The effects of environmental salinity on trunk kidney proteome of juvenile ayu (Plecoglossus altivelis)

Comparative Biochemistry and Physiology, Part D 4 (2009) 263–267

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part D j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / c b p d

The effects of environmental salinity on trunk kidney proteome of juvenile ayu (Plecoglossus altivelis) Jiong Chen ⁎, Hai Q. Wu, Yu H. Shi, Chang H. Li, Ming Y. Li Faculty of Life Science and Biotechnology, Ningbo University, Ningbo city 315211, Zhejiang province, People's Republic of China

a r t i c l e

i n f o

Article history: Received 11 March 2009 Received in revised form 15 June 2009 Accepted 15 June 2009 Available online 24 June 2009 Keywords: MALDI-TOF-MS/MS Plecoglossus altivelis Real-time PCR Salinity Trunk kidney proteome Two dimensional gel electrophoresis

a b s t r a c t As the life cycle of ayu spans river, brackish and seawater environments, it would be a suitable fish model for studying the responses to salinity changes in aquatic animals. We investigated the effect of salinity on trunk kidney proteome in ayu (Plecoglossus altivelis) using two-dimensional gel electrophoresis and mass spectrometry. The proteins involved in the process of energy metabolism, biosynthesis, DNA methylation and cell differentiation were mainly affected, and 10 significantly changed proteins were identified. Our result showed that isocitrate dehydrogenase (ICD), pyruvate dehydrogenase (E1), O-glycosyl hydrolase, mitochondrial precursor of ATP synthase subunit beta, mitochondrial ferrtin (MtF), retinol binding protein (RBP) were down-regulated, whereas aldehyde dehydrogenase, cytokeratin 1, S-adenosylhomocysteine hydrolase, Cys-Met metabolism PLP-dependent enzyme were up-regulated when ayu transferred from freshwater to brackish water. Partial coding sequences of E1, ICD, MtF and RBP genes were determined, and the effects of salinity on their mRNA expression in ayu trunk kidney were tested by real-time PCR subsequently. Their possible direct or indirect roles in the adaptation of ayu to salinity are discussed. © 2009 Elsevier Inc. All rights reserved.

1. Introduction Freshwater (FW) fishes are hyperosmotic to the medium and constantly taking on water by diffusion through their skin and, to a much larger extent, through the thin membranes of their gills. Therefore, to maintain the high concentration of their body fluids, they must continuously excrete the excess water they have absorbed. This is accomplished by producing very dilute urine through the highly efficient trunk kidneys, and actively absorbing salt through the gills from the environment. In contrast, seawater fishes are hypotonic to the medium and passively lose water and gain salt. To compensate, they drink seawater and actively excrete most monovalent ions via the gills as well as the trunk kidneys (Moyle and Cech, 1982; Oguri, 1991). Therefore, the trunk kidneys play an important role in fluid and ion balance in fish. Early studies have largely described the structure and ultrastructure of the fish trunk kidney which changes according to the environmental salinity (Hwang and Wu, 1988; Mizuno et al., 2001). Recently, comparative studies have shown that the expression of some genes and proteins in fish trunk kidney are able to respond to

⁎ Corresponding author. Faculty of Life Science and Biotechnology, Ningbo University, Ningbo city 315211, Zhejiang province, People's Republic of China. Tel.: +86 574 87609571; fax: +86 574 87600167. E-mail address: [email protected] (J. Chen). 1744-117X/$ – see front matter © 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.cbd.2009.06.003

environmental salinity (Kalujnaia et al., 2007; Ky et al., 2007; Yada et al., 2008). However, the critical nodes in the gene networks where the environmental salinity acts to influence particular responses are likely to differ from one species to the other (Ky et al., 2007). Therefore, it seems necessary to study separately each fish species of economic importance when focusing on such biological processes. Ayu, Plecoglossus altivelis, the sole member of the Osmeriformes family Plecoglossidae, is a fish found only in streams and coastal waters in regions of Asia. Possessing a special smell and good taste, they are considered a popular and highly valued edible fish in Asia. Since the life cycle of ayu encompasses river, brackish and seawater environments, it would be also a suitable fish model for studying the responses of aquatic animals to environmental salinity (McDowall, 1992). The aim of the present work was to study ayu trunk kidney proteome, changes occurring during acclimation from FW to brackish water (BW), and, tentatively, to identify differentially expressed proteins. These patterns could prove useful markers of fresh-salt water transition. To this end, we combined a two-dimensional gel electrophoresis (2-DE) that separated proteins according to isoelectric point and molecular weight, with matrix assisted laser desorption ionization time-of-flight tandem mass spectrometry (MALDI-TOF-MS/ MS). Using MALDI-TOF-MS/MS, certain proteins were identified with reference to the NCBI non-redundant (NCBInr) protein database. Partial coding sequences of E1, ICD, MtF and RBP genes were determined, and the effects of salinity on their mRNA expression in ayu trunk kidney were tested by real-time PCR (RT-PCR)

264

J. Chen et al. / Comparative Biochemistry and Physiology, Part D 4 (2009) 263–267

Table 1 List of spots/proteins identified by MALDI-TOF-MS/MS analysis on the ayu trunk kidney 2-DE gel. Spota

Fold changeb

Protein namec

Accession numberd

Exp. Mr

Exp. pI

Functions

1 3 4 7 8 9 15 18 19 20

0.32 0.37 0.22 0.18 2.17 2.11 0.31 1.79 1.43 0.19

ATP synthase subunit beta, mitochondrial precursor Mitochondrial ferritin H-2 Pyruvate dehydrogenase (lipoamide) beta Retinol binding protein Aldehyde dehydrogenase S-adenosylhomocysteine hydrolase Isocitrate dehydrogenase Cys-Met metabolism PLP- dependent enzyme Cytokeratin-1 O-glycosyl hydrolase family 30

gi|47605558 gi|185133949 gi|47085923 gi|10697027 gi|44890712 gi|40363541 gi|41054651 gi|45360727 gi|1346343 gi|47225360

55212.9 20330 39283.1 24506.7 55267.9 47933.4 50364.5 43651.1 65978 64025.1

5.05 5.69 5.78 4.98 6.18 6.33 8.35 6.06 8.16 8.63

Energy metabolism Iron traffic Energy metabolism Lipid binding Energy metabolism Regulation of cellular methylation Energy metabolism Biosynthesis Cytoskeleton Energy metabolism

a b c d

Spot numbers correspond to those shown in Fig. 1. The cut off value for protein spot difference is 1.4, and all differences are consistent with t-test (P b 0.05). The fold change is defined as the photodensity ratios of corresponding protein spots in the gels of FW and BW samples. Accession number comes from NCBI non-redundant (NCBInr) protein database. Protein name is identified by results of MALDI-TOF-MS/MS, with proteins scores N59 and Total Ion C.I.% N 95%.

subsequently. Their possible roles in the adaptation of ayu to environmental salinity were also discussed.

CAPS buffer plus 15% methanol and Tris–CAPS buffer plus 0.1% SDS, respectively. After this second-dimension separation by SDS-PAGE, the gels were stained with Coomassie brilliant blue G-250.

2. Materials and methods 2.1. Fish and experimental conditions

2.4. Protein identification

About 40 specimens of juvenile ayu, weighing 20–25 g, were obtained from a commercial farm in Ningbo city, China. These fish were kept in 8 freshwater tanks at 20–22 °C in a circulating water system using filtered water, fed with commercial pellets once a day, and acclimatized to laboratory conditions for two weeks before experiments. Then the fish were subjected to BW (containing 0.17 M NaCl) in four tanks or to FW in the other four tanks over a period of 3 weeks, and fed with commercial pellets once a day.

The 2-DE image analysis was carried out using the PDQuest 2-D analysis software (Bio-Rad). Spots that showed significant difference between the two groups but no significant difference for three replicated within group samples were selected. To extract the corresponding proteins, selected spots were excised from the 2-DE gel, triturated, and washed with water. Proteins were reduced with 10 mM DTT in 100 mM NH4HCO3 (45 min, at 55 °C), and S-alkylated with 55 mM iodoacetamide in 100 mM NH4HCO3 (30 min, at 25 °C, in the dark). Gel particles were washed with 50 mM NH4HCO3 and acetonitrile, dried, and rehydrated with digestion solution (12.5 ng/μL of trypsin in 50 mM NH4HCO3). After incubation for 1 h at 4 °C, the supernatant digestion solution was replaced by 50 mM NH4HCO3, and gel particles were incubated overnight at 37 °C. Gel particles were further extracted with 25 mM NH4HCO3/acetonitrile (1:1 v/v), and overall peptide mixtures were freeze-dried. The peptides were dissolved with 5 μL matrix solution and sonicated for 2 min. A digested aliquot (1 μl) was analyzed by MALDI-TOF-MS/MS using a 4700 Proteomics Analyzer (Mass spectra, Applied Biosystems), and data were run in the NCBInr protein database using a Mascot search to identify the extracted proteins. The specific parameters were: error = 100 ppm; index mode = combined (MS + MS/MS); searching database parameter = trypsin; max missed cleavage = one; variable modifications = acetyl (N-term), carbamidomethyl (C), and oxidation (M); MS/MS Fragment Toleration = 0.2 Da; precursor tolerance = 0.2 Da; peptide charge = +1; maximun peptide rank = 10; minimum ion score C.I.% = 0.

2.2. Sample preparations Trunk kidney tissues of BW and FW fish were quickly washed in a cold rinse buffer containing a 1:20 dilution of protease inhibitor cocktail (Roche, New Jersey, USA) to remove cell debris and blood, and were then frozen by immersing in liquid nitrogen. Sample preparation and solubilization were performed according to the SWISS-2D PAGE sample preparation procedure with minor modification. Pooled BW sample and FW sample were obtained by combining equal amounts of extracted trunk kidney proteins from the 4 fish in each treatment group, respectively. Pooled samples are suitable for comparative proteomics and can minimize the effect of individual variation (Weinkauf et al., 2006). For each treatment group, frozen samples (approximately 10 mg) were crushed in a mortar containing liquid nitrogen, and mixed with 1.0 ml of a solution containing 7 M urea, 2 M thiourea, 4% CHAPS (w/v), 65 mM DTT, 0.2% v/v Ampholyte and a cocktail of protease inhibitors. The protein concentration of each pooled sample was determined according to Bradford's method (Bradford, 1976) using bovine serum albumin as a standard. 2.3. Two-dimensional gel electrophoresis Samples containing 2.0 mg of total protein were loaded in the rehydration step and separated in horizontal 2-DE using ReadyStrip IPG strips (Bio-Rad, Richmond, CA, USA). Isoelectric focusing (IEF) was performed using nonlinear immobility pH gradient (IPG) strips (0.5 × 180 mm, pH 5.0–8.0), run at 50 V for 14 h; 250 V for 1 h; 500 V for 1 h; 1000 V for 2 h; 9000 V for 8 h, 9000 V for 88,000 Vh using a Bio-Rad Protean IEF Cell (Bio-Rad, Richmond, CA, USA). After equilibration, reduction, and alkylation, the IPG strips were transferred onto 12% second-dimension slab gels, and then run on an SDS discontinuous system at 60 mA for 5 h using a BIO-RAD Criterion Dodeca Cell (Bio-Rad). Buffers at the anode and cathode were Tris–

Table 2 Oligonucleotide primers used to amplify the cDNA of selected ayu genes. Gene

Primer

Nucleotide sequence (5′ to 3′)

Lengtha

Accession no.b

E1

E1(+) E1(−) ICD(+) ICD(−) MtF(+) MtF(−) RBP(+) RBP(−) pActin2(+) pActin2(−)

GCAGTATCAGGGGATGCTG GCCCGCACCTGGATCAAG CTGTCCAACGTGGATGTGG CTCACGGAAGACGGTGCC CTGGAGGCCATGCAGTGT GGTAGTGGGTCTCCAGGA ATGACAGCCTCTGCCCAG CACAGAAACCTGTGTGTGG TCGTGCGTGACATCAAGGAG CGCACTTCATGATGCTGTTG

180

FN392683

237

FN392684

124

FN392682

367

FN392685

231

AB020884

ICD MtF RBP β-actin a b

Amplicon length in base pairs. The nucleotide sequences FN392682–FN392685 are determined in this paper.

J. Chen et al. / Comparative Biochemistry and Physiology, Part D 4 (2009) 263–267

265

Stratagene Mx3000P QPCR System (Agilent Technologies, La Jolla, USA). E1, ICD, MtF and RBP mRNA expression were normalized against β-actin mRNA expression. 3. Results 3.1. 2-DE gel and protein identification The 2-DE and Coomassie brilliant blue G-250 staining gave reproducible and reliable results for the three replications in each treatment group. The 2-DE pictures were normalized and analyzed by PDQuest 2-D analysis software. Compared with FW gel, 21 differentially expressed protein spots were selected by this software in BW gel. Spot 1–6, 7, 10, 12, 13, 15–17 and 20–21 were down-regulated when ayu adapted to BW, while others were up-regulated (Fig. 1). Those spots were subsequently analyzed by MALDI-TOF-MS/MS and 10 spots were successfully identified by Mascot search with reliable protein scores (N59) and Total Ion C.I.% (N95%) (Table 1). 3.2. Down-regulated proteins in BW gel E1 (spot 4) contributes to linking the glycolysis metabolic pathway to tricarboxylic acid cycle (TCA cycle), which is a major control point of the cycle (Williamson and Cooper, 1980). ICD (spot 15) catalyzes the third step of TCA cycle, which is the rate-limiting and irreversible step as well as the first NADH-yielding reaction of the TCA cycle (Williamson and Cooper, 1980). O-glycosyl hydrolase family 30 (Glyco_hydro_30) (spot 20) was an enzyme that hydrolyse the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a non-carbohydrate moiety. MtF (spot 3) may play a role in storing iron in the mitochondria. Retinol binding protein (RBP) (spot 7) is a protein involved in retinol (the animal form of Vitamin A) trafficking. ATP synthase subunit beta, mitochondrial precursor (spot 1) is an enzyme that can synthesize ATP from ADP and inorganic phosphate using some form of energy. 3.3. Up-regulated proteins in BW gel

Fig. 1. Coomassie brilliant blue G-250-stained 2-DE gels of (a) FW and (b) BW ayu trunk kidneys. A total of 2.0 mg of protein was loaded, and 2-DE was performed using a pH range of 5–8 in the first dimension, and SDS-PAGE (12%) in the second dimension. Using PDQuest 2-D analysis software, a cut off value of 1.4 was used to select out protein spots that showed significant difference (t-test, P b 0.05) in expression level between the FW and BW experimental groups. The selected protein spots were numbered for easy reference.

Aldehyde dehydrogenase (Aldhase) (spot 8) plays a role in the metabolism of many molecules including certain fats (cholesterol and other fatty acids) and protein building blocks (amino acids). Cytokeratin 1 (spot 19) is an intermediate filament keratin found in the intracytoplasmic cytoskeleton of epithelial tissue. S-adenosylhomocysteine hydrolase (AdoHcyase) (spot 9) has an important role in the regulation of processes such as transmethylation, trans-sulfuration and purine metabolism (Turner et al., 2000). Cys-Met metabolism PLP-

2.5. Gene expression analysis Total RNA was isolated from trunk kidneys using RNAiso regent (TaKaRa), treated with deoxyribonuclease I (TaKaRa, Kyoto, Japan) and reverse transcribed using Reverse Transcriptase M-MLV (RNase Hˉ) (TaKaRa). In order to correlate mRNA expression and protein abundance of selected proteins, the cDNAs of FW and BW ayu were subjected to RT-PCR analysis. Specific primer pairs of pyruvate dehydrogenase (E1), isocitrate dehydrogenase (ICD), mitochondrial ferrtin (MtF), retinol binding protein (RBP) and β-actin were designed according to the sequences of those ayu genes (Table 2). Approximately,1.0 μL of each reverse transcription reaction served as a template in 25 μL of RT-PCR reaction using SYBR premix Ex Taq (Perfect Real Time) (TaKaRa). Each RT-PCR reaction was carried out in triplicate with an initial denaturation step of 600 s at 95 °C, followed by an amplification of the target cDNA (35 cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s and with an extension time of 30 s at 72 °C) and performed with the

Fig. 2. Expression of E1, ICD, MtF and RBP mRNAs in ayu trunk kidney. Relative expression levels of mRNA are normalized against β-actin. Each bar represents the mean ± S.E.M. of the results from 4 ayu. “*”: significantly different from comparable values for FW ayu.

266

J. Chen et al. / Comparative Biochemistry and Physiology, Part D 4 (2009) 263–267

dependent enzyme (spot 18) was involved in biosynthesis of amino acids and amino acid-derived metabolites. 3.4. E1, ICD, MtF and RBP transcripts in ayu trunk kidney Transcript abundances of E1, ICD, MtF and RBP genes in ayu trunk kidney were determined by RT-PCR. In accord with the proteomic analysis, data indicated that long-time salinity treatment caused a significant down-regulation in the mRNA expression level of E1 (down to 0.26 fold), ICD (down to 0.39 fold), MtF (down to 0.12 fold) and RBP (down to 0.08 fold), normalized against β-actin in trunk kidney (Fig. 2). 4. Discussion Changes in the protein composition of fish tissues and fluids have been associated with different physiological conditions (Ky et al., 2007). In this study, a proteomics approach was employed to monitor the changes of trunk kidney proteome associated with the changes of environmental salinity. We found that the proteins with significant expression alteration were mainly involved in energy metabolism, biosynthesis, DNA methylation and cell differentiation. However, proteins involved in osmoregulation specifically had not been identified, and some of those proteins have never been mentioned in previous studies related to salinity acclimation. The use of whole trunk kidney may cause such a problem. This proteomic result is relevant to the previous functional genomic studies on sea bass (Dicentrachus labrax) and European eel (Anguilla anguilla) (Boutet et al., 2006; Kalujnaia et al., 2007). There are reports suggesting a strong effect of salinity on fish food intake and macronutrient selection (Rubio et al., 2005). In our investigation, transferring ayu fish from FW to BW only reduced food intake at first several days and returned to normal less than a week. Therefore, salinity on fish food intake is unlikely to be the major cause for the trunk kidney protein expression changes observed. A sufficient and timely energy supply is a prerequisite for the operation of osmoregulatory mechanism in fish (Tseng and Hwang, 2008), and our results might provide some indications on fish energetics of osmoregulation. TCA cycle is the central metabolic hub for the cell, and the gateway to the aerobic metabolism of any molecule that can be transformed into an acetyl group or dicarboxylic acid. The decreased expression of ICD in our results (Fig. 1; Table 1) indicates the down-regulation of TCA cycle when ayu fish transferred from FW to BW. Glyco_hydro_30 and E1 were down-regulated, and Aldhase was up-regulated (Fig. 1; Table 1), suggesting the downregulation of glucose metabolism and the up-regulation of lipid metabolism. Since most fish utilize lipids as the major energy source in contrast to mammals which mainly use carbohydrates (Watanabe, 1982), lipid metabolism appears more important for maintaining homeostasis in fish than that in homeotherms. It has been speculated that, after adaptation to BW, ayu trunk kidney might produce energy through pathways other than glycolysis. In fat snook (Centropomus parallelus), lipids were known to be important for meeting the metabolic requirements after long-term acclimation to a salinity (Rocha et al., 2005, 2007). The content of myo-inositol in the kidney of Mozambique tilapia (Oreochromis mossambicus) increased in parallel with plasma osmolality, possibly suggesting the increased utilization of lipids (Fiess et al., 2007). Triacylglycerols (TGs) have been documented to be a main form of lipid storage in fish (Ho et al., 2003). We also determined the concentration of serum TGs in ayu fish, and found that it was significantly higher in BW ayu (0.58 ± 0.08 mmol/L) than that in FW ayu (0.36 ± 0.05 mmol/L). Our result coincided with the previous reports that the plasma TGs of gilthead seabream (Sparus auratus) and Arctic char (Salvelinus alpinus) increased after long-term seawater acclimation (Aas-Hansen et al.,

2005; Sangiao-Alvarellos et al., 2003). Increases in the TG content suggest an enhanced capacity for oxidizing lipids in those species. Morgan and Iwama (1991) concluded that life habits appear, to a certain extent, to determine the type of metabolic response to salinity changes, i.e., the lowest metabolic rates are associated with the environment in which a species is most commonly found. Numerous studies have shown that 20 to N50% of the total fish energy budget are dedicated to osmoregulation (Boeuf and Payan, 2001). However, recent ones indicate that the osmotic cost is not as high (roughly 10%) as this (Kidder et al., 2006). In this study, mitochondrial precursor of ATP synthase subunit beta was down-regulated after ayu adapted to BW (Table 1), indicating the total energy demand by its trunk kidney decreased. However, there is no available data on energy cost in ayu to prove this. Mitochondrial ferritin (MtF) has many roles pertaining to molecular function such as iron storage in the mitochondria (Levi et al., 2001). TCA cycle and iron homeostasis may be interconnected due to the fact that iron perturbations positively modulate the expression of some TCA cycle enzymes including mitochondrial aconitase, citrate synthase, ICD, and succinate dehydrogenase by a translational mechanism (Cairo and Recalcati, 2007; Gray et al., 1996; Oexle et al., 1999). A low level of MtF might reflect the nature of low iron concentration in mitochondria (Table 1). Vitamin A metabolites, e.g. all-transand 9-cis-retinoic acids, are potential regulators of gene transcription, and play important roles in regulating cell proliferation and differentiation (Mangelsdorf et al., 1994). Previous study has shown that in Vitamin A deficiency, mucussecreting cells are replaced by keratin producing cells (Mclaren and Martin, 1997). Early studies also revealed that the structure and ultrastructure of the fish kidney would change according to the environmental salinity (Mizuno et al., 2001; Hwang and Wu, 1988). A down-regulation of RBP and an up-regulation on cytokeratin-1 were determined at the same time in the trunk kidney of ayu adapted to BW, suggesting a possible relationship between the two (Fig. 1; Table 1). However, there is no direct evidence proving that RBP/ cytokeratin-1 expression changes in ayu trunk kidney are the result of cell differentiation. The expression change of AdoHcyase would alter the ratio between adenosine and cAMP, which may be the cause of the DNA methylation and therefore transcription regulation (Coppin et al., 2008; Kloor and Osswald, 2004). In our study, one month adaptation for ayu in different salinity leads to the expression change of so many proteins involved in a wide range of functions, such as energy metabolism. The up-regulated AdoHcyase might be responsible for the complex DNA methylation, whose controlling function then result in these protein expression changes (Fig. 1; Table 1). And, the up-regulated Cys-Met metabolism PLP-dependent enzyme, involved in biosynthesis of amino acids and amino acid-derived metabolites, might reflect such enormous transition (Fig. 1; Table 1). Overall, the data indicate that protein expression in ayu trunk kidney could response to altered salinity (Fig. 1), and the changes of E1, ICD, MtF and RBP in mRNA levels are paralleled by their changes in proteins levels (Fig. 2). Although those proteins are not directly associated with ion or water transport, they are involved in the processes which have direct or indirect roles in the adaptation of ayu to environmental salinity. Sequencing of the ayu genome is progressing rapidly, and as more sequence data becomes available, proteomic profiling coupled with MALDI-TOF-MS/MS will be an increasingly powerful research tool in ayu studies. Acknowledgments We thank Dr M. J. Adams, Rothamsted Research, Harpenden, UK for help in correcting the English of the manuscript. The project was supported by the 973 Program (2008CB117015) and the KC Wong Magna Fund in Ningbo University.

J. Chen et al. / Comparative Biochemistry and Physiology, Part D 4 (2009) 263–267

References Aas-Hansen, O., Vijayan, M.M., Johnson, H.K., Cameron, C., Jørgensen, E.H., 2005. Resmoltification in wild, anadromous Arctic char (Salvelinus alpinus): a survey of osmoregulatory, metabolic, and endocrine changes preceding annual seawater migration. Can. J. Fish. Aquat. Sci. 62, 195–204. Boeuf, G., Payan, P., 2001. How should salinity influence fish growth? Comp. Biochem. Physiol. C 130, 411–423. Boutet, I., Long Ky, C.L., Bonhomme, F., 2006. A transcriptomic approach of salinity response in the euryhaline teleost, Dicentrarchus labrax. Gene 379, 40–50. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Cairo, G., Recalcati, S., 2007. Iron-regulatory proteins: molecular biology and pathophysiological implications. Expert. Rev. Mol. Med. 9, 1–13. Coppin, J.F., Qu, W., Waalkes, M.P., 2008. Interplay between cellular methyl metabolism and adaptive efflux during oncogenic transformation from chronic arsenic exposure in human cells. J. Biol. Chem. 283, 19342–19350. Fiess, J.C., Kunkel-Patterson, A., Mathias, L., Riley, L.G., Yancey, P.H., Hirano, T., Grau, E.G., 2007. Effects of environmental salinity and temperature on osmoregulatory ability, organic osmolytes, and plasma hormone profiles in the Mozambique tilapia (Oreochromis mossambicus). Comp. Biochem. Physiol. 146, 252–264. Gray, N.K., Pantopoulos, K., Dandekar, T., Ackrell, B.A., Hentze, M.W., 1996. Translational regulation of mammalian and Drosophila citric acid cycle enzymes via ironresponsive elements. Proc. Natl. Acad. Sci. U. S. A. 93, 4925–4930. Ho, S.Y., Pack, M., Farber, S.A., 2003. Analysis of small molecule metabolism in zebrafish. Methods Enzymol. 364, 408–426. Hwang, P.P., Wu, S.M., 1988. Salinity effects on cytometrical parameters of the kidney in the euryhaline teleost Oreochromic mossambicus Peters. J. Fish Biol. 33, 89–95. Kidder III, G.W., Petersen, C.W., Preston, R.L., 2006. Energetics of osmoregulation: II. Water flux and osmoregulatory work in the euryhaline fish, Fundulus heteroclitus. J. Exp. Zool. A Comp. Exp. Biol. 305, 318–327. Kalujnaia, S., McWilliam, I.S., Zaguinaiko, V.A., Feilen, A.L., Nicholson, J., Hazon, N., Cutler, C.P., Cramb, G., 2007. Transcriptomic approach to the study of osmoregulation in the European eel Anguilla anguilla. Physiol. Genomics 31, 385–401. Kloor, D., Osswald, H., 2004. S-Adenosylhomocysteine hydrolase as a target for intracellular adenosine action. Trends Pharmacol. Sci. 25, 294–297. Ky, C.L., de Lorgeril, J., Hirtz, C., Sommerer, N., Rossignol, M., Bonhomme, F., 2007. The effect of environmental salinity on the proteome of the sea bass (Dicentrarchus labrax L.). Anim. Genet. 38, 601–608. Levi, S., Corsi, B., Bosisio, M., Invernizzi, R., Volz, A., Sanford, D., Arosio, P., Drysdale, J., 2001. A human mitochondrial ferritin encoded by an intronless gene. J. Biol. Chem. 276, 24437–24440. Mangelsdorf, D.J., Umesono, K., Evans, R.M., 1994. The retinoid receptors, In: Sporn, M.B., Roberts, A.B., Goodman, D.S. (Eds.), The Retinoids: Biology, Chemistry, and Medicine, 2nd ed. Raven Press, New York, pp. 319–349.

267

McDowall, R.M., 1992. Diadromy: origins and definitions of terminology. Copeia 248–251. McLaren, D.S., Martin, F., 1997. Sight and life manual on Vitamin A deficiency disorders (VADD. Task Force Sight and Life, Basel, Switzerland. Mizuno, S., Misaka, N., Kasahara, N., 2001. Morphological changes in juxtaglomerular cells of the kidney during smoltification in masu salmon Oncorhynchus masou. Fish. Sci. 67, 538–540. Morgan, J.D., Iwama, G.K., 1991. Effects of salinity on growth, metabolism, and ion regulation in juvenile rainbow and steelhead trout (Oncorhynchus mykiss) and fall chinook salmon (Oncorhynchus tshawytscha). Can. J. Fish. Aquat. Sci. 48, 2083–2094. Moyle, P.B., Cech, J.J., 1982. Fishes: An Introduction to Ichthyology. Prentice-Hall, Englewood Cliffs, New Jersey. Oexle, H., Gnaiger, E., Weiss, G., 1999. Iron-dependent changes in cellular energy metabolism: influence on citric acid cycle and oxidative phosphorylation. Biochim. Biophys. Acta 1413, 99–107. Oguri, M., 1991. Kidney: its variety in function. In: Itazawa, Y., Hanyu, I. (Eds.), Fish Physiology Kouseishakonseikaku, Tokyo, pp. 103–123. Rocha, A.J., Gomes, V., Phan, V.N., Passos, M.J., Furia, R.R., 2005. Metabolic demand and growth of juveniles of Centropomus parallelus as function of salinity. J. Exp. Mar. Biol. Ecol. 316, 157–165. Rocha, A.J., Gomes, V., Ngan, P.V., Passos, M.J., Furia, R.R., 2007. Effects of anionic surfactant and salinity on the bioenergetics of juveniles of Centropomus parallelus (Poey). Ecotoxicol. Environ. Saf. 68, 397–404. Rubio, V.C., Sánchez-Vázquez, F.J., Madrid, J.A., 2005. Effects of salinity on food intake and macronutrient selection in European sea bass. Physiol. Behav. 85, 333–339. Sangiao-Alvarellos, S., Laiz-Carrión, R., Guzmán, J.M., Martin del Río, M.P., Miguez, J.M., Mancera, J.M., Soengas, J.L., 2003. Acclimation of S. aurata to various salinities alters energy metabolism of osmoregulatory and nonosmoregulatory organs. Am. J. Physiol. Regul. Integr. Comp. Physiol. 285, R897–R907. Tseng, Y.C., Hwang, P.P., 2008. Some insights into energy metabolism for osmoregulation in fish. Comp. Biochem. Physiol. C 148, 419–429. Turner, M.A., Yang, X., Yin, D., Kuczera, K., Borchardt, R.T., Howell, P.L., 2000. Structure and function of S-adenosylhomocysteine hydrolase. Cell Biochem. Biophys. 33, 101–125. Watanabe, T., 1982. Lipid nutrition in fish. Comp. Biochem. Physiol. 73B, 3–15. Weinkauf, M., Hiddemann, W., Dreyling, M., 2006. Sample pooling in 2-D gel electrophoresis: a new approach to reduce nonspecific expression background. Electrophoresis 27, 4555–4558. Williamson, J.R., Cooper, R.H., 1980. Regulation of the citric acid cycle in mammalian systems. FEBS Lett. 117 (Suppl), K73–K85. Yada, T., Hyodo, S., Schreck, C.B., 2008. Effects of seawater acclimation on mRNA levels of corticosteroid receptor genes in osmoregulatory and immune systems in trout. Gen. Comp. Endocrinol. 156, 622–627.