- Email: [email protected]
Biological function of a gC1qR homolog (EcgC1qR) of Exopalaemon carinicauda in defending bacteria challenge
Fish and Shellfish Immunology 82 (2018) 378–385
Contents lists available at ScienceDirect
Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Short communication
Biological function of a gC1qR homolog (EcgC1qR) of Exopalaemon carinicauda in defending bacteria challenge
T
Jiquan Zhanga,b,c, Yujie Liua, Yanyan Lia, Naike Sua, Yaru Zhoua, Jianhai Xiangb,c, Yuying Suna,∗ a
College of Life Sciences, Hebei University, Baoding, Hebei, 071002, China Laboratory for Marine Biology and Biotechnology, Qingdao National Laboratory for Marine Science and Technology, Qingdao, 266000, China c Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao, 266071, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Exopalaemon carinicauda Globular heads of C1q CRISPR/Cas9 Knock-out
The gC1qR is a ubiquitously expressed cell protein that interacts with the globular heads of C1q (gC1q) and many other ligands. In this study, one gC1qR homolog gene was obtained from Exopalaemon carinicauda and named EcgC1qR. The complete nucleotide sequence of EcgC1qR contained a 774 bp open reading frame (ORF) encoding EcgC1qR precursor of 257 amino acids. The deduced amino acid sequence of EcgC1qR revealed a 55amino-acid-long mitochondrial targeting sequence at the N-terminal and a mitochondrial acidic matrix protein of 33 kDa (MAM33) domain. The genomic organization of EcgC1qR gene showed that EcgC1qR gene contained five exons and four introns. EcgC1qR could express in all of the detected tissues and its expression was much higher in hepatopancreas and hemocytes. The expression of EcgC1qR in the hepatopancreas of prawns challenged with Vibrio parahaemolyticus and Aeromonas hydrophila changed in a time-dependent manner. The expression of EcgC1qR in prawns challenged with V. parahaemolyticus was up-regulated at 6 h (p < 0.05), and significantly up-regulated at 12 h and 24 h (p < 0.01), and then returned to the control levels at 48 h postchallenge (p > 0.05). At the same time, the expression in Aeromonas-challenged group was significantly upregulated at 6, 12 and 24 h. The recombinant EcgC1qR could inhibit the growth of two tested bacteria. In addition, we successfully deleted EcgC1qR gene through CRISPR/Cas9 technology and it was the first time to obtain the mutant of gC1qR homolog gene in crustacean. It's a great progress to study the biological function of gC1qR in crustacean in future.
1. Introduction As economically important species, many crustaceans are cultured and the majority of them are shrimp and prawns. In recent years, the outbreak of diseases has significantly compromised shrimp aquaculture [1]. The complement system performs a critical function in host defense and inflammation [2]. In 1994, Ghebrehiwet et al. [3] firstly isolated a novel cell surface protein from Raji cells, which could bind to the globular “heads” of C1q molecules and designated gC1qR. The gC1qR is a ubiquitously expressed cell protein that interacts with the globular heads of C1q (gC1q) and many other ligands [4]. It has been reported that crustacean gC1qR plays an important role in defensing attack of virus and bacteria. The firstly reported crustacean gC1qR gene (PlgC1qR) was from the freshwater crayfish Pacifastacus leniusculus and it had antiviral activity against white spot syndrome virus (WSSV) [5]. Li et al. [6] found that recombinant gC1qR from Fenneropenaeus chinensis could bind to Staphylococcus aureus in a
∗
concentration-dependent manner and it might be involved in defending against bacterial infections in shrimp. Yang et al. [7] firstly identified and characterized the C1q subcomponent binding protein (PmC1qBP) from Penaeus monodon and found that PmC1qBP was involved in shrimp immune responses to pathogenic infections. Ye et al. [8] reported that MrgC1qR from Macrobrachium rosenbergii might function as a pathogenrecognition receptor (PRR). Huang et al. [2] reported the first gC1qR in crab and speculated that EsgC1qR was involved in the innate immunity of Chinese mitten crab, Eriocheir sinensis. Exopalaemon carinicauda, an economically important species in China, had an advantage over other shrimp of prawns in basic research. It can be maintained with reproductive capacity all the year round in the laboratory environment with an about 60-day reproduction cycle. Its genome draft had been performed and the assembly covers more than 95% of coding regions [9]. In addition, we had successfully performed the site-specific genome editing in E. carinicauda via CRISPR/ Cas9 [10], and it can be used as a feasible means for the study of
Corresponding author. E-mail address: [email protected] (Y. Sun).
https://doi.org/10.1016/j.fsi.2018.08.046 Received 30 May 2018; Received in revised form 15 August 2018; Accepted 21 August 2018 Available online 23 August 2018 1050-4648/ © 2018 Published by Elsevier Ltd.
Fish and Shellfish Immunology 82 (2018) 378–385
J. Zhang et al.
Table 1 Primers mentioned in the paper. Primers
Sequences (5′-3′)
Sequence information
RT-EcgC1qRF RT-EcgC1qRR 18S-F 18S-R 9k-EcgC1qRF
CCAAGTGTTTTAGGAGGTCT ACAAAGTGGAAGATGGGAAT TATACGCTAGTGGAGCTGGAA GGGGAGGTAGTGACGAAAAAT GCTACGTACATCATCACCATCACCACAGTCTATTTAGCCGTGCCCTCA
9k-EcgC1qRR 5′AOX1 3′AOX1 EcgC1qR-gRNA EcgC1qR-detF EcgC1qR-detR
GCGCGGCCGCTTAGAAGTAACCCTCTCCCAAAGGATC GACTGGTTCCAATTGACAAGC GCAAATGGCATTCTGACATCC CAGGACAATAGCGCGAAGTT TATTTAGCCGTGCCCTCATG TGTGTGGATGCCGTGAATAC
Real-time PCR Real-time PCR Real-time PCR Real-time PCR Construct the expression vector, introducing a restriction enzyme site for SnaB I and a 6 × His-tag Construct the expression vector, introducing a restriction enzyme site for Not I Confirm the insert target gene Confirm the insert target gene sgRNA target site for EcgC1qR Detection primers Detection primers
Note: F and R stand for forward primers and reverse ones, respectively.
Fig. 1. (A) The nucleotide sequence and deduced amino acid sequence of EcgC1qR. The mitochondrial targeting sequence was underlined and the RGD motif was double underlined. The mitochondrial acidic matrix protein domain (MAM33) was shadowed in pink. The N-glycosylation sites are boxed in red. (B) The genomic structure of EcgC1qR. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
potential function of recombinant EcgC1qR was also analyzed. In addition, we successfully deleted the EcgC1qR using CRISPR/Cas9 technology, which is a great progress to study the biological function of gC1qR in crustacean in future.
important biological questions that cannot be easily addressed in other shrimp and prawns [11,12]. In this research, we firstly reported a gC1qR gene (EcgC1qR) in E. carinicauda. The expression profile of EcgC1qR in different tissues and its immune function against bacteria was analyzed. Furthermore, EcgC1qR was recombinantly expressed in Pichia pastoris and its
379
Fish and Shellfish Immunology 82 (2018) 378–385
J. Zhang et al.
Fig. 2. The sites of the guide RNA (gRNA) and the detection primers.
Fig. 3. Alignment of the amino acid sequence of EcgC1qR with other Decapoda gC1qR. The identical residues are shown in solid boxes. Sequences start at the first methionine residue. F. chinensis (FcgC1qR, AAL55258.4); L. vannamei (LvgC1qR, AAR04348.1); M. rosenbergii (MrgC1qR, AAL37948.1); P. monodon (PmgC1qR, AAR89516.1); P. leniusculus (PlgC1qR, AAR89516.1); E. carinicauda (EcgC1qR, MF095887, in this paper).
prawns were sampled from each group. In the bacterial challenge experiments, the prawns were injected intramuscularly into the last abdominal segment with 10 μL phosphate buffer saline (PBS) containing V. parahaemolyticus or A. hydrophila (107 CFU mL−1). The prawns injected with 10 μL sterile PBS were maintained as control. The hepatopancreas of five prawns from each group were collected at 0, 6, 12, 24, 48, 72, and 96 h for RNA extraction. 2.2. RNA isolation, cDNA synthesis and bioinformatic analysis The total RNA was extracted from the above samples with Trizol® reagent (Thermo, USA) and then treated with RQI RNase-Free DNase (Promega, USA). Two micrograms of total RNA and 0.2 μM random hexamer primers were used to synthesize cDNA using M-MLV reverse transcriptase (Promega, USA). Based on the transcriptomic and genomic data of E. carinicauda [9], the gC1qR sequence of E. carinicauda (EcgC1qR) was obtained by reverse transcription-polymerase chain reaction (RT-PCR). The cloned sequence was analyzed for the identity and similarity by BLAST on-line. The multiple sequence alignment was performed using Bioedit. The online software SMART (http://smart.embl-heidelberg.de/) was used to predict the domain architecture of deduced amino acid sequence.
Fig. 4. Detection of EcgC1qR transcripts in different tissues of E. carinicauda. Tissues were shown in the abscissa. The amount of EcgC1qR mRNA was normalized to the 18S rRNA transcript level. Data are shown as means ± SD (standard deviation) of three separate individuals in the tissues.
2. Materials and methods 2.1. Experimental animal and immune challenge
2.3. Quantitative real-time PCR (qRT-PCR) analysis of EcgC1qR expression Referring to our previous research [13], the experimental animals, E. carinicauda, with body length of 5.0 ± 0.5 cm were bred in tanks with aerated fresh seawater at 24–26 °C, 30 ppt salinity and fed twice per day with fresh clam meat. Fifteen healthy adult prawns were dissected to separate the eyestalk, intestine, muscle, cuticle, hepatopancreas, nerve cord, heart, stomach, and gill for RNA extraction [13]. Prawns for expression profiles after immune challenge: The prawns with the same size were challenged with Vibrio parahaemolyticus and Aeromonas hydrophila according to the method [1,14]. V. parahaemolyticus and A. hydrophila were isolated from the gills of E. carinicauda by Dr. Yuying Sun [11]. Experimental and control groups were set up for each sampling point (0, 6, 12, 24, 48, 72, 96 h) and 200
Quantitative real-time PCR (qRT-PCR) [11] was used to analyze EcgC1qR distribution in different tissues and its expression profiles at different sampling time in the hepatopancreas using Mastercycler ep realplex (Eppendorf, Germany). 18S rRNA was used as the internal control. Primers are shown in Table 1. The PCR products were firstly sequenced to confirm the specificity and effectiveness of primers for qRT-PCR. The calculated length of EcgC1qR and 18S rRNA was 124 bp and 147 bp, respectively. The qRT-PCR for EcgC1qR and 18S rRNA was performed according to the program of 40 cycles of 95 °C for 15 s, 55 °C for 20 s and 72 °C for 20 s, following by an extension of 72 °C for 10 min. The data were analyzed using the comparative CT method and then subjected to one-way ANOVA using SPSS 19.0. The p values less than 380
Fish and Shellfish Immunology 82 (2018) 378–385
J. Zhang et al.
Fig. 5. Expression profiles of EcgC1qR in hepatopancreas after the prawns were challenged with V. parahaemolyticus or A. hydrophila and equal volume of PBS at 0, 6, 12, 24, 48, 72, and 96 h. The amount of EcgC1qR mRNA was normalized to 18S rRNA transcript level. Data are shown as means ± SD (standard deviation) of three separate individuals in hepatopancreas.
Fig. 6. Analysis of expressed and purified recombinant EcgC1qR protein (rEcgC1qR) by SDS-PAGE. M: protein marker (PR1910, Solarbio, China); T0: expression of the rEcgC1qR before induction with methanol (0 h); T4: expression of rEcgC1qR induced with 0.5% (v/v) methanol at 96 h; P0, P1: elution of rEcgC1qR purified by affinity chromatography on Ni-NTA agarose with 10 mM and 300 mM imidazole.
grow on histidine-deficient minimal dextrose agar plates. In addition, isolation of genomic DNA was performed following the Invitrogen's protocol and PCR amplifications were then carried out to select positive clones according to Invitrogen's recommendations with a pair of primers (5′AOX1/3′AOX1) (Table 1). For each positive clone, small-scale expression trials were initially performed to identify the most productive transformants and secretion of EcgC1qR was determined by SDS-PAGE using 12% (w/v) separating gel and 5% (w/v) stacking gel at 96 h after induction with methanol. Once the most productive transformant was selected, a large-scale expression of recombinant EcgC1qR was performed and the cells were pelleted out from the culture medium by centrifugation at 8, 000 r/min for 10 min at 4 °C. The supernatant was used to purify the recombinant EcgC1qR by affinity chromatography using Ni-NTA-agarose resin [17].
0.05 were considered statistically significant. 2.4. Recombinant expression and purification of EcgC1qR in Pichia pastoris Based on the information of EcgC1qR and multiple cloning sites (MCS) in the pPIC9K (Invitrogen, USA), a pair of primers 9k-EcgC1qRF/ 9k-EcgC1qRR was designed to construct the recombinant plasmid according to our previous research [15]. The PCR product amplified using the primers 9k-EcgC1qRF/9k-EcgC1qRR was digested with SnaB I and Not I at the same reaction volume. The digested PCR product was recovered and ligated into the linearized vector pPIC9k precut with SnaB I and Not I (Takara, Dalian, China). The constructed plasmid pPIC9kEcgC1qR was transformed into competent E. coli DH5α and verified by sequencing. Then, the extracted plasmid was linearized with Sal I followed by transformation with Pichia pastoris host strain KM71 using PEG1000 method [16]. Transformants were selected for their ability to 381
Fish and Shellfish Immunology 82 (2018) 378–385
J. Zhang et al.
2.6. Designation and synthesis of gRNA specialized for EcgC1qR According to our previous research [10,12], one sgRNA target site for EcgC1qR was designed using the online tool ZiFiT (http://zifit. partners.org/ZiFiT/ChoiceMenu.aspx), named EcgC1qR-gRNA. The gRNA sequence and the primers for detecting and sequencing were shown in Fig. 2. By searching in the genome sequence of E. carinicauda reported by Yuan et al. [9], no any possible off-target site was found. The gRNA of EcgC1qR was synthesized using the Thermo Scientific TranscriptAid T7 High Yield Transcription Kit (Thermo, USA). Then, it was purified by phenol chloroform extraction. The gRNA concentration and quality were assessed by Nanodrop (2000) and electrophoresis on 1% agarose gel. Then it was preserved at −80 °C in portions for microinjection. 2.7. Preparation of Cas9 mRNA Referring to our previous research [10], the pCMV-Cas9 vector was linearized by Xba I and purified by ethanol precipitation. The product was used to synthesize Cas9 mRNA that had both 5′cap and 3′poly (A) tail in vitro with mMACHINE® T7 Ultra Kit (Ambion, USA). Then it was purified by phenol chloroform extraction and was preserved at −80 °C in portions for microinjection. 2.8. Microinjection and indels detection by sanger sequencing The microinjection materials containing 200 ng/μL Cas9 mRNA, 100 ng/μL gRNA and 0.05% of the inert dye phenol red in the buffer (100 mM HEPES, 1.5 M NaCl) were filtered through 0.22 μm filtering membranes. The injection volume was approximately 0.5 nL. The prawns in experimental group were coinjected with Cas9 mRNA and EcgC1qR gRNA synthesized in vitro. The genomic DNA of mysis larvae prawns was extracted and the genomic region flanking the target site was amplified by MightyAmp® Genotyping Kit (Takara, Dalian, China) according to the manufacturer's instruction. For Sanger sequencing detections, the amplified PCR products were purified using Gel Extraction Kit (OMEGA, USA) and then cloned into pMD19-T Simple Vector (Takara, Dalian, China). The detection primers used to amplify the target fragment are EcgC1qR-detF and EcgC1qR-detR.
Fig. 7. Assay for the antibacterial activity of rEcgC1qR. 0.5% (w/v) of the purified rEcgC1qR was used to test the antibacterial activities against V. parahaemolyticus (A) and A. hydrophila (B). 0.5% bovine serum albumin (BSA) was used as control. Bacterial growth was evaluated by measuring the culture absorbance at 540 nm. Data are shown as means ± SD (standard deviation) of three separate tests.
3. Results 2.5. Antibacterial activity of rEcgC1qR 3.1. Characterization of EcgC1qR Referring to the method described by Huang et al. [2], the antibacterial activity of rEcgC1qR was determined using V. parahaemolyticus and A. hydrophila as the tested strains. The strains were screened out through plat streaking method, of which one single clone for each strain was picked and cultured in LB medium till the final optical density of 0.5 at 450 nm (OD 450). 0.5% (w/v) of the purified rEcgC1qR solution was used to test the antibacterial activities against V. parahaemolyticus and A. hydrophila. Meanwhile, the same concentration of bovine serum albumin (BSA) solution was used as the negative control. At 30, 60, and 120 min, the absorbance at 450 nm was recorded. Each experiment duplicates three times.
In this research, the cDNA sequence of EcgC1qR was obtained with 774 bp (GenBank accession no. JX435327) and it encoded EcgC1qR precursor of 257 amino acids (Fig. 1 A). Predicted by signal 4.1, there is no signal peptide in the deduced protein. It had a predicted molecular weight (MW) of 28509.96 Da and theoretical isoelectric point (pI) of 4.79. Analyzed by the MITOPROT program, a 55-amino-acid-long mitochondrial targeting sequence was found at the N terminal of the deduced protein (residues 1–55). One RGD motif was also predicted using ExPASy PROSITE (residues 66–68). The domain architecture of EcgC1qR protein analyzed by SMART software showed that there was a mitochondrial acidic matrix protein of 33 kDa (MAM33) domain (residues 75–254) (Fig. 1A). In addition, the genomic DNA fragment of EcgC1qR with the corresponding cDNA sequence was obtained by PCR
Table 2 Mutation frequencies induced by microinjection of Cas9 mRNA and EcgC1qR gRNA. RNA concentration 100 ng/μL EcgC1qR-gRNA
200 ng/μL (pCMV-Cas9)
Injected Embryos
Survival Postlarvae
Mutant Postlarvae
Survival Rate
Mutant Rate
212
24
11
11.32%
5.19%
382
Fish and Shellfish Immunology 82 (2018) 378–385
J. Zhang et al.
Fig. 8. Sanger sequencing of the PCR products from 10 prawns indicated the indel mutations caused by CRISPR/Cas9 genome editing system. WTM-01 means the wild-type group. MTM-01 and 02 mean the injected embryos. The PAM site was represented in blue rectangles. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
the proteins secreted into the medium and visualized by SDS-PAGE, there was a protein band specifically induced by methanol in the position on the SDS-PAGE gel expected for the size of rEcgC1qR of approximately 29 kDa (Fig. 6A). The supernatant was used to purify rEcgC1qR by affinity chromatography using Ni-NTA-agarose resin and the purified rEcgC1qR was visualized as a single band on SDS-PAGE gel (Fig. 6B). Then, 0.5% (w/v) of the purified rEcgC1qR solution was used to test the antibacterial activities against V. parahaemolyticus and A. hydrophila. As shown in Fig. 7A and B, the addition of rEcgC1qR could inhibit the growth of V. parahaemolyticus and A. hydrophila compared with that of BSA (p > 0.05), which indicated that rEcgC1qR was an antibacterial protein.
and the result showed that it is composed of 5 exons and 4 introns (Fig. 1B). All intron-exon boundaries were consistent with the consensus splicing junctions at both the 5′ splice donor site (GT) and the 3’ splice acceptor sites (AG) of each intron. In addition, the 55-amino-acid-long mitochondrial targeting sequence lies in the first exon. Therefore, we designed one guide RNA (gRNA) specialized for EcgC1qR and a pair of detection primers in the first exon (Fig. 2). A multiple sequence alignment showed that EcgC1qR displayed high identities with those of M. rosenbergii (MrgC1qR, 89%), Litopenaeus vannamei (LvgC1qR, 72%), P. monodon (PmgC1qR, 72%), F. chinensis (FcgC1qR, 72%), P. leniusculus (PlgC1qR, 70%) (Fig. 3). 3.2. Tissue distribution of EcgC1qR mRNA
3.5. Knockout of EcgC1qR using CRISPR/Cas9 technology Expression profile of EcgC1qR in different tissues of E. carinicauda was examined by qRT-PCR (Fig. 4). It was found that EcgC1qR could express in all of the detected tissues and its expression was much higher in hepatopancreas and hemocytes. Therefore, hepatopancreas are selected as target tissue to study the expression after the prawns are challenged with bacteria.
Ten days after co-injection into the one-cell embryo, five embryos were selected randomly in each group to detect the genome editing. The mutation rate of the embryos injected with Cas9 mRNA and one EcGC1qR sgRNA were analyzed (Table 2). After 15 days hatching, 24 embryos in the 212 injected one-cell stage embryos, could develop to postlarvae and the reproductive survival rate was 11.32%. Detection of the mutation for the 24 survival postlarvae, the number of mutant prawns was 11 and the mutant rate reached 5.19%. The target fragment was amplified to sequence and the results showed that multiple peaks occurred initially after the PAM sites compared with that of the wild-type prawn (Fig. 8). It indicated that the target site had been successfully edited and there was a concentrationdependent at gRNA. Furtherly, the PCR products were ligated into pMD 19-T vector (Takara, Dalian, China) and transformed into competent E. coli DH5ɑ. Ninety-six clones were randomly selected to sequence and the results showed in which eight types of deletion mutation were generated (Fig. 9).
3.3. Time course of EcgC1qR expression after V. parahaemolyticus or A. hydrophila challenge In this research, the immune function of EcgC1qR against bacteria in the prawns and the expression of EcgC1qR in hepatopancreas of E. carinicauda was measured through a semi-quantitative RT-PCR method. The results showed that the expression of hepatopancreas in the prawns challenged with V. parahaemolyticus or A. hydrophila changed in a timedependent manner (Fig. 5A and B). Compared with the expression of EcgC1qR in control group, EcgC1qR expression of EcgC1qR in prawns challenged with V. parahaemolyticus was up-regulated at 6 h (p < 0.05), and significantly up-regulated at 12 h (p < 0.01), and then returned to the control levels at 48 h post-challenge (p > 0.05). At the same time, the expression in Aeromonas-challenged group was significantly up-regulated at 6 and 12 h (p < 0.01) and returned to the control levels at 48 h post-challenge (p > 0.05).
4. Discussion The complement pathway is an important component of the innate immunity in vertebrates [7]. In this research, we firstly report one gC1qR homolog gene from E. carinicauda named EcgC1qR. The deduced amino acid sequence of EcgC1qR revealed a 55-amino-acid-long mitochondrial targeting sequence at N terminal of the deduced protein and a mitochondrial acidic matrix protein of 33 kDa (MAM33) domain. Until now, there are a lot of reports about gC1qR in crustaceans [2,5–8].
3.4. Antibacterial activity of rEcgC1qR The selected positive clone was cultured initially in BMGY medium and then induced with 0.5% (v/v) methanol in BMMY for 96 h. Among 383
Fish and Shellfish Immunology 82 (2018) 378–385
J. Zhang et al.
Fig. 9. Sanger sequencing of the different clones inserted the PCR products which indicated the indel mutations caused by CRISPR/Cas9 technology. WT means the wild-type (blank group) and MT-C1 – MT-C8 mean the different types. The PAM site was represented in blue box. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
V. parahaemolyticus and A. hydrophila. As we known, V. parahaemolyticus and A. hydrophila are two kinds of key pathogen bacteria of shrimp and the same result was also reported in other crustaceans. The recombinant gC1qR from F. chinensis could bind to several bacteria, which suggested that FcgC1qR might be involved in defending against bacterial infections in the Chinese white shrimp [6]. Huang et al. [2] found that the recombinant EsgC1qR, one gC1qR from E. sinensis, could bind to various bacteria, LPS, and PGN. Ye et al. [8] found that recombinant MrgC1qR could bind pathogen-associated molecular patterns (PAMPs) such as LPS or PGN, which suggested that MrgC1qR might function as a pathogen-recognition receptor (PRR). As we known, gC1qR in shrimp could bind to the PAMPs of bacteria and there are some disadvantages in expressing it using E. coli. Therefore, we selected P pastoris to recombinantly express the EcgC1qR. Our results showed that rEcgC1qR had the same antibacterial activity as those from other shrimp [6–8] or crab [2]. At present, there were a lot of reports about the function of gC1qR homolog gene in the immune defense in crustaceans [2,5–8]. In the previous research, studies were mainly based on gene cloning and expression analysis at the transcriptional or translational level. In our laboratory, we constructed the gene editing platform using CRISPR/
A multiple sequence alignment showed that EcgC1qR displayed high identities with those of M. rosenbergii (MrgC1qR, 89%), L. vannamei (LvgC1qR, 72%), P. monodon (PmgC1qR, 72%), F. chinensis (FcgC1qR, 72%), P. leniusculus (PlgC1qR, 70%). The genomic organization of EcgC1qR gene analyzed by PCR amplification showed that EcgC1qR gene contains five exons and four introns. It is the first report about intron/exon structure of Penaeid gC1qR. EcgC1qR could express in all of the detected tissues and its expression was much higher in hepatopancreas and hemocytes. This expression pattern agrees with those of other reported crustaceans [2,5–8]. As we know, bacteria are important pathogen in aquaculture. In this study, the immune function of EcgC1qR against bacteria was analyzed by challenging prawns with V. parahaemolyticus or A. hydrophila. Analyzing by RT-PCR, the expression of EcgC1qR in hepatopancreas was significantly up-regulated after V. parahaemolyticus or A. hydrophila challenge from 6 h to 24 h, which showed that EcgC1qR might play an important role in immune defense against bacteria. Herein, we also obtained the recombinant EcgC1qR using Pichia pastoris. The antibacterial activity of the purified recombinant EcgC1qR was evaluated and the results showed that it could inhibit the growth of
384
Fish and Shellfish Immunology 82 (2018) 378–385
J. Zhang et al.
Cas9 system in E. carinicauda and it can work efficiently in E. carinicauda [10–12]. In this paper, it was the first time to obtain the mutant of gC1qR homolog gene through CRISPR/Cas9 technology in crustacean. It's a great progress to study the biological function of EcgC1qR in prawns in future.
[6] X. Li, Z. Du, J. Lan, X. Zhang, Y. Mu, X. Zhao, et al., A novel pathogen-binding gC1qR homolog, FcgC1qR, in the Chinese white shrimp, Fenneropenaeus chinensis, Dev. Comp. Immunol. 36 (2012) 400–407. [7] L. Yang, X. Liu, W. Liu, X. Li, L. Qiu, J. Huang, et al., Characterization of complement 1q binding protein of tiger shrimp, Penaeus monodon, and its C1q binding activity, Fish Shellfish Immunol. 34 (2013) 82–90. [8] T. Ye, X. Huang, X. Wang, Y. Shi, K. Hui, Q. Ren, Characterization of a gC1qR from the giant freshwater prawn, Macrobrachium rosenbergii, Fish Shellfish Immunol. 43 (2015) 200–208. [9] J. Yuan, Y. Gao, X. Zhang, J. Wei, C. Liu, F. Li, et al., Genome sequences of marine shrimp Exopalaemon carinicauda Holthuis provide insights into genome size evolution of Caridea, Mar. Drugs 15 (2017). [10] T. Gui, J. Zhang, F. Song, Y. Sun, S. Xie, K. Yu, et al., CRISPR/Cas9-mediated genome editing and mutagenesis of EcChi4 in Exopalaemon carinicauda, Genes, Genomes Genomics 6 (2016) 3757–3764. [11] Y. Sun, J. Zhang, J. Xiang, A CRISPR/Cas9-mediated mutation in chitinase changes immune response to bacteria in Exopalaemon carinicauda, Fish Shellfish Immunol. 71 (2017) 43–49. [12] J. Zhang, F. Song, Y. Sun, K. Yu, J. Xiang, CRISPR/Cas9-mediated deletion of EcMIH shortens metamorphosis time from mysis larva to postlarva of Exopalaemon carinicauda, Fish Shellfish Immunol. 77 (2018) 244–251. [13] Y. Sun, J. Zhang, J. Xiang, Immune function against bacteria of chitin deacetylase 1 (EcCDA1) from Exopalaemon carinicauda, Fish Shellfish Immunol. 75 (2018) 115–123. [14] C. Saejung, K. Hatai, L. Sanoamuang, The in vitro antibacterial effects of organic salts, chemical disinfectants and antibiotics against pathogens of black disease in fairy shrimp of Thailand, J. Fish. Dis. 37 (2014) 33–41. [15] J. Zhang, F. Li, Z. Wang, X. Zhang, Q. Zhou, J. Xiang, Cloning, expression and identification of ferritin from Chinese shrimp, Fenneropenaeus chinensis, J. Biotechnol. 125 (2006) 173–184. [16] J. Zhang, F. Li, Z. Wang, J. Xiang, Expression, purification, and characterization of recombinant Chinese shrimp crustin-like protein (CruFc) in Pichia pastoris, Biotechnol. Lett. 29 (2007) 813–817. [17] Y. Sun, J. Zhang, S. Wang, Heterologous expression and efficient secretion of chitosanase from Microbacterium sp in Escherichia coli, Indian J. Microbiol. 55 (2015) 194–199.
Conflicts of interest There is no conflict of interest. Acknowledgments The project was supported by The National Natural Science Foundation of China (Nos. 31872613, 41876196, 31772885). References [1] C. Yang, J. Zhang, F. Li, H. Ma, Q. Zhang, T.A. Jose Priya, et al., A Toll receptor from Chinese shrimp Fenneropenaeus chinensis is responsive to Vibrio anguillarum infection, Fish Shellfish Immunol. 24 (2008) 564–574. [2] Y. Huang, W. Wang, Q. Ren, Function of gC1qR in innate immunity of Chinese mitten crab, Eriocheir sinensis, Dev. Comp. Immunol. 61 (2016) 34–41. [3] B. Ghebrehiwet, B. Lim, E. Peerschke, A. Willis, K. Reid, Isolation, cDNA cloning, and overexpression of a 33-kD cell surface glycoprotein that binds to the globular “heads” of C1q, J. Exp. Med. 179 (1994) 1809–1821. [4] A. Tye, B. Ghebrehiwet, N. Guo, K. Sastry, B. Chow, E. Peerschke, et al., The human gC1qR/p32 gene, C1qBP. Genomic organization and promoter analysis, J. Biol. Chem. 276 (2001) 17069–17075. [5] A. Watthanasurorot, P. Jiravanichpaisal, I. Soderhall, K. Soderhall, A gC1qR prevents white spot syndrome virus replication in the freshwater crayfish Pacifastacus leniusculus, J. Virol. 84 (2010) 10844–10851.
385
Contents lists available at ScienceDirect
Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Short communication
Biological function of a gC1qR homolog (EcgC1qR) of Exopalaemon carinicauda in defending bacteria challenge
T
Jiquan Zhanga,b,c, Yujie Liua, Yanyan Lia, Naike Sua, Yaru Zhoua, Jianhai Xiangb,c, Yuying Suna,∗ a
College of Life Sciences, Hebei University, Baoding, Hebei, 071002, China Laboratory for Marine Biology and Biotechnology, Qingdao National Laboratory for Marine Science and Technology, Qingdao, 266000, China c Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao, 266071, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Exopalaemon carinicauda Globular heads of C1q CRISPR/Cas9 Knock-out
The gC1qR is a ubiquitously expressed cell protein that interacts with the globular heads of C1q (gC1q) and many other ligands. In this study, one gC1qR homolog gene was obtained from Exopalaemon carinicauda and named EcgC1qR. The complete nucleotide sequence of EcgC1qR contained a 774 bp open reading frame (ORF) encoding EcgC1qR precursor of 257 amino acids. The deduced amino acid sequence of EcgC1qR revealed a 55amino-acid-long mitochondrial targeting sequence at the N-terminal and a mitochondrial acidic matrix protein of 33 kDa (MAM33) domain. The genomic organization of EcgC1qR gene showed that EcgC1qR gene contained five exons and four introns. EcgC1qR could express in all of the detected tissues and its expression was much higher in hepatopancreas and hemocytes. The expression of EcgC1qR in the hepatopancreas of prawns challenged with Vibrio parahaemolyticus and Aeromonas hydrophila changed in a time-dependent manner. The expression of EcgC1qR in prawns challenged with V. parahaemolyticus was up-regulated at 6 h (p < 0.05), and significantly up-regulated at 12 h and 24 h (p < 0.01), and then returned to the control levels at 48 h postchallenge (p > 0.05). At the same time, the expression in Aeromonas-challenged group was significantly upregulated at 6, 12 and 24 h. The recombinant EcgC1qR could inhibit the growth of two tested bacteria. In addition, we successfully deleted EcgC1qR gene through CRISPR/Cas9 technology and it was the first time to obtain the mutant of gC1qR homolog gene in crustacean. It's a great progress to study the biological function of gC1qR in crustacean in future.
1. Introduction As economically important species, many crustaceans are cultured and the majority of them are shrimp and prawns. In recent years, the outbreak of diseases has significantly compromised shrimp aquaculture [1]. The complement system performs a critical function in host defense and inflammation [2]. In 1994, Ghebrehiwet et al. [3] firstly isolated a novel cell surface protein from Raji cells, which could bind to the globular “heads” of C1q molecules and designated gC1qR. The gC1qR is a ubiquitously expressed cell protein that interacts with the globular heads of C1q (gC1q) and many other ligands [4]. It has been reported that crustacean gC1qR plays an important role in defensing attack of virus and bacteria. The firstly reported crustacean gC1qR gene (PlgC1qR) was from the freshwater crayfish Pacifastacus leniusculus and it had antiviral activity against white spot syndrome virus (WSSV) [5]. Li et al. [6] found that recombinant gC1qR from Fenneropenaeus chinensis could bind to Staphylococcus aureus in a
∗
concentration-dependent manner and it might be involved in defending against bacterial infections in shrimp. Yang et al. [7] firstly identified and characterized the C1q subcomponent binding protein (PmC1qBP) from Penaeus monodon and found that PmC1qBP was involved in shrimp immune responses to pathogenic infections. Ye et al. [8] reported that MrgC1qR from Macrobrachium rosenbergii might function as a pathogenrecognition receptor (PRR). Huang et al. [2] reported the first gC1qR in crab and speculated that EsgC1qR was involved in the innate immunity of Chinese mitten crab, Eriocheir sinensis. Exopalaemon carinicauda, an economically important species in China, had an advantage over other shrimp of prawns in basic research. It can be maintained with reproductive capacity all the year round in the laboratory environment with an about 60-day reproduction cycle. Its genome draft had been performed and the assembly covers more than 95% of coding regions [9]. In addition, we had successfully performed the site-specific genome editing in E. carinicauda via CRISPR/ Cas9 [10], and it can be used as a feasible means for the study of
Corresponding author. E-mail address: [email protected] (Y. Sun).
https://doi.org/10.1016/j.fsi.2018.08.046 Received 30 May 2018; Received in revised form 15 August 2018; Accepted 21 August 2018 Available online 23 August 2018 1050-4648/ © 2018 Published by Elsevier Ltd.
Fish and Shellfish Immunology 82 (2018) 378–385
J. Zhang et al.
Table 1 Primers mentioned in the paper. Primers
Sequences (5′-3′)
Sequence information
RT-EcgC1qRF RT-EcgC1qRR 18S-F 18S-R 9k-EcgC1qRF
CCAAGTGTTTTAGGAGGTCT ACAAAGTGGAAGATGGGAAT TATACGCTAGTGGAGCTGGAA GGGGAGGTAGTGACGAAAAAT GCTACGTACATCATCACCATCACCACAGTCTATTTAGCCGTGCCCTCA
9k-EcgC1qRR 5′AOX1 3′AOX1 EcgC1qR-gRNA EcgC1qR-detF EcgC1qR-detR
GCGCGGCCGCTTAGAAGTAACCCTCTCCCAAAGGATC GACTGGTTCCAATTGACAAGC GCAAATGGCATTCTGACATCC CAGGACAATAGCGCGAAGTT TATTTAGCCGTGCCCTCATG TGTGTGGATGCCGTGAATAC
Real-time PCR Real-time PCR Real-time PCR Real-time PCR Construct the expression vector, introducing a restriction enzyme site for SnaB I and a 6 × His-tag Construct the expression vector, introducing a restriction enzyme site for Not I Confirm the insert target gene Confirm the insert target gene sgRNA target site for EcgC1qR Detection primers Detection primers
Note: F and R stand for forward primers and reverse ones, respectively.
Fig. 1. (A) The nucleotide sequence and deduced amino acid sequence of EcgC1qR. The mitochondrial targeting sequence was underlined and the RGD motif was double underlined. The mitochondrial acidic matrix protein domain (MAM33) was shadowed in pink. The N-glycosylation sites are boxed in red. (B) The genomic structure of EcgC1qR. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
potential function of recombinant EcgC1qR was also analyzed. In addition, we successfully deleted the EcgC1qR using CRISPR/Cas9 technology, which is a great progress to study the biological function of gC1qR in crustacean in future.
important biological questions that cannot be easily addressed in other shrimp and prawns [11,12]. In this research, we firstly reported a gC1qR gene (EcgC1qR) in E. carinicauda. The expression profile of EcgC1qR in different tissues and its immune function against bacteria was analyzed. Furthermore, EcgC1qR was recombinantly expressed in Pichia pastoris and its
379
Fish and Shellfish Immunology 82 (2018) 378–385
J. Zhang et al.
Fig. 2. The sites of the guide RNA (gRNA) and the detection primers.
Fig. 3. Alignment of the amino acid sequence of EcgC1qR with other Decapoda gC1qR. The identical residues are shown in solid boxes. Sequences start at the first methionine residue. F. chinensis (FcgC1qR, AAL55258.4); L. vannamei (LvgC1qR, AAR04348.1); M. rosenbergii (MrgC1qR, AAL37948.1); P. monodon (PmgC1qR, AAR89516.1); P. leniusculus (PlgC1qR, AAR89516.1); E. carinicauda (EcgC1qR, MF095887, in this paper).
prawns were sampled from each group. In the bacterial challenge experiments, the prawns were injected intramuscularly into the last abdominal segment with 10 μL phosphate buffer saline (PBS) containing V. parahaemolyticus or A. hydrophila (107 CFU mL−1). The prawns injected with 10 μL sterile PBS were maintained as control. The hepatopancreas of five prawns from each group were collected at 0, 6, 12, 24, 48, 72, and 96 h for RNA extraction. 2.2. RNA isolation, cDNA synthesis and bioinformatic analysis The total RNA was extracted from the above samples with Trizol® reagent (Thermo, USA) and then treated with RQI RNase-Free DNase (Promega, USA). Two micrograms of total RNA and 0.2 μM random hexamer primers were used to synthesize cDNA using M-MLV reverse transcriptase (Promega, USA). Based on the transcriptomic and genomic data of E. carinicauda [9], the gC1qR sequence of E. carinicauda (EcgC1qR) was obtained by reverse transcription-polymerase chain reaction (RT-PCR). The cloned sequence was analyzed for the identity and similarity by BLAST on-line. The multiple sequence alignment was performed using Bioedit. The online software SMART (http://smart.embl-heidelberg.de/) was used to predict the domain architecture of deduced amino acid sequence.
Fig. 4. Detection of EcgC1qR transcripts in different tissues of E. carinicauda. Tissues were shown in the abscissa. The amount of EcgC1qR mRNA was normalized to the 18S rRNA transcript level. Data are shown as means ± SD (standard deviation) of three separate individuals in the tissues.
2. Materials and methods 2.1. Experimental animal and immune challenge
2.3. Quantitative real-time PCR (qRT-PCR) analysis of EcgC1qR expression Referring to our previous research [13], the experimental animals, E. carinicauda, with body length of 5.0 ± 0.5 cm were bred in tanks with aerated fresh seawater at 24–26 °C, 30 ppt salinity and fed twice per day with fresh clam meat. Fifteen healthy adult prawns were dissected to separate the eyestalk, intestine, muscle, cuticle, hepatopancreas, nerve cord, heart, stomach, and gill for RNA extraction [13]. Prawns for expression profiles after immune challenge: The prawns with the same size were challenged with Vibrio parahaemolyticus and Aeromonas hydrophila according to the method [1,14]. V. parahaemolyticus and A. hydrophila were isolated from the gills of E. carinicauda by Dr. Yuying Sun [11]. Experimental and control groups were set up for each sampling point (0, 6, 12, 24, 48, 72, 96 h) and 200
Quantitative real-time PCR (qRT-PCR) [11] was used to analyze EcgC1qR distribution in different tissues and its expression profiles at different sampling time in the hepatopancreas using Mastercycler ep realplex (Eppendorf, Germany). 18S rRNA was used as the internal control. Primers are shown in Table 1. The PCR products were firstly sequenced to confirm the specificity and effectiveness of primers for qRT-PCR. The calculated length of EcgC1qR and 18S rRNA was 124 bp and 147 bp, respectively. The qRT-PCR for EcgC1qR and 18S rRNA was performed according to the program of 40 cycles of 95 °C for 15 s, 55 °C for 20 s and 72 °C for 20 s, following by an extension of 72 °C for 10 min. The data were analyzed using the comparative CT method and then subjected to one-way ANOVA using SPSS 19.0. The p values less than 380
Fish and Shellfish Immunology 82 (2018) 378–385
J. Zhang et al.
Fig. 5. Expression profiles of EcgC1qR in hepatopancreas after the prawns were challenged with V. parahaemolyticus or A. hydrophila and equal volume of PBS at 0, 6, 12, 24, 48, 72, and 96 h. The amount of EcgC1qR mRNA was normalized to 18S rRNA transcript level. Data are shown as means ± SD (standard deviation) of three separate individuals in hepatopancreas.
Fig. 6. Analysis of expressed and purified recombinant EcgC1qR protein (rEcgC1qR) by SDS-PAGE. M: protein marker (PR1910, Solarbio, China); T0: expression of the rEcgC1qR before induction with methanol (0 h); T4: expression of rEcgC1qR induced with 0.5% (v/v) methanol at 96 h; P0, P1: elution of rEcgC1qR purified by affinity chromatography on Ni-NTA agarose with 10 mM and 300 mM imidazole.
grow on histidine-deficient minimal dextrose agar plates. In addition, isolation of genomic DNA was performed following the Invitrogen's protocol and PCR amplifications were then carried out to select positive clones according to Invitrogen's recommendations with a pair of primers (5′AOX1/3′AOX1) (Table 1). For each positive clone, small-scale expression trials were initially performed to identify the most productive transformants and secretion of EcgC1qR was determined by SDS-PAGE using 12% (w/v) separating gel and 5% (w/v) stacking gel at 96 h after induction with methanol. Once the most productive transformant was selected, a large-scale expression of recombinant EcgC1qR was performed and the cells were pelleted out from the culture medium by centrifugation at 8, 000 r/min for 10 min at 4 °C. The supernatant was used to purify the recombinant EcgC1qR by affinity chromatography using Ni-NTA-agarose resin [17].
0.05 were considered statistically significant. 2.4. Recombinant expression and purification of EcgC1qR in Pichia pastoris Based on the information of EcgC1qR and multiple cloning sites (MCS) in the pPIC9K (Invitrogen, USA), a pair of primers 9k-EcgC1qRF/ 9k-EcgC1qRR was designed to construct the recombinant plasmid according to our previous research [15]. The PCR product amplified using the primers 9k-EcgC1qRF/9k-EcgC1qRR was digested with SnaB I and Not I at the same reaction volume. The digested PCR product was recovered and ligated into the linearized vector pPIC9k precut with SnaB I and Not I (Takara, Dalian, China). The constructed plasmid pPIC9kEcgC1qR was transformed into competent E. coli DH5α and verified by sequencing. Then, the extracted plasmid was linearized with Sal I followed by transformation with Pichia pastoris host strain KM71 using PEG1000 method [16]. Transformants were selected for their ability to 381
Fish and Shellfish Immunology 82 (2018) 378–385
J. Zhang et al.
2.6. Designation and synthesis of gRNA specialized for EcgC1qR According to our previous research [10,12], one sgRNA target site for EcgC1qR was designed using the online tool ZiFiT (http://zifit. partners.org/ZiFiT/ChoiceMenu.aspx), named EcgC1qR-gRNA. The gRNA sequence and the primers for detecting and sequencing were shown in Fig. 2. By searching in the genome sequence of E. carinicauda reported by Yuan et al. [9], no any possible off-target site was found. The gRNA of EcgC1qR was synthesized using the Thermo Scientific TranscriptAid T7 High Yield Transcription Kit (Thermo, USA). Then, it was purified by phenol chloroform extraction. The gRNA concentration and quality were assessed by Nanodrop (2000) and electrophoresis on 1% agarose gel. Then it was preserved at −80 °C in portions for microinjection. 2.7. Preparation of Cas9 mRNA Referring to our previous research [10], the pCMV-Cas9 vector was linearized by Xba I and purified by ethanol precipitation. The product was used to synthesize Cas9 mRNA that had both 5′cap and 3′poly (A) tail in vitro with mMACHINE® T7 Ultra Kit (Ambion, USA). Then it was purified by phenol chloroform extraction and was preserved at −80 °C in portions for microinjection. 2.8. Microinjection and indels detection by sanger sequencing The microinjection materials containing 200 ng/μL Cas9 mRNA, 100 ng/μL gRNA and 0.05% of the inert dye phenol red in the buffer (100 mM HEPES, 1.5 M NaCl) were filtered through 0.22 μm filtering membranes. The injection volume was approximately 0.5 nL. The prawns in experimental group were coinjected with Cas9 mRNA and EcgC1qR gRNA synthesized in vitro. The genomic DNA of mysis larvae prawns was extracted and the genomic region flanking the target site was amplified by MightyAmp® Genotyping Kit (Takara, Dalian, China) according to the manufacturer's instruction. For Sanger sequencing detections, the amplified PCR products were purified using Gel Extraction Kit (OMEGA, USA) and then cloned into pMD19-T Simple Vector (Takara, Dalian, China). The detection primers used to amplify the target fragment are EcgC1qR-detF and EcgC1qR-detR.
Fig. 7. Assay for the antibacterial activity of rEcgC1qR. 0.5% (w/v) of the purified rEcgC1qR was used to test the antibacterial activities against V. parahaemolyticus (A) and A. hydrophila (B). 0.5% bovine serum albumin (BSA) was used as control. Bacterial growth was evaluated by measuring the culture absorbance at 540 nm. Data are shown as means ± SD (standard deviation) of three separate tests.
3. Results 2.5. Antibacterial activity of rEcgC1qR 3.1. Characterization of EcgC1qR Referring to the method described by Huang et al. [2], the antibacterial activity of rEcgC1qR was determined using V. parahaemolyticus and A. hydrophila as the tested strains. The strains were screened out through plat streaking method, of which one single clone for each strain was picked and cultured in LB medium till the final optical density of 0.5 at 450 nm (OD 450). 0.5% (w/v) of the purified rEcgC1qR solution was used to test the antibacterial activities against V. parahaemolyticus and A. hydrophila. Meanwhile, the same concentration of bovine serum albumin (BSA) solution was used as the negative control. At 30, 60, and 120 min, the absorbance at 450 nm was recorded. Each experiment duplicates three times.
In this research, the cDNA sequence of EcgC1qR was obtained with 774 bp (GenBank accession no. JX435327) and it encoded EcgC1qR precursor of 257 amino acids (Fig. 1 A). Predicted by signal 4.1, there is no signal peptide in the deduced protein. It had a predicted molecular weight (MW) of 28509.96 Da and theoretical isoelectric point (pI) of 4.79. Analyzed by the MITOPROT program, a 55-amino-acid-long mitochondrial targeting sequence was found at the N terminal of the deduced protein (residues 1–55). One RGD motif was also predicted using ExPASy PROSITE (residues 66–68). The domain architecture of EcgC1qR protein analyzed by SMART software showed that there was a mitochondrial acidic matrix protein of 33 kDa (MAM33) domain (residues 75–254) (Fig. 1A). In addition, the genomic DNA fragment of EcgC1qR with the corresponding cDNA sequence was obtained by PCR
Table 2 Mutation frequencies induced by microinjection of Cas9 mRNA and EcgC1qR gRNA. RNA concentration 100 ng/μL EcgC1qR-gRNA
200 ng/μL (pCMV-Cas9)
Injected Embryos
Survival Postlarvae
Mutant Postlarvae
Survival Rate
Mutant Rate
212
24
11
11.32%
5.19%
382
Fish and Shellfish Immunology 82 (2018) 378–385
J. Zhang et al.
Fig. 8. Sanger sequencing of the PCR products from 10 prawns indicated the indel mutations caused by CRISPR/Cas9 genome editing system. WTM-01 means the wild-type group. MTM-01 and 02 mean the injected embryos. The PAM site was represented in blue rectangles. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
the proteins secreted into the medium and visualized by SDS-PAGE, there was a protein band specifically induced by methanol in the position on the SDS-PAGE gel expected for the size of rEcgC1qR of approximately 29 kDa (Fig. 6A). The supernatant was used to purify rEcgC1qR by affinity chromatography using Ni-NTA-agarose resin and the purified rEcgC1qR was visualized as a single band on SDS-PAGE gel (Fig. 6B). Then, 0.5% (w/v) of the purified rEcgC1qR solution was used to test the antibacterial activities against V. parahaemolyticus and A. hydrophila. As shown in Fig. 7A and B, the addition of rEcgC1qR could inhibit the growth of V. parahaemolyticus and A. hydrophila compared with that of BSA (p > 0.05), which indicated that rEcgC1qR was an antibacterial protein.
and the result showed that it is composed of 5 exons and 4 introns (Fig. 1B). All intron-exon boundaries were consistent with the consensus splicing junctions at both the 5′ splice donor site (GT) and the 3’ splice acceptor sites (AG) of each intron. In addition, the 55-amino-acid-long mitochondrial targeting sequence lies in the first exon. Therefore, we designed one guide RNA (gRNA) specialized for EcgC1qR and a pair of detection primers in the first exon (Fig. 2). A multiple sequence alignment showed that EcgC1qR displayed high identities with those of M. rosenbergii (MrgC1qR, 89%), Litopenaeus vannamei (LvgC1qR, 72%), P. monodon (PmgC1qR, 72%), F. chinensis (FcgC1qR, 72%), P. leniusculus (PlgC1qR, 70%) (Fig. 3). 3.2. Tissue distribution of EcgC1qR mRNA
3.5. Knockout of EcgC1qR using CRISPR/Cas9 technology Expression profile of EcgC1qR in different tissues of E. carinicauda was examined by qRT-PCR (Fig. 4). It was found that EcgC1qR could express in all of the detected tissues and its expression was much higher in hepatopancreas and hemocytes. Therefore, hepatopancreas are selected as target tissue to study the expression after the prawns are challenged with bacteria.
Ten days after co-injection into the one-cell embryo, five embryos were selected randomly in each group to detect the genome editing. The mutation rate of the embryos injected with Cas9 mRNA and one EcGC1qR sgRNA were analyzed (Table 2). After 15 days hatching, 24 embryos in the 212 injected one-cell stage embryos, could develop to postlarvae and the reproductive survival rate was 11.32%. Detection of the mutation for the 24 survival postlarvae, the number of mutant prawns was 11 and the mutant rate reached 5.19%. The target fragment was amplified to sequence and the results showed that multiple peaks occurred initially after the PAM sites compared with that of the wild-type prawn (Fig. 8). It indicated that the target site had been successfully edited and there was a concentrationdependent at gRNA. Furtherly, the PCR products were ligated into pMD 19-T vector (Takara, Dalian, China) and transformed into competent E. coli DH5ɑ. Ninety-six clones were randomly selected to sequence and the results showed in which eight types of deletion mutation were generated (Fig. 9).
3.3. Time course of EcgC1qR expression after V. parahaemolyticus or A. hydrophila challenge In this research, the immune function of EcgC1qR against bacteria in the prawns and the expression of EcgC1qR in hepatopancreas of E. carinicauda was measured through a semi-quantitative RT-PCR method. The results showed that the expression of hepatopancreas in the prawns challenged with V. parahaemolyticus or A. hydrophila changed in a timedependent manner (Fig. 5A and B). Compared with the expression of EcgC1qR in control group, EcgC1qR expression of EcgC1qR in prawns challenged with V. parahaemolyticus was up-regulated at 6 h (p < 0.05), and significantly up-regulated at 12 h (p < 0.01), and then returned to the control levels at 48 h post-challenge (p > 0.05). At the same time, the expression in Aeromonas-challenged group was significantly up-regulated at 6 and 12 h (p < 0.01) and returned to the control levels at 48 h post-challenge (p > 0.05).
4. Discussion The complement pathway is an important component of the innate immunity in vertebrates [7]. In this research, we firstly report one gC1qR homolog gene from E. carinicauda named EcgC1qR. The deduced amino acid sequence of EcgC1qR revealed a 55-amino-acid-long mitochondrial targeting sequence at N terminal of the deduced protein and a mitochondrial acidic matrix protein of 33 kDa (MAM33) domain. Until now, there are a lot of reports about gC1qR in crustaceans [2,5–8].
3.4. Antibacterial activity of rEcgC1qR The selected positive clone was cultured initially in BMGY medium and then induced with 0.5% (v/v) methanol in BMMY for 96 h. Among 383
Fish and Shellfish Immunology 82 (2018) 378–385
J. Zhang et al.
Fig. 9. Sanger sequencing of the different clones inserted the PCR products which indicated the indel mutations caused by CRISPR/Cas9 technology. WT means the wild-type (blank group) and MT-C1 – MT-C8 mean the different types. The PAM site was represented in blue box. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
V. parahaemolyticus and A. hydrophila. As we known, V. parahaemolyticus and A. hydrophila are two kinds of key pathogen bacteria of shrimp and the same result was also reported in other crustaceans. The recombinant gC1qR from F. chinensis could bind to several bacteria, which suggested that FcgC1qR might be involved in defending against bacterial infections in the Chinese white shrimp [6]. Huang et al. [2] found that the recombinant EsgC1qR, one gC1qR from E. sinensis, could bind to various bacteria, LPS, and PGN. Ye et al. [8] found that recombinant MrgC1qR could bind pathogen-associated molecular patterns (PAMPs) such as LPS or PGN, which suggested that MrgC1qR might function as a pathogen-recognition receptor (PRR). As we known, gC1qR in shrimp could bind to the PAMPs of bacteria and there are some disadvantages in expressing it using E. coli. Therefore, we selected P pastoris to recombinantly express the EcgC1qR. Our results showed that rEcgC1qR had the same antibacterial activity as those from other shrimp [6–8] or crab [2]. At present, there were a lot of reports about the function of gC1qR homolog gene in the immune defense in crustaceans [2,5–8]. In the previous research, studies were mainly based on gene cloning and expression analysis at the transcriptional or translational level. In our laboratory, we constructed the gene editing platform using CRISPR/
A multiple sequence alignment showed that EcgC1qR displayed high identities with those of M. rosenbergii (MrgC1qR, 89%), L. vannamei (LvgC1qR, 72%), P. monodon (PmgC1qR, 72%), F. chinensis (FcgC1qR, 72%), P. leniusculus (PlgC1qR, 70%). The genomic organization of EcgC1qR gene analyzed by PCR amplification showed that EcgC1qR gene contains five exons and four introns. It is the first report about intron/exon structure of Penaeid gC1qR. EcgC1qR could express in all of the detected tissues and its expression was much higher in hepatopancreas and hemocytes. This expression pattern agrees with those of other reported crustaceans [2,5–8]. As we know, bacteria are important pathogen in aquaculture. In this study, the immune function of EcgC1qR against bacteria was analyzed by challenging prawns with V. parahaemolyticus or A. hydrophila. Analyzing by RT-PCR, the expression of EcgC1qR in hepatopancreas was significantly up-regulated after V. parahaemolyticus or A. hydrophila challenge from 6 h to 24 h, which showed that EcgC1qR might play an important role in immune defense against bacteria. Herein, we also obtained the recombinant EcgC1qR using Pichia pastoris. The antibacterial activity of the purified recombinant EcgC1qR was evaluated and the results showed that it could inhibit the growth of
384
Fish and Shellfish Immunology 82 (2018) 378–385
J. Zhang et al.
Cas9 system in E. carinicauda and it can work efficiently in E. carinicauda [10–12]. In this paper, it was the first time to obtain the mutant of gC1qR homolog gene through CRISPR/Cas9 technology in crustacean. It's a great progress to study the biological function of EcgC1qR in prawns in future.
[6] X. Li, Z. Du, J. Lan, X. Zhang, Y. Mu, X. Zhao, et al., A novel pathogen-binding gC1qR homolog, FcgC1qR, in the Chinese white shrimp, Fenneropenaeus chinensis, Dev. Comp. Immunol. 36 (2012) 400–407. [7] L. Yang, X. Liu, W. Liu, X. Li, L. Qiu, J. Huang, et al., Characterization of complement 1q binding protein of tiger shrimp, Penaeus monodon, and its C1q binding activity, Fish Shellfish Immunol. 34 (2013) 82–90. [8] T. Ye, X. Huang, X. Wang, Y. Shi, K. Hui, Q. Ren, Characterization of a gC1qR from the giant freshwater prawn, Macrobrachium rosenbergii, Fish Shellfish Immunol. 43 (2015) 200–208. [9] J. Yuan, Y. Gao, X. Zhang, J. Wei, C. Liu, F. Li, et al., Genome sequences of marine shrimp Exopalaemon carinicauda Holthuis provide insights into genome size evolution of Caridea, Mar. Drugs 15 (2017). [10] T. Gui, J. Zhang, F. Song, Y. Sun, S. Xie, K. Yu, et al., CRISPR/Cas9-mediated genome editing and mutagenesis of EcChi4 in Exopalaemon carinicauda, Genes, Genomes Genomics 6 (2016) 3757–3764. [11] Y. Sun, J. Zhang, J. Xiang, A CRISPR/Cas9-mediated mutation in chitinase changes immune response to bacteria in Exopalaemon carinicauda, Fish Shellfish Immunol. 71 (2017) 43–49. [12] J. Zhang, F. Song, Y. Sun, K. Yu, J. Xiang, CRISPR/Cas9-mediated deletion of EcMIH shortens metamorphosis time from mysis larva to postlarva of Exopalaemon carinicauda, Fish Shellfish Immunol. 77 (2018) 244–251. [13] Y. Sun, J. Zhang, J. Xiang, Immune function against bacteria of chitin deacetylase 1 (EcCDA1) from Exopalaemon carinicauda, Fish Shellfish Immunol. 75 (2018) 115–123. [14] C. Saejung, K. Hatai, L. Sanoamuang, The in vitro antibacterial effects of organic salts, chemical disinfectants and antibiotics against pathogens of black disease in fairy shrimp of Thailand, J. Fish. Dis. 37 (2014) 33–41. [15] J. Zhang, F. Li, Z. Wang, X. Zhang, Q. Zhou, J. Xiang, Cloning, expression and identification of ferritin from Chinese shrimp, Fenneropenaeus chinensis, J. Biotechnol. 125 (2006) 173–184. [16] J. Zhang, F. Li, Z. Wang, J. Xiang, Expression, purification, and characterization of recombinant Chinese shrimp crustin-like protein (CruFc) in Pichia pastoris, Biotechnol. Lett. 29 (2007) 813–817. [17] Y. Sun, J. Zhang, S. Wang, Heterologous expression and efficient secretion of chitosanase from Microbacterium sp in Escherichia coli, Indian J. Microbiol. 55 (2015) 194–199.
Conflicts of interest There is no conflict of interest. Acknowledgments The project was supported by The National Natural Science Foundation of China (Nos. 31872613, 41876196, 31772885). References [1] C. Yang, J. Zhang, F. Li, H. Ma, Q. Zhang, T.A. Jose Priya, et al., A Toll receptor from Chinese shrimp Fenneropenaeus chinensis is responsive to Vibrio anguillarum infection, Fish Shellfish Immunol. 24 (2008) 564–574. [2] Y. Huang, W. Wang, Q. Ren, Function of gC1qR in innate immunity of Chinese mitten crab, Eriocheir sinensis, Dev. Comp. Immunol. 61 (2016) 34–41. [3] B. Ghebrehiwet, B. Lim, E. Peerschke, A. Willis, K. Reid, Isolation, cDNA cloning, and overexpression of a 33-kD cell surface glycoprotein that binds to the globular “heads” of C1q, J. Exp. Med. 179 (1994) 1809–1821. [4] A. Tye, B. Ghebrehiwet, N. Guo, K. Sastry, B. Chow, E. Peerschke, et al., The human gC1qR/p32 gene, C1qBP. Genomic organization and promoter analysis, J. Biol. Chem. 276 (2001) 17069–17075. [5] A. Watthanasurorot, P. Jiravanichpaisal, I. Soderhall, K. Soderhall, A gC1qR prevents white spot syndrome virus replication in the freshwater crayfish Pacifastacus leniusculus, J. Virol. 84 (2010) 10844–10851.
385