- Email: [email protected]
Biohydrogen production from crude glycerol by immobilized Klebsiella sp. TR17 in a UASB reactor and bacterial quantification under non-sterile conditions
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 4 ) 1 e8
Available online at www.sciencedirect.com
ScienceDirect journal homepage: www.elsevier.com/locate/he
Biohydrogen production from crude glycerol by immobilized Klebsiella sp. TR17 in a UASB reactor and bacterial quantification under non-sterile conditions Teera Chookaew a, Sompong O-Thong b, Poonsuk Prasertsan a,c,* a
Department of Industrial Biotechnology, Faculty of Agro-Industry, Prince of Songkla University, Songkhla 90112, Thailand b Department of Biology, Faculty of Science, Thaksin University, Phatthalung 93110, Thailand c Palm Oil Products and Technology Research Center (POPTEC), Faculty of Agro-Industry, Prince of Songkla University, Songkhla 90112, Thailand
article info
abstract
Article history:
Biohydrogen production from crude glycerol by immobilized Klebsiella sp. TR17 was
Received 9 September 2013
investigated in an up-flow anaerobic sludge blanket (UASB) reactor. The reactor was
Received in revised form
operated under non-sterile conditions at 40 C and initial pH 8.0 at different hydraulic
8 April 2014
retention times (HRTs) (2e12 h) and glycerol concentrations (10e30 g/L). Decreasing the
Accepted 12 April 2014
HRT led to an increase in hydrogen production rate (HPR) and hydrogen yield (HY). The
Available online xxx
B
highest HPR of 242.15 mmol H2/L/d and HY of 44.27 mmol H2/g glycerol consumed were achieved at 4 h HRT and glycerol concentrations of 30 and 10 g/L, respectively. The main
Keywords:
soluble metabolite was 1,3-propanediol, which implies that Klebsiella sp. was dominant
Biohydrogen
among other microorganisms. Fluorescence in situ hybridization (FISH) revealed that the
Crude glycerol
microbial community was dominated by Klebsiella sp. with 56.96, 59.45, and 63.47% of total
UASB reactor
DAPI binding cells, at glycerol concentrations of 10, 20, and 30 g/L, respectively.
Fluorescence in situ hybridization
Copyright ª 2014, Hydrogen Energy Publications, LLC. Published by Elsevier Ltd. All rights
(FISH)
Introduction Hydrogen has potential as a fuel for the future because it is clean and has a high energy yield compared with hydrocarbon fuels [1]. Among the biological methods of hydrogen production, dark fermentation has various advantages such as its ability to use a wide range of substrates and no requirement
reserved.
for a light source. Thus, this method is relatively energy saving and environmentally friendly [2,3]. Crude glycerol is a by-product obtained from biodiesel production. An increase in biodiesel production would inevitably result in an increase in crude glycerol production [4]. Crude glycerol has high levels of impurities and its disposal is costly and energy intensive [5]. In order to make biodiesel production more sustainable, the conversion of crude glycerol
* Corresponding author. Department of Industrial Biotechnology, Faculty of Agro-Industry, Prince of Songkla University, Songkhla 90112, Thailand. Fax: þ66 7455 8866. E-mail address: [email protected] (P. Prasertsan). http://dx.doi.org/10.1016/j.ijhydene.2014.04.083 0360-3199/Copyright ª 2014, Hydrogen Energy Publications, LLC. Published by Elsevier Ltd. All rights reserved.
Please cite this article in press as: Chookaew T, et al., Biohydrogen production from crude glycerol by immobilized Klebsiella sp. TR17 in a UASB reactor and bacterial quantification under non-sterile conditions, International Journal of Hydrogen Energy (2014), http://dx.doi.org/10.1016/j.ijhydene.2014.04.083
2
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 4 ) 1 e8
to a variety of value-added products, such as hydrogen [6], 1,3propanediol [7,8], 2,3-butanediol [9], and ethanol [10] has been studied. Conversion of crude glycerol to hydrogen is an attractive approach. Investigations on hydrogen production from dark fermentation have been focused on using pure cultures [11], in which the genus Clostridium has been most studied for various waste materials such as food wastes [12], palm oil mill effluent [13], and molasses [14]. However, Clostridium is an obligate anaerobe, requiring a strictly anaerobic condition which makes it difficult to use for industrial production [15]. Thus, using facultative bacteria for the conversion of crude glycerol to hydrogen by dark fermentation is more appropriate. Klebsiella sp. is able to convert crude glycerol to hydrogen at a high rate and yield [16,17]. It is also easy to grow and will produce various valuable by-products, such as 1,3propanediol, 2,3-butanediol [18], and ethanol [19]. To make it more attractive for industrial applications, hydrogen should be produced under non-sterile conditions to minimize production costs. Under these conditions, the microorganisms present in the reactor during operation should be quantified to determine the dominant strains. Up-flow anaerobic sludge blanket (UASB) reactor is an effective process in wastewater treatment systems as it exhibits high organic removal efficiency [20e22]. In addition, it has also been employed for hydrogen production from various substrates such as starch-wastewater [23], desugared molasses [24], coffee drink manufacturing wastewater [1], and cheese whey [25]. However, it has not been reported for hydrogen production from crude glycerol. The objective of this work is to investigate the hydrogen production from crude glycerol in a UASB reactor using Klebsiella sp. TR17 immobilized on heat-pretreated methanogenic granules under non-sterile conditions. Subsequently, the microbial communities in the UASB reactor were determined by fluorescence in situ hybridization (FISH) in order to evaluate the role of immobilized Klebsiella sp. TR17 in the fermentation system.
Materials and methods Microorganism and culture medium Klebsiella sp. TR17 (accession number in Genbank AB647144) was isolated from crude glycerol-contaminated soil. The optimum conditions for hydrogen production for this strain were pH 8.0 and temperature at 40 C [19]. The culture medium contained: 11.14 g/L glycerol, 3.4 g/L K2HPO4, 2.47 g/L KH2PO4, 6.03 g/L NH4Cl, 0.2 g/L MgSO4$7H2O, 2.0 g/L yeast extract, 2.0 g/ L CaCO3, 5.0 mg/L FeSO4$7H2O, 2.0 mg/L CaCl2, and 2.0 mL/L B
trace element solution [26]. The crude glycerol with 50% purity was obtained from the Biodiesel Pilot Plant at Prince of Songkla University.
Experimental set-up and operation of UASB reactors The 1.3 L UASB reactor (6 cm diameter 47 cm height) was made from glass with 1.0 L working volume and operated at 40 C with water internal jacket recirculation. Fresh medium was fed from the bottom by a peristaltic pump while the evolved gas and effluent were discharged from the top of the reactor. The methanogenic granules were obtained from a UASB reactor of a seafood wastewater treatment system (Chotiwat Manufacturing Co., Ltd., Songkhla Province, Thailand). The methanogenic granules were autoclaved at 121 C for 30 min to kill methanogenic activity before being used as carriers for immobilization of Klebsiella sp. TR17. For the set-up, 440 mL of the heat-pretreated methanogenic granules were transferred to each UASB reactors with 560 mL of the inoculum (OD660 ¼ 0.5) [27]. After inoculation, the reactors were operated in batch mode for 24 h and fed with 10 g/ L pure glycerol, then the culture medium was re-circulated for 7 days at 12 h HRT (flow rate of 1.38 mL/min) in order to enhance bacterial immobilization on the granules before changing to crude glycerol. After reaching steady state, the reactors were operated at the HRTs of 12, 10, 8, 6, 4, and 2 h, respectively. The steady state of each HRT was established when the value of the hydrogen production rate was less than 5% difference, and the final pH of the effluent was constant [28]. The culture media containing glycerol concentrations of 10, 20, and 30 g/L were fed to each UASB reactor. The reactors were monitored by examining the effluent every three days for volatile suspended solids (VSS) concentration, and measuring twice a day for soluble metabolic products and glycerol residuals. Gas production and pH were measured daily. B
Fluorescence in situ hybridization (FISH) The FISH technique was selected for detection and quantification of Klebsiella sp. TR17 immobilized on heat-pretreated methanogenic granules. The samples were taken from each UASB reactor with different glycerol concentrations (10, 20, 30 g/L) at the end of the operation experiments. Table 1 shows the list of the specific oligonucleotide probes and hybridization conditions used in this study. Probes labeled with the sulfoindocyanine dyes Cy3, EUB338 [29] and Enterbact D [30], were used for the hybridization to target all bacteria and Klebsiella sp., respectively. Fixation of samples started by adding 375 mL of sludge samples to 1125 mL of 4% (v/v) paraformaldehyde (pH 7.2). Then, the samples were mixed
Table 1 e Oligonucleotide probes used for FISH technique. Probe
Specificity
Sequence (50 to 30 )
FA (%)a
NaCl (M)b
Ref.
EUB338 Enterbact D
All bacteria Klebsiella sp.
GCTGCCTCCCGTAGGAGT TGCTCTCGCGAGGTCGCTTCTCTT
35 0
0.08 0.90
[29] [30]
a b
Formamide concentration in the hybridization buffer. Sodium chloride concentration in the washing buffer.
Please cite this article in press as: Chookaew T, et al., Biohydrogen production from crude glycerol by immobilized Klebsiella sp. TR17 in a UASB reactor and bacterial quantification under non-sterile conditions, International Journal of Hydrogen Energy (2014), http://dx.doi.org/10.1016/j.ijhydene.2014.04.083
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 4 ) 1 e8
and kept at 4 C for 4 h before being centrifuged at 13,000 g for 5 min. The supernatants were discarded and the cells were washed twice in phosphate buffered saline (PBS). The cell pellet was re-suspended in 150 mL of filter-sterilized PBS, then 150 mL of filter-sterilized 96% ethanol was added. The samples were mixed carefully and stored at 20 C [31]. The fixed samples were further processed for FISH following the procedure as described by Amann et al. [32]. Quantitative determination was analyzed by counting 25 microscopic fields of view per sample, and the dye 40 ,60 -diamidino-2-phenilindol (DAPI) stain was used to count the total number of cells (total DAPI binding cells). The quantification of each bacterial group was counted as the ratio of the area covered by samples stained with probes and DAPI to the area covered by DAPI B
B
Fig. 1 e Variation in (A) HPR, (B) HY, and (C) HC with respect to different combinations of HRTs and glycerol concentrations in the UASB reactors. In each panel, symbols are C for 10 g/L, - for 20 g/L, and : for 30 g/L.
3
stained samples alone. Slides were viewed under a microscope (Nikon Corporation, Japan) [24].
Analytical methods The volume of gas production was measured every day by using a gas meter with water replacement method. Hydrogen content in the biogas was determined using an Oldham MX2100 gas detector (Cambridge Sensotec Ltd., England) [33]. Glycerol and other metabolite products were determined by HPLC [19]. VSS represented in the biomass concentration were determined using the Standard Methods [34]. The hydrogen production rate (mmol H2/L/d) was calculated by measuring the total volume of hydrogen produced divided by the incubation time. The hydrogen yield (mmol H2/g glycerol consumed) was calculated by measuring
Fig. 2 e Variation in (A) biomass concentration, (B) glycerol conversion rate, and (C) final pH for different combinations of HRTs and glycerol concentrations in the UASB reactors. In each panel, symbols are C for 10 g/L, - for 20 g/L, and : for 30 g/L.
Please cite this article in press as: Chookaew T, et al., Biohydrogen production from crude glycerol by immobilized Klebsiella sp. TR17 in a UASB reactor and bacterial quantification under non-sterile conditions, International Journal of Hydrogen Energy (2014), http://dx.doi.org/10.1016/j.ijhydene.2014.04.083
4
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 4 ) 1 e8
the total volume of hydrogen produced divided by the glycerol consumed (g/L). The glycerol conversion rate was calculated by using the equation: [(IeF)/I] 100%, in which I and F are the initial and final glycerol concentrations (g/L), respectively [6].
Results and discussion Effect of HRTs and glycerol concentrations on hydrogen production in UASB reactors The variation of HRTs and glycerol concentrations led to the variation in hydrogen production rate (HPR), hydrogen yield (HY), and hydrogen content (HC) (Fig. 1). The optimum HRT
was at 4 h, giving the highest value for HPR (242.15 mmol H2/ L/d) and HY (44.27 mmol H2/g glycerol consumed). The value, based on COD, was 11.95 mmol H2/g COD consumed accounted for 58% of the theoretical yield. At 4 h HRT, increasing glycerol concentrations (10, 20, and 30 g/L) resulted in the increase of HPR (165.21, 210.44, and 242.15 mmol H2/L/d, respectively) with the decrease of HY (44.27, 29.85, and 29.00 mmol H2/g glycerol consumed, respectively) but had no effect on HC (42, 46, and 43%, respectively). Limitation of glycerol could lead to higher hydrogen yield as it favored the conversion of pyruvate to acetyl CoA [19]. The result of HC in this study was similar to that of Zhang et al. [35] and Lin et al. [36]. It should be noted that the decline of HPR and HY at 2 h HRT may possibly be attributed to too low mixing and poor contact of glycerol with the microorganisms. This
Fig. 3 e Time course profile of soluble metabolic products during the operation of UASB reactors: (A) 10 g/L glycerol concentration, (B) 20 g/L glycerol concentration, and (C) 30 g/L glycerol concentration. In each panel, symbols are A succinic ethanol, and C 1,3-propanediol. acid, D acetic acid, , 2,3-butanediol,
+
Please cite this article in press as: Chookaew T, et al., Biohydrogen production from crude glycerol by immobilized Klebsiella sp. TR17 in a UASB reactor and bacterial quantification under non-sterile conditions, International Journal of Hydrogen Energy (2014), http://dx.doi.org/10.1016/j.ijhydene.2014.04.083
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 4 ) 1 e8
agrees with Liu et al. [37] who studied the effect of HRT (from 24 to 4 h) on fresh leachate biodegradation using the expanded granular sludge bed (EGSB) reactor and found that the lowest biodegradation was obtained at the lowest HRT tested. Biological hydrogen production varies depending on source of substrate, bacterial strains, reactor types, and operating conditions [13,16,19,27]. Compared with other UASB systems, the maximum HPR (242.15 mmol H2/L/d or 10.1 mmol H2/L h) from this study was higher than those from previous reports such as from waste glycerol (6.2 mmol H2/L h) [38], glucose (8.9 mmol H2/L h) [39], and pure glycerol (9 mmol H2/L h) [38]. However, it was lower than thatfrom a study using sucrose (144.6 mmol H2/L h) [27].
Effect of HRTs and glycerol concentrations on biomass concentration (VSS) and glycerol conversion rate in UASB reactors The optimum HRT for growth at glycerol concentrations of 10 and 30 g/L was at 6 h while it was at 4 h HRT for 20 g/L glycerol (Fig. 2A). The maximum growth (7.89, 9.15, and 17.47 g VSS/L) increased with increased glycerol concentrations (at 10, 20, and 30 g/L, respectively). It should be noted that the increase of biomass (1.2 and 2.2 folds) were lower than the increase of glycerol concentrations (2 and 3 folds, respectively). Glycerol conversion rate tended to decrease with the decrease of HRT. Therefore, its maximum value was obtained at the maximum HRT tested (12 h HRT) with the values of 97.34, 79.88, and 64.65% at 10, 20, and 30 g/L glycerol, respectively. On the contrary, increasing the glycerol concentration from 10 to 30 g/L caused a decrease in the glycerol conversion rate from 46.94 to 32.09%, at 4 h HRT (Fig. 2B). A decrease in HRTs led to a decrease in glycerol conversion rate but an increase in HPR and HY. The reason might be that higher HRTs caused a lower substrate feeding rate and a longer time for substrate remaining in the system, resulting in the higher glycerol conversion rate [40]. During fermentation of glycerol to hydrogen, the increase of final pH with the decrease of HRTs was observed at all three glycerol concentrations tested (Fig. 2C). At 4 h HRT, the final pH values were 6.3, 6.6, and 6.3 from 10, 20, and 30 g/L glycerol concentrations, respectively. Klebsiella sp. TR17 utilize glycerol and produce alcohol (2,3-butanediol, 1,3propanediol, and ethanol) and organic acids (such as succinic acid, acetic acid) (Fig. 3), the same as Klebsiella pneumoniae SU6 [7]. The oxidative pathway of glycerol provides energy and reducing equivalents (NADH) for the biosynthesis. The most energy-advantageous metabolite product of this pathway is acetic acid, as its formation is connected with NAD þ regeneration and coenzyme A recycling. However, high acetic acid secretion leads to the pH drop and cell growth inhibition by the accumulation of its undissociated form [9]. It was reported that the accumulation of 2,3butanediol, acetic acid, and 1,3-propanediol was irregular in the fermentation system without a pH control [9]. The pHcontrolled (pH 6.5e7.0) strategy was found to enhance 1,3propanediol from K. pneumoniae SU6 in fed-batch fermentation [7].
5
Effect of HRTs and glycerol concentrations on soluble metabolites production in UASB reactors During UASB operation, Klebsiella sp. not only produced hydrogen but alsosuccinic acid, acetic acid, 1,3-propanediol, 2,3-butanediol, and ethanol (Fig. 3). The maximum 1,3propanediol, as the main soluble metabolic product, was achieved at 12 h HRT for all glycerol concentrations tested and the maximum value was 9.0 g/L at 20 g/L glycerol. 1,3Propanediol is considered to be a favorable metabolite for Klebsiella sp [19]. Thus, the presence of high concentrations of 1,3-propanediol in this study could imply the dominance of Klebsiella sp. that successfully immobilized on heatpretreated anaerobic sludge granules in the UASB reactor and played an important role for hydrogen production from glycerol. It has been reported that when glycerol was in excess (>20 g/L), more NADH2 was used for the formation of 1,3-propanediol than hydrogen production [19]. Thus, the experimental results indicated that excessive glycerol at higher HRTs should be implemented for production of 1,3propanediol. Decreasing HRTs also led to lower ethanol concentrations as the HPR increased in all glycerol concentrations tested. This result coincides with Zhang et al. [35] who reported that the concentration of ethanol decreased (from 13 to 6 mM) when the HRTs decreased (from 4 to 0.5 h) whereas the hydrogen production rate increased (from 0.4 to 2.2 L/L h).
Analysis of the microbial community by FISH The FISH technique was used to monitor the contribution of various microorganisms and for quantification of the selected species under study in the three UASB reactors with different glycerol concentrations. Microbial composition of the sludge samples from the granules in UASB reactors after the end of experiment was illustrated in Fig. 4. The microbial community of UASB reactors fed with glycerol concentrations of 10, 20, and 30 g/L was found to contain Eubacteria with 75.13%, 77.05%, and 80.8% of total DAPI binding cells, respectively. Among Eubacteria, Klebsiella sp. accounted for 56.96%,
Fig. 4 e Microbial compositions of sludge samples obtained from granules in hydrogen producing UASB reactors. The error bars indicate the standard deviations from a triplicate sampling analysis.
Please cite this article in press as: Chookaew T, et al., Biohydrogen production from crude glycerol by immobilized Klebsiella sp. TR17 in a UASB reactor and bacterial quantification under non-sterile conditions, International Journal of Hydrogen Energy (2014), http://dx.doi.org/10.1016/j.ijhydene.2014.04.083
6
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 4 ) 1 e8
Fig. 5 e Images of the hydrogen-producing sludge. (A), (C), and (E) are samples from UASB reactors with 10, 20, and 30 g/L of glycerol, respectively, stained with DAPI for total cells. (B), (D), and (F) are samples from UASB reactors with 10, 20, and 30 g/L of glycerol, respectively, probe Enterbact D hybridization and labeled with Cy3 for detected Klebsiella sp.
59.45%, and 63.47% of total DAPI binding cells, respectively. The FISH images (Fig. 5) showed that Klebsiella sp. accounted for more than 56% of total DAPI binding cells within the glycerol concentrations tested (10e30 g/L). The main soluble metabolic product in this study was 1,3-propanediol which confirmed that Klebsiella sp. TR17 was dominant in the UASB reactors.
Conclusion The HPR and HY of the immobilized Klebsiella sp. TR17 increased with the decrease of HRTs under non-sterile conditions in UASB reactors using crude glycerol as the substrate. However, the glycerol conversion rate tended to decrease as the HRTs decreased from 12 to 2 h. At 4 h HRT, HPR and HY reached their maximum values of 242.15 mmol H2/L/d and 44.27 mmol H2/g glycerol consumed at 30 g/L and 10 g/L respectively. Decreasing HRT and glycerol concentration resulted in the decrease of soluble metabolites, in which 1,3propanediol was the main product. From the FISH
technique, the highest ratio of Klebsiella sp. and Eubacteria (63.5% and 80.8% of total DAPI binding cells, respectively) were achieved at 30 g/L glycerol.
Acknowledgment The authors gratefully acknowledge the Royal Golden Jubilee Ph.D Program of the Thailand Research Fund for the financial support to Mr. Teera Chookaew under the Grant No. PHD/ 0095/2551, the Graduate School and the Faculty of AgroIndustry, Prince of Songkla University, Thailand.
references
[1] Jung KW, Kim DH, Shin HS. Continuous fermentative hydrogen production from coffee drink manufacturing wastewater by applying UASB reactor. Int J Hydrogen Energy 2010;35:13370e8.
Please cite this article in press as: Chookaew T, et al., Biohydrogen production from crude glycerol by immobilized Klebsiella sp. TR17 in a UASB reactor and bacterial quantification under non-sterile conditions, International Journal of Hydrogen Energy (2014), http://dx.doi.org/10.1016/j.ijhydene.2014.04.083
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 4 ) 1 e8
[2] Yossan S, O-Thong S, Prasertsan P. Effect of initial pH, nutrients and temperature on hydrogen production from palm oil mill effluent using thermotolerant consortia and corresponding microbial communities. Int J Hydrogen energy 2012;37:13806e14. [3] Chairattanamanokorn P, Penthamkeerati P, Reungsang A, Lo YC, Lu WB, Chang JS. Production of biohydrogen from hydrolyzed bagasse with thermally preheated sludge. Int J Hydrogen energy 2009;34:7612e7. [4] Amaral PFF, Ferreira TF, Fontes GC, Coelho MAZ. Glycerol valorization: new biotechnological routes. Food Bioprod Process 2009;87:179e86. [5] Saenge C, Cheirsilp B, Suksaroge TT, Bourtoom T. Potential use of oleaginous red yeast Rhodotorula glutinis for the bioconversion of crude glycerol from biodiesel plant to lipids and carotenoids. Process Biochem 2011;46:210e8. [6] Markov SA, Averitt J, Waldron B. Bioreactor for glycerol conversion into H2 by bacterium Enterobacter aerogenes. Int J Hydrogen energy 2011;36:262e6. [7] Sattayasamitsathit S, Methacanon P, Prasertsan P. Enhance 1,3-propanediol production from crude glycerol in batch and fed-batch fermentation with two-phase pH-controlled strategy. Electron J Biotechn 2011;14:1e11. [8] Mu Y, Teng H, Zhang DJ, Wang W, Xiu ZL. Microbial production of 1,3-propanediol by Klebsiella pneumoniae using crude glycerol from biodiesel preparations. Biotechnol Lett 2006;28:1755e9. [9] Petrov K, Petrova P. High production of 2,3-butanediol from glycerol by Klebsiella pneumoniae G31. Appl Microbiol Biotechnol 2009;84:659e65. [10] Choi WJ, Hartono MR, Chan WH, Yeo SS. Ethanol production from biodiesel-derived crude glycerol by newly isolated Kluyvera cryocrescens. Appl Microbiol Biotechnol 2011;89:1255e64. [11] Lee DJ, Show KY, Su A. Dark fermentation on biohydrogen production: pure culture. Bioresour Technol 2011;102:8389e402. [12] Kim JK, Nhat L, Chun YN, Kim SW. Hydrogen production conditions from food waste by dark fermentation with Clostridium beijerinckii KCTC 1785. Biotechnol Bioprocess Eng 2008;13:499e504. [13] Chong ML, Rahim RA, Shirai Y, Hassan MA. Biohydrogen production by Clostridium butyricum EB6 from palm oil mill effluent. Int J Hydrogen Energy 2009;34:764e71. [14] Wang X, Jin B. Process optimization of biological hydrogen production from molasses by a newly isolated Clostridium butyricum W5. J Biosci Bioeng 2009;107:138e44. [15] Marone A, Massini G, Patriarca C, Signorini A, Varrone C, Izzo G. Hydrogen production from vegetable waste by bioaugmentation of indigenous fermentative communities. Int J Hydrogen Energy 2012;37:5612e22. [16] Liu F, Fang BS. Optimization of bio-hydrogen production from biodiesel wastes by Klebsiella pneumoniae. J Biotechnol 2007;2:274e80. [17] Chen X, Sun Y, Xiu Z, Li X, Zhang D. Stoichiometric analysis of biological hydrogen production by fermentative bacteria. Int J Hydrogen Energy 2005;1:1e11. [18] Sattayasamitsathit S, Prasertsan P, Methacanon P. Statistical optimization for simultaneous production of 1,3-propanediol and 2,3-butanediol using crude glycerol by newly bacterial isolate. Process Biochem 2011;46:608e14. [19] Chookaew T, O-Thong S, Prasertsan P. Fermentative production of hydrogen and soluble metabolites from crude glycerol of biodiesel plant by the newly isolated thermotolerant Klebsiella pneumoniae TR17. Int J Hydrogen Energy 2012;37:13314e22. [20] Buzzini AP, Sakamoto IK, Varesche MB, Pires EC. Evaluation of the microbial diversity in an UASB reactor treating
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32]
[33]
[34]
[35]
[36]
7
wastewater from an unbleached pulp plant. Process Biochem 2006;41:168e76. Khemkhao M, Nuntakumjorn B, Techkarnjanaruk S, Phalakornkule C. UASB performance and microbial adaptation during a transition from mesophilic to thermophilic treatment of palm oil mill effluent. J Environ Manage 2012;103:74e82. Lopes SIC, Dreissen C, Capela MI, Lens PNL. Comparison of CSTR and UASB reactor configuration for the treatment of sulfate rich wastewaters under acidifying conditions. Enzyme Microb Tech 2008;43:471e9. Akutsu Y, Lee DY, Chi YZ, Li YY, Harada H, Yu HQ. Thermophilic fermentative hydrogen production from starch-wastewater with bio-granules. Int J Hydrogen Energy 2009;34:5061e71. Kongjan P, O-Thong S, Angelidaki I. Biohydrogen production from desugared molassess (DM) using thermophilic mixed cultures immobilized on heat treated anaerobic sludge granules. Int J Hydrogen Energy 2011;36:14261e9. Castello E, Santos CG, Iglesias T, Paolino G, Wenzel J, Borzacconi L, et al. Feasibility of biohydrogen production from cheese whey using a UASB reactor: Links between microbial community and reactor performance. Int J Hydrogen Energy 2009;34:5674e82. Chookaew T, O-Thong S, Prasertsan P. Statistical optimization of medium components affecting simultaneous fermentative hydrogen and ethanol production from crude glycerol by thermotolerant Klebsiella sp. TR17. Int J Hydrogen Energy 2014;39:751e60. O-Thong S, Prasertsan P, Karakashev D, Angelidaki I. Highrate continuous hydrogen production by Thermoanaerobacterium thermosaccharolyticum PSU-2 immobilized on heat-pretreated methanogenic granules. Int J Hydrogen Energy 2008;33:6498e508. Chang FY, Lin CY. Biohydrogen production using an up-flow anaerobic sludge blanket reactor. Int J Hydrogen Energy 2004;29:33e9. Tsuneda S, Nagano T, Hoshino T, Ejiri Y, Noda N, Hirata A. Characterization of nitrifying granules produced in an aerobic upflow fluidized bed reactor. Water Res 2003;37:4965e73. Ootsubo M, Shimizu T, Tanaka R, Sawabe T, Tajima K, Yoshimizu M, et al. Oligonucleotide probe for detecting Enterobacteriaceae by in situ hybridization. J Appl Microbiol 2002;93:60e8. Ogue-Bon E, Khoo C, McCartney AL, Gibson GR, Rastall RA. In vitro effects of symbiotic fermentation on the canine faecal microbiota. FEMS Microbiol Ecol 2010;73:587e600. Amann RI, Ludwig W, Schleifer KH. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol Rev 1995;59:143e69. O-Thong S, Prasertsan P, Birkeland NK. Evaluation of methods for preparing hydrogen-producing seed inocula under thermophilic condition by process performance and microbial community analysis. Bioresour Technol 2009;100:909e18. APHA. Standard methods for the examination of water and waste water. 19th ed. Washington, DC: American Public Health Association; 1995. Zhang ZP, Tay JH, Show KY, Yan R, Liang DT, Lee DJ, et al. Biohydrogen production in a granular activated carbon anaerobic fluidized bed reactor. Int J Hydrogen Energy 2007;32:185e91. Lin PJ, Chang JS, Yang LH, Lin CY, Wu SY, Lee KS. Enhancing the performance of pilot-scale fermentative hydrogen production by proper combinations of HRT and substrate concentration. Int J Hydrogen Energy 2011; 36:14289e94.
Please cite this article in press as: Chookaew T, et al., Biohydrogen production from crude glycerol by immobilized Klebsiella sp. TR17 in a UASB reactor and bacterial quantification under non-sterile conditions, International Journal of Hydrogen Energy (2014), http://dx.doi.org/10.1016/j.ijhydene.2014.04.083
8
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 4 ) 1 e8
[37] Liu Q, Zhang X, Yu L, Zhao A, Tai J, Liu J, et al. Fermentative hydrogen production from fresh leachate in batch and continuous bioreactors. Bioresour Technol 2011;102:5411e7. [38] Reungsang A, Sittijunda S, O-thong S. Bio-hydrogen production from glycerol by immobilized Enterobacter aerogenes ATCC 13048 on heat-treated UASB granules as affected by organic loading rate. Int J Hydrogen Energy 2013;38:6970e9.
[39] Zhang H, Bruns MA, Logan BE. Biological hydrogen production by Clostridium acetobutylicum in an unsaturated flow reactor. Water Res 2006;40:728e34. [40] Hung CH, Lee KS, Cheng LH, Huang YH, Lin PJ, Chang JS. Quantitative analysis of a high-rate hydrogen-producing microbial community in anaerobic agitated granular sludge bed bioreactors using glucose as substrate. Appl Microbiol Biotechnol 2007;75:693e701.
Please cite this article in press as: Chookaew T, et al., Biohydrogen production from crude glycerol by immobilized Klebsiella sp. TR17 in a UASB reactor and bacterial quantification under non-sterile conditions, International Journal of Hydrogen Energy (2014), http://dx.doi.org/10.1016/j.ijhydene.2014.04.083
Available online at www.sciencedirect.com
ScienceDirect journal homepage: www.elsevier.com/locate/he
Biohydrogen production from crude glycerol by immobilized Klebsiella sp. TR17 in a UASB reactor and bacterial quantification under non-sterile conditions Teera Chookaew a, Sompong O-Thong b, Poonsuk Prasertsan a,c,* a
Department of Industrial Biotechnology, Faculty of Agro-Industry, Prince of Songkla University, Songkhla 90112, Thailand b Department of Biology, Faculty of Science, Thaksin University, Phatthalung 93110, Thailand c Palm Oil Products and Technology Research Center (POPTEC), Faculty of Agro-Industry, Prince of Songkla University, Songkhla 90112, Thailand
article info
abstract
Article history:
Biohydrogen production from crude glycerol by immobilized Klebsiella sp. TR17 was
Received 9 September 2013
investigated in an up-flow anaerobic sludge blanket (UASB) reactor. The reactor was
Received in revised form
operated under non-sterile conditions at 40 C and initial pH 8.0 at different hydraulic
8 April 2014
retention times (HRTs) (2e12 h) and glycerol concentrations (10e30 g/L). Decreasing the
Accepted 12 April 2014
HRT led to an increase in hydrogen production rate (HPR) and hydrogen yield (HY). The
Available online xxx
B
highest HPR of 242.15 mmol H2/L/d and HY of 44.27 mmol H2/g glycerol consumed were achieved at 4 h HRT and glycerol concentrations of 30 and 10 g/L, respectively. The main
Keywords:
soluble metabolite was 1,3-propanediol, which implies that Klebsiella sp. was dominant
Biohydrogen
among other microorganisms. Fluorescence in situ hybridization (FISH) revealed that the
Crude glycerol
microbial community was dominated by Klebsiella sp. with 56.96, 59.45, and 63.47% of total
UASB reactor
DAPI binding cells, at glycerol concentrations of 10, 20, and 30 g/L, respectively.
Fluorescence in situ hybridization
Copyright ª 2014, Hydrogen Energy Publications, LLC. Published by Elsevier Ltd. All rights
(FISH)
Introduction Hydrogen has potential as a fuel for the future because it is clean and has a high energy yield compared with hydrocarbon fuels [1]. Among the biological methods of hydrogen production, dark fermentation has various advantages such as its ability to use a wide range of substrates and no requirement
reserved.
for a light source. Thus, this method is relatively energy saving and environmentally friendly [2,3]. Crude glycerol is a by-product obtained from biodiesel production. An increase in biodiesel production would inevitably result in an increase in crude glycerol production [4]. Crude glycerol has high levels of impurities and its disposal is costly and energy intensive [5]. In order to make biodiesel production more sustainable, the conversion of crude glycerol
* Corresponding author. Department of Industrial Biotechnology, Faculty of Agro-Industry, Prince of Songkla University, Songkhla 90112, Thailand. Fax: þ66 7455 8866. E-mail address: [email protected] (P. Prasertsan). http://dx.doi.org/10.1016/j.ijhydene.2014.04.083 0360-3199/Copyright ª 2014, Hydrogen Energy Publications, LLC. Published by Elsevier Ltd. All rights reserved.
Please cite this article in press as: Chookaew T, et al., Biohydrogen production from crude glycerol by immobilized Klebsiella sp. TR17 in a UASB reactor and bacterial quantification under non-sterile conditions, International Journal of Hydrogen Energy (2014), http://dx.doi.org/10.1016/j.ijhydene.2014.04.083
2
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 4 ) 1 e8
to a variety of value-added products, such as hydrogen [6], 1,3propanediol [7,8], 2,3-butanediol [9], and ethanol [10] has been studied. Conversion of crude glycerol to hydrogen is an attractive approach. Investigations on hydrogen production from dark fermentation have been focused on using pure cultures [11], in which the genus Clostridium has been most studied for various waste materials such as food wastes [12], palm oil mill effluent [13], and molasses [14]. However, Clostridium is an obligate anaerobe, requiring a strictly anaerobic condition which makes it difficult to use for industrial production [15]. Thus, using facultative bacteria for the conversion of crude glycerol to hydrogen by dark fermentation is more appropriate. Klebsiella sp. is able to convert crude glycerol to hydrogen at a high rate and yield [16,17]. It is also easy to grow and will produce various valuable by-products, such as 1,3propanediol, 2,3-butanediol [18], and ethanol [19]. To make it more attractive for industrial applications, hydrogen should be produced under non-sterile conditions to minimize production costs. Under these conditions, the microorganisms present in the reactor during operation should be quantified to determine the dominant strains. Up-flow anaerobic sludge blanket (UASB) reactor is an effective process in wastewater treatment systems as it exhibits high organic removal efficiency [20e22]. In addition, it has also been employed for hydrogen production from various substrates such as starch-wastewater [23], desugared molasses [24], coffee drink manufacturing wastewater [1], and cheese whey [25]. However, it has not been reported for hydrogen production from crude glycerol. The objective of this work is to investigate the hydrogen production from crude glycerol in a UASB reactor using Klebsiella sp. TR17 immobilized on heat-pretreated methanogenic granules under non-sterile conditions. Subsequently, the microbial communities in the UASB reactor were determined by fluorescence in situ hybridization (FISH) in order to evaluate the role of immobilized Klebsiella sp. TR17 in the fermentation system.
Materials and methods Microorganism and culture medium Klebsiella sp. TR17 (accession number in Genbank AB647144) was isolated from crude glycerol-contaminated soil. The optimum conditions for hydrogen production for this strain were pH 8.0 and temperature at 40 C [19]. The culture medium contained: 11.14 g/L glycerol, 3.4 g/L K2HPO4, 2.47 g/L KH2PO4, 6.03 g/L NH4Cl, 0.2 g/L MgSO4$7H2O, 2.0 g/L yeast extract, 2.0 g/ L CaCO3, 5.0 mg/L FeSO4$7H2O, 2.0 mg/L CaCl2, and 2.0 mL/L B
trace element solution [26]. The crude glycerol with 50% purity was obtained from the Biodiesel Pilot Plant at Prince of Songkla University.
Experimental set-up and operation of UASB reactors The 1.3 L UASB reactor (6 cm diameter 47 cm height) was made from glass with 1.0 L working volume and operated at 40 C with water internal jacket recirculation. Fresh medium was fed from the bottom by a peristaltic pump while the evolved gas and effluent were discharged from the top of the reactor. The methanogenic granules were obtained from a UASB reactor of a seafood wastewater treatment system (Chotiwat Manufacturing Co., Ltd., Songkhla Province, Thailand). The methanogenic granules were autoclaved at 121 C for 30 min to kill methanogenic activity before being used as carriers for immobilization of Klebsiella sp. TR17. For the set-up, 440 mL of the heat-pretreated methanogenic granules were transferred to each UASB reactors with 560 mL of the inoculum (OD660 ¼ 0.5) [27]. After inoculation, the reactors were operated in batch mode for 24 h and fed with 10 g/ L pure glycerol, then the culture medium was re-circulated for 7 days at 12 h HRT (flow rate of 1.38 mL/min) in order to enhance bacterial immobilization on the granules before changing to crude glycerol. After reaching steady state, the reactors were operated at the HRTs of 12, 10, 8, 6, 4, and 2 h, respectively. The steady state of each HRT was established when the value of the hydrogen production rate was less than 5% difference, and the final pH of the effluent was constant [28]. The culture media containing glycerol concentrations of 10, 20, and 30 g/L were fed to each UASB reactor. The reactors were monitored by examining the effluent every three days for volatile suspended solids (VSS) concentration, and measuring twice a day for soluble metabolic products and glycerol residuals. Gas production and pH were measured daily. B
Fluorescence in situ hybridization (FISH) The FISH technique was selected for detection and quantification of Klebsiella sp. TR17 immobilized on heat-pretreated methanogenic granules. The samples were taken from each UASB reactor with different glycerol concentrations (10, 20, 30 g/L) at the end of the operation experiments. Table 1 shows the list of the specific oligonucleotide probes and hybridization conditions used in this study. Probes labeled with the sulfoindocyanine dyes Cy3, EUB338 [29] and Enterbact D [30], were used for the hybridization to target all bacteria and Klebsiella sp., respectively. Fixation of samples started by adding 375 mL of sludge samples to 1125 mL of 4% (v/v) paraformaldehyde (pH 7.2). Then, the samples were mixed
Table 1 e Oligonucleotide probes used for FISH technique. Probe
Specificity
Sequence (50 to 30 )
FA (%)a
NaCl (M)b
Ref.
EUB338 Enterbact D
All bacteria Klebsiella sp.
GCTGCCTCCCGTAGGAGT TGCTCTCGCGAGGTCGCTTCTCTT
35 0
0.08 0.90
[29] [30]
a b
Formamide concentration in the hybridization buffer. Sodium chloride concentration in the washing buffer.
Please cite this article in press as: Chookaew T, et al., Biohydrogen production from crude glycerol by immobilized Klebsiella sp. TR17 in a UASB reactor and bacterial quantification under non-sterile conditions, International Journal of Hydrogen Energy (2014), http://dx.doi.org/10.1016/j.ijhydene.2014.04.083
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 4 ) 1 e8
and kept at 4 C for 4 h before being centrifuged at 13,000 g for 5 min. The supernatants were discarded and the cells were washed twice in phosphate buffered saline (PBS). The cell pellet was re-suspended in 150 mL of filter-sterilized PBS, then 150 mL of filter-sterilized 96% ethanol was added. The samples were mixed carefully and stored at 20 C [31]. The fixed samples were further processed for FISH following the procedure as described by Amann et al. [32]. Quantitative determination was analyzed by counting 25 microscopic fields of view per sample, and the dye 40 ,60 -diamidino-2-phenilindol (DAPI) stain was used to count the total number of cells (total DAPI binding cells). The quantification of each bacterial group was counted as the ratio of the area covered by samples stained with probes and DAPI to the area covered by DAPI B
B
Fig. 1 e Variation in (A) HPR, (B) HY, and (C) HC with respect to different combinations of HRTs and glycerol concentrations in the UASB reactors. In each panel, symbols are C for 10 g/L, - for 20 g/L, and : for 30 g/L.
3
stained samples alone. Slides were viewed under a microscope (Nikon Corporation, Japan) [24].
Analytical methods The volume of gas production was measured every day by using a gas meter with water replacement method. Hydrogen content in the biogas was determined using an Oldham MX2100 gas detector (Cambridge Sensotec Ltd., England) [33]. Glycerol and other metabolite products were determined by HPLC [19]. VSS represented in the biomass concentration were determined using the Standard Methods [34]. The hydrogen production rate (mmol H2/L/d) was calculated by measuring the total volume of hydrogen produced divided by the incubation time. The hydrogen yield (mmol H2/g glycerol consumed) was calculated by measuring
Fig. 2 e Variation in (A) biomass concentration, (B) glycerol conversion rate, and (C) final pH for different combinations of HRTs and glycerol concentrations in the UASB reactors. In each panel, symbols are C for 10 g/L, - for 20 g/L, and : for 30 g/L.
Please cite this article in press as: Chookaew T, et al., Biohydrogen production from crude glycerol by immobilized Klebsiella sp. TR17 in a UASB reactor and bacterial quantification under non-sterile conditions, International Journal of Hydrogen Energy (2014), http://dx.doi.org/10.1016/j.ijhydene.2014.04.083
4
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 4 ) 1 e8
the total volume of hydrogen produced divided by the glycerol consumed (g/L). The glycerol conversion rate was calculated by using the equation: [(IeF)/I] 100%, in which I and F are the initial and final glycerol concentrations (g/L), respectively [6].
Results and discussion Effect of HRTs and glycerol concentrations on hydrogen production in UASB reactors The variation of HRTs and glycerol concentrations led to the variation in hydrogen production rate (HPR), hydrogen yield (HY), and hydrogen content (HC) (Fig. 1). The optimum HRT
was at 4 h, giving the highest value for HPR (242.15 mmol H2/ L/d) and HY (44.27 mmol H2/g glycerol consumed). The value, based on COD, was 11.95 mmol H2/g COD consumed accounted for 58% of the theoretical yield. At 4 h HRT, increasing glycerol concentrations (10, 20, and 30 g/L) resulted in the increase of HPR (165.21, 210.44, and 242.15 mmol H2/L/d, respectively) with the decrease of HY (44.27, 29.85, and 29.00 mmol H2/g glycerol consumed, respectively) but had no effect on HC (42, 46, and 43%, respectively). Limitation of glycerol could lead to higher hydrogen yield as it favored the conversion of pyruvate to acetyl CoA [19]. The result of HC in this study was similar to that of Zhang et al. [35] and Lin et al. [36]. It should be noted that the decline of HPR and HY at 2 h HRT may possibly be attributed to too low mixing and poor contact of glycerol with the microorganisms. This
Fig. 3 e Time course profile of soluble metabolic products during the operation of UASB reactors: (A) 10 g/L glycerol concentration, (B) 20 g/L glycerol concentration, and (C) 30 g/L glycerol concentration. In each panel, symbols are A succinic ethanol, and C 1,3-propanediol. acid, D acetic acid, , 2,3-butanediol,
+
Please cite this article in press as: Chookaew T, et al., Biohydrogen production from crude glycerol by immobilized Klebsiella sp. TR17 in a UASB reactor and bacterial quantification under non-sterile conditions, International Journal of Hydrogen Energy (2014), http://dx.doi.org/10.1016/j.ijhydene.2014.04.083
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 4 ) 1 e8
agrees with Liu et al. [37] who studied the effect of HRT (from 24 to 4 h) on fresh leachate biodegradation using the expanded granular sludge bed (EGSB) reactor and found that the lowest biodegradation was obtained at the lowest HRT tested. Biological hydrogen production varies depending on source of substrate, bacterial strains, reactor types, and operating conditions [13,16,19,27]. Compared with other UASB systems, the maximum HPR (242.15 mmol H2/L/d or 10.1 mmol H2/L h) from this study was higher than those from previous reports such as from waste glycerol (6.2 mmol H2/L h) [38], glucose (8.9 mmol H2/L h) [39], and pure glycerol (9 mmol H2/L h) [38]. However, it was lower than thatfrom a study using sucrose (144.6 mmol H2/L h) [27].
Effect of HRTs and glycerol concentrations on biomass concentration (VSS) and glycerol conversion rate in UASB reactors The optimum HRT for growth at glycerol concentrations of 10 and 30 g/L was at 6 h while it was at 4 h HRT for 20 g/L glycerol (Fig. 2A). The maximum growth (7.89, 9.15, and 17.47 g VSS/L) increased with increased glycerol concentrations (at 10, 20, and 30 g/L, respectively). It should be noted that the increase of biomass (1.2 and 2.2 folds) were lower than the increase of glycerol concentrations (2 and 3 folds, respectively). Glycerol conversion rate tended to decrease with the decrease of HRT. Therefore, its maximum value was obtained at the maximum HRT tested (12 h HRT) with the values of 97.34, 79.88, and 64.65% at 10, 20, and 30 g/L glycerol, respectively. On the contrary, increasing the glycerol concentration from 10 to 30 g/L caused a decrease in the glycerol conversion rate from 46.94 to 32.09%, at 4 h HRT (Fig. 2B). A decrease in HRTs led to a decrease in glycerol conversion rate but an increase in HPR and HY. The reason might be that higher HRTs caused a lower substrate feeding rate and a longer time for substrate remaining in the system, resulting in the higher glycerol conversion rate [40]. During fermentation of glycerol to hydrogen, the increase of final pH with the decrease of HRTs was observed at all three glycerol concentrations tested (Fig. 2C). At 4 h HRT, the final pH values were 6.3, 6.6, and 6.3 from 10, 20, and 30 g/L glycerol concentrations, respectively. Klebsiella sp. TR17 utilize glycerol and produce alcohol (2,3-butanediol, 1,3propanediol, and ethanol) and organic acids (such as succinic acid, acetic acid) (Fig. 3), the same as Klebsiella pneumoniae SU6 [7]. The oxidative pathway of glycerol provides energy and reducing equivalents (NADH) for the biosynthesis. The most energy-advantageous metabolite product of this pathway is acetic acid, as its formation is connected with NAD þ regeneration and coenzyme A recycling. However, high acetic acid secretion leads to the pH drop and cell growth inhibition by the accumulation of its undissociated form [9]. It was reported that the accumulation of 2,3butanediol, acetic acid, and 1,3-propanediol was irregular in the fermentation system without a pH control [9]. The pHcontrolled (pH 6.5e7.0) strategy was found to enhance 1,3propanediol from K. pneumoniae SU6 in fed-batch fermentation [7].
5
Effect of HRTs and glycerol concentrations on soluble metabolites production in UASB reactors During UASB operation, Klebsiella sp. not only produced hydrogen but alsosuccinic acid, acetic acid, 1,3-propanediol, 2,3-butanediol, and ethanol (Fig. 3). The maximum 1,3propanediol, as the main soluble metabolic product, was achieved at 12 h HRT for all glycerol concentrations tested and the maximum value was 9.0 g/L at 20 g/L glycerol. 1,3Propanediol is considered to be a favorable metabolite for Klebsiella sp [19]. Thus, the presence of high concentrations of 1,3-propanediol in this study could imply the dominance of Klebsiella sp. that successfully immobilized on heatpretreated anaerobic sludge granules in the UASB reactor and played an important role for hydrogen production from glycerol. It has been reported that when glycerol was in excess (>20 g/L), more NADH2 was used for the formation of 1,3-propanediol than hydrogen production [19]. Thus, the experimental results indicated that excessive glycerol at higher HRTs should be implemented for production of 1,3propanediol. Decreasing HRTs also led to lower ethanol concentrations as the HPR increased in all glycerol concentrations tested. This result coincides with Zhang et al. [35] who reported that the concentration of ethanol decreased (from 13 to 6 mM) when the HRTs decreased (from 4 to 0.5 h) whereas the hydrogen production rate increased (from 0.4 to 2.2 L/L h).
Analysis of the microbial community by FISH The FISH technique was used to monitor the contribution of various microorganisms and for quantification of the selected species under study in the three UASB reactors with different glycerol concentrations. Microbial composition of the sludge samples from the granules in UASB reactors after the end of experiment was illustrated in Fig. 4. The microbial community of UASB reactors fed with glycerol concentrations of 10, 20, and 30 g/L was found to contain Eubacteria with 75.13%, 77.05%, and 80.8% of total DAPI binding cells, respectively. Among Eubacteria, Klebsiella sp. accounted for 56.96%,
Fig. 4 e Microbial compositions of sludge samples obtained from granules in hydrogen producing UASB reactors. The error bars indicate the standard deviations from a triplicate sampling analysis.
Please cite this article in press as: Chookaew T, et al., Biohydrogen production from crude glycerol by immobilized Klebsiella sp. TR17 in a UASB reactor and bacterial quantification under non-sterile conditions, International Journal of Hydrogen Energy (2014), http://dx.doi.org/10.1016/j.ijhydene.2014.04.083
6
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 4 ) 1 e8
Fig. 5 e Images of the hydrogen-producing sludge. (A), (C), and (E) are samples from UASB reactors with 10, 20, and 30 g/L of glycerol, respectively, stained with DAPI for total cells. (B), (D), and (F) are samples from UASB reactors with 10, 20, and 30 g/L of glycerol, respectively, probe Enterbact D hybridization and labeled with Cy3 for detected Klebsiella sp.
59.45%, and 63.47% of total DAPI binding cells, respectively. The FISH images (Fig. 5) showed that Klebsiella sp. accounted for more than 56% of total DAPI binding cells within the glycerol concentrations tested (10e30 g/L). The main soluble metabolic product in this study was 1,3-propanediol which confirmed that Klebsiella sp. TR17 was dominant in the UASB reactors.
Conclusion The HPR and HY of the immobilized Klebsiella sp. TR17 increased with the decrease of HRTs under non-sterile conditions in UASB reactors using crude glycerol as the substrate. However, the glycerol conversion rate tended to decrease as the HRTs decreased from 12 to 2 h. At 4 h HRT, HPR and HY reached their maximum values of 242.15 mmol H2/L/d and 44.27 mmol H2/g glycerol consumed at 30 g/L and 10 g/L respectively. Decreasing HRT and glycerol concentration resulted in the decrease of soluble metabolites, in which 1,3propanediol was the main product. From the FISH
technique, the highest ratio of Klebsiella sp. and Eubacteria (63.5% and 80.8% of total DAPI binding cells, respectively) were achieved at 30 g/L glycerol.
Acknowledgment The authors gratefully acknowledge the Royal Golden Jubilee Ph.D Program of the Thailand Research Fund for the financial support to Mr. Teera Chookaew under the Grant No. PHD/ 0095/2551, the Graduate School and the Faculty of AgroIndustry, Prince of Songkla University, Thailand.
references
[1] Jung KW, Kim DH, Shin HS. Continuous fermentative hydrogen production from coffee drink manufacturing wastewater by applying UASB reactor. Int J Hydrogen Energy 2010;35:13370e8.
Please cite this article in press as: Chookaew T, et al., Biohydrogen production from crude glycerol by immobilized Klebsiella sp. TR17 in a UASB reactor and bacterial quantification under non-sterile conditions, International Journal of Hydrogen Energy (2014), http://dx.doi.org/10.1016/j.ijhydene.2014.04.083
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 4 ) 1 e8
[2] Yossan S, O-Thong S, Prasertsan P. Effect of initial pH, nutrients and temperature on hydrogen production from palm oil mill effluent using thermotolerant consortia and corresponding microbial communities. Int J Hydrogen energy 2012;37:13806e14. [3] Chairattanamanokorn P, Penthamkeerati P, Reungsang A, Lo YC, Lu WB, Chang JS. Production of biohydrogen from hydrolyzed bagasse with thermally preheated sludge. Int J Hydrogen energy 2009;34:7612e7. [4] Amaral PFF, Ferreira TF, Fontes GC, Coelho MAZ. Glycerol valorization: new biotechnological routes. Food Bioprod Process 2009;87:179e86. [5] Saenge C, Cheirsilp B, Suksaroge TT, Bourtoom T. Potential use of oleaginous red yeast Rhodotorula glutinis for the bioconversion of crude glycerol from biodiesel plant to lipids and carotenoids. Process Biochem 2011;46:210e8. [6] Markov SA, Averitt J, Waldron B. Bioreactor for glycerol conversion into H2 by bacterium Enterobacter aerogenes. Int J Hydrogen energy 2011;36:262e6. [7] Sattayasamitsathit S, Methacanon P, Prasertsan P. Enhance 1,3-propanediol production from crude glycerol in batch and fed-batch fermentation with two-phase pH-controlled strategy. Electron J Biotechn 2011;14:1e11. [8] Mu Y, Teng H, Zhang DJ, Wang W, Xiu ZL. Microbial production of 1,3-propanediol by Klebsiella pneumoniae using crude glycerol from biodiesel preparations. Biotechnol Lett 2006;28:1755e9. [9] Petrov K, Petrova P. High production of 2,3-butanediol from glycerol by Klebsiella pneumoniae G31. Appl Microbiol Biotechnol 2009;84:659e65. [10] Choi WJ, Hartono MR, Chan WH, Yeo SS. Ethanol production from biodiesel-derived crude glycerol by newly isolated Kluyvera cryocrescens. Appl Microbiol Biotechnol 2011;89:1255e64. [11] Lee DJ, Show KY, Su A. Dark fermentation on biohydrogen production: pure culture. Bioresour Technol 2011;102:8389e402. [12] Kim JK, Nhat L, Chun YN, Kim SW. Hydrogen production conditions from food waste by dark fermentation with Clostridium beijerinckii KCTC 1785. Biotechnol Bioprocess Eng 2008;13:499e504. [13] Chong ML, Rahim RA, Shirai Y, Hassan MA. Biohydrogen production by Clostridium butyricum EB6 from palm oil mill effluent. Int J Hydrogen Energy 2009;34:764e71. [14] Wang X, Jin B. Process optimization of biological hydrogen production from molasses by a newly isolated Clostridium butyricum W5. J Biosci Bioeng 2009;107:138e44. [15] Marone A, Massini G, Patriarca C, Signorini A, Varrone C, Izzo G. Hydrogen production from vegetable waste by bioaugmentation of indigenous fermentative communities. Int J Hydrogen Energy 2012;37:5612e22. [16] Liu F, Fang BS. Optimization of bio-hydrogen production from biodiesel wastes by Klebsiella pneumoniae. J Biotechnol 2007;2:274e80. [17] Chen X, Sun Y, Xiu Z, Li X, Zhang D. Stoichiometric analysis of biological hydrogen production by fermentative bacteria. Int J Hydrogen Energy 2005;1:1e11. [18] Sattayasamitsathit S, Prasertsan P, Methacanon P. Statistical optimization for simultaneous production of 1,3-propanediol and 2,3-butanediol using crude glycerol by newly bacterial isolate. Process Biochem 2011;46:608e14. [19] Chookaew T, O-Thong S, Prasertsan P. Fermentative production of hydrogen and soluble metabolites from crude glycerol of biodiesel plant by the newly isolated thermotolerant Klebsiella pneumoniae TR17. Int J Hydrogen Energy 2012;37:13314e22. [20] Buzzini AP, Sakamoto IK, Varesche MB, Pires EC. Evaluation of the microbial diversity in an UASB reactor treating
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32]
[33]
[34]
[35]
[36]
7
wastewater from an unbleached pulp plant. Process Biochem 2006;41:168e76. Khemkhao M, Nuntakumjorn B, Techkarnjanaruk S, Phalakornkule C. UASB performance and microbial adaptation during a transition from mesophilic to thermophilic treatment of palm oil mill effluent. J Environ Manage 2012;103:74e82. Lopes SIC, Dreissen C, Capela MI, Lens PNL. Comparison of CSTR and UASB reactor configuration for the treatment of sulfate rich wastewaters under acidifying conditions. Enzyme Microb Tech 2008;43:471e9. Akutsu Y, Lee DY, Chi YZ, Li YY, Harada H, Yu HQ. Thermophilic fermentative hydrogen production from starch-wastewater with bio-granules. Int J Hydrogen Energy 2009;34:5061e71. Kongjan P, O-Thong S, Angelidaki I. Biohydrogen production from desugared molassess (DM) using thermophilic mixed cultures immobilized on heat treated anaerobic sludge granules. Int J Hydrogen Energy 2011;36:14261e9. Castello E, Santos CG, Iglesias T, Paolino G, Wenzel J, Borzacconi L, et al. Feasibility of biohydrogen production from cheese whey using a UASB reactor: Links between microbial community and reactor performance. Int J Hydrogen Energy 2009;34:5674e82. Chookaew T, O-Thong S, Prasertsan P. Statistical optimization of medium components affecting simultaneous fermentative hydrogen and ethanol production from crude glycerol by thermotolerant Klebsiella sp. TR17. Int J Hydrogen Energy 2014;39:751e60. O-Thong S, Prasertsan P, Karakashev D, Angelidaki I. Highrate continuous hydrogen production by Thermoanaerobacterium thermosaccharolyticum PSU-2 immobilized on heat-pretreated methanogenic granules. Int J Hydrogen Energy 2008;33:6498e508. Chang FY, Lin CY. Biohydrogen production using an up-flow anaerobic sludge blanket reactor. Int J Hydrogen Energy 2004;29:33e9. Tsuneda S, Nagano T, Hoshino T, Ejiri Y, Noda N, Hirata A. Characterization of nitrifying granules produced in an aerobic upflow fluidized bed reactor. Water Res 2003;37:4965e73. Ootsubo M, Shimizu T, Tanaka R, Sawabe T, Tajima K, Yoshimizu M, et al. Oligonucleotide probe for detecting Enterobacteriaceae by in situ hybridization. J Appl Microbiol 2002;93:60e8. Ogue-Bon E, Khoo C, McCartney AL, Gibson GR, Rastall RA. In vitro effects of symbiotic fermentation on the canine faecal microbiota. FEMS Microbiol Ecol 2010;73:587e600. Amann RI, Ludwig W, Schleifer KH. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol Rev 1995;59:143e69. O-Thong S, Prasertsan P, Birkeland NK. Evaluation of methods for preparing hydrogen-producing seed inocula under thermophilic condition by process performance and microbial community analysis. Bioresour Technol 2009;100:909e18. APHA. Standard methods for the examination of water and waste water. 19th ed. Washington, DC: American Public Health Association; 1995. Zhang ZP, Tay JH, Show KY, Yan R, Liang DT, Lee DJ, et al. Biohydrogen production in a granular activated carbon anaerobic fluidized bed reactor. Int J Hydrogen Energy 2007;32:185e91. Lin PJ, Chang JS, Yang LH, Lin CY, Wu SY, Lee KS. Enhancing the performance of pilot-scale fermentative hydrogen production by proper combinations of HRT and substrate concentration. Int J Hydrogen Energy 2011; 36:14289e94.
Please cite this article in press as: Chookaew T, et al., Biohydrogen production from crude glycerol by immobilized Klebsiella sp. TR17 in a UASB reactor and bacterial quantification under non-sterile conditions, International Journal of Hydrogen Energy (2014), http://dx.doi.org/10.1016/j.ijhydene.2014.04.083
8
i n t e r n a t i o n a l j o u r n a l o f h y d r o g e n e n e r g y x x x ( 2 0 1 4 ) 1 e8
[37] Liu Q, Zhang X, Yu L, Zhao A, Tai J, Liu J, et al. Fermentative hydrogen production from fresh leachate in batch and continuous bioreactors. Bioresour Technol 2011;102:5411e7. [38] Reungsang A, Sittijunda S, O-thong S. Bio-hydrogen production from glycerol by immobilized Enterobacter aerogenes ATCC 13048 on heat-treated UASB granules as affected by organic loading rate. Int J Hydrogen Energy 2013;38:6970e9.
[39] Zhang H, Bruns MA, Logan BE. Biological hydrogen production by Clostridium acetobutylicum in an unsaturated flow reactor. Water Res 2006;40:728e34. [40] Hung CH, Lee KS, Cheng LH, Huang YH, Lin PJ, Chang JS. Quantitative analysis of a high-rate hydrogen-producing microbial community in anaerobic agitated granular sludge bed bioreactors using glucose as substrate. Appl Microbiol Biotechnol 2007;75:693e701.
Please cite this article in press as: Chookaew T, et al., Biohydrogen production from crude glycerol by immobilized Klebsiella sp. TR17 in a UASB reactor and bacterial quantification under non-sterile conditions, International Journal of Hydrogen Energy (2014), http://dx.doi.org/10.1016/j.ijhydene.2014.04.083