Blocking the Myostatin Signal With a Dominant Negative Receptor Improves the Success of Human Myoblast Transplantation in Dystrophic Mice

original article

© The American Society of Gene & Cell Therapy

Blocking the Myostatin Signal With a Dominant Negative Receptor Improves the Success of Human Myoblast Transplantation in Dystrophic Mice Raouia Fakhfakh1, Annick Michaud1 and Jacques P Tremblay1 Unité de recherche en Génétique Humaine, Centre de recherche de CHUL, CHUQ, Faculté de médecine, Université Laval, Sainte-Foy, Québec, Canada

1

Duchenne muscular dystrophy (DMD) is a recessive ­disease caused by a dystrophin gene mutation. Myoblast transplantation permits to introduce the dystrophin gene in dystrophic muscle fibers. However, the success of this approach is reduced by the short duration of the regen­ eration following the transplantation, which reduces the number of hybrid fibers. Myostatin (MSTN) is a negative regulator of skeletal muscle development and responsible for limiting regeneration. It binds with high affinity to the activin type IIB receptor (ActRIIB). Our aim was to verify whether the success of the myoblast transplantation is enhanced by blocking the MSTN signal with expression of a dominant negative mutant of ActRIIB (dnActRIIB). In vitro, blocking MSTN activity with a lentivirus carrying dnActRIIB increased proliferation and fusion of human myoblasts because MSTN regulates the expression of several myogenic regulatory factors. In vivo, myoblasts infected with the dnActRIIB lentivirus were transplanted in immunodeficient dystrophic mice. Dystrophin immuno­ staining of tibialis anterior (TA) cross-sections of these mice 1 month post-transplantation revealed more human dystrophin-positive myofibers following the transplanta­ tion of dnActRIIB myoblasts than of control myoblasts. Thus, blocking the MSTN signal with dnActRIIB improved the success of myoblast transplantation by increasing the myoblast proliferation and fusion and changed the expression of myogenic regulatory factors. Received 19 February 2010; accepted 13 July 2010; published online 10 August 2010. doi:10.1038/mt.2010.171

Introduction Duchenne muscular dystrophy (DMD) is a severe X-linked, ­muscle-wasting recessive disease affecting 1 in 3,500 male births.1 It results from a mutation in the gene encoding dystrophin, a 427-kd protein composed of 3,685 amino acids.2 Dystrophin is located just beneath the membrane of skeletal myofibers and its absence in DMD patients causes sarcolemma instability leading to frequent muscle fiber damages and repairs.3,4 In dystrophic muscles, regeneration gradually fails and the normal cycle of degeneration–regeneration is tipped in favor of degeneration.3

This defective muscle repair resulting from myoblast senescence leads to death early in the third decade. Delivery of the normal dystrophin gene by the transplantation of muscle-derived precursor cells (i.e., myoblasts) obtained from a healthy donor results in the long-term restoration of this protein. Indeed, the transplanted myoblasts fuse with the host fibers and introduce in them the ­normal dystrophin gene.5 The success of myoblast transplantation, however, is reduced by the limited muscle regeneration in mdx mice and DMD patients.6 Myostatin (MSTN), a member of the transforming growth factor-β family, is a negative regulator of skeletal muscle growth.7,8 The dramatic effect of MSTN on postnatal growth is due to its negative regulation of satellite cell activation, proliferation, and self-renewal9 and to its inhibition of myoblast proliferation and differentiation.8,10 MSTN is also implicated in muscle regeneration process by blocking the macrophage migration and thus the inflammatory response that occurs after muscle damage.11 MSTN, initially secreted as a precursor protein, is ­composed of two identical 352 amino acid polypeptide chains, held together by a disulphide bond. The presence of the N-terminal 243 amino acid segments of this dimer, called MSTN propeptide renders the MSTN precursor biologically inactive.12 Proteolytic cleavage of these segments generates the mature form of MSTN, which ­exhibits biological activity only after its complete detachment from the propeptides. Before this detachment, the complex is referred to as a latency-associated protein. After the proteolytic processing, C-terminal mature MSTN, a 25-kd protein composed of two identical 109 amino acid polypeptide chains, held together by a single disulfide bond,13 binds to one of the two type II cell surface serine/ threonine kinase receptor [activin receptor type IIB (ActRIIB)] to a greater degree than to ActRIIA to elicit its biological function.14–17 Its binding to ActRIIB leads to the phosphorylation and activation of the activin type I receptor, which in turn initiates the intracellular signaling cascade by phosphorylation of the receptor-­regulated proteins Smad2 and Smad3.14,15,18 Upon phosphorylation, Smads form heterodimer with a Co-Smad, Smad4. This complex translocates into the nucleus, binds to DNA, and finally modulates transcription of various target genes.14,15,17,18 Within the cell, MSTN blocks myoblast growth by inhibiting the expression of myogenic regulatory factors, such as MyoD and by stimulating expression of cyclin-dependent kinase inhibitors such as p21.19

Correspondence: Jacques P Tremblay, Unité de recherche en Génétique Humaine, Centre de recherche du CHUL, 2705, Boulevard Laurier, Sainte-Foy, Québec, G1V 4G2 Canada. E-mail: [email protected]

204

www.moleculartherapy.org vol. 19 no. 1, 204–210 jan. 2011

© The American Society of Gene & Cell Therapy

Results Permanent expression of dnActRIIB Human myoblasts were infected with a lentivirus carrying or not dnActRIIB (Supplementary Figure S1). These cells were then lysed and the protein concentration of cell extracts was determined using BCA protein assay kit (Pierce, Rockford, IL). Samples were separated by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and immunoblotted with an anti-ActRIIB antibody. Western blot analyses demonstrated the dnActRIIB expression in myoblasts infected with lenti-CMV-dnActRIIB (Figure 1). The band of truncated receptor (25 kd) was more intense than the normal receptor band (100 kd).

Increase of myoblast growth following inhibition of the MSTN signal MSTN is a negative regulator of myoblast proliferation. To determine the effects of inhibition of the MSTN signal with a dnActRIIB, the proliferation of myoblasts carrying or not the dnActRIIB was evaluated with a fluorescence-based assay (CyQuant) that correlates with cell number. Myoblast growth medium was supplemented or not with 500 ng/ml MSTN and changed every 2 days. Cells were allowed to proliferate for 4 days and then plates were assayed for total cell number. MSTN significantly decreased the proliferation of normal myoblasts (expressing the normal ActRIIB) compared to untreated normal myoblasts (Figure  2). Myoblasts expressing dnActRIIB proliferated more than normal myoblasts and this difference was more important in presence of MSTN in medium. Molecular Therapy vol. 19 no. 1 jan. 2011

Control myoblast

dnActRIIB myoblast ActRIIB (100 kd)

dnActRIIB (25 kd) Figure 1  Western blot illustrating the permanent expression of dnActRIIB after infection with the lentivirus pCMV-dnActRIIB. Cultures of human myoblasts were supplemented with 20 × 106 lenti­ viral particles carrying or not dnActRIIB, and with 10 µg/ml polybrene. Supernatant was removed after 6 hours of infection and replaced with growth medium MB-1. After 24 hours, the proteins were extracted. Samples were separated by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and immunoblotted with an anti-ActRIIB antibody. The wild-type ActRIIB was expressed in both the control myoblasts and in those infected with the lentivirus pCMV-dnActRIIB. However, the dnActRIIB protein was expressed only in the myoblasts infected with the pCMV-dnActRIIB. dnActRIIB, dominant negative mutant of ActRIIB. 210 190 Cell number (AFU)

There are several MSTN inhibiting strategies currently under preclinical or clinical investigation. One of them is to block the MSTN signaling induced by its interaction with the activin type IIB receptor. MSTN binding to ActRIIB receptors is specific and transgenic mice with increased muscle expression of dominant negative form of ActRIIB (dnActRIIB) have increased muscle weights.16 A study in our laboratory confirmed these results and also indicated that the success of normal myoblast transplantation was improved in mdx mice carrying the dnActRIIB. This study demonstrated that myoblasts obtained from these nondystrophic transgenic mice formed more abundant dystrophin-positive fibers when transplanted in mdx muscles.20 It has also been shown that the MSTN propeptide inhibited binding of MSTN to ActRIIB receptors and blocked its inhibitory action on muscle growth in  vivo21 Other studies investigated another potential MSTN inhibitor, ­follistatin, which inhibits the activity of other transforming growth factor-β family members.22 Mice expressing increased levels of follistatin in muscle have dramatic increases in muscle weight, caused by both hyperplasia and hypertrophy. Our research group has recently demonstrated that follistatin improved the success of transplantation of normal myoblasts in mdx mice.16,23 Because in humans, there are no myoblast donors, who carry a dnActRIIB, we aimed to introduce this gene with a lentivirus in the human cells during their pretransplantation expansion in culture to evaluate the impact on the formation of ­dystrophin-positive fibers, thus improving the success of myoblast transplantation.

Blocking MSTN Signal Improves Myoblast Transplantation

170

dnActRIIB dnActRIIB+MSTN

150

ActRIIB 130

ActRIIB+MSTN

110 90 D0

D2

D4

Figure 2 Effect of myostatin on the proliferation of human myoblasts carrying or not dnActRIIB. Changes in cell number was evaluated with CyQUANT Cell Proliferation Assay Kit (arbitrary fluorescent unit) after 4 days with (+MSTN) 500 ng/ml myostatin or without myostatin. In the absence of MSTN, the myoblasts expressing the dnActRIIB proliferated more than the normal myoblasts expressing only the ActRIIB. In the pres­ ence of MSTN, the proliferation of the normal myoblasts was inhibited, whereas the proliferation of the dnActRIIB-expressing myoblasts was not changed. The presented data are means ± SD (n = 5). AFU, arbitrary fluorescent units; dnActRIIB, dominant negative mutant of ActRIIB.

Inhibition of differentiation by MSTN of normal myoblasts but not of dnActRIIB-expressing myoblasts Myogenic differentiation of human myoblasts was assessed 3 days after switching confluent myoblasts to a differentiation medium containing or not recombinant MSTN (500 ng/ml) The cultures were fixed and stained with 4′,6-diamidino-2-phenylindole, to visualize nuclei, and were treated with antibodies to MyHC (Figure 3a). MSTN treatment resulted in significant decreases of both the size and the number of ActRIIB myotubes but had no effect on the formation of dnActRIIB-expressing myotubes (Figure  3b,c). Subsequent analysis of the fusion index and the ­diameters of the myotubes demonstrated that MSTN treatment inhibited the fusion of normal myoblasts by about 45% (Figure 3b) and reduced the myotube diameter by 87% (Figure  3c). However, this inhibitory 205

© The American Society of Gene & Cell Therapy

Blocking MSTN Signal Improves Myoblast Transplantation

effect was not observed for the dnActRIIB-­expressing myoblasts. Indeed for these myoblasts, the fusion index and size of myotubes was elevated with or without MSTN in the differentiation medium, indicating that the expression of dnActRIIB facilitated myoblast differentiation and myotube diameters were enlarged by 12–57% with MSTN in the differentiation medium.

Improved transplantation success in Rag/mdx of human myoblasts carrying a dnActRIIB To investigate the effect of blocking the MSTN signal in dystrophic mice on the long-term success of the transplantation of normal human myoblasts, half a million myoblasts carrying or not ­dnActRIIB were transplanted in each tibialis anterior (TA) muscle of Rag/mdx mice. Figure 6a illustrates representative cross-­sections of transplanted muscles with control myoblasts (Figure  6a, left side) and dnActRIIB-expressing myoblasts (Figure 6a, right side). Analysis of variance revealed that more muscle fibers expressing human dystrophin (105 ± 20) were detected in the muscle cross-sections of Rag/mdx mice transplanted with myoblasts ­carrying dnActRIIB. Only 62 ± 2 muscle fibers positive for human 206

dnActRIIB myoblasts

DMEM2% +MSTN

b

c

ActRIIB myoblasts dnActRIIB myoblasts

*

100

*

80

60

40

20

ActRIIB myoblasts dnActRIIB myoblasts

*

120 % Of control (myotube diameter)

Expression of MyoD family mRNA in myoblasts carrying or not dnActRIIB MyoD family (i.e., the basic helix-loop-helix transcription factors: Myf5, MyoD, and myogenin) plays an essential role as central ­regulators of myogenesis.25 Myf5 and MyoD are expressed in myoblasts and myotubes, and are required for myogenesis. Myogenin is critical for myotube formation and terminal myogenic differentiation events,25 as it is highly expressed when myoblasts commit to differentiation state to form myotubes. Several studies have described that myogenic cells respond to MSTN by downregulating the expression of key transcriptional regulators of muscle development such as MyoD family, Pax3, Pax7, P21, explaining its inhibitory effects in differentiation.9,26–28 Therefore, inhibition of MSTN should lead to an increased expression of these regulators. Reverse transcription PCR analysis of MyoD family in myoblasts carrying or not dnActRIIB with or without MSTN in medium (Figure 5) showed that MyoD, myogenin, Myf5, and MyHC mRNA were detected with their expected size (Figure 5a). The expression of theses genes was increased in dnActRIIB-expressing myoblasts when compared with normal myoblasts, mostly in the expression of Myf5, myogenin, and MyHC (P < 0.05). However, in the presence of MSTN in medium, we observed an inhibition of the expression of these genes and MyoD in normal myoblasts, but not more in dnActRIIB-expressing myoblasts (Figure 5b). The expression of the myogenic factor seems almost higher in dnActRIIB-expressing myoblasts with or without MSTN treatment.

ActRIIB myoblasts

DMEM2%

Fusion index

Modulation of MSTN pathway in dnActRIIBexpressing myoblasts We tested whether the endogenous Smad2 is regulated by ­dnActRIIB expression. The best way to monitor Smad transactivation is by in vitro transfection of Smad sensors, which control the expression of a reporter gene such as green fluorescent protein. DnActRIIB reduced reporter activity of Smad2 (Figure  4), our results confirm those presented in another study.24

a

* *

100 80 60 40 20 0

DMEM2%

DMEM2% +MSTN

DMEM2%

DMEM2% +MSTN

Figure 3  Inhibition of human myoblast differentiation by myostatin. Myoblasts carrying or not dnActRIIB were differentiated into myotubes for 3 days in the presence or absence of myostatin in the differentia­ tion medium. (a) myotubes differentiated for 3 days, in the absence (DMEM2%) or in the presence of myostatin (500 ng/ml), were stained with anti-myosin heavy chain (MyHC) and 4′,6-diamidino-2-phenylindole. (b) In the absence of myostatin, the normal ActRIIB myotubes and the dnAc­ tRIIB-expressing myotubes had similar fusion indexes. In the presence of myostatin, the fusion indexes of the normal ActRIIB myoblasts were significantly reduced compared with the same myoblasts without myo­ statin. However, the fusion index of the ­dnActRIIB-expressing ­myotubes was not affected by the presence of myostatin. (c) The myotube diame­ ters are expressed as percentage of ActRIIB myotubes diameters (without myostatin). In the absence of myostatin, the normal ActRIIB myotubes and the dnActRIIB-expressing myotubes were of similar size. Presence of myostatin in differentiation medium reduced significantly the sizes of both the normal ActRIIB myotubes and the dnActRIIB-expressing myo­ tubes compared with the same myoblasts without myostatin. However, the size of the normal ActRIIB myotubes was reduced significantly more than that of dnActRIIB-­expressing myoblasts. Representative pictures are presented. Bar = 0.2 mm. Means ± SD from three independent experi­ ments are illustrated. *P < 0.05. DMEM,  Dulbecco’s modified Eagle’s medium.

dystrophin were detected in the muscle cross-section of Rag/mdx mice transplanted with normal myoblasts (Figure 6b). Thus, 40% more dystrophin-positive fibers were present following the transplantation of dnActRIIB-expressing myoblasts. This result can be explained by the reduced MSTN inhibition of the myoblasts expressing the mutated MSTN receptor.

Discussion MSTN is a key regulator of skeletal muscle development and growth. This study provided several important insights concerning the signaling of the MSTN pathway and its contribution to success of myoblast transplantation. Thus, blocking the MSTN signal in the transplanted human myoblasts enhanced the number www.moleculartherapy.org vol. 19 no. 1 jan. 2011

© The American Society of Gene & Cell Therapy

a

CAGA-reporter

Blocking MSTN Signal Improves Myoblast Transplantation

a

GFP

WT

GAPDH

MyoD

MyoD

Myf5

Myf5

Myogenin

Myogenin

MyHC

MyHC

dnActRIIB

1.8 1.6

Fold induction

b

dnActRIIB

GAPDH

CAGA (Smad site)

b

WT

Negative control

1.4

ActRIIB myoblasts

1.2

dnActRIIB myoblasts

1.0 0.8 0.6 0.4 0.2 0

Figure 4  Modulation of myostatin pathway in human myoblasts by dnActRIIB. (a) Illustration of a Smad2-dependent reporter, in which the Smad2-binding site (CAGA) is repeated 12 times in a promoter control­ ling the expression of green fluorescent protein (GFP). (b) Human myo­ blasts carrying or not the dnActRIIB were transfected with the reporter gene illustrated in a. The negative control was normal human myoblasts transfected with the GFP reporter controlled by a minimal promoter. Cells were then incubated with myostatin at 500 ng/ml during 2 days. The vertical axis is a measure of the GFP fluorescence in these cells. This fluorescence is a measure of the transcriptional activity of endo­genous Smad2. The transcriptional activity was reduced in the dnActRIIB­expressing myoblasts compared with the normal ActRIIB myoblasts. dnActRIIB, dominant negative mutant of ActRIIB.

of muscle fibers expressing human dystrophin in the muscles of Rag/mdx mice. This improved transplantation success was explained by the binding of endogenous MSTN to the truncated MSTN receptors, which were inefficient. Moreover, the dnActRIIB proteins also formed dimers with the normal ActRIIB proteins, therefore forming inactive receptors. We propose the following model (Figure 7) to illustrate the effect of presence of dnActRIIB in myoblasts, in which MSTN binds to the dnActRIIB receptor but without triggering signal transduction. The phosphorylation of the GS domain of the type I receptor is inhibited due to the lack of intracellular kinase of the mutated type II receptor. So, the Smad complex cannot be activated. Because of the lack of inhibition by MSTN, we hypothesized that human myoblasts genetically modified to express dnActRIIB would proliferate and fuse more with the host muscle fibers, thus producing more muscle fibers expressing human dystrophin than the normal human myoblasts. Our in vitro results confirmed this hypothesis, indeed MSTN, even added exogenously, has no inhibitory effect on myoblasts carrying the dnActRIIB and thus, these cells proliferated more than normal myoblasts (expressing only ActRIIB). These physiological changes involve variations in myogenic factor expression. MSTN decreases the proliferation and differentiation of myoblasts by repressing the expression of MyoD family of basic helix-loop-helix transcription factors, which include MyoD, myogenin, Myf5, and myogenic regulatory factor‑4.29 This study showed that expressions of myogenin, Myf5, and MyHC mRNAs are significantly higher in dnActRIIBexpressing myoblasts even in presence of exogenous MSTN. Taken together, our results show that inhibition of the MSTN sig­nal enhances the regenerative capacity of muscle. The dnActRIIB­expressing myoblasts are less susceptible to MSTN resulting in an Molecular Therapy vol. 19 no. 1 jan. 2011

c

MyoD

140 120 100 80 60 40 20 0

*

*

*

Myogenin

*

*

200 150 100 50 WT

200

dnActRIIB WT+ dnActRIIB+ MSTN MSTN

*

Myf5

*

*

0

WT

dnActRIIB WT+ dnActRIIB+ MSTN MSTN

*

500 400

150

MyHC

*

*

*

300

100

200

50 0

*

250

100 WT

dnActRIIB WT+ dnActRIIB+ MSTN MSTN

0

WT

dnActRIIB WT+ dnActRIIB+ MSTN MSTN

Figure 5 Expression of MyoD family mRNAs in wild-type (WT) and dnActRIIB-expressing human myoblasts. First strand complementary DNAs were synthesized from 1 µg total RNA from WT (ActRIIB) and dnActRIIB-expressing myoblasts incubated during 2 days (a) without or (b) with myostatin (MSTN) (500 ng/ml) in the culture medium. PCR amplification was done using specific primers for MyoD (430 bp), Myf5 (320 bp), myogenin (438 bp), and MyHC (850 bp). GAPDH served as the internal standard. (c) The mRNA expression of the myogenic ­factors was semiquantified using a densitometry method. The expression of MyoD, Myf5, myogenin, and MyHC were modified by the presence of the dnActRIIB in myoblasts and of myostatin in medium. They were higher in the dnActRIIB-expressing myoblasts than in the normal (WT) myoblasts, this increase did not the same extent, but significantly for myogenin and MyHC; the presence of myostatin reduced the expres­ sion of MyoD ­family factors in WT myoblasts but not as in dnActRIIBexpressing myoblasts. The data presented are means ± SD (n = 3), *P < 0.05. dnActRIIB, dominant negative mutant of ActRIIB.

increase in proliferation, fusion index, myotubes diameter, and expression specifically of Myf 5, myogenin, and MyHC. Numerous studies have examined the regulation of MSTN expression in response to a variety of stimuli and under different physiological conditions, and upregulation or downregulation of MSTN expression was detected in many of these studies.13,21,30–41 Clearly, much more work will be required to determine whether targeting the MSTN pathways will have beneficial effects for the treatment of dystrophies. However, our study indicates that the genetic modification of human myoblasts with a dnActRIIB increases the formation of dystrophin-positive muscle fibers in dystrophic skeletal muscles by increasing the fusion with the host myofibers. This approach could improve the success of cell therapy for the DMD, without the need of systemic inhibition of MSTN in the patient. This approach thus has the advantage 207

© The American Society of Gene & Cell Therapy

Blocking MSTN Signal Improves Myoblast Transplantation

that it permits to improve the proliferation and fusion of only the grafted myoblasts without leading to a muscle hypertrophy of the patient muscles, which may be at the expense of an early wearing out of the proliferative capacity of the patient own myoblasts, which may eventually accentuate the dystrophic process.

a

Number of dystrophin positive fibers

b

140

Materials and Methods

*

Animals. All the experiments were approved by the animal care committee

80

of the Centre Hospitalier de l’Université Laval. The Rag/mdx (immuno­ deficient dystrophic mouse model on a C57BL10J genetic background) mice are our internal laboratory colonies from crossing mdx mice with Rag mice.

60

Design and cloning of complementary DNA cassettes. The ActRIIB com-

120 100

40 20 0 ActRIIB myoblasts

dnActRIIB myoblasts

Figure 6  Increased graft success in Rag/mdx mice transplanted with myoblasts carrying dnActRIIB. (a) Immunohistochemical detection of dystrophin (red) and lamin A/C (green) in tibialis anterior (TA) muscle sections of Rag/mdx mice transplanted with either control human ActRIIB myoblasts or with dnActRIIb-expressing human myoblasts. (b) Graphical representation of the number of dystrophin-positive fibers per cross-section of TA muscles transplanted with ActRIIB or dnActRIIb-expressing myoblasts. There is, on average, 69% more dystrophin-positive fibers in TA muscles transplanted with dnActRIIb-expressing myoblasts than in those trans­ planted with ActRIIB myoblasts. (N = 5, dnActRIIb-expressing myoblast transplantation: 105 ± 28 dystrophin-positive fibers; control ActRIIB myo­ blast transplantation: 62 ± 12 dystrophin-positive fibers). Representative pictures are presented. Bar = 0.2 mm. The data presented are means ± SD (n = 5), P < 0.05. dnActRIIB, dominant negative mutant of ActRIIB.

a

plementary DNA (NM_004302) was studied to design sense and antisense primers to amplify a truncated ActRIIB formed by nucleotides 5–487 of the ActRIIB mRNA. This truncated receptor is called dnActRIIB (Table 1). A SalI restriction site was inserted at the 5′-antisense primer and BamHI at the 5′-primer sense to permit the insertion of the amplicon in a lenti­viral vector. The pCMV-dnActRIIB lentiviral vector was constructed from a lentivirus vector initially containing a cassette for the EGFP gene under the control of a cytomegalovirus promoter. The EGFP gene was withdrawn and replaced by the gene encoding the dnActRIIB. In fact, the resulting protein lacks the serine/threonine domain resulting in a receptor unable to activate the subsequent signaling pathway. Two other lentivirus vectors were used  for control: lenti-pCMV and lenti-pCMV-eGFP (Supplementary Figure S1). Transfection and lentivirus vector production. Lentivirus particles were produced by transient transfection of 293T cells growing in a serum-free suspension with three plasmids encoding the vector components, using the calcium phosphate method as described.42 Plasmid CMV-eGFP was used as a transfection control. Infectious lentivirus were harvested at 12, 24, 36, and 48 hours post-transfection and filtered through 0.22 μm.

MSTN

5 ActRIIB

3

2

1

b

6

ActRI 4

7

8

MSTN

dnActRIIB 9

Nucleus

Nucleus

ActRI 10

11

Figure 7  Blocking the myostatin signal with a dominant negative receptor. (a) (1) Mature myostatin binds to the dimer activin receptor type IIB (ActRIIB). (2) The ActRIIB recruits the activin receptor type I (ActRI). (3) Activation of the kinase activity of ActRI by transphosphorylation. (4) Smad2 and Smad3 are subsequently activated through phosphorylation. (5) Smad4 forms a complex with the Smad2–Smad3 heterodimer. (6) The complex translocates into the nucleus. (7, 8) Interaction with different cellular partners in order to regulate the transcription of various downstream response genes. (b) (9) Mature myostatin binds to the dimer dominant negative ActRIIB (dnActRIIB). (10) Due to lack of the kinase domain of dnActRIIB, ActRIIB will not recruit or activate the ActRI. (11) Thus, there is no activation of Smad protein function and a downregulation of specific gene expressions.

208

www.moleculartherapy.org vol. 19 no. 1 jan. 2011

© The American Society of Gene & Cell Therapy

Blocking MSTN Signal Improves Myoblast Transplantation

Table 1  Primers sequences to amplify the normal (ActRIIB), the dominant negative (dnActRIIB) receptors, Myf5, MyoD, myogenin, MyHC, and GAPDH Gene name

dnActRIIB ActRIIB Myf5 MyoD Myogenin MyHC GAPDH

Orientation

Primers sequence

Antisense

CGCCCTCCTCTGGGGATCGCTGTG

Sense

TGCTGTGAAGGCAACTTCTG

Antisense

CGCCCTCCTCTGGGGATCGCTGTG

Sense

GCAGACGGACCCGTGGATGA

Antisense

GTTAAGCATTGCAACAAGCTACCC

Sense

CCAGGCTTATCTATCATGTGCTATG

Antisense

CGATATACCAGGTGCTCTGAGGG

Sense

GGGTGGGTTACGGTTACACCTGC

Antisense

TAAGGTGTGTAAGGGAAGTCG

Sense

CCACAGACACATCTTCCACTGT

Antisense

CTGCTGAAGGAGAGGGAGCT

Sense

TGATTAGCTGGTCACACCTT

Antisense

CCCCTTCATTGACCTCAACTACA

Sense

TTGCTGATGATCTTGAGGCTGT

Number of cycles

Annealing temperature

Product size (bp)

30

65

373

30

65

1162

10 + 25

68, 64

320

33

63

430

33

63

438

33

63

850

29

56

342

Abbreviation: GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Myoblast preparation. Primary myoblast cultures were grown from ­muscle

biopsies performed in the Quadriceps femoris of a human ­cadaveric donor aged 13 months. The biopsies were dissociated with collagenase and trypsin as described43 and cultured in MB-1 medium (Hyclone, South Logan, UT) with 15% fetal bovine serum (FBS; Gibco, Burlington, Ontario, CA), 1% of penicillin–streptomycin (Gibco) and 10 ng/ml of basic fibroblast growth factor (Strathmann Biotec, Hamburg, Germany) in a humidified atmosphere with 5% CO2 at 37 °C. Myoblast infection. After 24 hours, culture of human myoblasts were

supplemented with 20 × 106 lentiviral particles (multiplicity of infection of 10) and with 10 μg/ml polybrene. Supernatant was removed after 6 hours of infection and replaced with growth medium MB-1. Human myoblasts were infected with a lentivirus carrying or not dnActRIIB. Lentivirus CMV-eGFP was used as a control of infection.

Western blot analysis of ActRIIB. Human myoblasts with various treatments

were lysed in a buffer containing 20 mmol/l Tris 7.5, 1 mmol/l Dithiothreitol, 1 mmol/l phenylmethylsulfonyl fluoride, and 1% sodium dodecyl sulfate. The total protein ­concentration of cell extracts was determined using BCA protein assay kit (Pierce). Samples were separated by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and immunoblotted with antiActRIIB antibodies.

Cell proliferation assay. Cellular growth curves were measured using the

CyQUANT Cell Proliferation Assay Kit (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Human myoblasts were seeded in 24-well plates at initial densities of 2 × 103 cells/well in a total volume of 100 μl MB-1 culture medium supplemented with 10% FBS and various doses of MSTN as noted. Cells were allowed to divide for the number of days indicated, with medium replaced every 2 days. At the indicated times, the medium was discarded, and plates were frozen. The day of the assay, plates were thawed, cells were lysed, and total cellular nucleic acid was measured using florescence at 520 nm emission following excitation at 480 nm. Cell differentiation assay. Myoblast differentiation was determined by myotube formation, myotubes were defined as the cells with three or more nuclei. After the myoblasts were cultured in the growth medium for 24 hours, the medium was replaced with a fusion medium containing only 2% FBS. Thereafter myoblasts were cultured in this fusion medium for Molecular Therapy vol. 19 no. 1 jan. 2011

72 hours. Myotubes were visualized by MyHC labeling. The cells were fixed with 95% ethanol and then washed twice with phosphate-buffered saline for 10 ­minutes and blocked with 10% FBS in phosphate-buffered saline. The samples were incubated for 2 hours at room temperature with anti-MyHC antibody (MF20; DSHB, Department of Biological Sciences, Iowa City, IA) (1:100) and for 1 hour with anti-mouse Alexa 546-­conjugated secondary antibody diluted 1:100. Finally, the cells were washed with phosphatebuffered saline and mounted on microscope glass slides. 4′,6-Diamidino2-phenylindole staining was done to label the nuclei. The number of nuclei incorporated in multinucleated myotubes was counted to estimate the ­terminal differentiation and normalized with the total ­number of nuclei. To analyze diameters, four pictures were taken per well and area of myotubes were measured (using Image J 1.40g; National Institutes of Health, Bethesda, MD); myotube diameters were determined as average from three independent measurements per myotube. Reverse transcription PCR. To detect MyoD family and MyHC mRNA, the

total RNA was extracted using TRIzol reagent (Invitrogen) from normal myoblasts containing the ActRIIB and from genetically ­modified ­myoblasts containing an additional dnActRIIB. First strand complementary DNAs were synthesized using 1 µg total RNA with the oligo (dt) primer and Superscript III reverse transcriptase (Invitrogen). PCR was performed with 1 µg of the reverse transcription reaction using the ­primers specific for MyoD, myogenin, Myf5, and MyHC (Table 1). The annealing temperatures were 63 °C for MyoD, myogenin, MyHC, and 64 °C for Myf5. The numbers of cycles of PCR was 33 for MyoD, myogenin, MyHC, and 10 + 25 for Myf5. Glyceraldehyde-3-phosphate dehydrogenase specific primers were used as internal controls (Table 1). PCR products were then separated by electrophoresis in 2% agarose gels and were stained with ethidium bromide. For MyoD family and MyHC mRNA, the images of the gels were digitized using PCBAS 2.0 computerized densitometry program (INSERM U148, Montpellier, France) and the results were normalized to glyceraldehyde-3-phosphate dehydrogenase. Analysis of variance was used for statistical analysis. The differences between means were considered significant at P < 0.05.

Myoblast transplantation. Half million myoblasts carrying or not the

dnActRIIB were transplanted in the TA of 5 to 8 weeks old Rag/mdx mice. Mice were killed after 30 days and the TA muscles were frozen in liquid nitrogen.

209

Blocking MSTN Signal Improves Myoblast Transplantation

Immunohistochemistry. Immunoassays with an antihuman ­dystrophin antibody (7F7; MRIC Biochemistry Group, Wrexham, UK) and with anti-lamin A/C (Vector Laboratory, Burlingame, CA) to visualize nuclei of human myoblasts, were performed on muscle cryostat sections. Nonspecific binding sites were blocked by incubating the sections with FBS (10%) in phosphate-buffered saline for 1 hour. Sections were then incubated with a mouse antihuman dystrophin antibody (1/50, 1 hour), followed by 30 minutes with a biotinylated anti-mouse antibody (Dako, Copenhagen, Denmark), and 30 minutes with streptavidin-Cy3 (Sigma, St Louis, MO). After a second blocking, sections were incubated with antilamin A/C (1/100, 1 hour) followed by an anti-mouse IgG conjugated with Alexa 488 (1/300, 1 hour). Incubations were done at room temperature. Immunohistochemical quantification of dystrophin-positive myo­ fibers in skeletal muscles of Rag/mdx mice was evaluated by manual counting on 12 cryostat sections distributed at 150-μm interval for each of the five muscles of each group. Afterward, the five highest sections of five TA muscles from each group were selected, and the means ± SD were calculated. Statistical analyses. The experimental values were presented as means ± SD. Statistical analysis was performed using the StatView statistical package (StatView 5; SAS Institute, Cary, NC.). Comparisons of different variables between groups were performed using analysis of variance techniques. Differences were considered statistically significant at P < 0.05.

SUPPLEMENTARY MATERIAL Figure S1.  Illustration of the pCMV, pCMV-dnActRIIB and pCMVeGFP plasmids.

ACKNOWLEDGMENTS We thank Glenn E. Morris and Le Thanh Lam (MRIC Biochemistry Group, Wrexham, UK) for providing the MANDYS104 antibody. This work was supported by grants from the Muscular Dystrophy Canada, Amyotrophic Lateral Sclerosis Foundation and the Canadian Institute for Health Research.

REFERENCES

1. Emery, AE (1993). Duchenne muscular dystrophy–Meryon’s disease. Neuromuscul Disord 3: 263–266. 2. Hoffman, EP, Brown, RH Jr and Kunkel, LM (1987). Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell 51: 919–928. 3. Blau, HM, Webster, C and Pavlath, GK (1983). Defective myoblasts identified in Duchenne muscular dystrophy. Proc Natl Acad Sci USA 80: 4856–4860. 4. Bonilla, E, Samitt, CE, Miranda, AF, Hays, AP, Salviati, G, DiMauro, S et al. (1988). Duchenne muscular dystrophy: deficiency of dystrophin at the muscle cell surface. Cell 54: 447–452. 5. Skuk, D and Tremblay, JP (2000). Progress in myoblast transplantation: a potential treatment of dystrophies. Microsc Res Tech 48: 213–222. 6. Skuk, D and Tremblay, JP (2003). Myoblast transplantation: the current status of a potential therapeutic tool for myopathies. J Muscle Res Cell Motil 24: 285–300. 7. McPherron, AC, Lawler, AM and Lee, SJ (1997). Regulation of skeletal muscle mass in mice by a new TGF-β superfamily member. Nature 387: 83–90. 8. Thomas, M, Langley, B, Berry, C, Sharma, M, Kirk, S, Bass, J et al. (2000). Myostatin, a negative regulator of muscle growth, functions by inhibiting myoblast proliferation. J Biol Chem 275: 40235–40243. 9. McCroskery, S, Thomas, M, Maxwell, L, Sharma, M and Kambadur, R (2003). Myostatin negatively regulates satellite cell activation and self-renewal. J Cell Biol 162: 1135–1147. 10. Langley, B, Thomas, M, Bishop, A, Sharma, M, Gilmour, S and Kambadur, R (2002). Myostatin inhibits myoblast differentiation by down-regulating MyoD expression. J Biol Chem 277: 49831–49840. 11. McCroskery, S, Thomas, M, Platt, L, Hennebry, A, Nishimura, T, McLeay, L et al. (2005). Improved muscle healing through enhanced regeneration and reduced fibrosis in myostatin-null mice. J Cell Sci 118(Pt 15): 3531–3541. 12. Jiang, MS, Liang, LF, Wang, S, Ratovitski, T, Holmstrom, J, Barker, C et al. (2004). Characterization and identification of the inhibitory domain of GDF-8 propeptide. Biochem Biophys Res Commun 315: 525–531. 13. Lee, SJ (2004). Regulation of muscle mass by myostatin. Annu Rev Cell Dev Biol 20: 61–86. 14. Joulia-Ekaza, D and Cabello, G (2007). The myostatin gene: physiology and pharmacological relevance. Curr Opin Pharmacol 7: 310–315.

210

© The American Society of Gene & Cell Therapy

15. Kollias, HD and McDermott, JC (2008). Transforming growth factor-β and myostatin signaling in skeletal muscle. J Appl Physiol 104: 579–587. 16. Lee, SJ and McPherron, AC (2001). Regulation of myostatin activity and muscle growth. Proc Natl Acad Sci USA 98: 9306–9311. 17. Patel, K and Amthor, H (2005). The function of myostatin and strategies of myostatin blockade-new hope for therapies aimed at promoting growth of skeletal muscle. Neuromuscul Disord 15: 117–126. 18. Joulia-Ekaza, D, Dominique, JE, Cabello, G and Gérard, C (2006). Myostatin regulation of muscle development: molecular basis, natural mutations, physiopathological aspects. Exp Cell Res 312: 2401–2414. 19. Wagner, KR (2005). Muscle regeneration through myostatin inhibition. Curr Opin Rheumatol 17: 720–724. 20. Benabdallah, BF, Bouchentouf, M and Tremblay, JP (2005). Improved success of myoblast transplantation in mdx mice by blocking the myostatin signal. Transplantation 79: 1696–1702. 21. Qiao, C, Li, J, Jiang, J, Zhu, X, Wang, B, Li, J et al. (2008). Myostatin propeptide gene delivery by adeno-associated virus serotype 8 vectors enhances muscle growth and ameliorates dystrophic phenotypes in mdx mice. Hum Gene Ther 19: 241–254. 22. Gamer, LW, Wolfman, NM, Celeste, AJ, Hattersley, G, Hewick, R and Rosen, V (1999). A novel BMP expressed in developing mouse limb, spinal cord, and tail bud is a potent mesoderm inducer in Xenopus embryos. Dev Biol 208: 222–232. 23. Benabdallah, BF, Bouchentouf, M, Rousseau, J, Bigey, P, Michaud, A, Chapdelaine, P et al. (2008). Inhibiting myostatin with follistatin improves the success of myoblast transplantation in dystrophic mice. Cell Transplant 17: 337–350. 24. Sartori, R, Milan, G, Patron, M, Mammucari, C, Blaauw, B, Abraham, R et al. (2009). Smad2 and 3 transcription factors control muscle mass in adulthood. Am J Physiol, Cell Physiol 296: C1248–C1257. 25. Perry, RL and Rudnick, MA (2000). Molecular mechanisms regulating myogenic determination and differentiation. Front Biosci 5: D750–D767. 26. McFarlane, C, Hennebry, A, Thomas, M, Plummer, E, Ling, N, Sharma, M et al. (2008). Myostatin signals through Pax7 to regulate satellite cell self-renewal. Exp Cell Res 314: 317–329. 27. Ríos, R, Carneiro, I, Arce, VM and Devesa, J (2001). Myostatin regulates cell survival during C2C12 myogenesis. Biochem Biophys Res Commun 280: 561–566. 28. Amthor, H, Otto, A, Macharia, R, McKinnell, I and Patel, K (2006). Myostatin imposes reversible quiescence on embryonic muscle precursors. Dev Dyn 235: 672–680. 29. Liu, D, Black, BL and Derynck, R (2001). TGF-β inhibits muscle differentiation through functional repression of myogenic transcription factors by Smad3. Genes Dev 15: 2950–2966. 30. Carlson, CJ, Booth, FW and Gordon, SE (1999). Skeletal muscle myostatin mRNA expression is fiber-type specific and increases during hindlimb unloading. Am J Physiol 277: R601–R606. 31. Gonzalez-Cadavid, NF, Taylor, WE, Yarasheski, K, Sinha-Hikim, I, Ma, K, Ezzat, S et al. (1998). Organization of the human myostatin gene and expression in healthy men and HIV-infected men with muscle wasting. Proc Natl Acad Sci USA 95: 14938–14943. 32. Ji, S, Losinski, RL, Cornelius, SG, Frank, GR, Willis, GM, Gerrard, DE et al. (1998). Myostatin expression in porcine tissues: tissue specificity and developmental and postnatal regulation. Am J Physiol 275(4 Pt 2): R1265–R1273. 33. Sharma, M, Kambadur, R, Matthews, KG, Somers, WG, Devlin, GP, Conaglen, JV et al. (1999). Myostatin, a transforming growth factor-β superfamily member, is expressed in heart muscle and is upregulated in cardiomyocytes after infarct. J Cell Physiol 180: 1–9. 34. Lalani, R, Bhasin, S, Byhower, F, Tarnuzzer, R, Grant, M, Shen, R et al. (2000). Myostatin and insulin-like growth factor-I and -II expression in the muscle of rats exposed to the microgravity environment of the NeuroLab space shuttle flight. J Endocrinol 167: 417–428. 35. Mendler, L, Zádor, E, Ver Heyen, M, Dux, L and Wuytack, F (2000). Myostatin levels in regenerating rat muscles and in myogenic cell cultures. J Muscle Res Cell Motil 21: 551–563. 36. Sakuma, K, Watanabe, K, Sano, M, Uramoto, I and Totsuka, T (2000). Differential adaptation of growth and differentiation factor 8/myostatin, fibroblast growth factor 6 and leukemia inhibitory factor in overloaded, regenerating and denervated rat muscles. Biochim Biophys Acta 1497: 77–88. 37. Wehling, M, Cai, B and Tidball, JG (2000). Modulation of myostatin expression during modified muscle use. FASEB J 14: 103–110. 38. Kawada, S, Tachi, C and Ishii, N (2001). Content and localization of myostatin in mouse skeletal muscles during aging, mechanical unloading and reloading. J Muscle Res Cell Motil 22: 627–633. 39. Lang, CH, Silvis, C, Nystrom, G and Frost, RA (2001). Regulation of myostatin by glucocorticoids after thermal injury. FASEB J 15: 1807–1809. 40. Marcell, TJ, Harman, SM, Urban, RJ, Metz, DD, Rodgers, BD and Blackman, MR (2001). Comparison of GH, IGF-I, and testosterone with mRNA of receptors and myostatin in skeletal muscle in older men. Am J Physiol Endocrinol Metab 281: E1159–E1164. 41. Morine, KJ, Bish, LT, Pendrak, K, Sleeper, MM, Barton, ER and Sweeney, HL (2010). Systemic myostatin inhibition via liver-targeted gene transfer in normal and dystrophic mice. PLoS ONE 5: e9176. 42. Naldini, L, Blömer, U, Gallay, P, Ory, D, Mulligan, R, Gage, FH et al. (1996). In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272: 263–267. 43. Kinoshita, I, Roy, R, Dugré, FJ, Gravel, C, Roy, B, Goulet, M et al. (1996). Myoblast transplantation in monkeys: control of immune response by FK506. J Neuropathol Exp Neurol 55: 687–697.

www.moleculartherapy.org vol. 19 no. 1 jan. 2011