Effects of stocking density on the growth performance, serum biochemistry, muscle composition and HSP70 gene expression of juvenile golden pompano Trachinotus ovatus (Linnaeus, 1758)

Aquaculture 518 (2020) 734841

Contents lists available at ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aquaculture

Effects of stocking density on the growth performance, serum biochemistry, muscle composition and HSP70 gene expression of juvenile golden pompano Trachinotus ovatus(Linnaeus, 1758)

T

Quan Yanga,b, Liang Guob,c, Bao-Suo Liub,c, Hua-Yang Guob,c, Ke-Cheng Zhub,c, Nan Zhangb,c, ⁎ Shi-Gui Jiangb,c,d, Dian-Chang Zhangb,c,d, a

National Demonstration Center for Experimental Fisheries Science Education, Shanghai Ocean University, 201306 Shanghai, China Key Laboratory of South China Sea Fishery Resources Exploitation and Utilization, Ministry of Agriculture and Rural Affairs, South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, 510300 Guangzhou, Guangdong Province, China c Guangdong Provincial Engineer Technology Research Center of Marine Biological Seed Industry, Guangzhou, Guangdong Province, China d Guangdong Provincial Key Laboratory of Fishery Ecology and Environment, Guangzhou, Guangdong Province, China b

A R T I C LE I N FO

A B S T R A C T

Keywords: Trachinotus ovatus Stocking density Growth Biochemistry Muscle quality HSP70

Golden pompano (Trachinotus ovatus) is one of the most important cultured marine fish in Southeast Asia. Stocking density affects the growth performance and welfare of fish in aquaculture. A 70-day rearing experiment was performed to evaluate the effect of different stocking densities on the growth performance, feed conversion ratio, serum biochemistry, muscle quality, antioxidant capacity and HSP70 mRNA expression of juvenile golden pompano cultured in off-shore sea cages. The experimental design was completely randomized using three replications with three treatments: low (100 fish/m3), medium (200 fish/m3), and high (300 fish/m3) stocking densities. Fish growth decreased significantly, and the feed conversion ratio increased significantly with increasing stocking density (P < .05). The serum glucose concentration increased significantly (P < .05), and the total protein, total triglyceride and total cholesterol concentrations were significantly reduced with increasing stocking density (P < .05). High stocking density led to elevated serum cortisol levels and decreased thyroxine levels. There was a significant decrease in the muscular crude fat content with increasing stocking density (P < .05), while the moisture, ash and protein contents did not significantly differ among the groups (P > .05). In this experiment, superoxide dismutase, glutamine transaminase and total antioxidant capacity increased significantly with increasing stocking density (P < .05). The expression levels of heat shock protein 70 were significantly up-regulated in the liver, kidney and brain as stocking density increased (P < .05); however, there was no significant difference in the spleen (P > .05). Overall, high stocking density was a chronic stressor in this experiment and had a negative effect on the growth, feed conversion ratio and animal welfare of T. ovatus.

1. Introduction The growth and physiological performance of farmed fish are affected by various environmental factors to varying degrees in aquaculture (Lisboa et al., 2015; Imsland et al., 2017; Refaey et al., 2018). Stocking density, an important environmental factor, affects fish growth and welfare (North et al., 2006; Costa et al., 2017). The negative effects of high stocking density on the growth performance of fish, such as juvenile turbot, Scophthalmus maximus (Jia et al., 2016b); channel catfish, Ictalurus punctatus (Refaey et al., 2018), and juvenile Chinese

sturgeon, Acipenser sinensis (Long et al., 2019) have been reported. Studies have also shown that stocking density has no direct effect on fish growth (Rafatnezhad et al., 2008; Andrade et al., 2015). However, relevant studies have shown that high stocking density has a positive impact on the growth performance of some fish species, such as juvenile mulloway, Argyrosomus japonicus (Pirozzi et al., 2009) and meagre, Argyrosomus regius (Millán-Cubillo et al., 2016). There are differences in the effects of stocking densities on different species of fish and even on different growth stages of the same fish. High stocking density is considered a chronic stressor in aquaculture

⁎ Corresponding author at: Key Laboratory of South China Sea Fishery Resources Exploitation and Utilization, Ministry of Agriculture and Rural Affairs, South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, 510300 Guangzhou, Guangdong Province, China. E-mail address: [email protected] (D.-C. Zhang).

https://doi.org/10.1016/j.aquaculture.2019.734841 Received 27 July 2019; Received in revised form 6 December 2019; Accepted 8 December 2019 Available online 09 December 2019 0044-8486/ © 2019 Published by Elsevier B.V.

Aquaculture 518 (2020) 734841

Q. Yang, et al.

Therefore, the purpose of this experiment was to investigate the effects of different stocking densities on the growth performance, serum biochemistry, muscle composition and HSP70 mRNA expression of juvenile golden pompano, T. ovatus, reared in cages in an inner Harbour for 70 days.

(Tort et al., 2004; Zahedi et al., 2019). During chronic stress induced by high stocking densities, the hypothalamic-pituitary-kidney (HPI) axis plays an important role, and this axis can increase serum cortisol levels (Barton, 2002; Ellis et al., 2002; Long et al., 2019). Cortisol plays an essential role in the maintenance of growth, energy balance and immunity regulation when teleost fish are stressed (Hori et al., 2010). Therefore, some scholars often use plasma or serum cortisol concentrations as indicators of the degree of stress in teleost fish (Wendelaar Bonga, 1997; Fatima et al., 2018). Thyroid hormones can cooperate with other hormones to promote the growth of fish (Power et al., 2001). Walter et al. (2012) showed that elevated cortisol levels under crowding stress could initiate a negative feedback mechanism in the interrenal axis, thereby reducing the release of thyroxine. Fatima et al. (2018) suggested that the inhibition of fish growth under crowding stress may be associated with decreased thyroxine concentrations. Serum metabolic indexes, including glucose, total protein, total triglyceride and total cholesterol of fish cultured under high stocking density also changed correspondingly in response to stress (Suárez et al., 2015; Long et al., 2019). Free radicals and reactive oxygen are produced in the body under chronic stress, and to avoid tissue damage, the body produces key enzymatic antioxidants to protect the system (Liu et al., 2018). Antioxidant enzymes include superoxide dismutase, which can remove the peroxide anion radicals produced by the body's metabolism and prevent biomolecular damage; catalase, which reduces H2O2; and glutathione peroxidase, which converts glutathione to an oxidized form to detoxify H2O2 and peroxides (Hart et al., 1988; Halliwell and Gutteridge, 2007; Trenzado et al., 2009). Oxidative stress occurs in the body when there is an imbalance between the reactive oxygen species content and the antioxidant enzyme activity (Mittler, 2002). This is especially important in aquaculture, where oxidative damage to fish tissue not only affects fish welfare but also affects the quality of the product (Andrade et al., 2015). Fish can provide high-quality protein and essential fat to humans, and fish proteins account for approximately 17% of the animal protein intake in the world's population (FAO, 2016). The decrease in the protein and fat contents in the muscle affects the quality of fish, thus reducing the economic value. High stocking density puts fish under chronic stress in aquaculture (Zahedi et al., 2019), affecting fat and protein metabolism in the muscle (Costas et al., 2008; Qi et al., 2016). Heat shock proteins (HSPs), also known as stress proteins, are a highly conserved family of cellular proteins that act as “molecular partners” in all organisms and play an important role in fish stress (Roberts et al., 2010; Qiang et al., 2015; Zahedi et al., 2019). According to the size of the protein, the HSP family is divided into five categories: HSP100, HSP90, HSP70, HSP60 and small molecule heat shock proteins (Morimoto et al., 1992; Aksakal et al., 2011). Among them, HSP70 is one of the most abundant stress proteins in the HSP family; it is widely distributed in organisms, plays the role of a “guardian”, functions as an immune, an apoptotic, an antioxidant and a molecular chaperone and participates in and regulates protein folding modifications (Gething and Sambrook, 1992; Morimoto et al., 1992; Kiang and Tsokos, 1998). Sanders (1993) noted out that HSPs may act as biomarkers of environmental stress in aquatic organisms. T. ovatus, belonging to Trachinotus, Carangidae and Perciformes, is widely distributed in tropical and subtropical waters of Southeast Asia and the Mediterranean (Sun et al., 2014). Because of its fast growth and flavourful meat, T. ovatus has become one of the most important cultured marine species in southern China (Liang et al., 2018). The artificial cage culturing of T. ovatus has an earlier history that began in the 1990s, while pond culturing began in 2004 (Sun et al., 2014). Some scholars have studied the effect of stocking density on T. ovatus cultured in cages, mainly focusing on the growth performance, feed coefficient and economic value (Gu and Zhou, 2009; Wang et al., 2017). However, to our knowledge, no studies have reported the effects of chronic stress from stocking density on the serum biochemistry, muscle composition and stress-related gene expression of juvenile golden pompano.

2. Materials and methods 2.1. Fish, experimental design and sampling Juvenile golden pompano, T. ovatus, were obtained from the Tropical Fisheries Research and Development Centre, South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Lingshui, China, in July 2018. The juvenile T. ovatus fish were kept for 1 week before the experiment to adapt to the aquaculture environment and were reared in off-shore sea cage (4 m × 4 m × 4 m) in Xincun Town, Lingshui County, China. After adaptation, experimental fish (body weight: 9.75 ± 0.11 g) were randomly distributed into three stocking densities, with 100, 200 and 300 fish per sea cage (1 m × 1 m × 1 m), which were designated low density (LD), medium density (MD) and high density (HD), respectively. There were three replicates for each stocking density. During adaptation and the experimental period, experimental fish were fed a commercial diet (Hainan Hengxing Feed Industry Co., Ltd., Hainan, China; crude protein > 37.0%, crude fat > 7.0%) twice daily (07:00 and 17:00) to apparent satiation. The experiment lasted for 10 weeks. Experimental cages were cleaned once a week. The number and weight of dead fish and the food intake in each cage was recorded every day. Dissolved oxygen (DO), pH and temperature were measured every day by an instrument (HACH30d, Loveland, Colorado, USA). During the experiment, the temperature range, dissolved oxygen level and pH range were 28–31 °C, > 5 mg/L, and 7.4–8.1, respectively. At the end of the experiment, fish were fasted for one day, and were anaesthetized with 100 mg/L eugenol (Shanghai Medical Instruments Co., Ltd., Shanghai, China) (Liu et al., 2019). Blood samples were taken from the caudal vein of fish (n = 9 per cage) randomly selected from each cage. The fish were anaesthetized, and samples were collected in a 1.5 mL centrifuge tube using a syringe (2.0 mL). The samples were allowed to at room temperature for 30 min. After standing, the blood samples were centrifuged at 3000 ×g at 4 °C for 15 min. After centrifugation, the serum was transferred to a cryotube (2.0 mL). Serum samples were cryopreserved in liquid nitrogen and subsequently stored at −80 °C until the serum biochemical indexes were detected. The fish liver, spleen, kidney and brain were collected (n = 4 per cage) and frozen in liquid nitrogen and stored at −80 °C until total RNA was isolated. The dorsal muscles of fish (n = 6 per cage) were taken and stored at −20 °C for nutrient detection. 2.2. Growth performance parameters The total number and body weight of fish in each cage were measured to calculate the weight gain rate (WG), average daily gain (ADG), specific growth rate (SGR) and feed conversion ratio (FCR). The body weight and body length of the experimental fish were measured to calculate the condition factor (CF). These growth performance parameters were calculated as follows: Weight gain rate: WG (%) = (WF-WI) / WI × 100; Average daily gain: ADG = (WF-WI) / T; Specific growth rate: SGR (%) = (ln WF / ln WI) / T × 100; Feed conversion ratio: FCR = total feed intake / total weight gain; Condition factor: CF = body weight / (body length)3 × 100; where WI was the initial weights (g), WF was the final weights (g), and T was the time of the experiment (days).

2

Aquaculture 518 (2020) 734841

Q. Yang, et al.

2.3. Serum cortisol and thyroxine assay

Table 1 The primers used for qPCR in this study.

The levels of serum thyroxine (T4) and cortisol (COR) were measured by commercial enzyme-linked immunosorbent assay (ELISA) kits using a warwickand DR-200BS enzyme label analyser (Hiwell Diatek Instruments Co., Ltd., Wuxi, China) (Long et al., 2019). All standards and samples were measured in duplicate. The commercial assay kits were provided by Nanjing Jiancheng Bioengineering Institute, China. 2.4. Serum biochemistry and antioxidase activity assay

Primers

Sequence (5′ → 3′)

Amplification target

EF-1α/Forward EF-1α/Reverse HSP70/Forward HSP70/Reverse

CCCCTTGGTCGTTTTGCC GCCTTGGTTGTCTTTCCGCTA TTGAGGAGGCTGCGCACAGCTTGTG ACGTCCAGCAGCAGCAGGTCCT

qRT-PCR qRT-PCR qRT-PCR qRT-PCR

60 °C for 20 s. Each assay of all samples was repeated three times. The mRNA expression of HSP70 relative to the reference gene (EF-1α) was calculated by the 2-ΔΔct method (Livak and Schmittgen, 2001).

The serum glucose (GLU) concentration was tested by the hexokinase method (Refaey et al., 2018). Total cholesterol (TC), total triglyceride (TG) and total protein (TP) were measured by the cholesterol oxidase (CHOD-PAP), glycerol lipase oxidase (GPO-PAP) and Bradford methods, respectively (Qi et al., 2016). Total antioxidant capacity (TAOC) was assessed via the ABTS method, by measuring the absorbance of ABTS∙+ at 405 nm or 734 nm and calculating the total antioxidant capacity of the sample. Superoxide dismutase (SOD) was determined by the xanthine oxidase method (Liu et al., 2018). Catalase (CAT) was tested using the hydrogen peroxide decomposition method (Goth, 1991). Glutathione peroxidase (GSH-PX) was evaluated by determining the consumption of reduced glutathione in enzymatic reactions. GSHPX promotes the reaction of hydrogen peroxide and reduced glutathione to produce water and oxidized glutathione, and GSH-PX can be expressed as its enzymatic reaction rate. All standards and samples were measured in duplicate according to the manufacturer's instructions using a Mindray BS-420 automatic biochemical instrument (Shenzhen Mindray Biological Medical Electronics Co., Ltd., Shenzhen, China). The commercial assay kits used above were provided by BioSino Bio-Technology and Science Inc.

2.7. Statistical analysis The statistical analysis of the data was performed with SPSS 22.0 software (IBM Corporation, New York, USA) in this study. The experimental results are expressed as the mean ± SE (mean ± standard error). The growth parameters, feed conversion ratio, serum hormone, biochemical, antioxidant enzyme activities, muscle composition and HSP70 mRNA expression were analysed according to one-way analysis of variance (ANOVA) taking stocking density as the factor, followed by Tukey's post hoc test. A significant difference was considered at P < .05. All data were tested for normality, homogeneity and independence before ANOVA. 3. Results 3.1. Growth performance parameters The effects of stocking density on the growth performance parameters and feed conversion ratio in juvenile golden pompano among groups were calculated (Table 2). Growth performance parameters decreased, and the FCR increased with the increase in stocking density. WF, ADG and CF significantly decreased and FCR significantly increased in the MD and HD groups compared to the LD group (P < .05). The WG of the HD group significantly decreased compared with that of the LD group (P < .05), and there was no significant difference in the MD group. There were no significant differences in the WF, ADG, WG, FCR and CF between the MD and HD groups (P > .05). No significant difference in SGR was found among the different groups (P > .05).

2.5. Muscle composition The muscle composition was determined according to the method of Refaey et al. (2018) and commissioned by the quality supervision food inspection station of Guangdong to be evaluated according to National Food Safety Standards of China. The crude protein in the muscle content was determined by the Kjeldahl method (GB5009.5-2016). The crude fat in the muscle content was tested by extraction with ether using the Soxhlet method (GB5009.6-2016). The ash in the muscle content was assessed by burning muscles in a muffle furnace for 8 h at 550 °C using GB5006.4-2016, and the water in the muscle content was evaluated via desiccation in an oven at 105 °C using GB5006.3-2016.

3.2. Level of cortisol and thyroxine in serum As shown in Table 3, the COR level increased with increasing stocking density, while there was no significant difference among the different groups (P > .05). T4 was significantly higher in the LD and MD groups compared to the HD group (P < .05), while the LD and MD groups were not significantly different (P > .05).

2.6. RNA extraction and qPCR analysis Total RNA from samples was isolated using the HiPure Universal RNA Mini kit (Magen, Guangzhou, China) following the manufacturer's instructions. The quality and concentration of RNA were measured by 1.0% agarose gel electrophoresis and NanoDrop 2000 (Thermo Scientific, USA), respectively. All RNA samples had 260/280 ratios of 1.8–2.0 and 260/230 values of 2.0–2.2. cDNA was synthesized using the PrimeScript™ RT reagent kit with gDNA Eraser (Perfect Real Time) (TaKaRa, Dalian, China) according to the manufacturer's instructions and stored at −80 °C until use. The specific primer pairs of heat shock protein 70 (HSP70) were designed previously (Tan et al., 2017). Specific primer pairs for HSP70 and the reference gene elongation factor 1 alpha (EF-1α) (Yu et al., 2017) are listed in Table 1. The expression patterns of HSP70 were analysed by quantitative real-time PCR (qRT-PCR) performed on a Roche LightCycler® 480 II (Roche Diagnostics, Shanghai, China). A 12.5 μL reaction volume contained 6.25 μL 2× TB Green Premix Ex Taq II (Tli RNaseH Plus) (TaKaRa), 1 μL cDNA template, 0.5 μL each forward and reverse primer and 4.25 μL Milli-Q water. The thermal profile for qPCR was 95 °C for 30 s, followed by 40 cycles at 95 °C for 5 s and

3.3. Serum biochemistry The effect of stocking density on the serum levels of GLU, TP, TG and TC of T. ovatus are shown in Table 4. GLU increased, and serum TP, TG and TC decreased with increasing stocking density. The GLU of the LD group was significantly lower than that of the MD and HD groups (P < .05), but there was no significant difference between the MD and HD groups (P > .05). The TP, TG and TC of the LD and MD groups were significantly higher than those of the HD group (P < .05), and there was no significant difference between the LD and MD groups (P > .05). 3.4. Oxidative stress parameters As shown in Table 5, the serum levels of SOD, GSH-PX and T-AOC of T. ovatus increased with increasing stocking density. SOD and T-AOC 3

Aquaculture 518 (2020) 734841

Q. Yang, et al.

Table 2 Effect of stocking density on the growth performance parameters of juvenile golden pompano cultured for 10 weeks. Parameters

Groups LD

MD a

Average initial weight (g) Average final weight (g) Average daily gain (g/fish/day) Weight gain rate (%) Specific growth rate (%) Feed conversion ratio Condition factor

HD a

9.67 ± 0.30 61.18 ± 1.89b 0.74 ± 0.03b 534.24 ± 29.33ab 2.59 ± 0.04a 1.81 ± 0.03a 2.78 ± 0.02b

9.83 ± 0.17 71.04 ± 1.17a 0.87 ± 0.01a 622.81 ± 15.80a 2.66 ± 0.02a 1.60 ± 0.05b 3.36 ± 0.01a

9.76 ± 0.11a 58.65 ± 1.20b 0.70 ± 0.02b 501.23 ± 16.37b 2.55 ± 0.02a 1.92 ± 0.03a 2.73 ± 0.01b

Data are expressed as the mean ± SE. Different letters indicate significant differences in the same row (P < .05). LD, low density; MD, medium density; HD, high density.

different (P > .05).

Table 3 The concentrations of cortisol and thyroxine in T. ovatus cultured at different stocking densities. Parameters

3.5. Muscle nutrient composition

Groups

Cortisol (ng/mL) Thyroxine (ng/mL)

LD

MD

HD

40.94 ± 3.66a 12.86 ± 0.77a

46.14 ± 1.11a 11.57 ± 0.52ab

49.11 ± 3.07a 10.44 ± 0.09b

The effect of stocking density on muscle nutrient composition is shown in Fig. 1. The muscle moisture, ash and crude protein contents increased with increasing stocking density, but the difference was not significant among the groups. However, the crude fat content of muscle decreased with increasing stocking density, and the fat content of the muscle of the LD group was significantly higher than that of the MD and HD groups. There was no significant difference in the crude fat content of the muscle between the MD and HD groups.

Data are expressed as the mean ± SE (n = 9 per cage). Different letters indicate significant differences in the same row (P < .05). LD, low density; MD, medium density; HD, high density. Table 4 Effect of stocking density on the serum metabolic parameters of juvenile golden pompano cultured for 10 weeks. Parameters

3.6. Gene expression The relative mRNA levels of HSP70 to EF-1α in the liver, spleen, kidney and brain with increasing stocking density are shown in Fig. 2. The HSP70 expression levels were significantly upregulated as stocking density increased in the liver, kidney and brain (P < .05), while there was no significant difference in the spleen (P > .05).

Groups

Glucose (mmol/ L) Total protein (g/L) Total triglyceride (mmol/ L) Total cholesterol (mmol/L)

LD

MD

HD

4.46 ± 0.45b 33.73 ± 0.62a 1.64 ± 0.12a

6.36 ± 0.24a 31.09 ± 1.46a 1.56 ± 0.14a

7.48 ± 0.19a 13.00 ± 0.85b 0.94 ± 0.06b

2.39 ± 0.23a

2.27 ± 0.17a

0.79 ± 0.11b

4. Discussion There are many factors that influence fish growth, such as feed composition (Hua et al., 2019), feeding frequency (Guo et al., 2018), dissolved oxygen (Neilan and Rose, 2014) and salinity (Lisboa et al., 2015). Stocking density is an environmental stress factor that affects the growth of fish (Long et al., 2019). Our results show that the growth performance of juvenile T. ovatus decreased with increasing stocking density, which is consistent with the results of studies on juvenile Japanese flounder, Paralichthys olivaceus (Duan et al., 2011) and juvenile turbot, S. maximus (Jia et al., 2016b). These results indicate that chronic crowding stress has a negative effect on the growth of juvenile T. ovatus, which may be due to the environmental stress increasing the energy demand of the fish, causing the metabolic energy of the fish to increase so that the growth energy is relatively reduced to cope with the stress (Lupatsch et al., 2010). CF is an important indicator of the economic value of farmed fish. In this research, the CF of juvenile T. ovatus in the HD group was the lowest, indicating that high stocking density would reduce the economic value of fish. In this study, FCR increased with increasing stocking densities, which is similar to the research results for Atlantic salmon (Liu et al., 2017) and may indicate that the fish need more metabolic energy to cope with the higher density of stress; therefore, to achieve the same growth performance, the fish in the higher stocking density group must consume more feed. However, related research has shown that stocking density has no effect on FCR (Aksungur et al., 2007; Sammouth et al., 2009). The cortisol is an important hormone that maintains the normal physiological function of the body, and serum or plasma COR concentrations are commonly used as indicators of the degree of stress in

Data are expressed as the mean ± SE (n = 9 per cage). Different letters indicate significant differences in the same row (P < .05). LD, low density; MD, medium density; HD, high density. Table 5 Oxidative stress parameters in T. ovatus held at three stocking densities and cultured for 10 weeks. Parameters

Groups LD

SOD (U/mL) GSH-PX (U/mL) CAT (U/mL) T-AOC (U/mL)

MD b

20.25 ± 0.84 660.04 ± 25.01b 62.19 ± 1.12a 10.73 ± 0.74b

HD ab

23.96 ± 0.94 685.04 ± 15.08b 45.89 ± 3.61b 12.47 ± 1.14ab

27.42 ± 1.62a 776.01 ± 18.07a 69.46 ± 1.57a 16.02 ± 0.60a

Data are expressed as the mean ± SE (n = 9 per cage). Different letters indicate significant differences in the same row (P < .05). LD, low density; MD, medium density; HD, high density. SOD, superoxide dismutase; GSH-PX, glutathione peroxidase; CAT, catalase; T-AOC, total antioxidant capacity.

were significantly higher in the HD group compared to the LD group (P < .05), and there was no significant difference between the MD and HD groups (P > .05). GSH-PX in the LD and MD groups was significantly decreased compared with that in the HD group (P < .05), and the LD and MD groups were not significantly different (P > .05). CAT was significantly higher in the LD and HD groups compared to the MD group (P < .05), but the LD and HD groups were not significantly 4

Aquaculture 518 (2020) 734841

Q. Yang, et al.

Fig. 1. Muscle composition of juvenile golden pompano cultured at different stocking densities for 10 weeks. Data are expressed as the mean ± SE (n = 6 per cage). Different letters indicate significant differences between groups (P < .05). Vertical bars denote standard error. LD, low density; MD, medium density; HD, high density.

fish (Wendelaar Bonga, 1997; Barton, 2002; Fatima et al., 2018). SalasLeiton et al. (2010) suggested that the plasma COR concentration increased significantly in Solea senegalensis in a high stocking density group. In addition, Sadhu et al. (2014) suggested that chronic stress caused by high stocking density resulted in increased serum cortisol levels in Lates calcarifer. In this study, the COR level increased with increasing stocking density, which slowed the growth of the experimental fish, suggesting that HD may be a source of chronic stress and can increase cortisol concentrations in farmed fish. However, de las Heras et al. (2015) suggested that fish growth seems to be promoted by higher COR levels, which induce evident metabolic reorganization, mostly related to the use of glucose as the main fuel source, and improve somatic growth. Increased cortisol is a common body response to stress and has been shown to interfere with thyroid function in fish (Walpita et al., 2007). Vijayan et al. (1990) stated that a decrease in thyroid hormones is caused by an increase in cortisol secretion in Salvelinus fontinalis under high density stress. Thyroid hormone (TH) can promote the growth and development of fish, and in teleost, the thyroid gland mainly synthesizes thyroxine, which deiodinates triiodothyronine (T3) in liver and kidney tissues (Eales and Brown, 1993; Van der Geyten et al., 1998). Park et al. (2006) indicated that a lack of thyroid hormones in fish under environmental stress results in abnormal growth, development and metabolism. Wang et al. (2019) showed that high stocking density has a negative influence on the growth of Salmo salar, which may be due to significantly lower T3 at high stocking densities. Studies have shown that decreased plasma T3 levels are associated with decreased T4 production or altered peripheral thyroid metabolism (Power et al., 2001; Walpita et al., 2007). Similarly, our results indicated that decreased T4 levels under HD conditions may be related to chronic stress caused by higher stocking densities; therefore, we hypothesize that the slower growth in the HD groups may be associated with decreased T4. Ardiansyah and Fotedar (2016) showed that the inhibition of L. calcarifer growth at high stocking densities may be

related to a decrease in the levels of circulating thyroid hormones. This conclusion supports the results of this experiment. Serum glucose levels are often used as stress indicators for fish physiological responses (Martínez-Porchas et al., 2009; Ni et al., 2014). TG and TC are closely related to the metabolism and physiological state of the body and can be used to evaluate fish adaptability to the environment (Refaey et al., 2018). Our results show that the TG and TC levels were lowest in the HD group; however, the GLU content significantly increased in the higher stocking density group, which may indicate that the fish consumed energy to cope with high stocking density stress, and the energy required is increased by TC and TG decomposition. Subhash Peter (2013) showed that COR is a major stress response in vertebrates and can increase glucose levels as an adaptive response; therefore, this may be related to an increase in the COR content, which promotes gluconeogenesis and thereby accelerates the conversion of non-carbohydrate substances to glucose. Similarly, studies have shown that the lower levels of TG and TC in rainbow trout cultured at higher stocking densities (Suárez et al., 2015). However, Jia et al. (2016b) showed that the levels of TC and TG in the plasma significantly increased in juvenile S. maximus under HD conditions, and Liu et al. (2017) showed no effect on the serum concentrations of TG and TC in Atlantic salmon. This difference is related to the species and stage of growth of the fish. TP is an indicator for assessing fish health under different stocking density conditions (Tahmasebi-Kohyani et al., 2012; Zahedi et al., 2019). The serum TP concentration was significantly lower in Anguilla marmorata at high stocking densities, which may be due to inhibition of serum protein synthesis, and in response to chronic stress, the TP in the serum may provide energy through gluconeogenesis (Tan et al., 2018). High stocking density can also cause oxidative stress in fish, because of the imbalance between reactive oxygen species and antioxidant defence systems (Mittler, 2002; Jia et al., 2016b). Jia et al. (2016b) suggested that there was a significant decrease in SOD, GSH-PX, CAT 5

Aquaculture 518 (2020) 734841

Q. Yang, et al.

Fig. 2. Relative expression levels of HSP70 mRNA in the liver (A), spleen(B), kidney (C)and brain(D) of juvenile golden pompano cultured at different stocking densities for 10 weeks. Data are expressed as the mean ± SE (n = 4 per cage). Different letters indicate significant differences between groups (P < .05). Vertical bars denote standard error. LD, low density; MD, medium density; HD, high density.

stocking density led to increased energy demand for juvenile T. ovatus, resulting in increased energy consumption and delayed growth, and then to adapt to this stress and energy metabolism, crude fat utilization increased, resulting in a reduction in the lipid content at higher stocking densities (Qi et al., 2016). Tort et al. (2004) showed that high stocking densities resulted in chronic stress in fish. To adapt to this stress and intraspecific competition, the energy consumption of fish will inevitably increase; if it continues for a long time, the energy in the fish will be exhausted. Heat shock proteins play an important role in the response of fish to environmental stress (Kregel, 2002; Salas-Leiton et al., 2010). VargasChacoff et al. (2019) showed that HSPs are indicators of stress and are important biomarkers for a variety of abiotic variables. In the HSP family, HSP70 mediates different cellular functions, assists in folding polypeptide chains, and repairs and degrades altered or denatured proteins (Kiang and Tsokos, 1998). When fish are exposed to environmental stress, they synthesize highly conserved HSP70 to cope with the adverse environment (Salas-Leiton et al., 2010). Studies have shown that the level of HSP70 mRNA is significantly upregulated in the skin of S. maximus under high stocking densities at the end of experiments (Jia et al., 2016a). In the present study, we examined a significant increase in the expression level of HSP70 in the liver, kidney and brain as the stocking density increased, which indicates that high density causes chronic stress and that the body secretes HSP70 to protect the body from damage. However, Salas-Leiton et al. (2010) showed that the expression level of S. senegalensis HSP70 in the liver and kidney was significantly reduced at the highest stocking density. The difference in results may be due to the type of fish or the different environments in which they are located. Basu et al. (2003) stated that cortisol can regulate the expression level of HSP70 mRNA. Our results showed that

and T-AOC in the plasma and/or liver of juvenile turbot farmed under HD conditions, which indicated the induction of oxidative stress in S. maximus. Similarly, Liu et al. (2017) showed that the activity of superoxide dismutase in Atlantic salmon was significantly lower in the high stocking density group, suggesting that higher stocking densities cause higher stress, leading to increased peroxidation in the fish body. The decrease in antioxidant enzyme activities in farmed fish was found to be a response to the chronic stress of overcrowding, resulting in an imbalance between the reactive oxygen species and antioxidant mechanisms (Costas et al., 2013; Andrade et al., 2015). Conversely, our results suggested that there was a significant increase in antioxidant enzyme activities (SOD and GSH-PX) and T-AOC in the serum of juvenile T. ovatus farmed in the HD group, which may be due to different experimental designs, experimental subjects and/or growth stages. Wang et al. (2013) showed that an increase in the activity of antioxidant enzymes was also observed in farmed fish under high stocking density conditions, indicating that the adaptive response of the antioxidant system protects the body from oxygen free radicals during stress. This view supports our research results. In this study, the effects of stocking density on the muscle composition of juvenile T. ovatus revealed a generally increasing trend of the protein, moisture and ash contents with increasing culture density, while the crude fat content exhibited a contrasting result. Similarly, Tan et al. (2018) showed that increased stocking density affects body composition in A. marmorata, resulting in decreased ash and lipid contents at high stocking densities. Liu et al. (2014) suggested that the stocking density significantly affected the protein content of the Atlantic salmon body, which had the highest content at high stocking densities. The accumulation of nutrients in the muscle also reflects the metabolism of fish to some extent. In this study, the stress of high 6

Aquaculture 518 (2020) 734841

Q. Yang, et al.

both cortisol and HSP70 expression levels were elevated, but the specific mechanism of action requires further study. In conclusion, this study shows that high stocking density is a chronic stressor that has a negative impact on the growth performance and physiological metabolism of juvenile golden pompano, T. ovatus. The HSP70 mRNA expression level increased in the liver, kidney and brain as stocking densities increased, indicating that it plays a role in the anti-stress response. Based on the experimental results, the cost of culture will increase, which is not conducive to economic benefits, and this also means that the animal welfare of juvenile golden pompano is negatively affected. Therefore, stocking density is particularly important in production practices, and the optimal stocking density of T. ovatus requires further study.

Fish. Aquat. Sci. 18, 217–221. https://doi.org/10.4194/1303-2712-v18_1_25. Gething, M.J., Sambrook, J., 1992. Protein folding in the cell. Nature 355, 33–45. https:// doi.org/10.1038/355033a0. Goth, L., 1991. A simple method for determination of serum catalase activity and revision of reference range. Clin. Chim. Acta 196 (2–3), 143–151. https://doi.org/10.1016/ 0009-8981(91)90067-M. Gu, H., Zhou, Y., 2009. Stocking density experiment of Trachinotus ovatus in off-shore cage. Fish. Modern. 36 (4). https://doi.org/10.3969/j.issn.1007-9580.2009.04.007. (33–36+41). Guo, Z., Cui, J., Li, M., Liu, H., Zhang, M., Meng, F., Shi, G., Wang, R., He, X., Zhao, Y., 2018. Effect of feeding frequency on growth performance, antioxidant status, immune response and resistance to hypoxia stress challenge on juvenile dolly varden char Salvelinus malma. Aquaculture 486, 197–201. https://doi.org/10.1016/j. aquaculture.2017.12.031. Halliwell, B., Gutteridge, J.M.C., 2007. Free Radicals in Biology and Medicine. Oxford University Press, New York. Hart, S., Wrathmell, A.B., Harris, J.E., Grayson, T.H., 1988. Gut immunology in fish: a review. Dev. Comp. Immunol. 12 (3), 453–480. https://doi.org/10.1016/0145-305X (88)90065-1. Hori, T.S., Gamperl, A.K., Afonso, L.O.B., Johnson, S.C., Hubert, S., Kimball, J., Bowman, S., Rise, M.L., 2010. Heat-shock responsive genes identified and validated in Atlantic cod (Gadus morhua) liver, head kidney and skeletal muscle using genomic techniques. BMC Genomics 11, 72. https://doi.org/10.1186/1471-2164-11-72. Hua, K., Koppe, W., Fontanillas, R., 2019. Effects of dietary protein and lipid levels on growth, body composition and nutrient utilization of Channa striata. Aquaculture 501, 368–373. https://doi.org/10.1016/j.aquaculture.2018.11.054. Imsland, A.K.D., Roth, B., Fjelldal, P.G., Stefansson, S.O., Handeland, S., Mikalsen, B., 2017. The effect of continuous light at low temperatures on growth in Atlantic salmon reared in commercial size sea pens. Aquaculture 479, 645–651. https://doi. org/10.1016/j.aquaculture.2017.07.014. Jia, R., Liu, B.L., Feng, W.R., Han, C., Huang, B., Lei, J.L., 2016a. Stress and immune responses in skin of turbot (Scophthalmus maximus) under different stocking densities. Fish Shellfish Immunol. 55, 131–139. https://doi.org/10.1016/j.fsi.2016.05.032. Jia, R., Liu, B.L., Han, C., Huang, B., Lei, J.L., 2016b. Influence of stocking density on growth performance, antioxidant status, and physiological response of juvenile turbot, Scophthalmus maximu, reared in land-based recirculating aquaculture system. J. World Aquacult. Soc. 47 (4), 587–599. https://doi.org/10.1111/jwas.12295. Kiang, J.G., Tsokos, G.C., 1998. Heat shock protein 70 kDa: molecular biology, biochemistry, and physiology. Pharmacol. Ther. 80 (2), 183–201. https://doi.org/10. 1016/S0163-7258(98)00028-X. Kregel, K.C., 2002. Invited review: heat shock proteins: modifying factors in physiological stress responses and acquired thermotolerance. J. Appl. Physiol. 92 (5), 2177–2186. https://doi.org/10.1152/japplphysiol.01267.2001. de las Heras, V., Martos-Sitcha, J.A., Yúfera, M., Mancera, J.M., Martínez-Rodríguez, G., 2015. Influence of stocking density on growth, metabolism and stress of thick- lipped grey mullet (Chelon labrosus) juveniles. Aquaculture 448, 29–37. https://doi.org/10. 1016/j.aquaculture.2015.05.033. Liang, Y.Y., Guo, H.Y., Zhu, K.C., Zhang, N., Yang, J.W., Sun, X.X., Jiang, S.G., Zhang, D.C., 2018. Genomic structure and molecular characterization of growth hormone and its expression response to different feed types in golden pompano Trachinotus ovatus (Linnaeus, 1758). Aquac. Res. 49 (5), 1973–1986. https://doi.org/10.1111/ are.13653. Lisboa, V., Barcarolli, I.F., Sampaio, L.A., Bianchini, A., 2015. Effect of salinity on survival, growth and biochemical parameters in juvenile Lebranch mullet Mugil liza (Perciformes: Mugilidae). Neotrop. Ichthyol. 13 (2), 447–452. https://doi.org/10. 1590/1982-0224-20140122. Liu, B., Liu, Y., Liu, Z., Qiu, D., Sun, G., Li, X., 2014. Influence of stocking density on growth, body composition and energy budget of Atlantic salmon Salmo salar L. in recirculating aquaculture systems. Chin. J. Oceanol. Limnol. 32 (5), 982–990. https://doi.org/10.1007/s00343-014-3195-2. Liu, B., Liu, Y., Sun, G., 2017. Effects of stocking density on growth performance and welfare-related physiological parameters of Atlantic salmon Salmo salar L. in recirculating aquaculture system. Aquac. Res. 48 (5), 2133–2144. https://doi.org/10. 1111/are.13050. Liu, G., Ye, Z., Liu, D., Zhao, J., Sivaramasamy, E., Deng, Y., Zhu, S., 2018. Influence of stocking density on growth, digestive enzyme activities, immune responses, antioxidant of Oreochromis niloticus fingerlings in biofloc systems. Fish Shellfish Immunol. 81, 416–422. https://doi.org/10.1016/j.fsi.2018.07.047. Liu, B., Guo, H.Y., Zhu, K.C., Liu, B.S., Guo, L., Zhang, N., Jiang, S.G., Zhang, D.C., 2019. Nutritional compositions in different parts of muscle in the longfin batfish, Platax teira (Forsskål, 1775). J. Appl. Anim. Res. 47 (1), 403–407. https://doi.org/10.1080/ 09712119.2019.1649680. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2-ΔΔCT method. Methods 25 (4), 402–408. https://doi. org/10.1006/meth.2001.1262. Long, L., Zhang, H., Ni, Q., Liu, H., Wu, F., Wang, X., 2019. Effects of stocking density on growth, stress, and immune responses of juvenile Chinese sturgeon (Acipenser sinensis) in a recirculating aquaculture system. Comp. Biochem. Physiol. C 219, 25–34. https://doi.org/10.1016/j.cbpc.2019.02.002. Lupatsch, I., Santos, G.A., Schrama, J.W., Verreth, J.A.J., 2010. Effect of stocking density and feeding level on energy expenditure and stress responsiveness in European sea bass Dicentrarchus labrax. Aquaculture 298 (3–4), 245–250. https://doi.org/10.1016/ j.aquaculture.2009.11.007. Martínez-Porchas, M., Martínez-Córdova, L.R., Ramos-Enriquez, R., 2009. Cortisol and glucose: reliable indicators of fish stress? Pan-am. J. Aquat. Sci. 4, 158–178. Millán-Cubillo, A.F., Martos-Sitcha, J.A., Ruiz-Jarabo, I., Cárdenas, S., Mancera, J.M.,

Acknowledgement The experiment was approved by the Research Ethics Committee, South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou, China, and conducted with the criterion of National Institute of Health Guide. This work was supported by the Guangdong Provincial Science and Technology Project (2019B030316030), the Chinese Agriculture Research System (CARS47), Guangdong Provincial Special Fund for Modern Agriculture Industry Technology Innovation Teams, and the National Infrastructure of Fishery Germplasm Resources Project (2019DKA30407). References Aksakal, E., Ekinci, D., Erdoğan, O., Beydemir, S., Alım, Z., Ceyhun, S.B., 2011. Increasing stocking density causes inhibition of metabolic–antioxidant enzymes and elevates mRNA levels of heat shock protein 70 in rainbow trout. Livest. Sci. 141 (1), 69–75. https://doi.org/10.1016/j.livsci.2011.07.006. Aksungur, N., Aksungur, M., Akbulut, B., Kutlu, İ., 2007. Effects of stocking density on growth performance, survival and food conversion ratio of turbot (Psetta maxima) in the net cages on the Southeastern Coast of the Black Sea. Turk. J. Fish. Aquat. Sci. 7, 147–152. Andrade, T., Afonso, A., Pérez-Jiménez, A., Oliva-Teles, A., de las Heras, V., Mancera, J.M., Serradeiro, R., Costas, B., 2015. Evaluation of different stocking densities in a Senegalese sole (Solea senegalensis) farm: implications for growth, humoral immune parameters and oxidative status. Aquaculture 438, 6–11. https://doi.org/10.1016/j. aquaculture.2014.12.034. Ardiansyah, Fotedar, R., 2016. Water quality, growth and stress responses of juvenile barramundi (Lates calcarifer Bloch), reared at four different densities in integrated recirculating aquaculture systems. Aquaculture 458, 113–120. https://doi.org/10. 1016/j.aquaculture.2016.03.001. Barton, B.A., 2002. Stress in fishes: a diversity of responses with particular reference to changes in circulating corticostreroids. Integr. Comp. Biol. 42 (3), 517–525. https:// doi.org/10.1093/icb/42.3.517. Basu, N., Kennedy, C.J., Iwama, G.K., 2003. The effects of stress on the association between hsp70 and the glucocorticoid receptor in rainbow trout. Comp. Biochem. Physiol. A 134 (3), 655–663. https://doi.org/10.1016/S1095-6433(02)00372-0. Costa, Â.A.P., Roubach, R., Dallago, B.S.L., Bueno, G.W., McManus, C., Bernal, F.E.M., 2017. Influence of stocking density on growth performance and welfare of juvenile tilapia (Oreochromis niloticus) in cages. Arq. Bras. Med. Vet. Zootec. 69 (1), 243–251. https://doi.org/10.1590/1678-4162-8939. Costas, B., Aragão, C., Mancera, J.M., Dinis, M.T., Conceição, L.E.C., 2008. High stocking density induces crowding stress and affects amino acid metabolism in Senegalese sole Solea senegalensis (Kaup 1858) juveniles. Aquac. Res. 39 (1), 1–9. https://doi.org/10. 1111/j.1365-2109.2007.01845.x. Costas, B., Aragao, C., Dias, J., Afonso, A., Conceicao, L.E.C., 2013. Interactive effects of a high-quality protein diet and high stocking density on the stress response and some innate immune parameters of Senegalese sole Solea senegalensis. Fish Physiol. Biochem. 39 (5), 1141–1151. https://doi.org/10.1007/s10695-013-9770-1. Duan, Y., Dong, X., Zhang, X., Miao, Z., 2011. Effects of dissolved oxygen concentration and stocking density on the growth, energy budget and body composition of juvenile Japanese flounder, Paralichthys olivaceus (Temminck et Schlegel). Aquac. Res. 42 (3), 407–416. https://doi.org/10.1111/j.1365-2109.2010.02635.x. Eales, J.G., Brown, S.B., 1993. Measurement and regulation of thyroidal status in teleost fish. Rev. Fish Biol. Fish. 3 (4), 299–347. https://doi.org/10.1007/BF00043383. Ellis, T., North, B., Scott, A.P., Bromage, N.R., Porter, M., Gadd, D., 2002. The relationships between stocking density and welfare in farmed rainbow trout. J. Fish Biol. 61, 493–531. https://doi.org/10.1006/jfbi.2002.2057. FAO, 2016. The State of World Fisheries and Aquaculture. Food and Agriculture Organization of the United Nations, Rome, Italy. Fatima, S., Izhar, S., Usman, Z., Rashid, F., Kanwal, Z., Jabeen, G., Latif, A.A., 2018. Effects of high stocking density on condition factor and profile of free thyroxine and cortisol in Catla catla (Hamilton, 1822) and Labeo rohita (Hamilton, 1822). Turk. J.

7

Aquaculture 518 (2020) 734841

Q. Yang, et al.

growth performance and metabolic and oxidative status of rainbow trout (Oncorhynchus mykiss). Aquac. Eng. 67, 59–66. https://doi.org/10.1016/j.aquaeng. 2015.06.001. Subhash Peter, M.C., 2013. Understanding the adaptive response in vertebrates: the phenomenon of ease and ease response during post-stress acclimation. Gen. Comp. Endocrinol. 181, 59–64. https://doi.org/10.1016/j.ygcen.2012.09.016. Sun, L., Guo, H., Zhu, C., Ma, Z., Jiang, S., Zhang, D., 2014. Genetic polymorphism of breeding populations of golden pompano (Trachinotus ovatus). South China Fish. Sci. 10 (2), 67–71. https://doi.org/10.3969/j.issn.2095-0780.2014.02.010. Tahmasebi-Kohyani, A., Keyvanshokooh, S., Nematollahi, A., Mahmoudi, N., PashaZanoosi, H., 2012. Effects of dietary nucleotides supplementation on rainbow trout (Oncorhynchus mykiss) performance and acute stress response. Fish Physiol. Biochem. 38 (2), 431–440. https://doi.org/10.1007/s10695-011-9524-x. Tan, X., Sun, Z., Huang, Z., Zhou, C., Lin, H., Tan, L., Xun, P., Huang, Q., 2017. Effects of dietary hawthorn extract on growth performance, immune responses, growth- and immune-related genes expression of juvenile golden pompano (Trachinotus ovatus) and its susceptibility to Vibrio harveyi infection. Fish Shellfish Immunol. 70, 656–664. https://doi.org/10.1016/j.fsi.2017.09.041. Tan, C., Sun, D., Tan, H., Liu, W., Luo, G., Wei, X., 2018. Effects of stocking density on growth, body composition, digestive enzyme levels and blood biochemical parameters of Anguilla marmorata in a recirculating aquaculture system. Turk. J. Fish. Aquat. Sci. 18, 9–16. https://doi.org/10.4194/1303-2712-v18_1_02. Tort, L., Balasch, J.C., MacKenzie, S., 2004. Fish health challenge after stress. Indicators of immunocompetence. Contrib. Sci. 2 (4), 443–454. Trenzado, C.E., Morales, A.E., Palma, J.M., de la Higuera, M., 2009. Blood antioxidant defenses and hematological adjustments in crowded/uncrowded rainbow trout (Oncorhynchus mykiss) fed on diets with different levels of antioxidant vitamins and HUFA. Comp. Biochem. Physiol. C 149 (3), 440–447. https://doi.org/10.1016/j. cbpc.2008.10.105. Van der Geyten, S., Mol, K.A., Pluymers, W., Kühn, E.R., Darras, V.M., 1998. Changes in plasma T3 during fasting/refeeding in tilapia (Oreochromis niloticus) are mainly regulated through changes in hepatic type II iodothyronine deiodinase. Fish Physiol. Biochem. 19, 135–143. https://doi.org/10.1023/A:1007790527748. Vargas-Chacoff, L., Muñoz, J.L.P., Saravia, J., Oyarzún, R., Pontigo, J.P., González, M.P., Mardones, O., Hawes, C., Pino, J., Wadsworth, S., Morera, F.J., 2019. Neuroendocrine stress response in Atlantic salmon (Salmo salar) and Coho salmon (Oncorynchus kisutch) during sea lice infestation. Aquaculture 507, 329–340. https:// doi.org/10.1016/j.aquaculture.2019.04.046. Vijayan, M.M., Ballantyne, J.S., Leatherland, J.F., 1990. High stocking density alters the energy metabolism of brook charr, Salvelinus fontinalis. Aquaculture 88, 371–381. https://doi.org/10.1016/0044-8486(90)90162-G. Walpita, C.N., Grommen, S.V.H., Darras, V.M., Van der Geyten, S., 2007. The influence of stress on thyroid hormone production and peripheral deiodination in the Nile tilapia (Oreochromis niloticus). Gen. Comp. Endocrinol. 150 (1), 18–25. https://doi.org/10. 1016/j.ygcen.2006.07.002. Walter, K.N., Corwin, E.J., Ulbrecht, J., Demers, L.M., Bennett, J.M., Whetzel, C.A., Klein, L.C., 2012. Elevated thyroid stimulating hormone is associated with elevated cortisol in healthy young men and women. Thyroid. Res. 5, 13. https://doi.org/10.1186/ 1756-6614-5-13. Wang, X., Dai, W., Xu, M., Pan, B., Li, X., Chen, Y., 2013. Effects of stocking density on growth, nonspecifc immune response, and antioxidant status in African catfsh (Clarias gariepinus). Isr. J. Aquacult-Bamid. 65. Wang, X., Lin, C., Yang, X., Huang, H., 2017. Effect of stocking density on aquaculture of Trachinotus ovatus in off-shore cage. J. Trop. Biol. 8 (1), 1–6. https://doi.org/10. 15886/j.cnki.rdswxb.2017.01.001. Wang, Y., Chi, L., Liu, Q., Xiao, Y., Ma, D., Xiao, Z., Xu, S., Li, J., 2019. Effects of stocking density on the growth and immunity of Atlantic salmon salmo salar reared in recirculating aquaculture system (RAS). J. Oceanol. Limnol. 37, 350–360. https://doi. org/10.1007/s00343-019-7350-7. Wendelaar Bonga, S.E., 1997. The stress response in fish. Physiol. Rev. 77 (3), 591–625. https://doi.org/10.1152/physrev.1997.77.3.591. Yu, W., Zhu, K., Guo, H., Zhang, N., Sun, X., Wu, N., Zhang, D., 2017. Cloning and expression analysis of MHCIIβ gene in Trachinotus ovatus. South China. Fish. Sci. 13 (4), 69–79. https://doi.org/10.3969/j.issn.2095-0780.2017.04.009. Zahedi, S., Akbarzadeh, A., Mehrzad, J., Noori, A., Harsij, M., 2019. Effect of stocking density on growth performance, plasma biochemistry and muscle gene expression in rainbow trout (Oncorhynchus mykiss). Aquaculture 498, 271–278. https://doi.org/10. 1016/j.aquaculture.2018.07.044.

2016. Low stocking density negatively affects growth, metabolism and stress pathways in juvenile specimens of meagre (Argyrosomus regius, Asso 1801). Aquaculture 451, 87–92. https://doi.org/10.1016/j.aquaculture.2015.08.034. Mittler, R., 2002. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 7 (9), 405–410. https://doi.org/10.1016/S1360-1385(02)02312-9. Morimoto, R.I., Sarge, K.D., Abravaya, K., 1992. Transcriptional regulation of heat shock genes. A paradigm for inducible genomic responses. J. Biol. Chem. 267 (31), 21987–21990. Neilan, R.M., Rose, K., 2014. Simulating the effects of fluctuating dissolved oxygen on growth, reproduction, and survival of fish and shrimp. J. Theor. Biol. 343, 54–68. https://doi.org/10.1016/j.jtbi.2013.11.004. Ni, M., Wen, H., Li, J., Chi, M., Bu, Y., Ren, Y., Zhang, M., Song, Z., Ding, H., 2014. The physiological performance and immune responses of juvenile Amur sturgeon (Acipenser schrenckii) to stocking density and hypoxia stress. Fish Shellfish Immunol. 36 (2), 325–335. https://doi.org/10.1016/j.fsi.2013.12.002. North, B.P., Turnbull, J.F., Ellis, T., Porter, M.J., Migaud, H., Bron, J., Bromage, N.R., 2006. The impact of stocking density on the welfare of rainbow trout (Oncorhynchus mykiss). Aquaculture 255 (1–4), 466–479. https://doi.org/10.1016/j.aquaculture. 2006.01.004. Park, J.W., Rinchard, J., Liu, F., Anderson, T.A., Kendall, R.J., Theodorakis, C.W., 2006. The thyroid endocrine disruptor perchlorate affects reproduction, growth, and survival of mosquitofish. Ecotox. Environ. Safe. 63 (3), 343–352. https://doi.org/10. 1016/j.ecoenv.2005.04.002. Pirozzi, I., Booth, M.A., Pankhurst, P.M., 2009. The effect of stocking density and repeated handling on the growth of juvenile mulloway, Argyrosomus japonicus (Temminck & Schlegel 1843). Aquac. Int. 17, 199–205. https://doi.org/10.1007/ s10499-008-9190-x. Power, D.M., Llewellyn, L., Faustino, M., Nowell, M.A., Björnsson, B.T., Einarsdottir, I.E., Canario, A.V.M., Sweeney, G.E., 2001. Thyroid hormones in growth and development of fish. Comp. Biochem. Physiol. C 130 (4), 447–459. https://doi.org/10.1016/ S1532-0456(01)00271-X. Qi, C., Xie, C., Tang, R., Qin, X., Wang, D., Li, D., 2016. Effect of stocking density on growth, physiological responses, and body composition of juvenile blunt snout bream, Megalobrama amblycephala. J. World Aquacult. Soc. 47 (3), 358–368. https:// doi.org/10.1111/jwas.12278. Qiang, J., Yang, H., Wang, H., Kpundeh, M.D., He, J., Xu, P., 2015. Physiological responses and HSP70 mRNA expression in GIFT tilapia juveniles, Oreochromis niloticus under short-term crowding. Aquac. Res. 46 (2), 335–345. https://doi.org/10.1111/ are.12189. Rafatnezhad, S., Falahatkar, B., Gilani, M.H.T., 2008. Effects of stocking density on hematological, growth indices and fin erosion of great sturgeon (Huso huso) juveniles. Aquac. Res. 39 (14), 1506–1513. https://doi.org/10.1111/j.1365-2109.2008. 02020.x. Refaey, M.M., Li, D., Tian, X., Zhang, Z., Zhang, X., Li, L., Tang, R., 2018. High stocking density alters growth performance, blood biochemistry, intestinal histology, and muscle quality of channel catfish Ictalurus punctatus. Aquaculture 492, 73–81. https://doi.org/10.1016/j.aquaculture.2018.04.003. Roberts, R.J., Agius, C., Saliba, C., Bossier, P., Sung, Y.Y., 2010. Heat shock proteins (chaperones) in fish and shellfish and their potential role in relation to fish health: a review. J. Fish Dis. 33, 789–801. https://doi.org/10.1111/j.1365-2761.2010. 01183.x. Sadhu, N., Sharma, S.R.K., Joseph, S., Dube, P., Philipose, K.K., 2014. Chronic stress due to high stocking density in open sea cage farming induces variation in biochemical and immunological functions in Asian seabass (Lates calcarifer, Bloch). Fish Physiol. Biochem. 40 (4), 1105–1113. https://doi.org/10.1007/s10695-014-9909-8. Salas-Leiton, E., Anguis, V., Martín-Antonio, B., Crespo, D., Planas, J.V., Infante, C., Cañavate, J.P., Manchado, M., 2010. Effects of stocking density and feed ration on growth and gene expression in the Senegalese sole (Solea senegalensis): potential effects on the immune response. Fish Shellfish Immunol. 28 (2), 296–302. https://doi. org/10.1016/j.fsi.2009.11.006. Sammouth, S., d’Orbcastel, E.R., Gasset, E., Lemarié, G., Breuil, G., Marino, G., Coeurdacier, J.L., Fivelstad, S., Blancheton, J.P., 2009. The effect of density on sea bass (Dicentrarchus labrax) performance in a tank-based recirculating system. Aquac. Eng. 40 (2), 72–78. https://doi.org/10.1016/j.aquaeng.2008.11.004. Sanders, B.M., 1993. Stress proteins in aquatic organisms: an environmental perspective. Crit. Rev. Toxicol. 23, 49–75. https://doi.org/10.3109/10408449309104074. Suárez, M.D., Trenzado, C.E., García-Gallego, M., Furné, M., García-Mesa, S., Domezain, A., Alba, I., Sanz, A., 2015. Interaction of dietary energy levels and culture density on

8