- Email: [email protected]
Immune function against bacteria of chitin deacetylase 1 (EcCDA1) from Exopalaemon carinicauda
Fish and Shellfish Immunology 75 (2018) 115–123
Contents lists available at ScienceDirect
Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Short communication
Immune function against bacteria of chitin deacetylase 1 (EcCDA1) from Exopalaemon carinicauda
T
Yuying Suna, Jiquan Zhanga,b,c,∗, Jianhai Xiangb,c a
College of Life Sciences, Hebei University, Baoding, Hebei 071002, China Laboratory for Marine Biology and Biotechnology, Qingdao National Laboratory for Marine Science and Technology, Qingdao 266000, China c Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China b
A R T I C L E I N F O
A B S T R A C T
Keywords: Exopalaemon carinicauda Chitin deacetylase Pichia pastoris
Chitin deacetylase (CDA, EC 3.5.1.41), belonging to a family of extracellular chitin-modifying enzymes, can catalyze the deacetylation of chitin. In this study, the full-length cDNA sequence encoding chitin deacetylase 1 (EcCDA1) was obtained fromExopalaemon carinicauda. The complete nucleotide sequence of EcCDA1 contained a 1611 bp open reading frame (ORF) encoding EcCDA1 precursor of 536 amino acids. The domain architecture of the deduced EcCDA1 protein contained a signal peptide, a chitin-binding peritrophin-A domain (ChtBD2), a lowdensity lipoprotein receptor class A domain (LDLa) and a Polysacc_deac_1 domain. EcCDA1 mRNA was predominantly expressed in the gills. The expression of EcCDA1 in the prawns challenged with Vibrio parahaemolyticus and Aeromonas hydrophila changed in a time-dependent manner. The expression of EcCDA1 in the prawns challenged with V. parahaemolyticus was up-regulated at 12 h (p < 0.05), and significantly up-regulated at 24 h and 48 h (p < 0.01), and then returned to the control levels at 96 h post-challenge (p > 0.05). At the same time, the expression in Aeromonas-challenged group was significantly up-regulated at 12, 24 and 48 h (p < 0.01) and returned to the control levels at 120 h post-challenge (p > 0.05). Then, EcCDA1 was recombinantly expressed in Pichia pastoris and the purified recombinant EcCDA1 could not inhibit the growth of V. parahaemolyticus or A. hydrophila, which indicated that the CDA1 may play its biological activity in immune defense by deacetylation from chitin.
1. Introduction Chitin, one of the most important biopolymers in nature, is mainly produced by fungi, arthropods and nematodes. In arthropods, their cuticles can form an exoskeleton to keep pace with body growth due to the presence of chitin and sclerotized proteins [1]. In addition, their growth and morphogenesis are strictly dependent on the capability to remodel chitin-containing structures [1]. Chitin-related enzymes play fundamental roles in chitin metabolism and they can be divided into three main categories, based on their functions to synthesize chitin (chitin synthases), to enzymatically alter chitin by deacetylation (chitin deacetylase, CDA) and to degrade chitin by hydrolytic process (chitinases and N-acetylglucosaminidases) [2]. CDAs (EC 3.5.1.41) are secreted proteins belonging to a family of extracellular chitin-modifying enzymes and they can hydrolyze the acetamido group in the N-acetylglucosamine units of chitin and chitosan [3]. CDA was first discovered from extracts of Mucor rouxii and it could convert nascent chitin into chitosan [4,5]. At present, a lot of CDA genes have been obtained in the species of ∗
Arthropod, especially in insects [3,6–10]. In insects, CDAs can convert chitin into chitosan, the N-deacetylated form of chitin, which influenced the mechanical and permeability properties of structures such as the cuticle and peritrophic matrices [11]. At present, a family of genes encoding chitin deacetylase (CDA)-like proteins in insects had been identified in the annotated genome sequences and the number of CDA genes was five to nine depending on the species [7]. All of the insect CDAs could be clustered into five major groups [6]. In Helicoverpa armigera, it is reported that the downregulation of a midgut-specific CDAlike protein as a possible mechanism to reduce susceptibility to baculovirus by decreasing peritrophic membrane (PM) permeability [12]. However, there was only one CDA gene reported in crustaceans, that is, CDA cDNA (named PmCDA1) cloned from the gills of black tiger shrimp, Penaeus monodon [13]. PmCDA1 was reported to be distinctly highly expressed in the gills of shrimp and the authors thought that gills in shrimps served as the predominant site for the formation of hemocyte nodules during injection of foreign particles and accumulation of viable bacteria during infection, suggesting its significant role in shrimp defense [13]. As we know, there is no model animal in Crustacean to be
Corresponding author. College of Life Sciences, Hebei University, Baoding, Hebei 071002, China. E-mail address: [email protected] (J. Zhang).
https://doi.org/10.1016/j.fsi.2018.02.004 Received 21 November 2017; Received in revised form 25 January 2018; Accepted 2 February 2018 Available online 05 February 2018 1050-4648/ © 2018 Elsevier Ltd. All rights reserved.
Fish and Shellfish Immunology 75 (2018) 115–123
Y. Sun et al.
Table 1 Primers mentioned in the paper. Primers
Sequences (5′-3′)
Sequence information
RT-EcCDA1F RT-EcCDA1R 18S-F 18S-R 9k-EcCDA1F
AGAAGAAGAGGGTCGTCAAGC GACTCATCGGCACAGTCAAAT TATACGCTAGTGGAGCTGGAA GGGGAGGTAGTGACGAAAAAT GCGAATTCCATCATCACCATCACCACGAAATAGTGAAACGCCAGGCGGCCAC
9k-EcCDA1R 5′AOX1 3′AOX1
GCGCGGCCGCTTAGAAGTAACCCTCTCCCAAAGGATC GACTGGTTCCAATTGACAAGC GCAAATGGCATTCTGACATCC
Real-time PCR Real-time PCR Real-time PCR Real-time PCR Construct the expression vector, introducing a restriction enzyme site for EcoR I and a 6 × His-tag Construct the expression vector, introducing a restriction enzyme site for Not I Confirm the insert target gene Confirm the insert target gene
Note: F and R stand for forward primers and reverse ones, respectively.
Fig. 1. (A) The nucleotide sequence and deduced amino acid sequence of EcCDA1. The predicted signal peptide is underlined in red. Chitin-binding peritrophin-A domain (ChtBD2) is underlined in black, low-density lipoprotein receptor class A domain (LDLa) is underlined in pink, and the Polysacc_deac_1 domain is underlined in blue. The N-glycosylation sites are circled in red. (B) The genomic structure of EcCDA1. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
116
Fish and Shellfish Immunology 75 (2018) 115–123
Y. Sun et al.
Fig. 2. (A) Alignment of the amino acid sequence of EcCDA1 with PmCDA1 and CqGP59. The identical residues are shown in solid boxes. Sequences start at the first methionine residue. Cherax quadricarinatus CqGP59 (GenBank accession number, ALC79575.1); Penaeus monodon PmCDA1 (ALO20448.1); Exopalaemon carinicauda EcCDA1 (MG014203, in this study). (B) Comparison of the domain architecture among EcCDA1, PmCDA1 and CqGP59.
2. Materials and methods
used in basic research. The ridgetail white prawns, Exopalaemon carincauda can be maintained with reproductive capacity all the year round in the laboratory environment with an about 60-day reproduction cycle [14]. In addition, the low-coverage sequencing and de novo assembly of the E. carinicauda genome had been performed and the assembly covers more than 95% of coding regions [15]. Therefore, E. carinicauda exhibited the potential to be used as an experimental animal in the research of Crustacean. In this research, we reported a CDA1 gene (EcCDA1) in E. carinicauda. The expression profile of EcCDA1 gene in different tissues and its immune function against bacteria was analyzed. Furthermore, the EcCDA1 was recombinantly expressed in Pichia pastoris and the partial enzymatic characterization of recombinant EcCDA1 was also analyzed.
2.1. Experimental animals, bacterial culture and immune challenge The ridgetail white prawns, E. carinicauda with body length of 5.5 ± 0.5 cm were bred in plastic tanks filled with aerated fresh seawater at 24–26 °C, 30 ppt salinity, and fed twice per day with fresh clam meat in our laboratory. Fifteen healthy adult E. carinicauda were dissected to separate eyestalk, intestine, muscle, cuticle, hepatopancreas, nerve cord, heart, stomach, and gill. Then, the samples were preserved in liquid nitrogen for RNA extraction [16]. Vibrio parahaemolyticus and Aeromonas hydrophila mentioned in this research were isolated from the intestine of diseased prawns and identified by Dr. Yuying Sun, co-author of this paper. The bacteria were cultured in Tryptic Soy Broth or TSA medium supplemented with 1% NaCl at 28 °C, 180 r/min. Prawns for expression profiles after immune challenge: The prawns
117
Fish and Shellfish Immunology 75 (2018) 115–123
Y. Sun et al.
Fig. 3. Phylogenetic tree of CDA1 or CDA1-like protein from different species based on the amino acid sequence comparisons.
Fig. 4. Detection of EcCDA1 transcripts in the different tissues of E. carinicauda detected. Tissues were shown in the abscissa. The amount of EcCDA1 mRNA was normalized to the 18S rRNA transcript level. Data are shown as means ± SD (standard deviation) of three separate individuals in the tissues.
0.2 μM random hexamer primers were used to synthesize cDNA by MMLV reverse transcriptase (Promega, USA). Based on the transcriptomic and genomic data of E. carinicauda [15], the full-length CDA1 sequence of E. carinicauda (EcCDA1) was confirmed by reverse transcription-polymerase chain reaction (RTPCR). The cloned sequence was analyzed for the identity and similarity by BLAST on-line. The multiple sequence alignments and phylogenetic analysis were performed using CLUSTAL W and MEGA 4.0 [19]. SMART (http://smart.embl-heidelberg.de/) was used to predict the domain architecture.
with the same size were challenged with V. parahaemolyticus or A. hydrophila according to the method [17,18]. Experimental groups and the control group were set up for each sampling point (0, 12, 24, 48, 72, 96, 120 h) and 200 prawns were sampled from each group. For the bacterial challenge experiment, the experimental group was injected individually with 10 μL phosphate buffer saline (PBS) containing V. parahaemolyticus or A. hydrophila (107 CFU mL−1). Each prawn was injected intramuscularly into the last abdominal segment. At the same time, the prawns injected with 10 μL sterile PBS were maintained as the control. The gills of five prawns from each group were collected at 0, 12, 24, 48, 72, 96, and 120 h. All the samples were preserved in liquid nitrogen for RNA extraction.
2.3. Quantitative real-time PCR (qRT-PCR) analysis of EcCDA1 mRNA expression
2.2. RNA isolation, cDNA synthesis and bioinformatic analysis Quantitative real-time PCR (qRT-PCR) [17] was used to analyze EcCDA1 distribution in different tissues of E. carinicauda and its expression profiles at different sampling time in the gills using Mastercycler ep realplex (Eppendorf). 18S rRNA was used as the internal
Total RNA was extracted from the collected samples with Trizol® reagent (Thermo, USA). Then, the extracted RNA was treated with RQI RNase-Free DNase (Promega, USA). Two micrograms of total RNA and 118
Fish and Shellfish Immunology 75 (2018) 115–123
Y. Sun et al.
Fig. 5. Expression profiles of EcCDA1 in the gills after the prawns were challenged with Vibrio parahaemolyticus or Aeromonas hydrophila and equal volume of PBS at 0, 12, 24, 48, 72, 96, and 120 h. The amount of EcCDA1 mRNA was normalized to the 18S rRNA transcript level. Data are shown as means ± SD (standard deviation) of three separate individuals in the gills. Fig. 6. Schematic representation of recombinant EcCDA1. The N-terminal regions of the Saccharomyces mating factor alpha precursor protein (MF_alpha_N), N-terminal His-Tag, chitinbinding peritrophin-A domain (ChtBD2), lowdensity lipoprotein receptor class A domain (LDLa), and polysaccharide deacetylase domain (Polysacc_deac_1). Scale showed the amino acids.
performed to identify the most productive transformants and secretion of EcCDA1 was determined by SDS-PAGE using 10% (w/v) separating gel and 5% (w/v) stacking gel at 96 h after induction with methanol. Once the most productive transformant was selected, a large-scale expression of recombinant EcCDA1 was performed and the cells were pelleted out from the culture medium by centrifugation at 8, 000 r/min for 10 min at 4 °C. The supernatant was used to purify the recombinant EcCDA1 by affinity chromatography using Ni-NTA-agarose resin [22].
control. Primers are shown in Table 1. The expected size of EcCDA1 and 18S rRNA was 136 bp and 147 bp in length, respectively. The PCR products were firstly sequenced to confirm the specificity and effectiveness of primers for qRT-PCR. The qRT-PCR for EcCDA1 and 18S rRNA was performed according to the program of 40 cycles of 95 °C for 15 s, 55 °C for 20 s and 72 °C for 20 s, following by an extension of 72 °C for 10 min. The data were analyzed using the comparative CT method and then subjected to one-way ANOVA using SPSS 19.0. The p values less than 0.05 were considered statistically significant.
2.5. Enzymatic assay for recombinant EcCDA1 activities 2.4. Recombinant expression and purification of EcNAG in Pichia pastoris Enzyme assay: The enzyme activity of purified rEcCDA1 was monitored using 4-Nitroacetanilide as the substrate and the hydrolyzed 4Nitroaniline was quantified by measuring the absorbance at 400 nm. The reaction mixture, containing 0.1 mL of 200 mg/L 4Nitroacetanilide, 0.1 mL of diluted enzyme solution, and 0.3 mL of 0.2 M phosphate buffer (pH 7.0), was incubated at 40 °C for 15 min. Heated for 5 min in boiling water to inactivate rEcCDA1, the mixture was added ddH2O up to 1 mL. The solution was centrifuged and CDA activity was determined by measuring amount of 4-Nitroaniline released from 4-Nitroacetanilide at OD400nm. One unit of CDA is defined as activity that catalyzes the release of 1 μg of 4-Nitroaniline per hour from 4-Nitroacetanilide under standard assay conditions [23]. The optimum pH of purified rEcCDA1 was determined by varying the pH of reaction mixture from 3 to 9. The optimum temperature was measured by putting reaction mixtures in different temperatures (ranging from 25 to 80 °C) at the optimal pH condition. Several metal ions (Ca2+, Mg2+, Cu2+, Hg2+, Mn2+, Fe3+, K+, Cd2+, Co2+ and Zn2+) were used to identify their effect on enzyme activity. Each metal ion was added into reaction mixture with a final concentration at 0.1 and
Based on the information of EcCDA1 and multiple cloning sites (MCS) in the pPIC9K, a pair of primers 9k-EcCDA1F/9k-EcCDA1R was designed to construct the recombinant plasmid according to our previous research [20]. The plasmid containing the full-length EcCDA1 sequence was used as the template. The PCR product was digested with EcoR I and Not I at the same reaction volume and the digested PCR product was ligated into the linearized vector pPIC9k precut with EcoR I and Not I. The resulting constructs pPIC9k-EcCDA1 was transformed into the E. coli DH5α and verified by sequencing. The recombinant plasmid pPIC9k-EcCDA1 was extracted and linearized with Sac I followed by transformation with Pichia pastoris host strain KM71 using PEG1000 method [21]. Transformants were selected for their ability to grow on histidine-deficient minimal dextrose agar plates. In addition, isolation of genomic DNA was performed following the Invitrogen's protocol and PCR amplifications were then carried out to select positive clones according to Invitrogen's recommendations with a pair of primers (5′AOX1/3′AOX1) (Table 1). For each positive clone, small-scale expression trials were initially 119
Fish and Shellfish Immunology 75 (2018) 115–123
Y. Sun et al.
Fig. 7. Influence of pH and temperature on enzymatic activity of rEcCDA1. (A) pH optimum and stability. The reaction mixture, containing 0.1 mL of 200 mg/L 4-Nitroacetanilide, 0.1 mL of 1.0 μM diluted enzyme solution, and 0.3 mL of 0.2 M buffer with pH 3.0 to 9.0, was incubated at 40 °C for 15 min. (B) Temperature optimum. Activity of rEcCDA1 (0.2 μM) on 4-Nitroacetanilide (50 mg/ L), samples was incubated for 15 min at pH 5.5. Heated for 5 min in boiling water to inactivate rEcCDA1, the mixture was added ddH2O up to 1 mL. The solution was centrifuged and CDA activity was determined by measuring amount of 4Nitroaniline released from 4-Nitroacetanilide at OD400nm. One unit of CDA is defined as activity that catalyzes the release of 1 μg of 4-Nitroaniline per hour from 4-Nitroacetanilide under standard assay conditions.
Table 2 Effect of metal ions on the activity of rEcCDA1.
0.1 mM 1.0 mM
Co2+
K+
Mn2+
Mg2+
Ca2+
Fe3+
Cu2+
Cd2+
Zn2+
Hg2+
Control
120.3 ± 3.9 144.4 ± 4.7
101.8 ± 3.2 100.9 ± 3.2
111.1 ± 3.5 113.5 ± 2.0
103.1 ± 3.3 100.4 ± 3.2
106.6 ± 3.4 103.6 ± 3.3
98.1 ± 3.1 94.7 ± 3.0
94.7 ± 3.0 91.2 ± 2.8
99.5 ± 2.4 97.9 ± 2.2
72.2 ± 2.2 65.0 ± 2.0
70.2 ± 2.1 63.7 ± 1.9
100 100
120
Fish and Shellfish Immunology 75 (2018) 115–123
Y. Sun et al.
Fig. 8. Assay for the antimicrobial activity of rEcCDA1. Three different concentrations of the purified rEcCDA1 solution (0.1, 0.5, and 2.0%) were used to test the antimicrobial activities against V. parahaemolyticus and A. hydrophila. 0.1% bovine serum albumin (BSA) was used as the negative control. Cultures were grown for 24 h with 250r/ min at 28 °C, and bacterial growth was evaluated by measuring the culture absorbance at 600 nm. Data are shown as means ± SD (standard deviation) of three separate tests.
A multiple sequence alignment showed that EcCDA1 displayed high identities with gastrolith protein 59 of Cherax quadricarinatus (CqGp59, 80%) and chitin deacetylase 1 of Penaeus monodon (PmCDA1, 74%) (Fig. 2A). In addition, CqGp59 should be CDA protein and it had the identical domain architecture with EcCDA1 and PmCDA1 (Fig. 2B). The phylogenetic tree analysis showed that Arthropoda CDA or CDA-like protein could be divided into two groups, Malacostraca CDA and Insecta CDA. EcCDA1 was divided into the Malacostraca CDA branch (Fig. 3). Bactrocera latifrons (BLCDA1, GenBank accession Nos. XP_ 018793742.1); Hyalella azteca (HaCDA1, XP_018026193.1); Bactrocera dorsalis (BdCDA1, XP_018026193.1); Ceratitis capitata (CcCDA1, XP_ 004534086.1); Drosophila melanogaster (DmSerp, NP_730444.1); Tribolium castaneum (TcCDA1, NP_001095946.1); Anopheles sinensis (AsCDA1, KFB50017.1); Daphnia pulex (DpCDA1, EFX70874.1); Penaeus monodon (PmCDA1, ALO20448.1); Cherax quadricarinatus (CqGp59, ALC79575.1); Ostrinia furnacalis (OfCDA1, AKJ26157.1); Stomoxys calcitrans (ScCDA1, XP_013107407.1); Exopalaemon carinicauda (EcCDA1, MG014203, in this research). Values on the line are bootstrap values showing percentage confidence of relatedness.
1.0 mM, and then the enzyme activity was determined immediately following the method described above. 2.6. Antimicrobial activity of rEcCDA1 Three different concentrations of the purified rEcCDA1 solution (0.1, 0.5, and 2.0%) were used to test the antimicrobial activities against V. parahaemolyticus and A. hydrophila. Meanwhile, 0.1% bovine serum albumin (BSA) was used as the negative control. Aliquots (10 μL) from each dilution were transferred to a 96-well polypropylene microtiter plate, and each well was inoculated with 100 μL of a suspension of mid-log phase bacteria (105 CFU/mL) in TSA medium supplemented with 1% NaCl. Cultures were grown for 24 h with 250 r/min at 28 °C, and bacterial growth was evaluated by measuring the culture absorbance at 600 nm using a microplate reader. 3. Results 3.1. Characterization of EcCDA1 Based on the transcriptomic and genomic data of E. carinicauda [15], the full-length cDNA sequence of EcCDA1 was obtained with 2887 bp (GenBank accession no. MG014203). As shown in Fig. 1A, the complete nucleotide sequence of EcCDA1 contained a 1611 bp open reading frame (ORF) encoding EcCDA1 precursor of 536 amino acids consisting of a 19 amino acid residue signal peptide and a mature polypeptide of 317 amino acid residues (Fig. 1 A). After removal of the signal peptide, the deduced protein had a predicted molecular weight (MW) about 59154.50 Da and theoretical isoelectric point (pI) of 4.64. The NetNglyc server was used to predict N-Glycosylation sites and the result showed that the protein contained three putative N-glycosylation sites at Asn170, 221 and 273 (Fig. 1A). The domain architecture prediction of EcCDA1 protein by SMART software online showed that there were three functional domains, including a chitin-binding peritrophinA domain (ChtBD2), a low-density lipoprotein receptor class A domain (LDLa) and a Polysacc_deac_1 domain (Fig. 1A). In addition, the genomic DNA fragment of EcCDA1 with the corresponding cDNA sequence was obtained by PCR and the result showed that it is composed of seven exons and six introns (Fig. 1B). All intron-exon boundaries were consistent with the consensus splicing junctions at both the 5′ splice donor site (GT) and the 3′ splice acceptor sites (AG) of each intron.
3.2. Tissue distribution of EcCDA1 mRNA Expression profiling of EcCDA1 in different tissues of E. carinicauda was examined by qRT-PCR (Fig. 4). It was predominantly expressed in gills. Therefore, gills are served as the tissue to study the expression profile after the prawns were challenged with bacteria. 3.3. Time course of EcCDA1 expression after V. parahaemolyticus or A. hydrophila challenge It had been reported that CDA1 from Penaeus monodon exhibited putative immune function against WSSV [13]. Herein, we tried to study the immune function of EcCDA1 against bacteria in the prawns and the expression of EcCDA1 in gills of E. carinicauda was measured through a semi-quantitative RT-PCR method. The results showed that the expression of EcCDA1 in the prawns challenged with Vibrio parahaemolyticus or Aeromonas hydrophila changed in a time-dependent manner (Fig. 5). Compared with the expression of EcCDA1 in the control group, the expression of EcCDA1 in the prawns challenged with V. parahaemolyticus was up-regulated at 12 h (p < 0.05), and significantly up-regulated at 24 h and 48 h (p < 0.01), and then returned to the 121
Fish and Shellfish Immunology 75 (2018) 115–123
Y. Sun et al.
(ChtBD2), a low-density lipoprotein receptor class A domain (LDLa) and a Polysacc_deac_1 domain. The phylogenetic tree analysis also showed that Arthropoda CDA1 could be divided into two groups, Malacostraca CDA1 and Insecta CDA1. EcCDA1, PmCDA1 and CqGp59 were divided into the Malacostraca CDA branch. In addition, our result showed that the expression of EcCDA1 was highest in gills, which was similar with PmCDA1 (74%) from P. monodon [13]. Previously, researchers reported that PmCDA1 exhibited putative immune function against WSSV [13]. However, there is no related report about the immune function of CDA1 against bacteria. As we know, bacteria are also key pathogen in fisheries. In this study, the immune function of EcCDA1 against bacteria was clarified by challenging the prawns with V. parahaemolyticus or A. hydrophila. Analyzing by semi-quantitative RT-PCR method, the expression of EcCDA1 in gills was significantly upregulated after V. parahaemolyticus or A. hydrophila challenge, which indicated that EcCDA1 might play a key role in immune defense against bacteria. It had been reported that some chitindegrading enzymes was related to the immune defense in Penaeid shrimp, such as chitinase from M. japonicas [25], Fenneropenaeus chinensis [26], E. carinicauda [16] and CDA1 from P. monodon [13], etc. In this research, we also obtained the recombinant EcCDA1 in Pichia pastoris. The partial enzymatic characterization was also confirmed and the rEcCDA1 could not inhibit the growth of the pathogen V. parahaemolyticus or A. hydrophila directly. Theoretically, chitosans can be produced from chitin by enzymatic deacetylation partially and the generated chitosans with different degree of acetylation (DA) might differ in their biological activities. Just like chitinases, CDA1 also possess a chitin-binding domain (CBD) to help it act on the insoluble chitin. The rEcCDA1 with a CBD could act on the insoluble chitin as a substrate to produce chitosan. Under slightly acidic conditions, chitosan is more water-soluble than chitin and the solubility of chitosan or partially deacetylated chitin render them more useful for applications. It was reported that CDAs played very important roles in the biological attack and defense systems and they could be used in the biological control of fungal plant pathogens or insect pests in agriculture and for the biocontrol of opportunistic fungal human pathogens [27]. Chitin is one of the major components of the cuticle of crustaceans. As a result, precise regulation of its synthesis and degradation is crucial for its growth and development. CDA plays an important role in the degradation of chitin. We presume that the CDA1 may play its biological activity in immune defense by deacetylation from chitin.
control levels at 96 h post-challenge (p > 0.05). At the same time, the expression in Aeromonas-challenged group was significantly up-regulated at 12, 24 and 48 h (p < 0.01) and returned to the control levels at 120 h post-challenge (p > 0.05). 3.4. Characterization of recombinant EcCDA1 (rEcCDA1) Based on the information of pPIC9K and the domain architecture of EcCDA1, the expression plasmid pPIC9k-EcCDA1 was designed and the domain architecture of predicted recombinant protein was showed in Fig. 6. The constructed recombinant plasmid, pPIC9k-EcCDA1, was linearized with Sac I and transformed into Pichia pastoris KM71 according to PEG1000 method. After transformation and screening by histidine-deficient medium and G418, the positive yeast cells containing plasmid were selected for cultivation and induction by 1% (v/v) methanol at 28 °C. Then, EcCDA1 was expressed with the intent to secrete it into the culture media and contained an N-terminal His-Tag for rapid purification at the native condition. The purified rEcCDA1 was used to study its characteristic, including the optimal pH and temperature, the effects of metal ions. The enzymatic characterization of rEcCDA1 was performed using 4Nitroacetanilide as the substrate and quantifying the hydrolyzed 4Nitroaniline. The pH dependency of rEcCDA1 is described by an unusual curve with an increase of activity over the pH range 3.0–5.5, followed by a decrease of activity over the pH range 5.5–9.0. Meanwhile, the pH stability of rEcCDA1 is described by an unusual curve with an almost linear increase over the pH 3.0 to 7.5, followed by a strong decrease in activity of the enzyme above pH 7.5 (Fig. 7A). Then, we tested the temperature optimum at 15 min and pH 5.5 as shown in Fig. 7B, revealing a broad optimal temperature of 30–45 °C with a maximum at 35 °C. Under the optimal pH and temperature conditions, several metal ions (Ca2+, Mg2+, Cu2+, Hg2+, Mn2+, Fe3+, K+, Cd2+, Co2+ and Zn2+) were used to identify their effect on enzyme activity. The results showed that rEcCDA1 activity was partially inhibited by the presence of 0.1 mM or 1.0 mM Zn2+ and Hg2+. In addition, the rEcCDA1 activity was increased by the presence of 0.1 mM or 1.0 mM the Co2+ and Mn2+ (Table 2). 3.5. Antimicrobial activity of rEcCDA1 Three different concentrations of the purified rEcCDA1 solution (0.1, 0.5, and 2.0%) were used to test the antimicrobial activities against V. parahaemolyticus and A. hydrophila. As shown in Fig. 8, the addition of rEcCDA1 could not inhibit the growth of V. parahaemolyticus and A. hydrophila compared with the control (p > 0.05), which indicated that rEcCDA1 was not an antimicrobial protein.
Acknowledgments The project was supported by The National Natural Science Foundation of China (Nos. 31172449, 41376165); A Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions; The National High Technology Research and Development Program of China (No. 2012AA10A401).
4. Discussion In crustaceans, the chitin exoskeleton is an important barrier against pathogens as well as for maintaining their morphology and physiology. Chitin, a long-chain polymer, is formed by polymerizing N-acetyl-Dglucosamine through β-1, 4-glycosidic bonds. Chitin metabolism is critical for the growth, development and survival of crustaceans. It was reported that chitin degradation required the action of many enzymes, including chitin deacetylase, chitinase and molt-associated protease, in which chitin deacetylases (CDA) play an important role [24]. Herein, we first report one chitin deacetylase 1 gene in E. carinicauda and named it EcCDA1. Until now, there is only one report about CDA1 in crustaceans [13]. By searching for the information of CDA1 in NCBI, we found that there was a gastrolith protein 59 (CqGp59) from C. quadricarinatus was deposited in the database. Comparison of the deduced amino acid sequence of EcCDA1 indicated that it was high similar to that of the PmCDA1 (74%) from P. monodon and CqGp59 (80%) from C. quadricarinatus. And, they contained similar functional domains, including a chitin-binding peritrophin-A domain
References [1] H. Merzendorfer, L. Zimoch, Chitin metabolism in insects: structure, function and regulation of chitin synthases and chitinases, J. Exp. Biol. 206 (24) (2003) 4393–4412. [2] G. Tetreau, X. Cao, Y.R. Chen, S. Muthukrishnan, H. Jiang, G.W. Blissard, M.R. Kanost, P. Wang, Overview of chitin metabolism enzymes in Manduca sexta: identification, domain organization, phylogenetic analysis and gene expression, Insect Biochem. Mol. Biol. 62 (2015) 114–126. [3] Y. Arakane, R. Dixit, K. Begum, Y. Park, C.A. Specht, H. Merzendorfer, K.J. Kramer, S. Muthukrishnan, R.W. Beeman, Analysis of functions of the chitin deacetylase gene family in Tribolium castaneum, Insect Biochem. Mol. Biol. 39 (5–6) (2009) 355–365. [4] Y. Araki, E. Ito, A pathway of chitosan formation in Mucor rouxii. Enzymatic deacetylation of chitin, Eur. J. Biochem. 55 (1) (1975) 71–78. [5] L.L. Davis, S. Bartnickigarcia, Chitosan synthesis by the tandem action of chitin synthetase and chitin deacetylase from Mucor rouxii, Biochemistry 23 (6) (1984) 1065–1073. [6] Y. Xi, P.L. Pan, Y.X. Ye, B. Yu, C.X. Zhang, Chitin deacetylase family genes in the brown planthopper, Nilaparvata lugens (Hemiptera: Delphacidae), Insect Mol. Biol.
122
Fish and Shellfish Immunology 75 (2018) 115–123
Y. Sun et al.
71 (2017) 43–49. [17] C. Yang, J. Zhang, F. Li, H. Ma, Q. Zhang, T.A. Jose Priya, X. Zhang, J. Xiang, A Toll receptor from Chinese shrimp Fenneropenaeus chinensis is responsive to Vibrio anguillarum infection, Fish Shellfish Immunol. 24 (5) (2008) 564–574. [18] C. Saejung, K. Hatai, L. Sanoamuang, The in-vitro antibacterial effects of organic salts, chemical disinfectants and antibiotics against pathogens of black disease in fairy shrimp of Thailand, J. Fish. Dis. 37 (1) (2014) 33–41. [19] K. Tamura, J. Dudley, M. Nei, S. Kumar, MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0, Mol. Biol. Evol. 24 (8) (2007) 1596–1599. [20] J. Zhang, T. Gui, J. Wang, J. Xiang, The ferritin gene in ridgetail white prawn Exopalaemon carinicauda: cloning, expression and function, Int. J. Biol. Macromol. 72 (2015) 320–325. [21] J. Zhang, F. Li, Z. Wang, J. Xiang, Expression, purification, and characterization of recombinant Chinese shrimp crustin-like protein (CruFc) in Pichia pastoris, Biotechnol. Lett. 29 (5) (2007) 813–817. [22] Y. Sun, J. Zhang, S. Wang, Heterologous expression and efficient secretion of chitosanase from Microbacterium sp in Escherichia coli, Indian J. Microbiol. 55 (2) (2015) 194–199. [23] Y.Y. Sun, J.Q. Zhang, S.J. Wu, S.J. Wang, Statistical optimization for production of chitin deacetylase from Rhodococcus erythropolis HG05, Carbohydr. Polym. 102 (2014) 649–652. [24] H.Z. Yu, M.H. Liu, X.Y. Wang, X. Yang, W.L. Wang, L. Geng, D. Yu, X.L. Liu, G.Y. Liu, J.P. Xu, Identification and expression profiles of chitin deacetylase genes in the rice leaf folder, Cnaphalocrocis medinalis, J. Asia-Pacif. Entomol 19 (3) (2016) 691–696. [25] D. Pan, N. He, Z. Yang, H. Liu, X. Xu, Differential gene expression profile in hepatopancreas of WSSV-resistant shrimp (Penaeus japonicus) by suppression subtractive hybridization, Dev. Comp. Immunol. 29 (2) (2005) 103–112. [26] J. Zhang, Y. Sun, F. Li, B. Huang, J. Xiang, Molecular characterization and expression analysis of chitinase (Fcchi-3) from Chinese shrimp, Fenneropenaeus chinensis, Mol. Biol. Rep. 37 (4) (2010) 1913–1921. [27] Y. Zhao, R.D. Park, R.A. Muzzarelli, Chitin deacetylases: properties and applications, Mar. Drugs 8 (1) (2010) 24–46.
23 (6) (2014) 695–705. [7] R. Dixit, Y. Arakane, C.A. Specht, C. Richard, K.J. Kramer, R.W. Beeman, S. Muthukrishnan, Domain organization and phylogenetic analysis of proteins from the chitin deacetylase gene family of Tribolium castaneum and three other species of insects, Insect Biochem. Mol. Biol. 38 (4) (2008) 440–451. [8] G. Quan, T. Ladd, J. Duan, F. Wen, D. Doucet, M. Cusson, P.J. Krell, Characterization of a spruce budworm chitin deacetylase gene: stage- and tissuespecific expression, and inhibition using RNA interference, Insect Biochem. Mol. Biol. 43 (8) (2013) 683–691. [9] U. Toprak, D. Baldwin, M. Erlandson, C. Gillott, X. Hou, C. Coutu, D.D. Hegedus, A chitin deacetylase and putative insect intestinal lipases are components of the Mamestra configurata (Lepidoptera: noctuidae) peritrophic matrix, Insect Mol. Biol. 17 (5) (2008) 573–585. [10] Y. Arakane, R. Dixit, K. Begum, Y. Park, C.A. Specht, H. Merzendorfer, K.J. Kramer, S. Muthukrishnan, R.W. Beeman, Analysis of functions of the chitin deacetylase gene family in Tribolium castaneum, Insect Biochem. Mol. Biol. 39 (5–6) (2009) 355–365. [11] G.Y. Han, X.M. Li, T. Zhang, X.T. Zhu, J.G. Li, Cloning and tissue-specific expression of a chitin deacetylase gene from Helicoverpa armigera (Lepidoptera: noctuidae) and its response to Bacillus thuringiensis, J. Insect Sci. 15 (2015). [12] A.K. Jakubowska, S. Caccia, K.H. Gordon, J. Ferre, S. Herrero, Downregulation of a chitin deacetylase-like protein in response to baculovirus infection and its application for improving baculovirus infectivity, J. Virol. 84 (5) (2010) 2547–2555. [13] K.P. Sarmiento, V.A. Panes, M.D. Santos, Molecular cloning and expression of chitin deacetylase 1 gene from the gills of Penaeus monodon (black tiger shrimp), Fish Shellfish Immunol. 55 (2016) 484–489. [14] J. Zhang, J. Wang, T. Gui, Z. Sun, J. Xiang, A copper-induced metallothionein gene from Exopalaemon carinicauda and its response to heavy metal ions, Int. J. Biol. Macromol. 70 (2014) 246–250. [15] J. Yuan, Y. Gao, X. Zhang, J. Wei, C. Liu, F. Li, J. Xiang, Genome sequences of marine shrimp Exopalaemon carinicauda Holthuis provide insights into genome size evolution of Caridea, Mar. Drugs 15 (7) (2017). [16] Y. Sun, J. Zhang, J. Xiang, A CRISPR/Cas9-mediated mutation in chitinase changes immune response to bacteria in Exopalaemon carinicauda, Fish Shellfish Immunol.
123
Contents lists available at ScienceDirect
Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Short communication
Immune function against bacteria of chitin deacetylase 1 (EcCDA1) from Exopalaemon carinicauda
T
Yuying Suna, Jiquan Zhanga,b,c,∗, Jianhai Xiangb,c a
College of Life Sciences, Hebei University, Baoding, Hebei 071002, China Laboratory for Marine Biology and Biotechnology, Qingdao National Laboratory for Marine Science and Technology, Qingdao 266000, China c Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071, China b
A R T I C L E I N F O
A B S T R A C T
Keywords: Exopalaemon carinicauda Chitin deacetylase Pichia pastoris
Chitin deacetylase (CDA, EC 3.5.1.41), belonging to a family of extracellular chitin-modifying enzymes, can catalyze the deacetylation of chitin. In this study, the full-length cDNA sequence encoding chitin deacetylase 1 (EcCDA1) was obtained fromExopalaemon carinicauda. The complete nucleotide sequence of EcCDA1 contained a 1611 bp open reading frame (ORF) encoding EcCDA1 precursor of 536 amino acids. The domain architecture of the deduced EcCDA1 protein contained a signal peptide, a chitin-binding peritrophin-A domain (ChtBD2), a lowdensity lipoprotein receptor class A domain (LDLa) and a Polysacc_deac_1 domain. EcCDA1 mRNA was predominantly expressed in the gills. The expression of EcCDA1 in the prawns challenged with Vibrio parahaemolyticus and Aeromonas hydrophila changed in a time-dependent manner. The expression of EcCDA1 in the prawns challenged with V. parahaemolyticus was up-regulated at 12 h (p < 0.05), and significantly up-regulated at 24 h and 48 h (p < 0.01), and then returned to the control levels at 96 h post-challenge (p > 0.05). At the same time, the expression in Aeromonas-challenged group was significantly up-regulated at 12, 24 and 48 h (p < 0.01) and returned to the control levels at 120 h post-challenge (p > 0.05). Then, EcCDA1 was recombinantly expressed in Pichia pastoris and the purified recombinant EcCDA1 could not inhibit the growth of V. parahaemolyticus or A. hydrophila, which indicated that the CDA1 may play its biological activity in immune defense by deacetylation from chitin.
1. Introduction Chitin, one of the most important biopolymers in nature, is mainly produced by fungi, arthropods and nematodes. In arthropods, their cuticles can form an exoskeleton to keep pace with body growth due to the presence of chitin and sclerotized proteins [1]. In addition, their growth and morphogenesis are strictly dependent on the capability to remodel chitin-containing structures [1]. Chitin-related enzymes play fundamental roles in chitin metabolism and they can be divided into three main categories, based on their functions to synthesize chitin (chitin synthases), to enzymatically alter chitin by deacetylation (chitin deacetylase, CDA) and to degrade chitin by hydrolytic process (chitinases and N-acetylglucosaminidases) [2]. CDAs (EC 3.5.1.41) are secreted proteins belonging to a family of extracellular chitin-modifying enzymes and they can hydrolyze the acetamido group in the N-acetylglucosamine units of chitin and chitosan [3]. CDA was first discovered from extracts of Mucor rouxii and it could convert nascent chitin into chitosan [4,5]. At present, a lot of CDA genes have been obtained in the species of ∗
Arthropod, especially in insects [3,6–10]. In insects, CDAs can convert chitin into chitosan, the N-deacetylated form of chitin, which influenced the mechanical and permeability properties of structures such as the cuticle and peritrophic matrices [11]. At present, a family of genes encoding chitin deacetylase (CDA)-like proteins in insects had been identified in the annotated genome sequences and the number of CDA genes was five to nine depending on the species [7]. All of the insect CDAs could be clustered into five major groups [6]. In Helicoverpa armigera, it is reported that the downregulation of a midgut-specific CDAlike protein as a possible mechanism to reduce susceptibility to baculovirus by decreasing peritrophic membrane (PM) permeability [12]. However, there was only one CDA gene reported in crustaceans, that is, CDA cDNA (named PmCDA1) cloned from the gills of black tiger shrimp, Penaeus monodon [13]. PmCDA1 was reported to be distinctly highly expressed in the gills of shrimp and the authors thought that gills in shrimps served as the predominant site for the formation of hemocyte nodules during injection of foreign particles and accumulation of viable bacteria during infection, suggesting its significant role in shrimp defense [13]. As we know, there is no model animal in Crustacean to be
Corresponding author. College of Life Sciences, Hebei University, Baoding, Hebei 071002, China. E-mail address: [email protected] (J. Zhang).
https://doi.org/10.1016/j.fsi.2018.02.004 Received 21 November 2017; Received in revised form 25 January 2018; Accepted 2 February 2018 Available online 05 February 2018 1050-4648/ © 2018 Elsevier Ltd. All rights reserved.
Fish and Shellfish Immunology 75 (2018) 115–123
Y. Sun et al.
Table 1 Primers mentioned in the paper. Primers
Sequences (5′-3′)
Sequence information
RT-EcCDA1F RT-EcCDA1R 18S-F 18S-R 9k-EcCDA1F
AGAAGAAGAGGGTCGTCAAGC GACTCATCGGCACAGTCAAAT TATACGCTAGTGGAGCTGGAA GGGGAGGTAGTGACGAAAAAT GCGAATTCCATCATCACCATCACCACGAAATAGTGAAACGCCAGGCGGCCAC
9k-EcCDA1R 5′AOX1 3′AOX1
GCGCGGCCGCTTAGAAGTAACCCTCTCCCAAAGGATC GACTGGTTCCAATTGACAAGC GCAAATGGCATTCTGACATCC
Real-time PCR Real-time PCR Real-time PCR Real-time PCR Construct the expression vector, introducing a restriction enzyme site for EcoR I and a 6 × His-tag Construct the expression vector, introducing a restriction enzyme site for Not I Confirm the insert target gene Confirm the insert target gene
Note: F and R stand for forward primers and reverse ones, respectively.
Fig. 1. (A) The nucleotide sequence and deduced amino acid sequence of EcCDA1. The predicted signal peptide is underlined in red. Chitin-binding peritrophin-A domain (ChtBD2) is underlined in black, low-density lipoprotein receptor class A domain (LDLa) is underlined in pink, and the Polysacc_deac_1 domain is underlined in blue. The N-glycosylation sites are circled in red. (B) The genomic structure of EcCDA1. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
116
Fish and Shellfish Immunology 75 (2018) 115–123
Y. Sun et al.
Fig. 2. (A) Alignment of the amino acid sequence of EcCDA1 with PmCDA1 and CqGP59. The identical residues are shown in solid boxes. Sequences start at the first methionine residue. Cherax quadricarinatus CqGP59 (GenBank accession number, ALC79575.1); Penaeus monodon PmCDA1 (ALO20448.1); Exopalaemon carinicauda EcCDA1 (MG014203, in this study). (B) Comparison of the domain architecture among EcCDA1, PmCDA1 and CqGP59.
2. Materials and methods
used in basic research. The ridgetail white prawns, Exopalaemon carincauda can be maintained with reproductive capacity all the year round in the laboratory environment with an about 60-day reproduction cycle [14]. In addition, the low-coverage sequencing and de novo assembly of the E. carinicauda genome had been performed and the assembly covers more than 95% of coding regions [15]. Therefore, E. carinicauda exhibited the potential to be used as an experimental animal in the research of Crustacean. In this research, we reported a CDA1 gene (EcCDA1) in E. carinicauda. The expression profile of EcCDA1 gene in different tissues and its immune function against bacteria was analyzed. Furthermore, the EcCDA1 was recombinantly expressed in Pichia pastoris and the partial enzymatic characterization of recombinant EcCDA1 was also analyzed.
2.1. Experimental animals, bacterial culture and immune challenge The ridgetail white prawns, E. carinicauda with body length of 5.5 ± 0.5 cm were bred in plastic tanks filled with aerated fresh seawater at 24–26 °C, 30 ppt salinity, and fed twice per day with fresh clam meat in our laboratory. Fifteen healthy adult E. carinicauda were dissected to separate eyestalk, intestine, muscle, cuticle, hepatopancreas, nerve cord, heart, stomach, and gill. Then, the samples were preserved in liquid nitrogen for RNA extraction [16]. Vibrio parahaemolyticus and Aeromonas hydrophila mentioned in this research were isolated from the intestine of diseased prawns and identified by Dr. Yuying Sun, co-author of this paper. The bacteria were cultured in Tryptic Soy Broth or TSA medium supplemented with 1% NaCl at 28 °C, 180 r/min. Prawns for expression profiles after immune challenge: The prawns
117
Fish and Shellfish Immunology 75 (2018) 115–123
Y. Sun et al.
Fig. 3. Phylogenetic tree of CDA1 or CDA1-like protein from different species based on the amino acid sequence comparisons.
Fig. 4. Detection of EcCDA1 transcripts in the different tissues of E. carinicauda detected. Tissues were shown in the abscissa. The amount of EcCDA1 mRNA was normalized to the 18S rRNA transcript level. Data are shown as means ± SD (standard deviation) of three separate individuals in the tissues.
0.2 μM random hexamer primers were used to synthesize cDNA by MMLV reverse transcriptase (Promega, USA). Based on the transcriptomic and genomic data of E. carinicauda [15], the full-length CDA1 sequence of E. carinicauda (EcCDA1) was confirmed by reverse transcription-polymerase chain reaction (RTPCR). The cloned sequence was analyzed for the identity and similarity by BLAST on-line. The multiple sequence alignments and phylogenetic analysis were performed using CLUSTAL W and MEGA 4.0 [19]. SMART (http://smart.embl-heidelberg.de/) was used to predict the domain architecture.
with the same size were challenged with V. parahaemolyticus or A. hydrophila according to the method [17,18]. Experimental groups and the control group were set up for each sampling point (0, 12, 24, 48, 72, 96, 120 h) and 200 prawns were sampled from each group. For the bacterial challenge experiment, the experimental group was injected individually with 10 μL phosphate buffer saline (PBS) containing V. parahaemolyticus or A. hydrophila (107 CFU mL−1). Each prawn was injected intramuscularly into the last abdominal segment. At the same time, the prawns injected with 10 μL sterile PBS were maintained as the control. The gills of five prawns from each group were collected at 0, 12, 24, 48, 72, 96, and 120 h. All the samples were preserved in liquid nitrogen for RNA extraction.
2.3. Quantitative real-time PCR (qRT-PCR) analysis of EcCDA1 mRNA expression
2.2. RNA isolation, cDNA synthesis and bioinformatic analysis Quantitative real-time PCR (qRT-PCR) [17] was used to analyze EcCDA1 distribution in different tissues of E. carinicauda and its expression profiles at different sampling time in the gills using Mastercycler ep realplex (Eppendorf). 18S rRNA was used as the internal
Total RNA was extracted from the collected samples with Trizol® reagent (Thermo, USA). Then, the extracted RNA was treated with RQI RNase-Free DNase (Promega, USA). Two micrograms of total RNA and 118
Fish and Shellfish Immunology 75 (2018) 115–123
Y. Sun et al.
Fig. 5. Expression profiles of EcCDA1 in the gills after the prawns were challenged with Vibrio parahaemolyticus or Aeromonas hydrophila and equal volume of PBS at 0, 12, 24, 48, 72, 96, and 120 h. The amount of EcCDA1 mRNA was normalized to the 18S rRNA transcript level. Data are shown as means ± SD (standard deviation) of three separate individuals in the gills. Fig. 6. Schematic representation of recombinant EcCDA1. The N-terminal regions of the Saccharomyces mating factor alpha precursor protein (MF_alpha_N), N-terminal His-Tag, chitinbinding peritrophin-A domain (ChtBD2), lowdensity lipoprotein receptor class A domain (LDLa), and polysaccharide deacetylase domain (Polysacc_deac_1). Scale showed the amino acids.
performed to identify the most productive transformants and secretion of EcCDA1 was determined by SDS-PAGE using 10% (w/v) separating gel and 5% (w/v) stacking gel at 96 h after induction with methanol. Once the most productive transformant was selected, a large-scale expression of recombinant EcCDA1 was performed and the cells were pelleted out from the culture medium by centrifugation at 8, 000 r/min for 10 min at 4 °C. The supernatant was used to purify the recombinant EcCDA1 by affinity chromatography using Ni-NTA-agarose resin [22].
control. Primers are shown in Table 1. The expected size of EcCDA1 and 18S rRNA was 136 bp and 147 bp in length, respectively. The PCR products were firstly sequenced to confirm the specificity and effectiveness of primers for qRT-PCR. The qRT-PCR for EcCDA1 and 18S rRNA was performed according to the program of 40 cycles of 95 °C for 15 s, 55 °C for 20 s and 72 °C for 20 s, following by an extension of 72 °C for 10 min. The data were analyzed using the comparative CT method and then subjected to one-way ANOVA using SPSS 19.0. The p values less than 0.05 were considered statistically significant.
2.5. Enzymatic assay for recombinant EcCDA1 activities 2.4. Recombinant expression and purification of EcNAG in Pichia pastoris Enzyme assay: The enzyme activity of purified rEcCDA1 was monitored using 4-Nitroacetanilide as the substrate and the hydrolyzed 4Nitroaniline was quantified by measuring the absorbance at 400 nm. The reaction mixture, containing 0.1 mL of 200 mg/L 4Nitroacetanilide, 0.1 mL of diluted enzyme solution, and 0.3 mL of 0.2 M phosphate buffer (pH 7.0), was incubated at 40 °C for 15 min. Heated for 5 min in boiling water to inactivate rEcCDA1, the mixture was added ddH2O up to 1 mL. The solution was centrifuged and CDA activity was determined by measuring amount of 4-Nitroaniline released from 4-Nitroacetanilide at OD400nm. One unit of CDA is defined as activity that catalyzes the release of 1 μg of 4-Nitroaniline per hour from 4-Nitroacetanilide under standard assay conditions [23]. The optimum pH of purified rEcCDA1 was determined by varying the pH of reaction mixture from 3 to 9. The optimum temperature was measured by putting reaction mixtures in different temperatures (ranging from 25 to 80 °C) at the optimal pH condition. Several metal ions (Ca2+, Mg2+, Cu2+, Hg2+, Mn2+, Fe3+, K+, Cd2+, Co2+ and Zn2+) were used to identify their effect on enzyme activity. Each metal ion was added into reaction mixture with a final concentration at 0.1 and
Based on the information of EcCDA1 and multiple cloning sites (MCS) in the pPIC9K, a pair of primers 9k-EcCDA1F/9k-EcCDA1R was designed to construct the recombinant plasmid according to our previous research [20]. The plasmid containing the full-length EcCDA1 sequence was used as the template. The PCR product was digested with EcoR I and Not I at the same reaction volume and the digested PCR product was ligated into the linearized vector pPIC9k precut with EcoR I and Not I. The resulting constructs pPIC9k-EcCDA1 was transformed into the E. coli DH5α and verified by sequencing. The recombinant plasmid pPIC9k-EcCDA1 was extracted and linearized with Sac I followed by transformation with Pichia pastoris host strain KM71 using PEG1000 method [21]. Transformants were selected for their ability to grow on histidine-deficient minimal dextrose agar plates. In addition, isolation of genomic DNA was performed following the Invitrogen's protocol and PCR amplifications were then carried out to select positive clones according to Invitrogen's recommendations with a pair of primers (5′AOX1/3′AOX1) (Table 1). For each positive clone, small-scale expression trials were initially 119
Fish and Shellfish Immunology 75 (2018) 115–123
Y. Sun et al.
Fig. 7. Influence of pH and temperature on enzymatic activity of rEcCDA1. (A) pH optimum and stability. The reaction mixture, containing 0.1 mL of 200 mg/L 4-Nitroacetanilide, 0.1 mL of 1.0 μM diluted enzyme solution, and 0.3 mL of 0.2 M buffer with pH 3.0 to 9.0, was incubated at 40 °C for 15 min. (B) Temperature optimum. Activity of rEcCDA1 (0.2 μM) on 4-Nitroacetanilide (50 mg/ L), samples was incubated for 15 min at pH 5.5. Heated for 5 min in boiling water to inactivate rEcCDA1, the mixture was added ddH2O up to 1 mL. The solution was centrifuged and CDA activity was determined by measuring amount of 4Nitroaniline released from 4-Nitroacetanilide at OD400nm. One unit of CDA is defined as activity that catalyzes the release of 1 μg of 4-Nitroaniline per hour from 4-Nitroacetanilide under standard assay conditions.
Table 2 Effect of metal ions on the activity of rEcCDA1.
0.1 mM 1.0 mM
Co2+
K+
Mn2+
Mg2+
Ca2+
Fe3+
Cu2+
Cd2+
Zn2+
Hg2+
Control
120.3 ± 3.9 144.4 ± 4.7
101.8 ± 3.2 100.9 ± 3.2
111.1 ± 3.5 113.5 ± 2.0
103.1 ± 3.3 100.4 ± 3.2
106.6 ± 3.4 103.6 ± 3.3
98.1 ± 3.1 94.7 ± 3.0
94.7 ± 3.0 91.2 ± 2.8
99.5 ± 2.4 97.9 ± 2.2
72.2 ± 2.2 65.0 ± 2.0
70.2 ± 2.1 63.7 ± 1.9
100 100
120
Fish and Shellfish Immunology 75 (2018) 115–123
Y. Sun et al.
Fig. 8. Assay for the antimicrobial activity of rEcCDA1. Three different concentrations of the purified rEcCDA1 solution (0.1, 0.5, and 2.0%) were used to test the antimicrobial activities against V. parahaemolyticus and A. hydrophila. 0.1% bovine serum albumin (BSA) was used as the negative control. Cultures were grown for 24 h with 250r/ min at 28 °C, and bacterial growth was evaluated by measuring the culture absorbance at 600 nm. Data are shown as means ± SD (standard deviation) of three separate tests.
A multiple sequence alignment showed that EcCDA1 displayed high identities with gastrolith protein 59 of Cherax quadricarinatus (CqGp59, 80%) and chitin deacetylase 1 of Penaeus monodon (PmCDA1, 74%) (Fig. 2A). In addition, CqGp59 should be CDA protein and it had the identical domain architecture with EcCDA1 and PmCDA1 (Fig. 2B). The phylogenetic tree analysis showed that Arthropoda CDA or CDA-like protein could be divided into two groups, Malacostraca CDA and Insecta CDA. EcCDA1 was divided into the Malacostraca CDA branch (Fig. 3). Bactrocera latifrons (BLCDA1, GenBank accession Nos. XP_ 018793742.1); Hyalella azteca (HaCDA1, XP_018026193.1); Bactrocera dorsalis (BdCDA1, XP_018026193.1); Ceratitis capitata (CcCDA1, XP_ 004534086.1); Drosophila melanogaster (DmSerp, NP_730444.1); Tribolium castaneum (TcCDA1, NP_001095946.1); Anopheles sinensis (AsCDA1, KFB50017.1); Daphnia pulex (DpCDA1, EFX70874.1); Penaeus monodon (PmCDA1, ALO20448.1); Cherax quadricarinatus (CqGp59, ALC79575.1); Ostrinia furnacalis (OfCDA1, AKJ26157.1); Stomoxys calcitrans (ScCDA1, XP_013107407.1); Exopalaemon carinicauda (EcCDA1, MG014203, in this research). Values on the line are bootstrap values showing percentage confidence of relatedness.
1.0 mM, and then the enzyme activity was determined immediately following the method described above. 2.6. Antimicrobial activity of rEcCDA1 Three different concentrations of the purified rEcCDA1 solution (0.1, 0.5, and 2.0%) were used to test the antimicrobial activities against V. parahaemolyticus and A. hydrophila. Meanwhile, 0.1% bovine serum albumin (BSA) was used as the negative control. Aliquots (10 μL) from each dilution were transferred to a 96-well polypropylene microtiter plate, and each well was inoculated with 100 μL of a suspension of mid-log phase bacteria (105 CFU/mL) in TSA medium supplemented with 1% NaCl. Cultures were grown for 24 h with 250 r/min at 28 °C, and bacterial growth was evaluated by measuring the culture absorbance at 600 nm using a microplate reader. 3. Results 3.1. Characterization of EcCDA1 Based on the transcriptomic and genomic data of E. carinicauda [15], the full-length cDNA sequence of EcCDA1 was obtained with 2887 bp (GenBank accession no. MG014203). As shown in Fig. 1A, the complete nucleotide sequence of EcCDA1 contained a 1611 bp open reading frame (ORF) encoding EcCDA1 precursor of 536 amino acids consisting of a 19 amino acid residue signal peptide and a mature polypeptide of 317 amino acid residues (Fig. 1 A). After removal of the signal peptide, the deduced protein had a predicted molecular weight (MW) about 59154.50 Da and theoretical isoelectric point (pI) of 4.64. The NetNglyc server was used to predict N-Glycosylation sites and the result showed that the protein contained three putative N-glycosylation sites at Asn170, 221 and 273 (Fig. 1A). The domain architecture prediction of EcCDA1 protein by SMART software online showed that there were three functional domains, including a chitin-binding peritrophinA domain (ChtBD2), a low-density lipoprotein receptor class A domain (LDLa) and a Polysacc_deac_1 domain (Fig. 1A). In addition, the genomic DNA fragment of EcCDA1 with the corresponding cDNA sequence was obtained by PCR and the result showed that it is composed of seven exons and six introns (Fig. 1B). All intron-exon boundaries were consistent with the consensus splicing junctions at both the 5′ splice donor site (GT) and the 3′ splice acceptor sites (AG) of each intron.
3.2. Tissue distribution of EcCDA1 mRNA Expression profiling of EcCDA1 in different tissues of E. carinicauda was examined by qRT-PCR (Fig. 4). It was predominantly expressed in gills. Therefore, gills are served as the tissue to study the expression profile after the prawns were challenged with bacteria. 3.3. Time course of EcCDA1 expression after V. parahaemolyticus or A. hydrophila challenge It had been reported that CDA1 from Penaeus monodon exhibited putative immune function against WSSV [13]. Herein, we tried to study the immune function of EcCDA1 against bacteria in the prawns and the expression of EcCDA1 in gills of E. carinicauda was measured through a semi-quantitative RT-PCR method. The results showed that the expression of EcCDA1 in the prawns challenged with Vibrio parahaemolyticus or Aeromonas hydrophila changed in a time-dependent manner (Fig. 5). Compared with the expression of EcCDA1 in the control group, the expression of EcCDA1 in the prawns challenged with V. parahaemolyticus was up-regulated at 12 h (p < 0.05), and significantly up-regulated at 24 h and 48 h (p < 0.01), and then returned to the 121
Fish and Shellfish Immunology 75 (2018) 115–123
Y. Sun et al.
(ChtBD2), a low-density lipoprotein receptor class A domain (LDLa) and a Polysacc_deac_1 domain. The phylogenetic tree analysis also showed that Arthropoda CDA1 could be divided into two groups, Malacostraca CDA1 and Insecta CDA1. EcCDA1, PmCDA1 and CqGp59 were divided into the Malacostraca CDA branch. In addition, our result showed that the expression of EcCDA1 was highest in gills, which was similar with PmCDA1 (74%) from P. monodon [13]. Previously, researchers reported that PmCDA1 exhibited putative immune function against WSSV [13]. However, there is no related report about the immune function of CDA1 against bacteria. As we know, bacteria are also key pathogen in fisheries. In this study, the immune function of EcCDA1 against bacteria was clarified by challenging the prawns with V. parahaemolyticus or A. hydrophila. Analyzing by semi-quantitative RT-PCR method, the expression of EcCDA1 in gills was significantly upregulated after V. parahaemolyticus or A. hydrophila challenge, which indicated that EcCDA1 might play a key role in immune defense against bacteria. It had been reported that some chitindegrading enzymes was related to the immune defense in Penaeid shrimp, such as chitinase from M. japonicas [25], Fenneropenaeus chinensis [26], E. carinicauda [16] and CDA1 from P. monodon [13], etc. In this research, we also obtained the recombinant EcCDA1 in Pichia pastoris. The partial enzymatic characterization was also confirmed and the rEcCDA1 could not inhibit the growth of the pathogen V. parahaemolyticus or A. hydrophila directly. Theoretically, chitosans can be produced from chitin by enzymatic deacetylation partially and the generated chitosans with different degree of acetylation (DA) might differ in their biological activities. Just like chitinases, CDA1 also possess a chitin-binding domain (CBD) to help it act on the insoluble chitin. The rEcCDA1 with a CBD could act on the insoluble chitin as a substrate to produce chitosan. Under slightly acidic conditions, chitosan is more water-soluble than chitin and the solubility of chitosan or partially deacetylated chitin render them more useful for applications. It was reported that CDAs played very important roles in the biological attack and defense systems and they could be used in the biological control of fungal plant pathogens or insect pests in agriculture and for the biocontrol of opportunistic fungal human pathogens [27]. Chitin is one of the major components of the cuticle of crustaceans. As a result, precise regulation of its synthesis and degradation is crucial for its growth and development. CDA plays an important role in the degradation of chitin. We presume that the CDA1 may play its biological activity in immune defense by deacetylation from chitin.
control levels at 96 h post-challenge (p > 0.05). At the same time, the expression in Aeromonas-challenged group was significantly up-regulated at 12, 24 and 48 h (p < 0.01) and returned to the control levels at 120 h post-challenge (p > 0.05). 3.4. Characterization of recombinant EcCDA1 (rEcCDA1) Based on the information of pPIC9K and the domain architecture of EcCDA1, the expression plasmid pPIC9k-EcCDA1 was designed and the domain architecture of predicted recombinant protein was showed in Fig. 6. The constructed recombinant plasmid, pPIC9k-EcCDA1, was linearized with Sac I and transformed into Pichia pastoris KM71 according to PEG1000 method. After transformation and screening by histidine-deficient medium and G418, the positive yeast cells containing plasmid were selected for cultivation and induction by 1% (v/v) methanol at 28 °C. Then, EcCDA1 was expressed with the intent to secrete it into the culture media and contained an N-terminal His-Tag for rapid purification at the native condition. The purified rEcCDA1 was used to study its characteristic, including the optimal pH and temperature, the effects of metal ions. The enzymatic characterization of rEcCDA1 was performed using 4Nitroacetanilide as the substrate and quantifying the hydrolyzed 4Nitroaniline. The pH dependency of rEcCDA1 is described by an unusual curve with an increase of activity over the pH range 3.0–5.5, followed by a decrease of activity over the pH range 5.5–9.0. Meanwhile, the pH stability of rEcCDA1 is described by an unusual curve with an almost linear increase over the pH 3.0 to 7.5, followed by a strong decrease in activity of the enzyme above pH 7.5 (Fig. 7A). Then, we tested the temperature optimum at 15 min and pH 5.5 as shown in Fig. 7B, revealing a broad optimal temperature of 30–45 °C with a maximum at 35 °C. Under the optimal pH and temperature conditions, several metal ions (Ca2+, Mg2+, Cu2+, Hg2+, Mn2+, Fe3+, K+, Cd2+, Co2+ and Zn2+) were used to identify their effect on enzyme activity. The results showed that rEcCDA1 activity was partially inhibited by the presence of 0.1 mM or 1.0 mM Zn2+ and Hg2+. In addition, the rEcCDA1 activity was increased by the presence of 0.1 mM or 1.0 mM the Co2+ and Mn2+ (Table 2). 3.5. Antimicrobial activity of rEcCDA1 Three different concentrations of the purified rEcCDA1 solution (0.1, 0.5, and 2.0%) were used to test the antimicrobial activities against V. parahaemolyticus and A. hydrophila. As shown in Fig. 8, the addition of rEcCDA1 could not inhibit the growth of V. parahaemolyticus and A. hydrophila compared with the control (p > 0.05), which indicated that rEcCDA1 was not an antimicrobial protein.
Acknowledgments The project was supported by The National Natural Science Foundation of China (Nos. 31172449, 41376165); A Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions; The National High Technology Research and Development Program of China (No. 2012AA10A401).
4. Discussion In crustaceans, the chitin exoskeleton is an important barrier against pathogens as well as for maintaining their morphology and physiology. Chitin, a long-chain polymer, is formed by polymerizing N-acetyl-Dglucosamine through β-1, 4-glycosidic bonds. Chitin metabolism is critical for the growth, development and survival of crustaceans. It was reported that chitin degradation required the action of many enzymes, including chitin deacetylase, chitinase and molt-associated protease, in which chitin deacetylases (CDA) play an important role [24]. Herein, we first report one chitin deacetylase 1 gene in E. carinicauda and named it EcCDA1. Until now, there is only one report about CDA1 in crustaceans [13]. By searching for the information of CDA1 in NCBI, we found that there was a gastrolith protein 59 (CqGp59) from C. quadricarinatus was deposited in the database. Comparison of the deduced amino acid sequence of EcCDA1 indicated that it was high similar to that of the PmCDA1 (74%) from P. monodon and CqGp59 (80%) from C. quadricarinatus. And, they contained similar functional domains, including a chitin-binding peritrophin-A domain
References [1] H. Merzendorfer, L. Zimoch, Chitin metabolism in insects: structure, function and regulation of chitin synthases and chitinases, J. Exp. Biol. 206 (24) (2003) 4393–4412. [2] G. Tetreau, X. Cao, Y.R. Chen, S. Muthukrishnan, H. Jiang, G.W. Blissard, M.R. Kanost, P. Wang, Overview of chitin metabolism enzymes in Manduca sexta: identification, domain organization, phylogenetic analysis and gene expression, Insect Biochem. Mol. Biol. 62 (2015) 114–126. [3] Y. Arakane, R. Dixit, K. Begum, Y. Park, C.A. Specht, H. Merzendorfer, K.J. Kramer, S. Muthukrishnan, R.W. Beeman, Analysis of functions of the chitin deacetylase gene family in Tribolium castaneum, Insect Biochem. Mol. Biol. 39 (5–6) (2009) 355–365. [4] Y. Araki, E. Ito, A pathway of chitosan formation in Mucor rouxii. Enzymatic deacetylation of chitin, Eur. J. Biochem. 55 (1) (1975) 71–78. [5] L.L. Davis, S. Bartnickigarcia, Chitosan synthesis by the tandem action of chitin synthetase and chitin deacetylase from Mucor rouxii, Biochemistry 23 (6) (1984) 1065–1073. [6] Y. Xi, P.L. Pan, Y.X. Ye, B. Yu, C.X. Zhang, Chitin deacetylase family genes in the brown planthopper, Nilaparvata lugens (Hemiptera: Delphacidae), Insect Mol. Biol.
122
Fish and Shellfish Immunology 75 (2018) 115–123
Y. Sun et al.
71 (2017) 43–49. [17] C. Yang, J. Zhang, F. Li, H. Ma, Q. Zhang, T.A. Jose Priya, X. Zhang, J. Xiang, A Toll receptor from Chinese shrimp Fenneropenaeus chinensis is responsive to Vibrio anguillarum infection, Fish Shellfish Immunol. 24 (5) (2008) 564–574. [18] C. Saejung, K. Hatai, L. Sanoamuang, The in-vitro antibacterial effects of organic salts, chemical disinfectants and antibiotics against pathogens of black disease in fairy shrimp of Thailand, J. Fish. Dis. 37 (1) (2014) 33–41. [19] K. Tamura, J. Dudley, M. Nei, S. Kumar, MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0, Mol. Biol. Evol. 24 (8) (2007) 1596–1599. [20] J. Zhang, T. Gui, J. Wang, J. Xiang, The ferritin gene in ridgetail white prawn Exopalaemon carinicauda: cloning, expression and function, Int. J. Biol. Macromol. 72 (2015) 320–325. [21] J. Zhang, F. Li, Z. Wang, J. Xiang, Expression, purification, and characterization of recombinant Chinese shrimp crustin-like protein (CruFc) in Pichia pastoris, Biotechnol. Lett. 29 (5) (2007) 813–817. [22] Y. Sun, J. Zhang, S. Wang, Heterologous expression and efficient secretion of chitosanase from Microbacterium sp in Escherichia coli, Indian J. Microbiol. 55 (2) (2015) 194–199. [23] Y.Y. Sun, J.Q. Zhang, S.J. Wu, S.J. Wang, Statistical optimization for production of chitin deacetylase from Rhodococcus erythropolis HG05, Carbohydr. Polym. 102 (2014) 649–652. [24] H.Z. Yu, M.H. Liu, X.Y. Wang, X. Yang, W.L. Wang, L. Geng, D. Yu, X.L. Liu, G.Y. Liu, J.P. Xu, Identification and expression profiles of chitin deacetylase genes in the rice leaf folder, Cnaphalocrocis medinalis, J. Asia-Pacif. Entomol 19 (3) (2016) 691–696. [25] D. Pan, N. He, Z. Yang, H. Liu, X. Xu, Differential gene expression profile in hepatopancreas of WSSV-resistant shrimp (Penaeus japonicus) by suppression subtractive hybridization, Dev. Comp. Immunol. 29 (2) (2005) 103–112. [26] J. Zhang, Y. Sun, F. Li, B. Huang, J. Xiang, Molecular characterization and expression analysis of chitinase (Fcchi-3) from Chinese shrimp, Fenneropenaeus chinensis, Mol. Biol. Rep. 37 (4) (2010) 1913–1921. [27] Y. Zhao, R.D. Park, R.A. Muzzarelli, Chitin deacetylases: properties and applications, Mar. Drugs 8 (1) (2010) 24–46.
23 (6) (2014) 695–705. [7] R. Dixit, Y. Arakane, C.A. Specht, C. Richard, K.J. Kramer, R.W. Beeman, S. Muthukrishnan, Domain organization and phylogenetic analysis of proteins from the chitin deacetylase gene family of Tribolium castaneum and three other species of insects, Insect Biochem. Mol. Biol. 38 (4) (2008) 440–451. [8] G. Quan, T. Ladd, J. Duan, F. Wen, D. Doucet, M. Cusson, P.J. Krell, Characterization of a spruce budworm chitin deacetylase gene: stage- and tissuespecific expression, and inhibition using RNA interference, Insect Biochem. Mol. Biol. 43 (8) (2013) 683–691. [9] U. Toprak, D. Baldwin, M. Erlandson, C. Gillott, X. Hou, C. Coutu, D.D. Hegedus, A chitin deacetylase and putative insect intestinal lipases are components of the Mamestra configurata (Lepidoptera: noctuidae) peritrophic matrix, Insect Mol. Biol. 17 (5) (2008) 573–585. [10] Y. Arakane, R. Dixit, K. Begum, Y. Park, C.A. Specht, H. Merzendorfer, K.J. Kramer, S. Muthukrishnan, R.W. Beeman, Analysis of functions of the chitin deacetylase gene family in Tribolium castaneum, Insect Biochem. Mol. Biol. 39 (5–6) (2009) 355–365. [11] G.Y. Han, X.M. Li, T. Zhang, X.T. Zhu, J.G. Li, Cloning and tissue-specific expression of a chitin deacetylase gene from Helicoverpa armigera (Lepidoptera: noctuidae) and its response to Bacillus thuringiensis, J. Insect Sci. 15 (2015). [12] A.K. Jakubowska, S. Caccia, K.H. Gordon, J. Ferre, S. Herrero, Downregulation of a chitin deacetylase-like protein in response to baculovirus infection and its application for improving baculovirus infectivity, J. Virol. 84 (5) (2010) 2547–2555. [13] K.P. Sarmiento, V.A. Panes, M.D. Santos, Molecular cloning and expression of chitin deacetylase 1 gene from the gills of Penaeus monodon (black tiger shrimp), Fish Shellfish Immunol. 55 (2016) 484–489. [14] J. Zhang, J. Wang, T. Gui, Z. Sun, J. Xiang, A copper-induced metallothionein gene from Exopalaemon carinicauda and its response to heavy metal ions, Int. J. Biol. Macromol. 70 (2014) 246–250. [15] J. Yuan, Y. Gao, X. Zhang, J. Wei, C. Liu, F. Li, J. Xiang, Genome sequences of marine shrimp Exopalaemon carinicauda Holthuis provide insights into genome size evolution of Caridea, Mar. Drugs 15 (7) (2017). [16] Y. Sun, J. Zhang, J. Xiang, A CRISPR/Cas9-mediated mutation in chitinase changes immune response to bacteria in Exopalaemon carinicauda, Fish Shellfish Immunol.
123