- Email: [email protected]
macrophages in ayu (Plecoglossus altivelis)
Developmental and Comparative Immunology 103 (2020) 103513
Contents lists available at ScienceDirect
Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/devcompimm
Beta-adrenergic receptor stimulation influences the function of monocytes/ macrophages in ayu (Plecoglossus altivelis)
T
Hong-Xia Shena,b,c, Xin-Jiang Lua,b,c,∗, Jian-Fei Lua,b,c, Jiong Chena,b,c,∗∗ a
State Key Laboratory for Quality and Safety of Agro-products, Ningbo University, Ningbo, 315211, China Laboratory of Biochemistry and Molecular Biology, School of Marine Sciences, Ningbo University, Ningbo, 315211, China c Key Laboratory of Applied Marine Biotechnology of Ministry of Education, Ningbo University, Ningbo, 315211, China b
ARTICLE INFO
ABSTRACT
Keywords: Adrenergic receptors Monocytes/macrophages Anti-inflammation Phagocytic activity RNAi Ayu
Adrenergic receptors (ARs) are members of the G-protein-coupled receptor superfamily that can be categorized into αARs and βARs. The specific function of ARs in teleost monocytes/macrophages (MO/MФ) remains unknown. We determined the cDNA sequence of ARs from ayu (Plecoglossus altivelis; PaαAR and PaβAR). Sequence comparisons showed that PaαAR was most closely related to the αAR of the Japanese flounder and Nile tilapia, while PaβAR was most closely related to the βAR of Atlantic salmon. The AR transcripts were mainly expressed in the spleen, and their expression was altered in various tissues upon infection with Vibrio anguillarum. PaαAR and PaβAR proteins were upregulated in MO/MФ after infection, and PaβAR knockdown resulted in a proinflammatory status in ayu MO/MФ upon V. anguillarum infection and lowered the phagocytic activity of MO/ MФ. Our results indicate that PaβAR plays the role of an anti-inflammatory mediator in the immune response of ayu against bacterial infection.
1. Introduction Adrenergic mediator, norepinephrine (NE) that is released from the nerve termini mediates a variety of biological responses (Jordan and Grassi, 2018). Primary and secondary lymphoid organs receive extensive noradrenergic innervations (Nardocci et al., 2014). Upon stimulation, NE is released from these organs (Nardocci et al., 2014). The binding of NE to adrenergic receptors (ARs), which are expressed on the cell surface, can modulate the function of immune cells (Chavan and Tracey, 2017), such as macrophages (Nardocci et al., 2014). NE represents the primary neurotransmitter that can immediately impact immune function (Bucsek et al., 2018). Studies on mouse bone marrow macrophages found that NE enhanced phagocytosis and cytokine production (Ağaç et al., 2018). No effect on phagocytosis was detected in tilapia (Oreochromis aureus) treated with NE (Chen et al., 2002). The absolute and relative affinity and sensitivity values for NE are not the same in different species (Bevan et al., 1988). The ARs were classified into two types based on intracellular activity, αAR and βAR (Bylund et al., 1994). ARs belong to a large family of cell surface receptors that regulate intracellular second messenger
systems by activating guanine nucleotide-binding regulatory proteins. They have been found on macrophages and other immune cells like lymphocytes and monocytes (Chavan and Tracey, 2017). The binding of NE to its receptor modulates cell homing, proliferation, and immune cell function (Chavan and Tracey, 2017). It is generally accepted that βAR and αAR have different if not opposite functions in effector cells (Exton, 1985). Importantly, αAR is responsible for increasing pro-inflammatory cytokine production in macrophages. The activation of βAR was found to have significant anti-inflammatory effects in mammalian macrophages (Noh et al., 2017). NE released by neurons, activates the development of a tissue-protective phenotype in muscularis macrophages by signaling through βAR (Chavan and Tracey, 2017). Protective actions of βAR promotion involve elimination of the recruitment of M1-activated macrophages to renal and cardiac tissues, rather than the induction of the phenotypic switch from M1 to M2 (Noh et al., 2017). αAR is present in the immune system of teleost (Dugan et al., 2003; Fabbri et al., 2010). The activation and inhibition of ARs can modulate immune cell function in the rainbow trout (Oncorhynchus mykiss) (Flory, 1990). Fish also have different alpha-adrenergic and betaadrenergic receptor subtypes. The α1a, α1b, and α1d ARs have been
∗ Corresponding author. State Key Laboratory for Quality and Safety of Agro-products, Laboratory of Biochemistry and Molecular Biology, School of Marine Sciences, Key Laboratory of Applied Marine Biotechnology of Ministry of Education, Ningbo University, Ningbo, 315211, China. ∗∗ Corresponding author. State Key Laboratory for Quality and Safety of Agro-products, Laboratory of Biochemistry and Molecular Biology, School of Marine Sciences, Key Laboratory of Applied Marine Biotechnology of Ministry of Education, Ningbo University, Ningbo, 315211, China. E-mail addresses: [email protected] (X.-J. Lu), [email protected] (J. Chen).
https://doi.org/10.1016/j.dci.2019.103513 Received 22 August 2019; Received in revised form 30 September 2019; Accepted 30 September 2019 Available online 01 October 2019 0145-305X/ © 2019 Elsevier Ltd. All rights reserved.
Developmental and Comparative Immunology 103 (2020) 103513
H.-X. Shen, et al.
characterized in rainbow trout (Chen et al., 2007); and the α2b, α2c, and α2d ARs have been characterized in zebrafish (Danio rerio) (Ruuskanen et al., 2005a). Furthermore, the β1, β2, and β3 ARs have been characterized in black bullhead catfish (Ameiurus melas) and zebrafish (Dugan et al., 2008; Ruuskanen et al., 2005a); β1 and β2 have been characterized in channel catfish (Ictalurus punctatus) (Finkenbine et al., 2002); the β2a-ARs have been characterized in the common carp (Cyprinus carpio) (Chadzinska et al., 2012); and the β3 ARs has been characterized in rainbow trout (Nikinmaa, 2003). However, the specific functions of ARs in monocytes/macrophages (MO/MФ) remain obscure in teleost. Ayu, Plecoglossus altivelis, is an economically important teleost species found in Asia. In recent years, outbreaks of serious vibriosis—caused by Vibrio anguillarum—which resulted in mass mortality, have been reported in ayu cultures (Li et al., 2018). MO/MФ form an essential part of the teleost innate immune response against infections (Grayfer et al., 2018). In this study, we determined the effect of NE on the expression of cytokine mRNAs in MO/MΦ. We determined the cDNA sequences of ARs from ayu (PaαAR and PaβAR) and analyzed the association between AR mRNA expression and V. anguillarum infection. In addition, the effects of PaβAR on the phagocytic activity and expression of cytokine mRNAs in MO/MΦ, and the relationship between βAR-mediated anti-inflammatory effects and the toll-like receptors (TLRs) signaling pathway were investigated.
12, and 24 h post-infection (hpi), after which they were immediately snap-frozen in liquid nitrogen and preserved at −80 °C until subsequent use. For in vitro MO/MΦ treatment, cells were isolated and cultured at a concentration of 2 × 106 cells/mL, and V. anguillarum were added at a concentration of two bacteria per macrophage. Subsequently, MO/MΦ were collected from the PBS- or V. anguillarum-treated group at 4, 8, 12, and 24 hpi. 2.4. Prokaryotic expression and antibody preparation Peptides that contain extracellular domains and lack the signal peptide for prokaryotic expression and antibody preparation were chosen. The extracellular domains of PaαAR (131–209 aa, PaαAR-ECL) and PaβAR (171–299 aa, PaβAR-ECL) were expressed using a prokaryotic expression system. Therefore, the partial sequence encoding a protein fragment was amplified using the primer pairs (Table 2). The amplicon of PaαAR-ECL was digested by EcoR I and Xho I. The amplicon of PaβAR-ECL was digested by BamH I and Xho I. Then, the PaαAR-ECL amplicon was cloned into the pET-32a expression vector, the PaβARECL amplicon was cloned into the pET-28a expression vector, and the constructed plasmids were subsequently transformed into Escherichia coli BL21 (DE3). Isopropyl-β-D-thiogalactopyranoside (IPTG) was used to induce the expression of the recombinant proteins (rPaαAR-ECL or rPaβAR-ECL). The recombinant proteins were purified using a nickelnitrilotriacetic acid (Ni-NTA) column (QIAGEN, Shanghai, China) and resolved by SDS-PAGE. The concentration of the endotoxin in the recombinant protein was less than 0.1 EU/mg after toxin removal with an endotoxin-removal column (Pierce, Rockford, IL, USA). The purified rPaαAR-ECL and rPaβAR-ECL proteins were used as immune antigens to produce antisera in ICR mice. The concentrations of the anti-PaαAR and anti-PaβAR antibodies were measured using the Bradford method.
2. Materials and methods 2.1. Fish maintenance All fish in this study weighed 40–50 g each and were obtained from a fishery in Ninghai County, Ningbo City, China. The fish were healthy, and without any pathological signs. The fish were maintained in freshwater tanks in a recirculating system at 20–22 °C for two weeks to acclimatize the fish to laboratory conditions prior to the start of the experiments. All experiments were performed in accordance with the Experimental Animal Management Law of China and were approved by the Animal Ethics Committee of Ningbo University, and were carried out in compliance with the National Institutes of Health's Guide for the Care and Use of Laboratory Animals.
2.5. Primary culture of ayu MO/MΦ Ayu head kidney-derived MO/MΦ were isolated as previously described (Chen et al., 2016). Briefly, the head kidney of ayu was isolated, washed, and disassociated in RPMI 1640 medium (Invitrogen, Shanghai, China) supplemented with 2% fetal bovine serum (FBS) (Invitrogen), penicillin (100 U/mL), streptomycin (100 μg/mL), and heparin (20 U/mL). Then, the leukocyte-enriched fractions were obtained from the Ficoll-medium interface by using a Ficoll density gradient (1.077 ± 0.001 g/mL) (Invitrogen). The cells were then seeded in 35 mm dishes at a density of 2 × 107 cells/mL. Non-adherent cells were washed off, and the attached cells were incubated in complete medium (RPMI1640, 5% ayu serum, 5% FBS, 100 U/mL penicillin, 100 mg/mL streptomycin) at 24 °C with 5% CO2.
2.2. Molecular cloning of PaαAR cDNA and PaβAR cDNA PaαAR cDNA and PaβAR cDNA sequences were obtained from a previously sequenced head kidney-derived MO/MФ transcriptome of ayu (Lu et al., 2016b). The authenticity of the PaαAR and PaβAR cDNA was confirmed by PCR, cloning, and sequencing. The cleavage sites of the signal peptides were predicted using the SignalP4.1 program (http://www.cbs.dtu.dk/services/SignalP/). The sequence obtained was then compared against other similar known sequences using a BLAST search (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Multiple alignments were analyzed using the ClustalW program (http://clustalw. ddbj.nig.ac.jp/), and phylogenetic tree analysis was conducted by the neighbor-joining method using MEGA version 5. Functional domains in PaαAR and PaβAR were predicted using the TMHMM-2.0 webserver (http://www.cbs.dtu.dk/services/TMHMM-2.0/). The sequences of fish αAR cDNA and βAR cDNA used in this study are listed in Table 1.
2.6. Real-time quantitative PCR (RT-qPCR) RT-qPCR was performed as previously described (Lu et al., 2016a). Briefly, total RNA was extracted from fish tissues and MO/MΦ using RNAiso (TaKaRa, Dalian, China). After treatment with DNase I, firststrand cDNA was synthesized using AMV reverse transcriptase (TaKaRa). The specific primers used in RT-qPCR are listed in Table 2. 18S rRNA was utilized as an internal control for cDNA normalization. RTqPCR was performed on an ABI StepOne Real-Time PCR System (Applied Biosystems, Foster City, USA) using SYBR premix Ex Taq II (TaKaRa). The reaction mixture was incubated for 180 s at 94 °C, and then subjected to 40 amplification cycles of 30 s at 94 °C, 30 s at 60 °C, and 30 s at 72 °C, followed by a melting curve analysis of 30 s at 94 °C, 30 s at 72 °C, and 30 s at 94 °C. Relative gene expression was calculated using the 2−ΔΔCt method with the house-keeping gene Pa18S rRNA used as the internal reference for normalization.
2.3. Bacterial infection V. anguillarum was grown at 28 °C in nutrient broth with shaking and was collected in the logarithmic growth stage. The bacteria were washed, resuspended, and diluted to a final concentration of 1.2 × 104 CFU/fish in 100 μL sterile phosphate-buffered solution (PBS). Ayu were infected by injecting V. anguillarum into the peritoneum (infected group), while PBS was used for injecting the control group. The liver, spleen, and head kidney tissue samples were collected at 4, 8, 2
Developmental and Comparative Immunology 103 (2020) 103513
H.-X. Shen, et al.
Table 1 Primers used in this study. Primer
Gene
Accession Number
Nucleotide Sequence (5′→3′)
Sequence Information
PaαARpF PaαARpR PaβARpF PaβARpR PaαARF PaαARR PaβARF PaβARR PaIL-1βF PaIL-1βR Pa18SF Pa18SR PaTNF-αF PaTNF-αR PaIL-10F PaIL-10R
αAR
MN081889
Prokaryotic expression
βAR
MN081890
PaαAR
MN081889
PaβAR
MN081890
IL-1β
HF543937
18S rRNA
FN646593
TNF-α
JP740414
IL-10
JP758157
CGAATTCATCACTTGTATGTGATTTAAGACa CCTCGAGTCACAGGATGATGAGCGCGb CGGATCCCAGGCGGAGAACGACCCc CCTCGACTCACATCTTCACCGGGAAAGd GACATCGACCTGGAGGAGAG ACTTTGGTTTTGGACGATGC AGCTCGCATAGCAGGAAGAG GGTCGAACACGTTGATGATG TACCGGTTGGTACATCAGCA TGACGGTAAAGTTGGTGCAA GAATGTCTGCCCTATCAACT GATGTGGTAGCCGTTTCT ACATGGGAGCTGTGTTCCTC GCAAACACACCGAAAAAGGT TGCTGGTGGTGCTGTTTATGTGT AAGGAGCAGCAGCGGTCAGAA
a b c d
RT-qPCR RT-qPCR RT-qPCR RT-qPCR RT-qPCR RT-qPCR
The underlined nucleotides represent the restriction sites for EcoR I. The underlined nucleotides represent the restriction sites for Xho I. The underlined nucleotides represent the restriction sites for BamH I. The underlined nucleotides represent the restriction sites for Xho I.
resolved using SDS-PAGE, transferred to membranes, and incubated with anti-PaαAR or anti-PaβAR antibodies at a dilution of 1:200. The membranes were washed and incubated with secondary antibody horseradish peroxidase (HRP)-labeled goat anti-mouse IgG (1:5000) and visualized using an ECL western blotting detection system (Lu et al., 2017b). Changes in relative band intensity were analyzed by the NIH ImageJ program.
Table 2 ARs sequences used for multiple sequence alignment and phylogenetic tree analysis. Accession Number
MN081889 XP_014055357 XP_021439319 XP_019947580 XP_020359216 XP_004571765 XP_010739366 XP_010895107 XP_004073361 XP_005467835 XP_018918977 XP_003970398 XP_018918977 NP_919346 XP_012687939 AAK01634 NP_031443 MN081890 XP_014027478 XP_021478754 XP_020327341 XP_010874705 XP_019949159 XP_018599679 XP_019119350 XP_004544350 XP_025752803 XP_018920521 XP_004080293 XP_011618038 NP_001121807 XP_018920521 XP_012677457 NP_000675 NP_031445
Species Latin Name
English Name
Protain
Plecoglossus altivelis Salmo salar Oncorhynchus mykiss Paralichthys olivaceus Oncorhynchus kisutch Maylandia zebra Larimichthys crocea Esox lucius Oryzias latipes Oreochromis niloticus Cyprinus carpio Takifugu rubripes Cyprinus carpio Danio rerio Clupea harengus Homo sapiens Mus musculus Plecoglossus altivelis Salmo salar Oncorhynchus mykiss Oncorhynchus kisutch Esox lucius Paralichthys olivaceus Scleropages formosus Pseudosciaena crocea Maylandia zebra Oreochromis niloticus Cyprinus carpio Oryzias latipes Takifugu rubripes Danio rerio Cyprinus carpio Clupea harengus Homo sapiens Mus musculus
ayu Atlantic salmon rainbow trout Japanese flounder coho salmon zebra mbuna large yellow croaker northern pike Japanese medaka Nile tilapia common carp Fugu rubripes commer carp zebrafish Atlantic herring human mouse ayu Atlantic salmon rainbow trout coho salmon northern pike Japanese flounder Asian bonytongue large yellow croaker zebra mbuna Nile tilapia common carp Japanese medaka Fugu rubripes zebrafish commer carp Atlantic herring human mouse
αAR αAR αAR αAR αAR αAR αAR αAR αAR αAR αAR αAR αAR αAR αAR αAR αAR βAR βAR βAR βAR βAR βAR βAR βAR βAR βAR βAR βAR βAR βAR βAR βAR βAR βAR
2.8. Phagocytosis assay Escherichia coli DH5α in the logarithmic phase of growth were collected and labeled with fluorescein isothiocyanate (FITC) (Sigma, St. Louis, MO, USA) according to the manufacturer's protocol, and cells were hereafter designated as DH5α-FITC. MO/MΦ were treated with PaβAR siRNA or scrambled siRNA for 72 h to knockdown the expression of PaβAR, and then cells were treated with 10−6 M NE for 30 min at 24 °C; PBS was used as the control. Then, FITC-DH5α was added at a concentration of 20 bacteria per macrophage, followed by incubation for an additional 30 min before washing extensively with sterile PBS. Trypan blue (0.4%) was used to quench the fluorescence that resulted from particles present outside the cells or sticking to the surface of the cells. The engulfed bacteria were investigated by flow cytometry and fluorescence microscopy assays. 2.9. RNA interference To knock down the expression of PaαAR and PaβAR, RNA interference was conducted as previously reported (Lu et al., 2017a). PaαAR siRNA (5′-CCGAGAACUAUAGCUGUGCCUCAUA-3′) and a scrambled siRNA (5′-CCGCAAUAUCGAUGUCCGCUAGAUA-3′), and PaβAR siRNA (5′-GACUACAACUUGAGCAGCACCUUGU-3′) and a scrambled siRNA ( 5′-GACAACUUCGAGGACCACUCUAUGU-3′) were designed to perform RNA interference (RNAi). The transfection of cells with siRNA was performed using Lipofectamine 2000 transfection reagent (Invitrogen) according to the manufacturer's protocol. Briefly, 5 μL of Lipofectamine (2000) in 250 μL of Opti-MEM (Invitrogen) was mixed with either 100 pmol PaαAR siRNA or scrambled siRNA in 250 μL of Opti-MEM. Then, 5 μL of Lipofectamine (2000) in 250 μL of Opti-MEM (Invitrogen) was mixed with either 100 pmol PaβAR siRNA or scrambled siRNA in 250 μL of Opti-MEM. The mixture was then incubated for 20 min at room temperature before being added to MO/MФ at a final siRNA concentration of 40 nM. After a 5.5 h incubation, the medium was
2.7. Western blot analysis MO/MΦ subjected to bacterial infection were lysed in a buffer (pH 7.4), and the soluble protein concentration was measured using the Bradford method. For the Western blot analysis, the proteins were 3
Developmental and Comparative Immunology 103 (2020) 103513
H.-X. Shen, et al.
changed to complete medium, and cells were cultured for another 48, 72, and 96 h before collection. RT-qPCR and Western blotting were used to confirm the knockdown of PaαAR and PaβAR at mRNA and protein levels, respectively.
3.3. Production of recombinant PaαAR-ECL and PaβAR-ECL and corresponding antibodies In order to confirm the expression of PaαAR and PaβAR proteins in ayu MO/MФ, we produced the recombinant protein via prokaryotic expression to prepare the antibody. SDS-PAGE analysis showed that the molecular weight (MW) of purified rPaαAR-ECL was approximately 30 kDa (Fig. 3A). The antiserum was then generated by immunizing the mice with purified rPaαAR-ECL. Western blot analyses revealed that this antiserum could detect PaαAR protein in the cell lysate of ayu MO/ MФ (Fig. 3B); further, the anti-PaαAR antibody could not detect PaβAR (Fig. 3C). The MW of purified rPaβAR-ECL was revealed to be approximately 19 kDa by SDS-PAGE analysis (Fig. 3D). Purified rPaβARECL was also used to generate antiserum. This antiserum was used to detect PaβAR protein in the cell lysate of ayu MO/MФ in Western blot analyses (Fig. 3E); further, the anti-PaβAR antibody could not detect PaαAR (Fig. 3F).
2.10. TLR ligand assay MO/MΦ were pretreated with PaβAR siRNA for 72 h, and cells were stimulated with lipopolysaccharide (LPS; 10 μg/mL), Pam3CSK4 (10 ng/mL), or R837 (10 μg/mL) in the absence or presence of 10−6 M NE for 30 min. Cells were harvested, and the mRNA expression of PaTNF-α, PaIL-1β, PAIL-10, and PaTGF-β was quantified by RT-qPCR. 2.11. Statistical analysis Results are presented as mean ± standard error of the mean (SEM). All data were subjected to a one-way or repeated-measures analysis of variance (ANOVA) with SPSS (version 13.0, Chicago, IL, USA). P values < 0.05 were considered statistically significant.
3.4. The expression of PaαAR and PaβAR in MO/MΦ after V. anguillarum challenge MO/MΦ were isolated and cultured at a concentration of 2 × 106 cells/mL, and V. anguillarum were added at a concentration of two bacteria per macrophage. Subsequently, MO/MΦ were collected from the PBS- or V. anguillarum-treated group at 4, 8, 12, and 24 hpi. The expression of PaαAR was not significant in V. anguillarum-infected MO/MΦ at 4 h compared with that in PBS-treated cells. The expression of PaαAR was upregulated in V. anguillarum-infected MO/MΦ at 8 (2.98-fold) and 12 h (3.06-fold) compared with that in PBS-treated cells. The expression of PaβAR was significantly upregulated in V. anguillarum-infected MO/MΦ at all time points compared with that in PBS-treated cells (Fig. 4).
3. Results 3.1. Molecular characterization and sequence analysis of PaαAR and PaβAR The PaαAR and PaβAR sequence were deposited in the GenBank Data Library under the accession numbers MN081889 and MN081890, respectively. PaαAR consisted of 1911 nucleotides and contained a large open reading frame (ORF) which encoded a 424-aa protein and with a molecular weight (MW) of 47.75 kDa and a theoretical isoelectric point (pI) of 8.73. PaβAR consisted of 2069 nucleotides and its ORF encoded a 459-aa protein with a molecular weight (MW) of 50.20 kDa, a theoretical isoelectric point (pI) of 8.37. Multiple sequence alignment with teleost αAR and βAR amino acid sequences revealed that the seven transmembrane domains of αAR and βAR were highly conserved, while N- and C-terminals varied (Figs. S1A and B). Sequence comparisons showed that PaαAR shared the highest amino acid identity (87%) with the αAR of Japanese flounder (Paralichthys olivaceus) and Nile tilapia (Oreochromis niloticus). PaβAR shared the highest amino acid identity (80.5%) with the βAR of Atlantic salmon (Salmo salar). Phylogenetic tree analysis showed that αARs were grouped to form a fish cluster distinct from a mammalian cluster (Fig. 1). The PaαAR amino acid sequence clustered within the fish αAR group. The phylogenetic tree analysis showed that βARs were grouped to form a fish cluster distinct from a mammalian cluster (Fig. 1). The PaβAR amino acid sequence clustered within the fish βAR group.
3.5. Effect of PaαAR and PaβAR knockdown on expression of PaIL-1β, PaTNF-α, PaIL-10, and PaTGF-β in ayu MO/MΦ RNAi was utilized to knockdown the expression of PaαAR and PaβAR, and the inhibition efficiency was assessed by a Western blot assay. When resting MO/MФ were transfected with PaαAR siRNA, the mRNA and protein levels of PaαAR decreased to 26.75 ± 0.03% at 72 h and 20.20 ± 0.02% of scrambled siRNA at 96 h (Fig. 5A and B). When resting MO/MФ were transfected with PaβAR siRNA, the mRNA and protein levels of PaβAR decreased to 23.16 ± 0.03% at 72 h and 14.56 ± 0.01% of scrambled siRNA at 96 h (Fig. 5C and D). When V. anguillarum-treated MO/MФ were treated with PaαAR siRNA, the mRNA levels of PaαAR decreased to 20.25 ± 0.02% at 96 h (Fig. 5E). When V. anguillarum-treated MO/MФ were treated with PaβAR siRNA, the mRNA levels of PaβAR decreased to 19.25 ± 0.02% at 96 h (Fig. 5F). These results suggest that PaαAR and PaβAR were effectively knocked down by PaαAR or PaβAR siRNA. Next, the effect of PaαAR and PaβAR on the expression of PaIL-1β, PaTNF-α, PAIL-10, and PaTGF-β was explored. To determine the optimal treatment concentration of NE, a concentration gradient of NE was used in MO/MΦ. The results showed that the expression of PaTNFα was downregulated when the concentration of NE was 10−6 M in V. anguillarum-infected MO/MΦ (Fig. 5E). In scrambled siRNA-treated MO/MΦ, NE decreased the mRNA levels of PaIL-1β and PaTNF-α after V. anguillarum infection (Fig. 5F and G). Moreover, PaαAR siRNA treatment did not alter the effect of NE on the production of PaIL-1β and PaTNF-α in V. anguillarum-infected MO/MΦ (Fig. 5F and G). In scrambled siRNA-treated MO/MΦ, NE increased the mRNA levels of PaIL-10 and PaTGF-β after V. anguillarum infection (Fig. 5H and I). Moreover, PaαAR siRNA treatment did not alter the effect of NE on the production of PaIL-10 and PaTGF-β in V. anguillarum-infected MO/MΦ (Fig. 5H and I). PaβAR siRNA treatment increased the mRNA levels of PaIL-1β and
3.2. Tissue distribution of PaαAR and PaβAR RT-qPCR was performed to analyze the mRNA expression of PaαAR in the tissues of healthy and bacteria-infected ayu. In healthy ayu, the PaαAR transcripts were detected in all eight tested tissues including the head kidney, gills, muscles, kidneys, liver, skin, heart, and spleen, with the highest expression observed in the spleen (Fig. 2A). Upon infection with V. anguillarum, PaαAR mRNA expression was significantly upregulated in the liver at all time points (Fig. 2B). In the spleen, PaαAR mRNA expression was significantly upregulated at 4 and 8 hpi (Fig. 2C). PaαAR mRNA expression was significantly upregulated at 4 hpi in the head kidney (Fig. 2D). RT-qPCR analysis also showed that the PaβAR transcripts were expressed in all eight tested tissues, with the highest expression in the spleen (Fig. 2E). Upon infection with V. anguillarum, PaβAR mRNA expression was significantly upregulated in the liver and spleen at 12 and 24 hpi (Fig. 2F and G), and at 24 hpi in the head kidney (Fig. 2H). 4
Developmental and Comparative Immunology 103 (2020) 103513
H.-X. Shen, et al.
Fig. 1. Phylogenetic tree analysis of αAR amino acid sequences and other related mammalian αARs. Phylogenetic tree analysis of βAR amino acid sequences and other related mammalian βARs. The values at the forks indicate the percentage of trees in which this grouping occurred after bootstrapping (1000 replicates; shown only when > 60%). The scale bar represents the number of substitutions per base position. GenBank accession numbers of sequences used are listed in Table 1.
PaTNF-α after NE treatment in V. anguillarum-treated MO/MΦ (Fig. 5J and K). PaβAR siRNA treatment decreased the mRNA levels of PaIL-10 and PaTGF-β after NE treatment in V. anguillarum-treated MO/MΦ (Fig. 5L and M).
3.7. NE suppresses TLR-induced pro-inflammatory cytokine secretion To explore the effect of NE on TLR-induced pro-inflammatory cytokines. PaβAR siRNA or scrambled siRNA-treated MO/MΦ were incubated with the TLR ligands Pam3CSK4, LPS, and R837 in the absence or presence of NE. Treatment with NE decreased the expression of PaTNF-α mRNA in LPS-stimulated MO/MΦ after scrambled siRNA incubation, while NE treatment did not change the expression of PaTNF-α mRNA in LPS-stimulated MO/MΦ after PaβAR siRNA incubation (Fig. 7A). In Pam3CSK4 or R837-stimulated MO/MΦ, NE treatment decreased the expression of PaTNF-α mRNA after incubation with scrambled siRNA, while NE treatment did not change the expression of PaTNF-α mRNA after incubation with PaβAR siRNA (Fig. 7B and C). In LPS-, Pam3CSK4-, or R837-stimulated MO/MΦ, NE treatment decreased the expression of PaIL-1β mRNA after incubation with scrambled siRNA, while NE treatment did not alter the expression of PaIL-1β mRNA after incubation with PaβAR siRNA (Fig. 7D–F). In LPS-, Pam3CSK4-, or R837-stimulated MO/MΦ, PaIL-10 mRNA was
3.6. PaβAR mediates the phagocytosis of ayu MO/MΦ MO/MΦ were treated with PaβAR siRNA for 72 h to knock down PaβAR. The results showed that NE increased the phagocytosis of MO/ MΦ (Fig. 6A–C). In PaβAR siRNA-treated MO/MΦ, phagocytosis was significantly downregulated compared to that in scrambled siRNAtreated MO/MΦ after NE treatment (Fig. 6C). MO/MΦ were treated with PaαAR siRNA for 72 h to knock down PaαAR. In PaαAR siRNAtreated MO/MΦ, phagocytosis did not change significantly with respect to scrambled siRNA-treated MO/MΦ after NE treatment (Fig. 6F). The results indicated that NE promotes the phagocytosis of ayu MO/MΦ through PaβAR.
5
Developmental and Comparative Immunology 103 (2020) 103513
H.-X. Shen, et al.
Fig. 2. RT-qPCR analysis of PaαAR and PaβAR mRNA expression in ayu tissues after V. anguillarum challenge. Tissues were collected at different time points after infection. (A) PaαAR mRNA expression in different tissues at 0 hpi (control). Gene expression was reported as the fold change in different tissues relative to the amount of head kidney. (B–D) PaαAR mRNA expression at different time points in ayu tissues following V. anguillarum infection. (E) PaβAR mRNA expression in different tissues at 0 hpi (control). Gene expression was reported as the fold change in different tissues relative to the amount of head kidney. (F–H) PaβAR mRNA expression at different time points in ayu tissues following V. anguillarum infection. PaαAR and PaβAR mRNA expression was normalized to that of 18S rRNA. Data are expressed as the mean ± SEM of the results from four fish. *p < 0.05.
Japanese flounder and Nile tilapia, and PaβAR was most closely related to Atlantic salmon and coho salmon. Furthermore, the expression of PaαAR and PaβAR proteins in ayu MO/MΦ was detected. Two new genes of αAR and βAR were found in ayu, a teleost belonging to the Osmeriformes family of Plecoglossidae. To date, many AR homologs have been identified in teleost. In zebrafish, the αAR gene has been detected in the brain, gills, heart, kidneys, liver, muscles, and skin (Ruuskanen et al., 2005b), while the βAR gene has been detected in the brain, heart, skin, and liver (Wang et al., 2009). In rainbow trout, the αAR mRNA is highly expressed in the spleen and brain, with low level of expression in the heart (Chen et al., 2007). The βAR gene in rainbow trout is highly expressed in the liver and muscles, and is expressed at low levels in the gills, heart, kidneys, and spleen (Nickerson et al., 2001). Experiments have confirmed the expression of βAR in goldfish, and the values are similar for the total head kidney and spleen cell suspensions and are higher in peritoneal inflammatory cells (Jozefowski and Plytycz, 1998). High expression of βAR in liver tissue and expression in immune-related organs and cells (thymus, spleen, head kidney, and peripheral blood leukocytes) was found in carp (Chadzinska et al., 2012). In this study, PaαAR and PaβAR mRNA were found to be expressed in all tested tissues with high expression in the spleen, suggesting that αAR and βAR in the teleost are expressed in immune organs. Upon infection with V. anguillarum, it was found that the mRNA of PaαAR and PaβAR were significantly upregulated in the liver, spleen, and head kidney at different infection times. After zymosan and LPS treatment, the expression of AR is altered in the leukocytes of carp (Chadzinska et al., 2012). The αAR and βAR expression levels after infection in teleost are unclear. In this study, the upregulation of αAR and βAR after infection may suggest that ARs are closely involved in teleost immune responses to microbial pathogens. Cytokine genes such as TNF-α, IL-1β, IL-10, and TGF-β play important roles in the inflammatory response (Hodgkinson et al., 2015; Khansari et al., 2017; Sun et al., 2018). βAR activation is recurrently associated with the inhibition of the pro-inflammatory program and
upregulated by NE treatment after incubation with scrambled siRNA, while PaIL-10 mRNA levels were not changed by NE treatment after incubation with PaβAR siRNA (Fig. 7G–I). The expression of PaTGF-β mRNA was upregulated after NE treatment in LPS-, Pam3CSK4-, or R837-stimulated MO/MΦ, while the levels of PaTGF-β mRNA were not changed by NE treatment after incubation with PaβAR siRNA (Fig. 7JL). We further investigated the effect of PaαAR on TLR-induced proinflammatory cytokines. In LPS-, Pam3CSK4-, or R837-stimulated MO/ MΦ, NE treatment decreased the expression of PaTNF-α mRNA after incubation with scrambled and PaαAR siRNA (Fig. 7M–O). In LPS-, Pam3CSK4-, or R837-stimulated MO/MΦ, NE treatment decreased the expression of PaIL-1β mRNA after incubation with scrambled and PaαAR siRNA (Fig. 7P–R). In LPS-, Pam3CSK4-, or R837-stimulated MO/MΦ, NE treatment upregulated the expression of PaIL-10 mRNA after incubation with scrambled and PaαAR siRNA (Fig. 7S-U). In LPS-, Pam3CSK4-, or R837-stimulated MO/MΦ, NE treatment upregulated the expression of PaTGF-β mRNA after incubation with scrambled and PaαAR siRNA (Fig. 7V–X). Our data do not suggest that PaαAR mediates the effect of NE on TLR-induced pro-inflammatory cytokines. 4. Discussion ARs belong to a superfamily of G-protein-coupled receptors that contain three extracellular and intracellular loops (Némethy et al., 2017). They are expressed on the surface of MO/MФ and bind to NE (Pavlov et al., 2018). Here, two cDNA sequences of ARs were identified from the transcriptome of ayu MO/MΦ. Sequence comparisons showed that PaαAR shared the highest amino acid identity with the αAR from the Japanese flounder (Paralichthys olivaceus) and Nile tilapia (Oreochromis niloticus). PaβAR shared the highest amino acid identity with βAR from Atlantic salmon (Salmo salar). A phylogenetic tree, which was constructed to identify the evolutionary relationship between the ARs of ayu and other teleost, showed that PaαAR was most closely related to 6
Developmental and Comparative Immunology 103 (2020) 103513
H.-X. Shen, et al.
Fig. 3. The specificity of the antibody for PaαAR and PaβAR. (A) The SDS-PAGE analysis of prokaryotic expressed PaαAR. Lane M: protein marker; 1 and 2: protein from BL21 (DE3) transformed with the pET32a-PaαAR plasmid before and after IPTG induction; 3: purified recombinant PaαAR. (B) Western blot analysis of the specificity of the antibody for PaαAR. 4: negative control; 5: purified recombinant PaαAR; 6: PaαAR in MO/MФ. (C) Western blot analysis of recombinant PaαAR and PaβAR using an anti-PaαAR antibody. 7: negative control; 8: purified recombinant PaαAR; 9: purified recombinant PaβAR. (D) SDS-PAGE analysis of prokaryotic expressed PaβAR. 10 and 11: protein from BL21 (DE3) transformed with the pET-32a-PaβAR plasmid before and after IPTG induction; 12: purified recombinant PaβAR. (E) Western blot analysis of the specificity of the antibody for PaβAR; 13: negative control; 14: purified recombinant PaβAR; 15: PaβAR in MO/MФ. (F) Western blot analysis of recombinant PaαAR and PaβAR with anti-PaβAR antibody. 16: negative control; 17: purified recombinant PaαAR; 18: purified recombinant PaβAR.
potentiated expression of anti-inflammatory factors in immune cells (Scanzano and Cosentino, 2015). In this study, it was found that NE decreased the mRNA expression of PaTNF-α and PaIL-1β, and increased the expression of PaIL-10 and PaTGF-β in infected ayu MO/MФ through PaβAR, but not through αAR. Another study has shown that NE can suppress TNF-α production and increase the production of IL-10 in isolated human monocytes (Ng and Toews, 2016). In rats, NE inhibits the secretion of TNF-α in cultured rat peritoneal macrophages (Li et al., 2015). Monocytes express βAR, and their activation is usually anti-inflammatory (Pinoli et al., 2017). The activation of αAR enhances the activity of macrophages and blocking of αAR inhibits the activation of
macrophages and the production of inflammatory cytokines (Huan et al., 2016). Therefore, NE in ayu results in an anti-inflammatory effect through βAR, which is consistent with the results in mammals. Phagocytic ability is an important property of MO/MΦ for defending against pathogenic bacterial infection (Salazar et al., 2016). In the teleost fishes, MO/MΦ have been shown to utilize phagocytosis to rapidly kill pathogens (Jiang et al., 2018). βAR can induce changes in critical functions of phagocytosis in macrophages (Kim et al., 2019). In this study, NE promoted phagocytosis in ayu MO/MΦ. After the RNAimediated knockdown of PaβAR expression, the phagocytosis of ayu MO/MФ was significantly downregulated compared to that of the
Fig. 4. The expression of PaαAR and PaβAR in MO/MΦ after V. anguillarum challenge. (A) RTqPCR analysis of PaαAR mRNA expression in ayu MO/MΦ after V. anguillarum treatment. (B) RT-qPCR analysis of PaβAR mRNA expression in ayu MO/MΦ after V. anguillarum challenge. Cells were collected at different time points post-infection. mRNA expression was normalized to that of 18S rRNA. Gene expression was measured as the fold change at different time points relative to PBS-treated cells. (C) Western blot analysis was performed to analyze variations in PaαAR and PaβAR protein expression in MO/MФ. Expression of PaαAR and PaβAR proteins was normalized to that of β-actin. Data are expressed as the mean ± SEM of the results from five fish. *p < 0.05. 7
Developmental and Comparative Immunology 103 (2020) 103513
H.-X. Shen, et al.
Fig. 5. Effect of PaαAR and PaβAR knockdown on the mRNA levels of PaIL-1β, PaTNF-α, PaIL-10, and PaTGF-β in V. anguillarum-treated ayu MO/MΦ. (A–B) Protein levels and mRNA expression of PaαAR in resting MO/MΦ treated with PaαAR siRNA. (C–D) Protein levels and mRNA expression of PaβAR in resting MO/MΦ treated with PaβAR siRNA. (E) mRNA expression of PaαAR in PaαAR siRNA-treated MO/MΦ stimulated with V. anguillarum for 4 h. (F) mRNA expression of PaβAR in PaβAR siRNA-treated MO/MΦ stimulated with V. anguillarum for 4 h. (G) MO/MΦ were treated with different concentrations of NE for 30 min, and the mRNA level of PaTNF-α was estimated by RT-qPCR. (H–K) mRNA expression of PaIL-1β, PaTNF-α, PaIL-10, and PaTGF-β in MO/MΦ treated with PaαAR siRNA. (L–O) mRNA expression of PaIL-1β, PaTNF-α, PaIL-10, and PaTGF-β in MO/MΦ treated with PaβAR siRNA. The mRNA levels of PaIL-1β, PaTNF-α, PaIL-10, and PaTGF-β were determined by RT-qPCR. Data are expressed as the mean ± SEM. N = 5. *p < 0.05.
8
Developmental and Comparative Immunology 103 (2020) 103513
H.-X. Shen, et al.
Fig. 6. Effect of PaβAR on the phagocytosis of ayu MO/MΦ. (A) Scatter plots in flow cytometry. (B) Flow cytometry of FITC fluorescence intensity in MO/MФ. (C) Relative mean fluorescence intensity (MFI) of MO/MФ. Effect of PaαAR on the phagocytosis of ayu MO/MΦ. (D) Scatter plots in flow cytometry. (E) Flow cytometry of FITC fluorescence intensity in MO/MФ. (F) Relative mean fluorescence intensity (MFI) of MO/MФ. Relative MFI was presented as the fold change with respect to the control, which was assigned a unit of 100. Data are expressed as the mean ± SEM of five independent experiments. *p < 0.05.
control in this study. This result is similar to that of a study that showed that NE could enhance the phagocytosis of bone marrow-derived macrophages in mice (Xiu et al., 2013). Therefore, we suggest that NE is involved in phagocytosis in ayu MO/MФ, and the effect of NE on phagocytosis is mediated by PaβAR. TLRs play an important role in innate immunity. Triggering of the TLR pathway leads to the regulation of immune and inflammatory genes/factors (Williams et al., 2018). NE was found to regulate cytokine expression in MO/MФ after stimulation with different TLR ligands in mice (Ağaç et al., 2018). Here, it was also found that NE suppressed the expression of PaTNF-α and PaIL-1β, and promoted the expression of PaIL-10 and PaTGF-β after stimulation with different TLR ligands in ayu MO/MФ. After PaβAR knockdown, the effects of NE on cytokines were eliminated. The TLR family—an important group of pattern recognition receptors—is essential for the immune response in teleost fish (Su et al.,
2015). There are distinct differences between teleost and mammalian TLR signaling. For example, the TLR ligand, LPS is relatively tolerant in the teleost (Novoa et al., 2009). In this study, it was found that NE regulated the function of the TLR ligands in both teleost and mice, suggesting that the regulatory effect of NE on TLR is essentially conservative despite the distinct differences between teleost and mammal TLR. In conclusion, αAR and βAR genes were characterized in ayu. The transcripts of PaαAR and PaβAR were upregulated in various immune tissues upon bacterial infection in ayu. It was shown that the function of NE in ayu MO/MФ is to improve the production of anti-inflammatory cytokines and phagocytosis. It was also found that the anti-inflammatory functions of NE were mediated by PaβAR. This research broadens our knowledge of the functions and mechanisms of ARs, and will assist in the control of various teleost diseases.
9
Developmental and Comparative Immunology 103 (2020) 103513
H.-X. Shen, et al.
Fig. 7. NE suppresses TLR-induced cytokine secretion through the PaβAR in ayu MO/MΦ. (A–C) mRNA levels of PaTNF-α in MO/MΦ treated with LPS, Pam3CSK4, or R837 after incubation with scrambled siRNA and PaβAR siRNA. (D–F) mRNA levels of PaIL-1β in MO/MΦ treated with LPS, Pam3CSK4, or R837 after incubation with scrambled siRNA and PaβAR siRNA. (G–I) mRNA levels of PaIL-10 in MO/MΦ treated with LPS, Pam3CSK4, or R837 after incubation with scrambled siRNA and PaβAR siRNA. (J–L) mRNA levels of PaTGF-β in MO/MΦ treated with LPS, Pam3CSK4, or R837 after incubation with scrambled siRNA and PaβAR siRNA. (M–O) mRNA levels of PaTNF-α in MO/MΦ treated with LPS, Pam3CSK4, or R837 after incubation with scrambled siRNA and PaαAR siRNA. (P–R) mRNA levels of PaIL-1β in MO/MΦ treated with LPS, Pam3CSK4, or R837 after incubation with scrambled siRNA and PaαAR siRNA. (S–U) mRNA levels of PaIL-10 in MO/MΦ treated with LPS, Pam3CSK4, or R837 after incubation with scrambled siRNA and PaαAR siRNA. (V–X) mRNA levels of PaTGF-β in MO/MΦ treated with LPS, Pam3CSK4, or R837 after incubation with scrambled siRNA and PaαAR siRNA. The value of the NE-treated group normalized to the control of a different group. Data are expressed as the mean ± SEM. N = 5. *p < 0.05.
10
Developmental and Comparative Immunology 103 (2020) 103513
H.-X. Shen, et al.
Acknowledgments
head kidney stimulated with Vibrio anguillarum bacterin. Fish Shellfish Immunol. 70, 736–749. Kim, T.H., Ly, C., Christodoulides, A., Nowell, C.J., Gunning, P.W., Sloan, E.K., Rowat, A.C., 2019. Stress hormone signaling through beta-adrenergic receptors regulates macrophage mechanotype and function. FASEB J. 33, 3997–4006. Li, M., Yang, X., Zhuang, C.C., Cao, Z., Ren, L.M., Xiu, C.Y., Li, Y.F., Zhu, Y.Z., 2015. NE strengthens the immunosuppression induced by AlCl 3 through β2-AR/cAMP pathway in cultured rat peritoneal macrophages. Biol. Trace Elem. Res. 164, 234–241. Li, C.H., Ding, F.F., Chen, J., Mo, L.B., Chen, J., 2018. Cloning, expression, and functional analyses of MHC class II A in ayu, Plecoglossus altivelis. Turk. J. Fish. Aquat. Sci. 18, 1091–1100. Lu, X.J., Chen, Q., Rong, Y.J., Chen, J., 2016a. Mobilisation and dysfunction of haematopoietic stem/progenitor cells after Listonella anguillarum infection in ayu, Plecoglossus altivelis. Sci. Rep. 6, 28082. Lu, X.J., Zhang, H., Yang, G.J., Li, M.Y., Chen, J., 2016b. Comparative transcriptome analysis on the alteration of gene expression in ayu (Plecoglossus altivelis) larvae associated with salinity change. Zool. Res. 37, 126–135. Lu, X.J., Chen, Q., Rong, Y.J., Chen, F., Chen, J., 2017a. CXCR3. 1 and CXCR3. 2 differentially contribute to macrophage polarization in teleost fish. J. Immunol. 198, 4692–4706. Lu, X.J., Chen, Q., Chen, J., Chen, J., 2017b. Molecular identification and functional analysis of KLF2 in Plecoglossus altivelis (ayu): it's regulatory role in monocyte/macrophage activation. Fish Shellfish Immunol. 62, 257–264. Nardocci, G., Navarro, C., Cortés, P.P., Imarai, M., Montoya, M., Valenzuela, B., Jara, P., Acuña-Castillo, C., Fernández, R., 2014. Neuroendocrine mechanisms for immune system regulation during stress in fish. Fish Shellfish Immunol. 40, 531–538. Némethy, A., Vavrinec, P., Vavrincová‐Yaghi, D., Čepcová, D., Mišúth, S., Král'ová, E., Čižmáriková, R., Račanská, E., 2017. Synthesis and biological evaluation of new combined α/β‐Adrenergic blockers. Arch. Pharm. 350, e201600394. Ng, T.M., Toews, M.L., 2016. Impaired norepinephrine regulation of monocyte inflammatory cytokine balance in heart failure. World J. Cardiol. 8, 584–589. Nickerson, J.G., Dugan, S.G., Drouin, G., Moon, T.W., 2001. A putative β2‐adrenoceptor from the rainbow trout (Oncorhynuchus mykiss) molecular characterization and pharmacology. Eur. J. Biochem. 268, 6465–6472. Nikinmaa, M., 2003. Beta3-adrenergic receptors–studies on rainbow trout reveal ancient evolutionary origins and functions distinct from the thermogenic response. Am. J. Physiol. Regul. Integr. Comp. Physiol. 285, R515–516. Noh, H., Yu, M.R., Kim, H.J., Lee, J.H., Park, B.W., Wu, I.H., Matsumoto, M., King, G.L., 2017. Beta 2-adrenergic receptor agonists are novelregulators of macrophage activation indiabetic renal and cardiovascular complications. Kidney Int. 92, 101–113. Novoa, B., Bowman, T.V., Zon, L., Figueras, A., 2009. LPS response and tolerance in the zebrafish (Danio rerio). Fish Shellfish Immunol. 26, 326–331. Pavlov, V.A., Chavan, S.S., Tracey, K.J., 2018. Molecular and functional neuroscience in immunity. Annu. Rev. Immunol. 36, 783–812. Pinoli, M., Marino, F., Cosentino, M., 2017. Dopaminergic regulation of innate immunity: a review. J. Neuroimmune Pharmacol. 12, 602–623. Ruuskanen, J.O., Laurila, J., Xhaard, H., Rantanen, V.V., Vuoriluoto, K., Wurster, S., Marjamaki, A., Vainio, M., Johnson, M.S., Scheinin, M., 2005a. Conserved structural, pharmacological and functional properties among the three human and five zebrafish alpha 2-adrenoceptors. Br. J. Pharmacol. 144, 165–177. Ruuskanen, J.O., Peitsaro, N., Kaslin, J.V., Panula, P., Scheinin, M., 2005b. Expression and function of α2‐adrenoceptors in zebrafish: drug effects, mRNA and receptor distributions. J. Neurochem. 94, 1559–1569. Salazar, S., Oliver, C., Yáñez, A.J., Avendaño-Herrera, R., 2016. Comparative analysis of innate immune responses to Streptococcus phocae strains in Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). Fish Shellfish Immunol. 51, 97–103. Scanzano, A., Cosentino, M., 2015. Adrenergic regulation of innate immunity: a review. Front. Pharmacol. 6, 171. Su, J.J., Su, J.G., Shang, X.Y., Wan, Q.Y., Chen, X.H., Rao, Y.L., 2015. SNP detection of TLR8 gene, association study with susceptibility/resistance to GCRV and regulation on mRNA expression in grass carp, Ctenopharyngodon idella. Fish Shellfish Immunol. 43, 1–12. Sun, Y.L., Li, Y.W., Rao, J.D., Liu, Z.H., Chen, Q.L., 2018. Effects of inorganic mercury exposure on histological structure, antioxidant status and immune response of immune organs in yellow catfish (Pelteobagrus fulvidraco). J. Appl. Toxicol. 38, 843–854. Wang, Z.P., Nishimura, Y., Shimada, Y., Umemoto, N., Hirano, M., Zang, L.Q., Oka, T., Sakamoto, C., Kuroyanagi, J., Tanaka, T., 2009. Zebrafish beta-adrenergic receptor mRNA expression and control of pigmentation. Gene 446, 18–27. Williams, L.M., Fuess, L.E., Brennan, J.J., Mansfield, K.M., Salas-Rodriguez, E., Welsh, J., Awtry, J., Banic, S., Chacko, C., Chezian, A., Dowers, D., Estrada, F., Hsieh, Y.H., Kang, J., Li, W., Malchiodi, Z., Malinowski, J., Matuszak, S., McTigue, T.4th., Mueller, D., Nguyen, B., Nguyen, M., Nguyen, P., Nguyen, S., Njoku, N., Patel, K., Pellegrini, W., Pliakas, T., Qadir, D., Ryan, E., Schiffer, A., Thiel, A., Yunes, S.A., Spilios, K.E., Pinzon, C.J.H., Mydlarz, L.D., Gilmore, T.D., 2018. A conserved Toll-like receptor-to-NF-kappaB signaling pathway in the endangered coral Orbicella faveolata. Dev. Comp. Immunol. 79, 128–136. Xiu, F.M., Stanojcic, M., Jeschke, M.G., 2013. Norepinephrine inhibits macrophage migration by decreasing CCR2 expression. PLoS One 8, e69167.
This project was supported by the Program for the Natural Science Foundation of China (41776151; 31772876), the Zhejiang Provincial Natural Science Foundation of China (LR18C040001; LZ18C190001), the Scientific Innovation Team Project of Ningbo (2015C110018) and the K.C. Wong Magna Fund in Ningbo University. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.dci.2019.103513. References Ağaç, D., Estrada, L.D., Maples, R., Hooper, L.V., Farrar, J.D., 2018. The beta2-adrenergic receptor controls inflammation by driving rapid IL-10 secretion. Brain Behav. Immun. 74, 176–185. Bevan, J.A., Bevan, R.D., Kite, K., Oriowo, M.A., 1988. Species differences in sensitivity of aortae to norepinephrine are related to α-adrenoceptor affinity. Trends Pharmacol. Sci. 9, 87–89. Bucsek, M.J., Giridharan, T., Macdonald, C.R., Hylander, B.L., Repasky, E.A., 2018. An overview of the role of sympathetic regulation of immune responses in infectious disease and autoimmunity. Int. J. Hyperth. 34, 135–143. Bylund, D.B., Eikenberg, D.C., Hieble, J.P., Langer, S.Z., Lefkowitz, R.J., Minneman, K.P., Molinoff, P.B., Jr, R.R., Trendelenburg, U., 1994. International union of pharmacology nomenclature of adrenoceptors. Pharmacol. Rev. 46, 121–136. Chadzinska, M., Tertil, E., Kepka, M., Hermsen, T., Scheer, M., Verburg-van Kemenade, B.M., 2012. Adrenergic regulation of the innate immune response in common carp (Cyprinus carpio L.). Dev. Comp. Immunol. 36, 306–316. Chavan, S.S., Tracey, K.J., 2017. Essential neuroscience in immunology. J. Immunol. 198, 3389–3397. Chen, W.H., Sun, L.T., Tsai, C.L., Song, Y.L., Chang, C.F., 2002. Cold-stress induced the modulation of catecholamines, cortisol, immunoglobulin M, and leukocyte phagocytosis in tilapia. Gen. Comp. Endocrinol. 126, 90–100. Chen, X., Perry, S.F., Aris-Brosou, S., Selva, C., Moon, T.W., 2007. Characterization and functional divergence of the α1-adrenoceptor gene family: insights from rainbow trout (Oncorhynchus mykiss). Physiol. Genom. 32, 142–153. Chen, Q., Lu, X.J., Li, M.Y., Chen, J., 2016. Molecular cloning, pathologically-correlated expression and functional characterization of the colony stimulating factor 1 receptor (CSF-1R) gene from a teleost, Plecoglossus altivelis. Zool. Res. 37, 96–102. Dugan, S.G., Lortie, M.B., Nickerson, J.G., Moon, T.W., 2003. Regulation of the rainbow trout (Oncorhynchus mykiss) hepatic β2-adrenoceptor by adrenergic agonists. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 136, 331–342. Dugan, S.G., Chen, X., Nickerson, J.G., Montpetit, C.J., Moon, T.W., 2008. Regulation of the black bullhead hepatic beta-adrenoceptors. Comparative biochemistry and physiology. Part B, Biochem. Mol. Biol. 149, 265–274. Exton, J.H., 1985. Mechanisms involved in alpha-adrenergic phenomena. Am. J. Physiol. 248, 633–647. Fabbri, E., Chen, X., Capuzzo, A., Moon, T.W., 2010. Binding kinetics and sequencing of hepatic alpha1-adrenergic receptors in two marine teleosts, mackerel (Scomber scombrus) and anchovy (Engraulis encrasicolus). J. Exp. Zool. A Ecol. Genet. Physiol. 309, 157–165. Finkenbine, S.S., Gettys, T.W., Burnett, K.G., 2002. Beta-adrenergic receptors on leukocytes of the channel catfish, Ictalurus punctatus. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 131, 27–37. Flory, C.M., 1990. Phylogeny of neuroimmunoregulation: effects of adrenergic and cholinergic agents on the in vitro antibody response of the rainbow trout, Onchorynchus mykiss. Dev. Comp. Immunol. 14, 283–294. Grayfer, L., Kerimoglu, B., Yaparla, A., Hodgkinson, J.W., Xie, J., Belosevic, M., 2018. Mechanisms of fish macrophage antimicrobial immunity. Front. Immunol. 9, 1105. Hodgkinson, J.W., Grayfer, L., Belosevic, M., 2015. Biology of bony fish macrophages. Biology (Basel) 4, 881–906. Huan, H.B., Wen, X.D., Chen, X.J., Wu, L., Wu, L.L., Zhang, L., Yang, D.P., Zhang, X., Bie, P., Qian, C., 2016. Sympathetic nervous system promotes hepatocarcinogenesis by modulating inflammation through activation of alpha1-adrenergic receptors of Kupffer cells. Brain Behav. Immun. 59, 118–134. Jiang, H., Hu, Y.Z., Wei, X.L., Xiao, X., Jakovlić, I., Liu, X.L., Su, J.G., Yuan, G.L., 2018. Chemotactic effect of β-defensin 1 on macrophages in Megalobrama amblycephala. Fish Shellfish Immunol. 74, 35–42. Jordan, J., Grassi, G., 2018. The norepinephrine transporter deserves more attention. J. Hypertens. 36, 1472–1474. Jozefowski, S.J., Plytycz, B., 1998. Characterization of beta-adrenergic receptors in fish and amphibian lymphoid organs. Dev. Comp. Immunol. 22, 587–603. Khansari, A.R., Parra, D., Reyes-López, F.E., Tort, L., 2017. Modulatory in vitro effect of stress hormones on the cytokine response of rainbow trout and gilthead sea bream
11
Contents lists available at ScienceDirect
Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/devcompimm
Beta-adrenergic receptor stimulation influences the function of monocytes/ macrophages in ayu (Plecoglossus altivelis)
T
Hong-Xia Shena,b,c, Xin-Jiang Lua,b,c,∗, Jian-Fei Lua,b,c, Jiong Chena,b,c,∗∗ a
State Key Laboratory for Quality and Safety of Agro-products, Ningbo University, Ningbo, 315211, China Laboratory of Biochemistry and Molecular Biology, School of Marine Sciences, Ningbo University, Ningbo, 315211, China c Key Laboratory of Applied Marine Biotechnology of Ministry of Education, Ningbo University, Ningbo, 315211, China b
ARTICLE INFO
ABSTRACT
Keywords: Adrenergic receptors Monocytes/macrophages Anti-inflammation Phagocytic activity RNAi Ayu
Adrenergic receptors (ARs) are members of the G-protein-coupled receptor superfamily that can be categorized into αARs and βARs. The specific function of ARs in teleost monocytes/macrophages (MO/MФ) remains unknown. We determined the cDNA sequence of ARs from ayu (Plecoglossus altivelis; PaαAR and PaβAR). Sequence comparisons showed that PaαAR was most closely related to the αAR of the Japanese flounder and Nile tilapia, while PaβAR was most closely related to the βAR of Atlantic salmon. The AR transcripts were mainly expressed in the spleen, and their expression was altered in various tissues upon infection with Vibrio anguillarum. PaαAR and PaβAR proteins were upregulated in MO/MФ after infection, and PaβAR knockdown resulted in a proinflammatory status in ayu MO/MФ upon V. anguillarum infection and lowered the phagocytic activity of MO/ MФ. Our results indicate that PaβAR plays the role of an anti-inflammatory mediator in the immune response of ayu against bacterial infection.
1. Introduction Adrenergic mediator, norepinephrine (NE) that is released from the nerve termini mediates a variety of biological responses (Jordan and Grassi, 2018). Primary and secondary lymphoid organs receive extensive noradrenergic innervations (Nardocci et al., 2014). Upon stimulation, NE is released from these organs (Nardocci et al., 2014). The binding of NE to adrenergic receptors (ARs), which are expressed on the cell surface, can modulate the function of immune cells (Chavan and Tracey, 2017), such as macrophages (Nardocci et al., 2014). NE represents the primary neurotransmitter that can immediately impact immune function (Bucsek et al., 2018). Studies on mouse bone marrow macrophages found that NE enhanced phagocytosis and cytokine production (Ağaç et al., 2018). No effect on phagocytosis was detected in tilapia (Oreochromis aureus) treated with NE (Chen et al., 2002). The absolute and relative affinity and sensitivity values for NE are not the same in different species (Bevan et al., 1988). The ARs were classified into two types based on intracellular activity, αAR and βAR (Bylund et al., 1994). ARs belong to a large family of cell surface receptors that regulate intracellular second messenger
systems by activating guanine nucleotide-binding regulatory proteins. They have been found on macrophages and other immune cells like lymphocytes and monocytes (Chavan and Tracey, 2017). The binding of NE to its receptor modulates cell homing, proliferation, and immune cell function (Chavan and Tracey, 2017). It is generally accepted that βAR and αAR have different if not opposite functions in effector cells (Exton, 1985). Importantly, αAR is responsible for increasing pro-inflammatory cytokine production in macrophages. The activation of βAR was found to have significant anti-inflammatory effects in mammalian macrophages (Noh et al., 2017). NE released by neurons, activates the development of a tissue-protective phenotype in muscularis macrophages by signaling through βAR (Chavan and Tracey, 2017). Protective actions of βAR promotion involve elimination of the recruitment of M1-activated macrophages to renal and cardiac tissues, rather than the induction of the phenotypic switch from M1 to M2 (Noh et al., 2017). αAR is present in the immune system of teleost (Dugan et al., 2003; Fabbri et al., 2010). The activation and inhibition of ARs can modulate immune cell function in the rainbow trout (Oncorhynchus mykiss) (Flory, 1990). Fish also have different alpha-adrenergic and betaadrenergic receptor subtypes. The α1a, α1b, and α1d ARs have been
∗ Corresponding author. State Key Laboratory for Quality and Safety of Agro-products, Laboratory of Biochemistry and Molecular Biology, School of Marine Sciences, Key Laboratory of Applied Marine Biotechnology of Ministry of Education, Ningbo University, Ningbo, 315211, China. ∗∗ Corresponding author. State Key Laboratory for Quality and Safety of Agro-products, Laboratory of Biochemistry and Molecular Biology, School of Marine Sciences, Key Laboratory of Applied Marine Biotechnology of Ministry of Education, Ningbo University, Ningbo, 315211, China. E-mail addresses: [email protected] (X.-J. Lu), [email protected] (J. Chen).
https://doi.org/10.1016/j.dci.2019.103513 Received 22 August 2019; Received in revised form 30 September 2019; Accepted 30 September 2019 Available online 01 October 2019 0145-305X/ © 2019 Elsevier Ltd. All rights reserved.
Developmental and Comparative Immunology 103 (2020) 103513
H.-X. Shen, et al.
characterized in rainbow trout (Chen et al., 2007); and the α2b, α2c, and α2d ARs have been characterized in zebrafish (Danio rerio) (Ruuskanen et al., 2005a). Furthermore, the β1, β2, and β3 ARs have been characterized in black bullhead catfish (Ameiurus melas) and zebrafish (Dugan et al., 2008; Ruuskanen et al., 2005a); β1 and β2 have been characterized in channel catfish (Ictalurus punctatus) (Finkenbine et al., 2002); the β2a-ARs have been characterized in the common carp (Cyprinus carpio) (Chadzinska et al., 2012); and the β3 ARs has been characterized in rainbow trout (Nikinmaa, 2003). However, the specific functions of ARs in monocytes/macrophages (MO/MФ) remain obscure in teleost. Ayu, Plecoglossus altivelis, is an economically important teleost species found in Asia. In recent years, outbreaks of serious vibriosis—caused by Vibrio anguillarum—which resulted in mass mortality, have been reported in ayu cultures (Li et al., 2018). MO/MФ form an essential part of the teleost innate immune response against infections (Grayfer et al., 2018). In this study, we determined the effect of NE on the expression of cytokine mRNAs in MO/MΦ. We determined the cDNA sequences of ARs from ayu (PaαAR and PaβAR) and analyzed the association between AR mRNA expression and V. anguillarum infection. In addition, the effects of PaβAR on the phagocytic activity and expression of cytokine mRNAs in MO/MΦ, and the relationship between βAR-mediated anti-inflammatory effects and the toll-like receptors (TLRs) signaling pathway were investigated.
12, and 24 h post-infection (hpi), after which they were immediately snap-frozen in liquid nitrogen and preserved at −80 °C until subsequent use. For in vitro MO/MΦ treatment, cells were isolated and cultured at a concentration of 2 × 106 cells/mL, and V. anguillarum were added at a concentration of two bacteria per macrophage. Subsequently, MO/MΦ were collected from the PBS- or V. anguillarum-treated group at 4, 8, 12, and 24 hpi. 2.4. Prokaryotic expression and antibody preparation Peptides that contain extracellular domains and lack the signal peptide for prokaryotic expression and antibody preparation were chosen. The extracellular domains of PaαAR (131–209 aa, PaαAR-ECL) and PaβAR (171–299 aa, PaβAR-ECL) were expressed using a prokaryotic expression system. Therefore, the partial sequence encoding a protein fragment was amplified using the primer pairs (Table 2). The amplicon of PaαAR-ECL was digested by EcoR I and Xho I. The amplicon of PaβAR-ECL was digested by BamH I and Xho I. Then, the PaαAR-ECL amplicon was cloned into the pET-32a expression vector, the PaβARECL amplicon was cloned into the pET-28a expression vector, and the constructed plasmids were subsequently transformed into Escherichia coli BL21 (DE3). Isopropyl-β-D-thiogalactopyranoside (IPTG) was used to induce the expression of the recombinant proteins (rPaαAR-ECL or rPaβAR-ECL). The recombinant proteins were purified using a nickelnitrilotriacetic acid (Ni-NTA) column (QIAGEN, Shanghai, China) and resolved by SDS-PAGE. The concentration of the endotoxin in the recombinant protein was less than 0.1 EU/mg after toxin removal with an endotoxin-removal column (Pierce, Rockford, IL, USA). The purified rPaαAR-ECL and rPaβAR-ECL proteins were used as immune antigens to produce antisera in ICR mice. The concentrations of the anti-PaαAR and anti-PaβAR antibodies were measured using the Bradford method.
2. Materials and methods 2.1. Fish maintenance All fish in this study weighed 40–50 g each and were obtained from a fishery in Ninghai County, Ningbo City, China. The fish were healthy, and without any pathological signs. The fish were maintained in freshwater tanks in a recirculating system at 20–22 °C for two weeks to acclimatize the fish to laboratory conditions prior to the start of the experiments. All experiments were performed in accordance with the Experimental Animal Management Law of China and were approved by the Animal Ethics Committee of Ningbo University, and were carried out in compliance with the National Institutes of Health's Guide for the Care and Use of Laboratory Animals.
2.5. Primary culture of ayu MO/MΦ Ayu head kidney-derived MO/MΦ were isolated as previously described (Chen et al., 2016). Briefly, the head kidney of ayu was isolated, washed, and disassociated in RPMI 1640 medium (Invitrogen, Shanghai, China) supplemented with 2% fetal bovine serum (FBS) (Invitrogen), penicillin (100 U/mL), streptomycin (100 μg/mL), and heparin (20 U/mL). Then, the leukocyte-enriched fractions were obtained from the Ficoll-medium interface by using a Ficoll density gradient (1.077 ± 0.001 g/mL) (Invitrogen). The cells were then seeded in 35 mm dishes at a density of 2 × 107 cells/mL. Non-adherent cells were washed off, and the attached cells were incubated in complete medium (RPMI1640, 5% ayu serum, 5% FBS, 100 U/mL penicillin, 100 mg/mL streptomycin) at 24 °C with 5% CO2.
2.2. Molecular cloning of PaαAR cDNA and PaβAR cDNA PaαAR cDNA and PaβAR cDNA sequences were obtained from a previously sequenced head kidney-derived MO/MФ transcriptome of ayu (Lu et al., 2016b). The authenticity of the PaαAR and PaβAR cDNA was confirmed by PCR, cloning, and sequencing. The cleavage sites of the signal peptides were predicted using the SignalP4.1 program (http://www.cbs.dtu.dk/services/SignalP/). The sequence obtained was then compared against other similar known sequences using a BLAST search (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Multiple alignments were analyzed using the ClustalW program (http://clustalw. ddbj.nig.ac.jp/), and phylogenetic tree analysis was conducted by the neighbor-joining method using MEGA version 5. Functional domains in PaαAR and PaβAR were predicted using the TMHMM-2.0 webserver (http://www.cbs.dtu.dk/services/TMHMM-2.0/). The sequences of fish αAR cDNA and βAR cDNA used in this study are listed in Table 1.
2.6. Real-time quantitative PCR (RT-qPCR) RT-qPCR was performed as previously described (Lu et al., 2016a). Briefly, total RNA was extracted from fish tissues and MO/MΦ using RNAiso (TaKaRa, Dalian, China). After treatment with DNase I, firststrand cDNA was synthesized using AMV reverse transcriptase (TaKaRa). The specific primers used in RT-qPCR are listed in Table 2. 18S rRNA was utilized as an internal control for cDNA normalization. RTqPCR was performed on an ABI StepOne Real-Time PCR System (Applied Biosystems, Foster City, USA) using SYBR premix Ex Taq II (TaKaRa). The reaction mixture was incubated for 180 s at 94 °C, and then subjected to 40 amplification cycles of 30 s at 94 °C, 30 s at 60 °C, and 30 s at 72 °C, followed by a melting curve analysis of 30 s at 94 °C, 30 s at 72 °C, and 30 s at 94 °C. Relative gene expression was calculated using the 2−ΔΔCt method with the house-keeping gene Pa18S rRNA used as the internal reference for normalization.
2.3. Bacterial infection V. anguillarum was grown at 28 °C in nutrient broth with shaking and was collected in the logarithmic growth stage. The bacteria were washed, resuspended, and diluted to a final concentration of 1.2 × 104 CFU/fish in 100 μL sterile phosphate-buffered solution (PBS). Ayu were infected by injecting V. anguillarum into the peritoneum (infected group), while PBS was used for injecting the control group. The liver, spleen, and head kidney tissue samples were collected at 4, 8, 2
Developmental and Comparative Immunology 103 (2020) 103513
H.-X. Shen, et al.
Table 1 Primers used in this study. Primer
Gene
Accession Number
Nucleotide Sequence (5′→3′)
Sequence Information
PaαARpF PaαARpR PaβARpF PaβARpR PaαARF PaαARR PaβARF PaβARR PaIL-1βF PaIL-1βR Pa18SF Pa18SR PaTNF-αF PaTNF-αR PaIL-10F PaIL-10R
αAR
MN081889
Prokaryotic expression
βAR
MN081890
PaαAR
MN081889
PaβAR
MN081890
IL-1β
HF543937
18S rRNA
FN646593
TNF-α
JP740414
IL-10
JP758157
CGAATTCATCACTTGTATGTGATTTAAGACa CCTCGAGTCACAGGATGATGAGCGCGb CGGATCCCAGGCGGAGAACGACCCc CCTCGACTCACATCTTCACCGGGAAAGd GACATCGACCTGGAGGAGAG ACTTTGGTTTTGGACGATGC AGCTCGCATAGCAGGAAGAG GGTCGAACACGTTGATGATG TACCGGTTGGTACATCAGCA TGACGGTAAAGTTGGTGCAA GAATGTCTGCCCTATCAACT GATGTGGTAGCCGTTTCT ACATGGGAGCTGTGTTCCTC GCAAACACACCGAAAAAGGT TGCTGGTGGTGCTGTTTATGTGT AAGGAGCAGCAGCGGTCAGAA
a b c d
RT-qPCR RT-qPCR RT-qPCR RT-qPCR RT-qPCR RT-qPCR
The underlined nucleotides represent the restriction sites for EcoR I. The underlined nucleotides represent the restriction sites for Xho I. The underlined nucleotides represent the restriction sites for BamH I. The underlined nucleotides represent the restriction sites for Xho I.
resolved using SDS-PAGE, transferred to membranes, and incubated with anti-PaαAR or anti-PaβAR antibodies at a dilution of 1:200. The membranes were washed and incubated with secondary antibody horseradish peroxidase (HRP)-labeled goat anti-mouse IgG (1:5000) and visualized using an ECL western blotting detection system (Lu et al., 2017b). Changes in relative band intensity were analyzed by the NIH ImageJ program.
Table 2 ARs sequences used for multiple sequence alignment and phylogenetic tree analysis. Accession Number
MN081889 XP_014055357 XP_021439319 XP_019947580 XP_020359216 XP_004571765 XP_010739366 XP_010895107 XP_004073361 XP_005467835 XP_018918977 XP_003970398 XP_018918977 NP_919346 XP_012687939 AAK01634 NP_031443 MN081890 XP_014027478 XP_021478754 XP_020327341 XP_010874705 XP_019949159 XP_018599679 XP_019119350 XP_004544350 XP_025752803 XP_018920521 XP_004080293 XP_011618038 NP_001121807 XP_018920521 XP_012677457 NP_000675 NP_031445
Species Latin Name
English Name
Protain
Plecoglossus altivelis Salmo salar Oncorhynchus mykiss Paralichthys olivaceus Oncorhynchus kisutch Maylandia zebra Larimichthys crocea Esox lucius Oryzias latipes Oreochromis niloticus Cyprinus carpio Takifugu rubripes Cyprinus carpio Danio rerio Clupea harengus Homo sapiens Mus musculus Plecoglossus altivelis Salmo salar Oncorhynchus mykiss Oncorhynchus kisutch Esox lucius Paralichthys olivaceus Scleropages formosus Pseudosciaena crocea Maylandia zebra Oreochromis niloticus Cyprinus carpio Oryzias latipes Takifugu rubripes Danio rerio Cyprinus carpio Clupea harengus Homo sapiens Mus musculus
ayu Atlantic salmon rainbow trout Japanese flounder coho salmon zebra mbuna large yellow croaker northern pike Japanese medaka Nile tilapia common carp Fugu rubripes commer carp zebrafish Atlantic herring human mouse ayu Atlantic salmon rainbow trout coho salmon northern pike Japanese flounder Asian bonytongue large yellow croaker zebra mbuna Nile tilapia common carp Japanese medaka Fugu rubripes zebrafish commer carp Atlantic herring human mouse
αAR αAR αAR αAR αAR αAR αAR αAR αAR αAR αAR αAR αAR αAR αAR αAR αAR βAR βAR βAR βAR βAR βAR βAR βAR βAR βAR βAR βAR βAR βAR βAR βAR βAR βAR
2.8. Phagocytosis assay Escherichia coli DH5α in the logarithmic phase of growth were collected and labeled with fluorescein isothiocyanate (FITC) (Sigma, St. Louis, MO, USA) according to the manufacturer's protocol, and cells were hereafter designated as DH5α-FITC. MO/MΦ were treated with PaβAR siRNA or scrambled siRNA for 72 h to knockdown the expression of PaβAR, and then cells were treated with 10−6 M NE for 30 min at 24 °C; PBS was used as the control. Then, FITC-DH5α was added at a concentration of 20 bacteria per macrophage, followed by incubation for an additional 30 min before washing extensively with sterile PBS. Trypan blue (0.4%) was used to quench the fluorescence that resulted from particles present outside the cells or sticking to the surface of the cells. The engulfed bacteria were investigated by flow cytometry and fluorescence microscopy assays. 2.9. RNA interference To knock down the expression of PaαAR and PaβAR, RNA interference was conducted as previously reported (Lu et al., 2017a). PaαAR siRNA (5′-CCGAGAACUAUAGCUGUGCCUCAUA-3′) and a scrambled siRNA (5′-CCGCAAUAUCGAUGUCCGCUAGAUA-3′), and PaβAR siRNA (5′-GACUACAACUUGAGCAGCACCUUGU-3′) and a scrambled siRNA ( 5′-GACAACUUCGAGGACCACUCUAUGU-3′) were designed to perform RNA interference (RNAi). The transfection of cells with siRNA was performed using Lipofectamine 2000 transfection reagent (Invitrogen) according to the manufacturer's protocol. Briefly, 5 μL of Lipofectamine (2000) in 250 μL of Opti-MEM (Invitrogen) was mixed with either 100 pmol PaαAR siRNA or scrambled siRNA in 250 μL of Opti-MEM. Then, 5 μL of Lipofectamine (2000) in 250 μL of Opti-MEM (Invitrogen) was mixed with either 100 pmol PaβAR siRNA or scrambled siRNA in 250 μL of Opti-MEM. The mixture was then incubated for 20 min at room temperature before being added to MO/MФ at a final siRNA concentration of 40 nM. After a 5.5 h incubation, the medium was
2.7. Western blot analysis MO/MΦ subjected to bacterial infection were lysed in a buffer (pH 7.4), and the soluble protein concentration was measured using the Bradford method. For the Western blot analysis, the proteins were 3
Developmental and Comparative Immunology 103 (2020) 103513
H.-X. Shen, et al.
changed to complete medium, and cells were cultured for another 48, 72, and 96 h before collection. RT-qPCR and Western blotting were used to confirm the knockdown of PaαAR and PaβAR at mRNA and protein levels, respectively.
3.3. Production of recombinant PaαAR-ECL and PaβAR-ECL and corresponding antibodies In order to confirm the expression of PaαAR and PaβAR proteins in ayu MO/MФ, we produced the recombinant protein via prokaryotic expression to prepare the antibody. SDS-PAGE analysis showed that the molecular weight (MW) of purified rPaαAR-ECL was approximately 30 kDa (Fig. 3A). The antiserum was then generated by immunizing the mice with purified rPaαAR-ECL. Western blot analyses revealed that this antiserum could detect PaαAR protein in the cell lysate of ayu MO/ MФ (Fig. 3B); further, the anti-PaαAR antibody could not detect PaβAR (Fig. 3C). The MW of purified rPaβAR-ECL was revealed to be approximately 19 kDa by SDS-PAGE analysis (Fig. 3D). Purified rPaβARECL was also used to generate antiserum. This antiserum was used to detect PaβAR protein in the cell lysate of ayu MO/MФ in Western blot analyses (Fig. 3E); further, the anti-PaβAR antibody could not detect PaαAR (Fig. 3F).
2.10. TLR ligand assay MO/MΦ were pretreated with PaβAR siRNA for 72 h, and cells were stimulated with lipopolysaccharide (LPS; 10 μg/mL), Pam3CSK4 (10 ng/mL), or R837 (10 μg/mL) in the absence or presence of 10−6 M NE for 30 min. Cells were harvested, and the mRNA expression of PaTNF-α, PaIL-1β, PAIL-10, and PaTGF-β was quantified by RT-qPCR. 2.11. Statistical analysis Results are presented as mean ± standard error of the mean (SEM). All data were subjected to a one-way or repeated-measures analysis of variance (ANOVA) with SPSS (version 13.0, Chicago, IL, USA). P values < 0.05 were considered statistically significant.
3.4. The expression of PaαAR and PaβAR in MO/MΦ after V. anguillarum challenge MO/MΦ were isolated and cultured at a concentration of 2 × 106 cells/mL, and V. anguillarum were added at a concentration of two bacteria per macrophage. Subsequently, MO/MΦ were collected from the PBS- or V. anguillarum-treated group at 4, 8, 12, and 24 hpi. The expression of PaαAR was not significant in V. anguillarum-infected MO/MΦ at 4 h compared with that in PBS-treated cells. The expression of PaαAR was upregulated in V. anguillarum-infected MO/MΦ at 8 (2.98-fold) and 12 h (3.06-fold) compared with that in PBS-treated cells. The expression of PaβAR was significantly upregulated in V. anguillarum-infected MO/MΦ at all time points compared with that in PBS-treated cells (Fig. 4).
3. Results 3.1. Molecular characterization and sequence analysis of PaαAR and PaβAR The PaαAR and PaβAR sequence were deposited in the GenBank Data Library under the accession numbers MN081889 and MN081890, respectively. PaαAR consisted of 1911 nucleotides and contained a large open reading frame (ORF) which encoded a 424-aa protein and with a molecular weight (MW) of 47.75 kDa and a theoretical isoelectric point (pI) of 8.73. PaβAR consisted of 2069 nucleotides and its ORF encoded a 459-aa protein with a molecular weight (MW) of 50.20 kDa, a theoretical isoelectric point (pI) of 8.37. Multiple sequence alignment with teleost αAR and βAR amino acid sequences revealed that the seven transmembrane domains of αAR and βAR were highly conserved, while N- and C-terminals varied (Figs. S1A and B). Sequence comparisons showed that PaαAR shared the highest amino acid identity (87%) with the αAR of Japanese flounder (Paralichthys olivaceus) and Nile tilapia (Oreochromis niloticus). PaβAR shared the highest amino acid identity (80.5%) with the βAR of Atlantic salmon (Salmo salar). Phylogenetic tree analysis showed that αARs were grouped to form a fish cluster distinct from a mammalian cluster (Fig. 1). The PaαAR amino acid sequence clustered within the fish αAR group. The phylogenetic tree analysis showed that βARs were grouped to form a fish cluster distinct from a mammalian cluster (Fig. 1). The PaβAR amino acid sequence clustered within the fish βAR group.
3.5. Effect of PaαAR and PaβAR knockdown on expression of PaIL-1β, PaTNF-α, PaIL-10, and PaTGF-β in ayu MO/MΦ RNAi was utilized to knockdown the expression of PaαAR and PaβAR, and the inhibition efficiency was assessed by a Western blot assay. When resting MO/MФ were transfected with PaαAR siRNA, the mRNA and protein levels of PaαAR decreased to 26.75 ± 0.03% at 72 h and 20.20 ± 0.02% of scrambled siRNA at 96 h (Fig. 5A and B). When resting MO/MФ were transfected with PaβAR siRNA, the mRNA and protein levels of PaβAR decreased to 23.16 ± 0.03% at 72 h and 14.56 ± 0.01% of scrambled siRNA at 96 h (Fig. 5C and D). When V. anguillarum-treated MO/MФ were treated with PaαAR siRNA, the mRNA levels of PaαAR decreased to 20.25 ± 0.02% at 96 h (Fig. 5E). When V. anguillarum-treated MO/MФ were treated with PaβAR siRNA, the mRNA levels of PaβAR decreased to 19.25 ± 0.02% at 96 h (Fig. 5F). These results suggest that PaαAR and PaβAR were effectively knocked down by PaαAR or PaβAR siRNA. Next, the effect of PaαAR and PaβAR on the expression of PaIL-1β, PaTNF-α, PAIL-10, and PaTGF-β was explored. To determine the optimal treatment concentration of NE, a concentration gradient of NE was used in MO/MΦ. The results showed that the expression of PaTNFα was downregulated when the concentration of NE was 10−6 M in V. anguillarum-infected MO/MΦ (Fig. 5E). In scrambled siRNA-treated MO/MΦ, NE decreased the mRNA levels of PaIL-1β and PaTNF-α after V. anguillarum infection (Fig. 5F and G). Moreover, PaαAR siRNA treatment did not alter the effect of NE on the production of PaIL-1β and PaTNF-α in V. anguillarum-infected MO/MΦ (Fig. 5F and G). In scrambled siRNA-treated MO/MΦ, NE increased the mRNA levels of PaIL-10 and PaTGF-β after V. anguillarum infection (Fig. 5H and I). Moreover, PaαAR siRNA treatment did not alter the effect of NE on the production of PaIL-10 and PaTGF-β in V. anguillarum-infected MO/MΦ (Fig. 5H and I). PaβAR siRNA treatment increased the mRNA levels of PaIL-1β and
3.2. Tissue distribution of PaαAR and PaβAR RT-qPCR was performed to analyze the mRNA expression of PaαAR in the tissues of healthy and bacteria-infected ayu. In healthy ayu, the PaαAR transcripts were detected in all eight tested tissues including the head kidney, gills, muscles, kidneys, liver, skin, heart, and spleen, with the highest expression observed in the spleen (Fig. 2A). Upon infection with V. anguillarum, PaαAR mRNA expression was significantly upregulated in the liver at all time points (Fig. 2B). In the spleen, PaαAR mRNA expression was significantly upregulated at 4 and 8 hpi (Fig. 2C). PaαAR mRNA expression was significantly upregulated at 4 hpi in the head kidney (Fig. 2D). RT-qPCR analysis also showed that the PaβAR transcripts were expressed in all eight tested tissues, with the highest expression in the spleen (Fig. 2E). Upon infection with V. anguillarum, PaβAR mRNA expression was significantly upregulated in the liver and spleen at 12 and 24 hpi (Fig. 2F and G), and at 24 hpi in the head kidney (Fig. 2H). 4
Developmental and Comparative Immunology 103 (2020) 103513
H.-X. Shen, et al.
Fig. 1. Phylogenetic tree analysis of αAR amino acid sequences and other related mammalian αARs. Phylogenetic tree analysis of βAR amino acid sequences and other related mammalian βARs. The values at the forks indicate the percentage of trees in which this grouping occurred after bootstrapping (1000 replicates; shown only when > 60%). The scale bar represents the number of substitutions per base position. GenBank accession numbers of sequences used are listed in Table 1.
PaTNF-α after NE treatment in V. anguillarum-treated MO/MΦ (Fig. 5J and K). PaβAR siRNA treatment decreased the mRNA levels of PaIL-10 and PaTGF-β after NE treatment in V. anguillarum-treated MO/MΦ (Fig. 5L and M).
3.7. NE suppresses TLR-induced pro-inflammatory cytokine secretion To explore the effect of NE on TLR-induced pro-inflammatory cytokines. PaβAR siRNA or scrambled siRNA-treated MO/MΦ were incubated with the TLR ligands Pam3CSK4, LPS, and R837 in the absence or presence of NE. Treatment with NE decreased the expression of PaTNF-α mRNA in LPS-stimulated MO/MΦ after scrambled siRNA incubation, while NE treatment did not change the expression of PaTNF-α mRNA in LPS-stimulated MO/MΦ after PaβAR siRNA incubation (Fig. 7A). In Pam3CSK4 or R837-stimulated MO/MΦ, NE treatment decreased the expression of PaTNF-α mRNA after incubation with scrambled siRNA, while NE treatment did not change the expression of PaTNF-α mRNA after incubation with PaβAR siRNA (Fig. 7B and C). In LPS-, Pam3CSK4-, or R837-stimulated MO/MΦ, NE treatment decreased the expression of PaIL-1β mRNA after incubation with scrambled siRNA, while NE treatment did not alter the expression of PaIL-1β mRNA after incubation with PaβAR siRNA (Fig. 7D–F). In LPS-, Pam3CSK4-, or R837-stimulated MO/MΦ, PaIL-10 mRNA was
3.6. PaβAR mediates the phagocytosis of ayu MO/MΦ MO/MΦ were treated with PaβAR siRNA for 72 h to knock down PaβAR. The results showed that NE increased the phagocytosis of MO/ MΦ (Fig. 6A–C). In PaβAR siRNA-treated MO/MΦ, phagocytosis was significantly downregulated compared to that in scrambled siRNAtreated MO/MΦ after NE treatment (Fig. 6C). MO/MΦ were treated with PaαAR siRNA for 72 h to knock down PaαAR. In PaαAR siRNAtreated MO/MΦ, phagocytosis did not change significantly with respect to scrambled siRNA-treated MO/MΦ after NE treatment (Fig. 6F). The results indicated that NE promotes the phagocytosis of ayu MO/MΦ through PaβAR.
5
Developmental and Comparative Immunology 103 (2020) 103513
H.-X. Shen, et al.
Fig. 2. RT-qPCR analysis of PaαAR and PaβAR mRNA expression in ayu tissues after V. anguillarum challenge. Tissues were collected at different time points after infection. (A) PaαAR mRNA expression in different tissues at 0 hpi (control). Gene expression was reported as the fold change in different tissues relative to the amount of head kidney. (B–D) PaαAR mRNA expression at different time points in ayu tissues following V. anguillarum infection. (E) PaβAR mRNA expression in different tissues at 0 hpi (control). Gene expression was reported as the fold change in different tissues relative to the amount of head kidney. (F–H) PaβAR mRNA expression at different time points in ayu tissues following V. anguillarum infection. PaαAR and PaβAR mRNA expression was normalized to that of 18S rRNA. Data are expressed as the mean ± SEM of the results from four fish. *p < 0.05.
Japanese flounder and Nile tilapia, and PaβAR was most closely related to Atlantic salmon and coho salmon. Furthermore, the expression of PaαAR and PaβAR proteins in ayu MO/MΦ was detected. Two new genes of αAR and βAR were found in ayu, a teleost belonging to the Osmeriformes family of Plecoglossidae. To date, many AR homologs have been identified in teleost. In zebrafish, the αAR gene has been detected in the brain, gills, heart, kidneys, liver, muscles, and skin (Ruuskanen et al., 2005b), while the βAR gene has been detected in the brain, heart, skin, and liver (Wang et al., 2009). In rainbow trout, the αAR mRNA is highly expressed in the spleen and brain, with low level of expression in the heart (Chen et al., 2007). The βAR gene in rainbow trout is highly expressed in the liver and muscles, and is expressed at low levels in the gills, heart, kidneys, and spleen (Nickerson et al., 2001). Experiments have confirmed the expression of βAR in goldfish, and the values are similar for the total head kidney and spleen cell suspensions and are higher in peritoneal inflammatory cells (Jozefowski and Plytycz, 1998). High expression of βAR in liver tissue and expression in immune-related organs and cells (thymus, spleen, head kidney, and peripheral blood leukocytes) was found in carp (Chadzinska et al., 2012). In this study, PaαAR and PaβAR mRNA were found to be expressed in all tested tissues with high expression in the spleen, suggesting that αAR and βAR in the teleost are expressed in immune organs. Upon infection with V. anguillarum, it was found that the mRNA of PaαAR and PaβAR were significantly upregulated in the liver, spleen, and head kidney at different infection times. After zymosan and LPS treatment, the expression of AR is altered in the leukocytes of carp (Chadzinska et al., 2012). The αAR and βAR expression levels after infection in teleost are unclear. In this study, the upregulation of αAR and βAR after infection may suggest that ARs are closely involved in teleost immune responses to microbial pathogens. Cytokine genes such as TNF-α, IL-1β, IL-10, and TGF-β play important roles in the inflammatory response (Hodgkinson et al., 2015; Khansari et al., 2017; Sun et al., 2018). βAR activation is recurrently associated with the inhibition of the pro-inflammatory program and
upregulated by NE treatment after incubation with scrambled siRNA, while PaIL-10 mRNA levels were not changed by NE treatment after incubation with PaβAR siRNA (Fig. 7G–I). The expression of PaTGF-β mRNA was upregulated after NE treatment in LPS-, Pam3CSK4-, or R837-stimulated MO/MΦ, while the levels of PaTGF-β mRNA were not changed by NE treatment after incubation with PaβAR siRNA (Fig. 7JL). We further investigated the effect of PaαAR on TLR-induced proinflammatory cytokines. In LPS-, Pam3CSK4-, or R837-stimulated MO/ MΦ, NE treatment decreased the expression of PaTNF-α mRNA after incubation with scrambled and PaαAR siRNA (Fig. 7M–O). In LPS-, Pam3CSK4-, or R837-stimulated MO/MΦ, NE treatment decreased the expression of PaIL-1β mRNA after incubation with scrambled and PaαAR siRNA (Fig. 7P–R). In LPS-, Pam3CSK4-, or R837-stimulated MO/MΦ, NE treatment upregulated the expression of PaIL-10 mRNA after incubation with scrambled and PaαAR siRNA (Fig. 7S-U). In LPS-, Pam3CSK4-, or R837-stimulated MO/MΦ, NE treatment upregulated the expression of PaTGF-β mRNA after incubation with scrambled and PaαAR siRNA (Fig. 7V–X). Our data do not suggest that PaαAR mediates the effect of NE on TLR-induced pro-inflammatory cytokines. 4. Discussion ARs belong to a superfamily of G-protein-coupled receptors that contain three extracellular and intracellular loops (Némethy et al., 2017). They are expressed on the surface of MO/MФ and bind to NE (Pavlov et al., 2018). Here, two cDNA sequences of ARs were identified from the transcriptome of ayu MO/MΦ. Sequence comparisons showed that PaαAR shared the highest amino acid identity with the αAR from the Japanese flounder (Paralichthys olivaceus) and Nile tilapia (Oreochromis niloticus). PaβAR shared the highest amino acid identity with βAR from Atlantic salmon (Salmo salar). A phylogenetic tree, which was constructed to identify the evolutionary relationship between the ARs of ayu and other teleost, showed that PaαAR was most closely related to 6
Developmental and Comparative Immunology 103 (2020) 103513
H.-X. Shen, et al.
Fig. 3. The specificity of the antibody for PaαAR and PaβAR. (A) The SDS-PAGE analysis of prokaryotic expressed PaαAR. Lane M: protein marker; 1 and 2: protein from BL21 (DE3) transformed with the pET32a-PaαAR plasmid before and after IPTG induction; 3: purified recombinant PaαAR. (B) Western blot analysis of the specificity of the antibody for PaαAR. 4: negative control; 5: purified recombinant PaαAR; 6: PaαAR in MO/MФ. (C) Western blot analysis of recombinant PaαAR and PaβAR using an anti-PaαAR antibody. 7: negative control; 8: purified recombinant PaαAR; 9: purified recombinant PaβAR. (D) SDS-PAGE analysis of prokaryotic expressed PaβAR. 10 and 11: protein from BL21 (DE3) transformed with the pET-32a-PaβAR plasmid before and after IPTG induction; 12: purified recombinant PaβAR. (E) Western blot analysis of the specificity of the antibody for PaβAR; 13: negative control; 14: purified recombinant PaβAR; 15: PaβAR in MO/MФ. (F) Western blot analysis of recombinant PaαAR and PaβAR with anti-PaβAR antibody. 16: negative control; 17: purified recombinant PaαAR; 18: purified recombinant PaβAR.
potentiated expression of anti-inflammatory factors in immune cells (Scanzano and Cosentino, 2015). In this study, it was found that NE decreased the mRNA expression of PaTNF-α and PaIL-1β, and increased the expression of PaIL-10 and PaTGF-β in infected ayu MO/MФ through PaβAR, but not through αAR. Another study has shown that NE can suppress TNF-α production and increase the production of IL-10 in isolated human monocytes (Ng and Toews, 2016). In rats, NE inhibits the secretion of TNF-α in cultured rat peritoneal macrophages (Li et al., 2015). Monocytes express βAR, and their activation is usually anti-inflammatory (Pinoli et al., 2017). The activation of αAR enhances the activity of macrophages and blocking of αAR inhibits the activation of
macrophages and the production of inflammatory cytokines (Huan et al., 2016). Therefore, NE in ayu results in an anti-inflammatory effect through βAR, which is consistent with the results in mammals. Phagocytic ability is an important property of MO/MΦ for defending against pathogenic bacterial infection (Salazar et al., 2016). In the teleost fishes, MO/MΦ have been shown to utilize phagocytosis to rapidly kill pathogens (Jiang et al., 2018). βAR can induce changes in critical functions of phagocytosis in macrophages (Kim et al., 2019). In this study, NE promoted phagocytosis in ayu MO/MΦ. After the RNAimediated knockdown of PaβAR expression, the phagocytosis of ayu MO/MФ was significantly downregulated compared to that of the
Fig. 4. The expression of PaαAR and PaβAR in MO/MΦ after V. anguillarum challenge. (A) RTqPCR analysis of PaαAR mRNA expression in ayu MO/MΦ after V. anguillarum treatment. (B) RT-qPCR analysis of PaβAR mRNA expression in ayu MO/MΦ after V. anguillarum challenge. Cells were collected at different time points post-infection. mRNA expression was normalized to that of 18S rRNA. Gene expression was measured as the fold change at different time points relative to PBS-treated cells. (C) Western blot analysis was performed to analyze variations in PaαAR and PaβAR protein expression in MO/MФ. Expression of PaαAR and PaβAR proteins was normalized to that of β-actin. Data are expressed as the mean ± SEM of the results from five fish. *p < 0.05. 7
Developmental and Comparative Immunology 103 (2020) 103513
H.-X. Shen, et al.
Fig. 5. Effect of PaαAR and PaβAR knockdown on the mRNA levels of PaIL-1β, PaTNF-α, PaIL-10, and PaTGF-β in V. anguillarum-treated ayu MO/MΦ. (A–B) Protein levels and mRNA expression of PaαAR in resting MO/MΦ treated with PaαAR siRNA. (C–D) Protein levels and mRNA expression of PaβAR in resting MO/MΦ treated with PaβAR siRNA. (E) mRNA expression of PaαAR in PaαAR siRNA-treated MO/MΦ stimulated with V. anguillarum for 4 h. (F) mRNA expression of PaβAR in PaβAR siRNA-treated MO/MΦ stimulated with V. anguillarum for 4 h. (G) MO/MΦ were treated with different concentrations of NE for 30 min, and the mRNA level of PaTNF-α was estimated by RT-qPCR. (H–K) mRNA expression of PaIL-1β, PaTNF-α, PaIL-10, and PaTGF-β in MO/MΦ treated with PaαAR siRNA. (L–O) mRNA expression of PaIL-1β, PaTNF-α, PaIL-10, and PaTGF-β in MO/MΦ treated with PaβAR siRNA. The mRNA levels of PaIL-1β, PaTNF-α, PaIL-10, and PaTGF-β were determined by RT-qPCR. Data are expressed as the mean ± SEM. N = 5. *p < 0.05.
8
Developmental and Comparative Immunology 103 (2020) 103513
H.-X. Shen, et al.
Fig. 6. Effect of PaβAR on the phagocytosis of ayu MO/MΦ. (A) Scatter plots in flow cytometry. (B) Flow cytometry of FITC fluorescence intensity in MO/MФ. (C) Relative mean fluorescence intensity (MFI) of MO/MФ. Effect of PaαAR on the phagocytosis of ayu MO/MΦ. (D) Scatter plots in flow cytometry. (E) Flow cytometry of FITC fluorescence intensity in MO/MФ. (F) Relative mean fluorescence intensity (MFI) of MO/MФ. Relative MFI was presented as the fold change with respect to the control, which was assigned a unit of 100. Data are expressed as the mean ± SEM of five independent experiments. *p < 0.05.
control in this study. This result is similar to that of a study that showed that NE could enhance the phagocytosis of bone marrow-derived macrophages in mice (Xiu et al., 2013). Therefore, we suggest that NE is involved in phagocytosis in ayu MO/MФ, and the effect of NE on phagocytosis is mediated by PaβAR. TLRs play an important role in innate immunity. Triggering of the TLR pathway leads to the regulation of immune and inflammatory genes/factors (Williams et al., 2018). NE was found to regulate cytokine expression in MO/MФ after stimulation with different TLR ligands in mice (Ağaç et al., 2018). Here, it was also found that NE suppressed the expression of PaTNF-α and PaIL-1β, and promoted the expression of PaIL-10 and PaTGF-β after stimulation with different TLR ligands in ayu MO/MФ. After PaβAR knockdown, the effects of NE on cytokines were eliminated. The TLR family—an important group of pattern recognition receptors—is essential for the immune response in teleost fish (Su et al.,
2015). There are distinct differences between teleost and mammalian TLR signaling. For example, the TLR ligand, LPS is relatively tolerant in the teleost (Novoa et al., 2009). In this study, it was found that NE regulated the function of the TLR ligands in both teleost and mice, suggesting that the regulatory effect of NE on TLR is essentially conservative despite the distinct differences between teleost and mammal TLR. In conclusion, αAR and βAR genes were characterized in ayu. The transcripts of PaαAR and PaβAR were upregulated in various immune tissues upon bacterial infection in ayu. It was shown that the function of NE in ayu MO/MФ is to improve the production of anti-inflammatory cytokines and phagocytosis. It was also found that the anti-inflammatory functions of NE were mediated by PaβAR. This research broadens our knowledge of the functions and mechanisms of ARs, and will assist in the control of various teleost diseases.
9
Developmental and Comparative Immunology 103 (2020) 103513
H.-X. Shen, et al.
Fig. 7. NE suppresses TLR-induced cytokine secretion through the PaβAR in ayu MO/MΦ. (A–C) mRNA levels of PaTNF-α in MO/MΦ treated with LPS, Pam3CSK4, or R837 after incubation with scrambled siRNA and PaβAR siRNA. (D–F) mRNA levels of PaIL-1β in MO/MΦ treated with LPS, Pam3CSK4, or R837 after incubation with scrambled siRNA and PaβAR siRNA. (G–I) mRNA levels of PaIL-10 in MO/MΦ treated with LPS, Pam3CSK4, or R837 after incubation with scrambled siRNA and PaβAR siRNA. (J–L) mRNA levels of PaTGF-β in MO/MΦ treated with LPS, Pam3CSK4, or R837 after incubation with scrambled siRNA and PaβAR siRNA. (M–O) mRNA levels of PaTNF-α in MO/MΦ treated with LPS, Pam3CSK4, or R837 after incubation with scrambled siRNA and PaαAR siRNA. (P–R) mRNA levels of PaIL-1β in MO/MΦ treated with LPS, Pam3CSK4, or R837 after incubation with scrambled siRNA and PaαAR siRNA. (S–U) mRNA levels of PaIL-10 in MO/MΦ treated with LPS, Pam3CSK4, or R837 after incubation with scrambled siRNA and PaαAR siRNA. (V–X) mRNA levels of PaTGF-β in MO/MΦ treated with LPS, Pam3CSK4, or R837 after incubation with scrambled siRNA and PaαAR siRNA. The value of the NE-treated group normalized to the control of a different group. Data are expressed as the mean ± SEM. N = 5. *p < 0.05.
10
Developmental and Comparative Immunology 103 (2020) 103513
H.-X. Shen, et al.
Acknowledgments
head kidney stimulated with Vibrio anguillarum bacterin. Fish Shellfish Immunol. 70, 736–749. Kim, T.H., Ly, C., Christodoulides, A., Nowell, C.J., Gunning, P.W., Sloan, E.K., Rowat, A.C., 2019. Stress hormone signaling through beta-adrenergic receptors regulates macrophage mechanotype and function. FASEB J. 33, 3997–4006. Li, M., Yang, X., Zhuang, C.C., Cao, Z., Ren, L.M., Xiu, C.Y., Li, Y.F., Zhu, Y.Z., 2015. NE strengthens the immunosuppression induced by AlCl 3 through β2-AR/cAMP pathway in cultured rat peritoneal macrophages. Biol. Trace Elem. Res. 164, 234–241. Li, C.H., Ding, F.F., Chen, J., Mo, L.B., Chen, J., 2018. Cloning, expression, and functional analyses of MHC class II A in ayu, Plecoglossus altivelis. Turk. J. Fish. Aquat. Sci. 18, 1091–1100. Lu, X.J., Chen, Q., Rong, Y.J., Chen, J., 2016a. Mobilisation and dysfunction of haematopoietic stem/progenitor cells after Listonella anguillarum infection in ayu, Plecoglossus altivelis. Sci. Rep. 6, 28082. Lu, X.J., Zhang, H., Yang, G.J., Li, M.Y., Chen, J., 2016b. Comparative transcriptome analysis on the alteration of gene expression in ayu (Plecoglossus altivelis) larvae associated with salinity change. Zool. Res. 37, 126–135. Lu, X.J., Chen, Q., Rong, Y.J., Chen, F., Chen, J., 2017a. CXCR3. 1 and CXCR3. 2 differentially contribute to macrophage polarization in teleost fish. J. Immunol. 198, 4692–4706. Lu, X.J., Chen, Q., Chen, J., Chen, J., 2017b. Molecular identification and functional analysis of KLF2 in Plecoglossus altivelis (ayu): it's regulatory role in monocyte/macrophage activation. Fish Shellfish Immunol. 62, 257–264. Nardocci, G., Navarro, C., Cortés, P.P., Imarai, M., Montoya, M., Valenzuela, B., Jara, P., Acuña-Castillo, C., Fernández, R., 2014. Neuroendocrine mechanisms for immune system regulation during stress in fish. Fish Shellfish Immunol. 40, 531–538. Némethy, A., Vavrinec, P., Vavrincová‐Yaghi, D., Čepcová, D., Mišúth, S., Král'ová, E., Čižmáriková, R., Račanská, E., 2017. Synthesis and biological evaluation of new combined α/β‐Adrenergic blockers. Arch. Pharm. 350, e201600394. Ng, T.M., Toews, M.L., 2016. Impaired norepinephrine regulation of monocyte inflammatory cytokine balance in heart failure. World J. Cardiol. 8, 584–589. Nickerson, J.G., Dugan, S.G., Drouin, G., Moon, T.W., 2001. A putative β2‐adrenoceptor from the rainbow trout (Oncorhynuchus mykiss) molecular characterization and pharmacology. Eur. J. Biochem. 268, 6465–6472. Nikinmaa, M., 2003. Beta3-adrenergic receptors–studies on rainbow trout reveal ancient evolutionary origins and functions distinct from the thermogenic response. Am. J. Physiol. Regul. Integr. Comp. Physiol. 285, R515–516. Noh, H., Yu, M.R., Kim, H.J., Lee, J.H., Park, B.W., Wu, I.H., Matsumoto, M., King, G.L., 2017. Beta 2-adrenergic receptor agonists are novelregulators of macrophage activation indiabetic renal and cardiovascular complications. Kidney Int. 92, 101–113. Novoa, B., Bowman, T.V., Zon, L., Figueras, A., 2009. LPS response and tolerance in the zebrafish (Danio rerio). Fish Shellfish Immunol. 26, 326–331. Pavlov, V.A., Chavan, S.S., Tracey, K.J., 2018. Molecular and functional neuroscience in immunity. Annu. Rev. Immunol. 36, 783–812. Pinoli, M., Marino, F., Cosentino, M., 2017. Dopaminergic regulation of innate immunity: a review. J. Neuroimmune Pharmacol. 12, 602–623. Ruuskanen, J.O., Laurila, J., Xhaard, H., Rantanen, V.V., Vuoriluoto, K., Wurster, S., Marjamaki, A., Vainio, M., Johnson, M.S., Scheinin, M., 2005a. Conserved structural, pharmacological and functional properties among the three human and five zebrafish alpha 2-adrenoceptors. Br. J. Pharmacol. 144, 165–177. Ruuskanen, J.O., Peitsaro, N., Kaslin, J.V., Panula, P., Scheinin, M., 2005b. Expression and function of α2‐adrenoceptors in zebrafish: drug effects, mRNA and receptor distributions. J. Neurochem. 94, 1559–1569. Salazar, S., Oliver, C., Yáñez, A.J., Avendaño-Herrera, R., 2016. Comparative analysis of innate immune responses to Streptococcus phocae strains in Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). Fish Shellfish Immunol. 51, 97–103. Scanzano, A., Cosentino, M., 2015. Adrenergic regulation of innate immunity: a review. Front. Pharmacol. 6, 171. Su, J.J., Su, J.G., Shang, X.Y., Wan, Q.Y., Chen, X.H., Rao, Y.L., 2015. SNP detection of TLR8 gene, association study with susceptibility/resistance to GCRV and regulation on mRNA expression in grass carp, Ctenopharyngodon idella. Fish Shellfish Immunol. 43, 1–12. Sun, Y.L., Li, Y.W., Rao, J.D., Liu, Z.H., Chen, Q.L., 2018. Effects of inorganic mercury exposure on histological structure, antioxidant status and immune response of immune organs in yellow catfish (Pelteobagrus fulvidraco). J. Appl. Toxicol. 38, 843–854. Wang, Z.P., Nishimura, Y., Shimada, Y., Umemoto, N., Hirano, M., Zang, L.Q., Oka, T., Sakamoto, C., Kuroyanagi, J., Tanaka, T., 2009. Zebrafish beta-adrenergic receptor mRNA expression and control of pigmentation. Gene 446, 18–27. Williams, L.M., Fuess, L.E., Brennan, J.J., Mansfield, K.M., Salas-Rodriguez, E., Welsh, J., Awtry, J., Banic, S., Chacko, C., Chezian, A., Dowers, D., Estrada, F., Hsieh, Y.H., Kang, J., Li, W., Malchiodi, Z., Malinowski, J., Matuszak, S., McTigue, T.4th., Mueller, D., Nguyen, B., Nguyen, M., Nguyen, P., Nguyen, S., Njoku, N., Patel, K., Pellegrini, W., Pliakas, T., Qadir, D., Ryan, E., Schiffer, A., Thiel, A., Yunes, S.A., Spilios, K.E., Pinzon, C.J.H., Mydlarz, L.D., Gilmore, T.D., 2018. A conserved Toll-like receptor-to-NF-kappaB signaling pathway in the endangered coral Orbicella faveolata. Dev. Comp. Immunol. 79, 128–136. Xiu, F.M., Stanojcic, M., Jeschke, M.G., 2013. Norepinephrine inhibits macrophage migration by decreasing CCR2 expression. PLoS One 8, e69167.
This project was supported by the Program for the Natural Science Foundation of China (41776151; 31772876), the Zhejiang Provincial Natural Science Foundation of China (LR18C040001; LZ18C190001), the Scientific Innovation Team Project of Ningbo (2015C110018) and the K.C. Wong Magna Fund in Ningbo University. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.dci.2019.103513. References Ağaç, D., Estrada, L.D., Maples, R., Hooper, L.V., Farrar, J.D., 2018. The beta2-adrenergic receptor controls inflammation by driving rapid IL-10 secretion. Brain Behav. Immun. 74, 176–185. Bevan, J.A., Bevan, R.D., Kite, K., Oriowo, M.A., 1988. Species differences in sensitivity of aortae to norepinephrine are related to α-adrenoceptor affinity. Trends Pharmacol. Sci. 9, 87–89. Bucsek, M.J., Giridharan, T., Macdonald, C.R., Hylander, B.L., Repasky, E.A., 2018. An overview of the role of sympathetic regulation of immune responses in infectious disease and autoimmunity. Int. J. Hyperth. 34, 135–143. Bylund, D.B., Eikenberg, D.C., Hieble, J.P., Langer, S.Z., Lefkowitz, R.J., Minneman, K.P., Molinoff, P.B., Jr, R.R., Trendelenburg, U., 1994. International union of pharmacology nomenclature of adrenoceptors. Pharmacol. Rev. 46, 121–136. Chadzinska, M., Tertil, E., Kepka, M., Hermsen, T., Scheer, M., Verburg-van Kemenade, B.M., 2012. Adrenergic regulation of the innate immune response in common carp (Cyprinus carpio L.). Dev. Comp. Immunol. 36, 306–316. Chavan, S.S., Tracey, K.J., 2017. Essential neuroscience in immunology. J. Immunol. 198, 3389–3397. Chen, W.H., Sun, L.T., Tsai, C.L., Song, Y.L., Chang, C.F., 2002. Cold-stress induced the modulation of catecholamines, cortisol, immunoglobulin M, and leukocyte phagocytosis in tilapia. Gen. Comp. Endocrinol. 126, 90–100. Chen, X., Perry, S.F., Aris-Brosou, S., Selva, C., Moon, T.W., 2007. Characterization and functional divergence of the α1-adrenoceptor gene family: insights from rainbow trout (Oncorhynchus mykiss). Physiol. Genom. 32, 142–153. Chen, Q., Lu, X.J., Li, M.Y., Chen, J., 2016. Molecular cloning, pathologically-correlated expression and functional characterization of the colony stimulating factor 1 receptor (CSF-1R) gene from a teleost, Plecoglossus altivelis. Zool. Res. 37, 96–102. Dugan, S.G., Lortie, M.B., Nickerson, J.G., Moon, T.W., 2003. Regulation of the rainbow trout (Oncorhynchus mykiss) hepatic β2-adrenoceptor by adrenergic agonists. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 136, 331–342. Dugan, S.G., Chen, X., Nickerson, J.G., Montpetit, C.J., Moon, T.W., 2008. Regulation of the black bullhead hepatic beta-adrenoceptors. Comparative biochemistry and physiology. Part B, Biochem. Mol. Biol. 149, 265–274. Exton, J.H., 1985. Mechanisms involved in alpha-adrenergic phenomena. Am. J. Physiol. 248, 633–647. Fabbri, E., Chen, X., Capuzzo, A., Moon, T.W., 2010. Binding kinetics and sequencing of hepatic alpha1-adrenergic receptors in two marine teleosts, mackerel (Scomber scombrus) and anchovy (Engraulis encrasicolus). J. Exp. Zool. A Ecol. Genet. Physiol. 309, 157–165. Finkenbine, S.S., Gettys, T.W., Burnett, K.G., 2002. Beta-adrenergic receptors on leukocytes of the channel catfish, Ictalurus punctatus. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 131, 27–37. Flory, C.M., 1990. Phylogeny of neuroimmunoregulation: effects of adrenergic and cholinergic agents on the in vitro antibody response of the rainbow trout, Onchorynchus mykiss. Dev. Comp. Immunol. 14, 283–294. Grayfer, L., Kerimoglu, B., Yaparla, A., Hodgkinson, J.W., Xie, J., Belosevic, M., 2018. Mechanisms of fish macrophage antimicrobial immunity. Front. Immunol. 9, 1105. Hodgkinson, J.W., Grayfer, L., Belosevic, M., 2015. Biology of bony fish macrophages. Biology (Basel) 4, 881–906. Huan, H.B., Wen, X.D., Chen, X.J., Wu, L., Wu, L.L., Zhang, L., Yang, D.P., Zhang, X., Bie, P., Qian, C., 2016. Sympathetic nervous system promotes hepatocarcinogenesis by modulating inflammation through activation of alpha1-adrenergic receptors of Kupffer cells. Brain Behav. Immun. 59, 118–134. Jiang, H., Hu, Y.Z., Wei, X.L., Xiao, X., Jakovlić, I., Liu, X.L., Su, J.G., Yuan, G.L., 2018. Chemotactic effect of β-defensin 1 on macrophages in Megalobrama amblycephala. Fish Shellfish Immunol. 74, 35–42. Jordan, J., Grassi, G., 2018. The norepinephrine transporter deserves more attention. J. Hypertens. 36, 1472–1474. Jozefowski, S.J., Plytycz, B., 1998. Characterization of beta-adrenergic receptors in fish and amphibian lymphoid organs. Dev. Comp. Immunol. 22, 587–603. Khansari, A.R., Parra, D., Reyes-López, F.E., Tort, L., 2017. Modulatory in vitro effect of stress hormones on the cytokine response of rainbow trout and gilthead sea bream
11