer for qPCR in this study Primer name

Sequence（5' −3'）

TLR9-F1

GTGGTATTGCTTACAGGTGCTTT

TLR9-R1

CTCCAGATTCACAATTAACTCATTG

TLR8-F1

TGGGTGATGAGAAATCTGCG

TLR8-R1

GCCTCTGTTAAGACAAAAAGGG

B2M-F

AAGTCAGTCCACCCAAGGTTCA

B2M-R

GGGATTTCCATTCCGTTCTTCATG

Primers were adopted from Wei et al (2017) and Sun et al (2017) as designed in this study;

TLR8,

Toll-like

beta-2-microglobulin.

receptor

8;

TLR9,

Toll-like

receptor

9;

B2M,

Journal Pre-proof

Journal Pre-proof

Journal Pre-proof

Journal Pre-proof

Journal Pre-proof

Journal Pre-proof

Journal Pre-proof

Dear editor, We would like to submit the enclosed manuscript entitled “Beneficial effects of a host gut-derived probiotic, Bacillus pumilus, on the growth, non-specific immune response and disease resistance of juvenile golden pompano, Trachinotus ovatus”, the highlights are listed as following: 1. A potential probiotic Bacillus pumilus A97 was screened out of 434 isolates from the intestines of healthy Trachinotus ovatus. 2. A97 exhibited good probiotic properties in vitro. 3. Dietary supplementation of A97 significantly improved the weight gain, specific growth rate, non-specific immune response and disease resistance of T. ovatus.

Thank you and best regards. Yours sincerely, Corresponding author Name: Shifeng Wang E-mail: shifeng_15@163. com. 2019-5-10