Calcium treatments promote the aroma volatiles emission of pear (Pyrus ussuriensis ‘Nanguoli’) fruit during post-harvest ripening process

Scientia Horticulturae 215 (2017) 102–111

Contents lists available at ScienceDirect

Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti

Calcium treatments promote the aroma volatiles emission of pear (Pyrus ussuriensis ‘Nanguoli’) fruit during post-harvest ripening process Shuwei Wei a,b,1 , Gaihua Qin a,c,1 , Huping Zhang a,1 , Shutian Tao a , Jun Wu a , Shaomin Wang b , Shaoling Zhang a,∗ a

College of Horticulture, State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing 210095, China Shandong Institute of Pomology, Taian 271000, China c Horticultural Research Institute, Anhui Academy of Agricultural Sciences, Hefei 230031, China b

a r t i c l e

i n f o

Article history: Received 25 October 2016 Received in revised form 8 December 2016 Accepted 9 December 2016 Keywords: Pear Calcium Aroma Metabolites Emission Post-harvest ripening

a b s t r a c t Aroma is an important factor affecting pear fruit quality. This study was undertaken to assess whether pre-harvest calcium sprays (15 d before harvest, applications at 4%, w/v, 120 d after full bloom) could improve aroma of Pyrus ussuriensis ‘Nanguoli’ pear fruit at harvest and post-harvest, and analyse the mechanism of metabolic regulation. Most compounds contributing to overall flavor in ripe ‘Nanguoli’ fruit at harvest and post-harvest were enhanced in response to pre-harvest calcium applications. Ester, especially acetyl ester, content was enhanced by calcium treatment; however, contents of alcohols, aldehydes and hydrocarbons were little affected. These effects were consistent with higher pyruvate decarboxylase and alcohol dehydrogenase activities in treated fruit, suggesting that calcium treatment increased supply of alcohols and acyl CoAs for ester biosynthesis. We also found that activities of ˇ-glucosidases (involved in the emission of bound volatile compounds) were improved and the contents of bound volatiles were reduced by calcium treatment. At the same time, relative contents of linoleic and linolenic acids were improved by calcium treatment, expression of genes encoding fatty acid desaturase involved in the biosynthesis of unsaturated fatty acid precursors (linoleic and linolenic acids) for volatile aroma were improved. Calcium treatment increased content of volatile aromatic substances, both because calcium promoted the decomposition of bound aroma substances to free aromatic forms, and also promoted the synthesis of volatile aromatic substances in pear fruit. © 2016 Published by Elsevier B.V.

1. Introduction Calcium (Ca) is a major element of fruit, and also functions as a intracellular signal transduction molecule in many physiological processes. Ca has an important influence on fruit quality and storability, and is used to maintain the quality of fruit during postharvest, reduce decay and extend shelf life for apple (Morales and Duque, 2002), peach (Verdini et al., 2008), apricot (Liu et al., 2009), straw-

∗ Corresponding author. E-mail addresses: [email protected] (S. Wei), [email protected] (G. Qin), [email protected] (H. Zhang), shutian [email protected] (S. Tao), [email protected] (J. Wu), [email protected] (S. Wang), [email protected] (S. Zhang). 1 Shuwei Wei and Gaihua Qin contributed equally to this work. http://dx.doi.org/10.1016/j.scienta.2016.12.008 0304-4238/© 2016 Published by Elsevier B.V.

berry (Chen et al., 2010; Chyau et al., 2003) and pear (Omaima et al., 2010; Wójcik et al., 2014). Thus, Ca plays a critical role in fruit quality and storability (Fallahi et al., 1997; Malakouti et al., 1999). Recently, Ca treatment was also found to promote the formation of volatile aromatic substances in fruit. For instance, Ca treatment promoted biosynthesis of aroma substances in ‘Fuji’ apple fruit during storage (Ortiz et al., 2009); Ca sprays before harvest increased aroma formation of ‘Fuji Kiku-8’ apple fruit (Ortiz et al., 2011); and Ca treatment at commercial maturity of ‘Golden Reinders’ apples can increase the content of aroma substances in medium-term storage (Ortiz et al., 2010a,b). However, the effect of Ca treatment on pear aroma emission is not clear, and the mechanism of improvement of fruit volatile aroma substances by Ca treatment requires analysis.

S. Wei et al. / Scientia Horticulturae 215 (2017) 102–111

‘Nanguoli’ pear, a variety of Pyrus ussuriensis that is one of the four main cultivated species of pear in China, is widely planted in northern China for its attractive color, exquisite flesh and pleasant flavor. Esters are the important volatiles of ripe fruit, endowing a ‘fruity’ flavor note (Qin et al., 2012). ‘Nanguoli’ fruit is very hard and has little aromatic volatile production when harvested at commercial harvest; however, after a post-harvest ripening process of about 10 d at 20 ◦ C, the fruit has an intense aromatic production, improving final fruit quality. Thus ‘Nanguoli’ is a good material for aroma research. The aim of this experiment was to examine the effect of Ca on pear fruit aroma emission and analyse the mechanism of metabolic regulation. 2. Materials and methods 2.1. Treatments of pear fruit For the characterization of aroma emission, ‘Nanguoli’ (Pyrus ussuriensis) was selected for research (Table 1). Fruits were provided by the National Germplasm Repository of Pear in the Research Institute of Pomology, Chinese Academy of Agricultural Sciences (CAAS), Xingcheng, Liaoning Province, China. Fifteen days before harvest (September 5, 2013 and September 7, 2014), six uniform ten-year-old ‘Nanguoli’ trees were selected and divided into two groups (three trees of earch group were treated as biological replicates): one was treated with Ca, while the second one was maintained as control. Fruit of about the same size and color from different sides of experimental trees were sprayed with calcium chloride 4% (W/V) on fruit surface, and the other three trees were sprayed with water as control (CK). Orchard management procedures, such as fertilization and irrigation, were the same for all treatments. Healthy fruits were harvested in commercial ripening period (135 days after pollination) and five days before commercial ripening (130 days after pollination) by hand-picking, with all fruits picked from the southern or western crown, about 2 m above the ground. Individually packed fruit were taken to the laboratory immediately after harvest. Half of the fruits harvested in commercial ripening fruits were cored and seeded and the skin and flesh were frozen with liquid nitrogen and stored in −80 ◦ C freezer. The other half of the fruits harvested in commercial ripening were kept in 20 ◦ C for five days of post-harvest ripening, at the end of which were cored and seeded, while the skin and flesh was frozen with liquid nitrogen and stored in a −80 ◦ C freezer. For each treatment, 20–30 pears were combined for each of three replicates. Table 1 Description of ‘Nanguoli’ fruit samples used in this study. Sample code

Description

T1 T2 T3 T4 T5

Fruits with water treatment 5 days before commercial harvest Fruits with Ca treatment 5 days before commercial harvest Fruit with water treatment in commercial harvest Fruit with Ca treatment in commercial harvest Fruit (with water treatment pre-harvest) post-harvest ripening for 5 days in 20 ◦ C Fruit (with Ca treatment pre-harvest) post-harvest ripening for 5 days in 20 ◦ C

T6

103

study, Fibres were activated before sampling according to the manufacturer’s instructions. The core and seeds of each pear fruits were removed and discarded, the skin and flesh was ground with a commercial blender to pulp for the extraction and concentration of volatile aromatic compounds. For each extraction, 10 g of pulp were placed into a 20 ml screw-cap vial containing 3.6 g of NaCl to facilitate the release of volatile compounds. Prior to sealing of the vials, 50 ␮l of 0.04 g ml−1 3-nonanone was added as internal standard, and mixed with a glass rod. A magnetic follower was added to each vial, which was placed into a constant-temperature water bath at 40 ◦ C with stirring. The SPME fibre was exposed to the head space of the sample for 30 min to adsorb the analyte, then introduced into the heated injector port of the chromatograph for desorption at 250 ◦ C for 5 min in splitless mode. The volatile constituents were analyzed with an Agilent 5973B mass selective detector coupled to an Agilent 7890A gas chromatograph, equipped with a 30 m × 0.25 mm × 1.0 mm HP-5 MS (5% phenyl-polymethylsiloxane) capillary column. A constant column flow of 1.0 ml/min helium was used as carrier gas. The injector and detector temperature were 250 and 280 ◦ C, respectively. The oven temperature program was 35 ◦ Cfor 8 min, increased at 2 ◦ C/min to 140 ◦ C, 140 ◦ C for 2 min, then increased at 10 ◦ C/min to 260 ◦ Cand held for 5 min. Mass spectra were recorded at 70 eV in electron impact (EI) ionization mode. The temperature of quadrupole mass detector and ion source were 150 and 230 ◦ C, respectively. The temperature of transfer line was 280 ◦ C. Mass spectra were scanned in the m/z range 33–350 amu at intervals of 1 s. Tentative identification of the volatile components was done by comparing the mass spectra of the samples with the data system library (NIST 98). Whenever it was possible, MS identification was confirmed with authentic references. Quantification was done by the internal standard method, where the concentration of each volatile aromatic compound was normalized to that of 3-nonanone. 2.3. Extraction and assay of aroma-related enzyme activities Fruits harvested in commercial ripening period (135 days after pollination), 5 days before commercial ripening (130 days after pollination) and post-harvest ripening for 5 days were extraction and assay of aroma-related enzyme activities (Table 3), following the methods reported by Ortiz et al. (2010a). Samples of both peel and pulp tissue were taken separately from 15 individual pear fruit (from combined sample of two treatments), frozen in liquid nitrogen, lyophilized, powdered and kept at −80 ◦ C until processing. Of freeze-dried, powdered tissue, 100 mg was used for each determination. Extraction and assays of lipoxygenase (LOX), pyruvate decarboxylase (PDC), alcohol dehydrogenase (ADH) and alcohol o-acyltransferase (AAT) activities on crude enzyme extracts were performed as described by Lara et al. (2003). Hydroperoxide lyase (HPL) was extracted and activity assayed according to Vick (1991). Total protein content in the enzyme extract was determined with the method of Bradford (1976). One activity unit (U) was defined as the variation in one unit of absorbance per minute. Each determination was done in triplicate and results were expressed as specific activity (U mg protein−1 ). 2.4. Measurement of ethylene production rate and determination of Ca in fruit tissue

2.2. Extraction and concentration of volatile aroma compounds GC–MS and HS-SPME were used for the extraction and concentration of volatile aroma compounds (Table 2), following the methods reported by Qin et al. (2014). SPME fibres coated with a 65 ␮m thickness of polydimethylsiloxane-divinylbenzene (65 ␮m PDMS/DVB; Supelco Co., Bellefonte, PA, USA) were used in this

Ethylene production rate was measured by gas chromatograph (GC). Fruit of known weight (g) was placed in a sealed desiccator (about 2 l volume) for 1 h at 25 ◦ C. 1.0 ml gas in head space was withdrawn with a syringe and injected into the injector port of the GC (GC5890C, Nanjing Kejie Analytical Instruments Co. Ltd., China) equipped with a flame ion detector. Activated alumina col-

104

S. Wei et al. / Scientia Horticulturae 215 (2017) 102–111

Table 2 Effects of Ca treatments on aroma composition of ‘Nanguoli’ pear fruit (ng/g FW). Aroma Volatiles

T1

T2

T3

T4

T5

T6

Ethyl Acetate Propyl acetate Butyl acetate Acetic acid, isobutyl ester Pentyl acetate Hexyl acetate Heptyl acetate 2-Methyl-1-butyl acetate Caprylyl acetate Methyl pentanoate Ethyl propanoate Butanoic acid, methyl ester Butanoic acid, ethyl ester Propyl butanoate Butanoic acid, butyl ester Propyl butanoate Hexyl butanoate Isobutyric acid, ethyl ester Butanoic acid, 2-methyl-,methyl ester, (.+/−.)Butanoic acid, 2-methyl-,ethyl ester Hexyl 2-methylbutyrate Ethyl pentanoate Methyl caproate Ethyl caproate Propyl caproate Propyl hexanoate Hexyl hexanoate Ethyl (E)-2-hexenoate Ethyl (E)-3-hexenote Ethyl enanthate Methyl caprylate Ethyl caprylate Ethyl (E)-2-octenoate 4-Octenoic acid, ethyl ether (E,Z)-Ethyl 2,4-decadienoate Esters Subtotal Ethanol 1-Pentanol 1-Hexanol (E)-2-Hexen-1-ol 2-Butyl-1-octanol Alcohols Subtotal acetaldehyde Butanal,2-methylIsobutyraldehyde Pentanal Hexanal (E)-2-Hexenal Aldehydes Subtotal 6-Methyl-5-heptene-2-one Ketones Subtotal Hexane 1,4-Dimethylbenzene alpha.-Farnesene Dodecane Pentadecane Tetradecane Tetradecane, 2,6,10-trimethyl3,6-Dimethyloctane 4,6-Dimethyldodecane Alkanes Subtotal Total

6.00 ± 0.12 – 163.05 ± 7.33 – 10.80 ± 0.54 267.40 ± 4.54 – – – – – 3.20 ± 0.21 4.50 ± 0.23 5.20 ± 0.43 14.90 ± 1.12 – 257.5 ± 11.78 – – – – 1.50 ± 0.09 13.10 ± 1.18 118.2 ± 9.38 2.60 ± 0.15 – 54.20 ± 3.98 – – – – 6.35 ± 0.23 – – – 928.5D – – 29.75 ± 1.11 – – 29.75BC 178.01 ± 3.39 4.10 ± 0.14 – – 500.04 ± 7.45 383 ± 12.87 1065.15F 10.60 ± 0.14 10.6A 1.05 ± 0.09 – 875.85 ± 19.56 13.10 ± 1.11 – 12.75 ± 1.26 4.85 ± 0.34 4.55 ± 0.48 9.55 ± 0.76 921.70A 2955.70E

6.60 ± 0.2 – 199.55 ± 8.49 – 9.60 ± 0.78 257.20 ± 5.78 – – – – – 4.00 ± 0.26 7.30 ± 0.34 3.50 ± 0.16 12.05 ± 1.17 – 263.95 ± 12.87 – – – – 1.55 ± 0.08 11.55 ± 1.15 93.15 ± 8.67 1.35 ± 0.88 – 69.85 ± 3.76 – – – – 5.45 ± 0.26 – – – 946.65D – – 35.6 ± 2.37 – – 35.6 AB 243.50 ± 4.45 2.65 ± 0.12 – 0.90 ± 0.04 700.30 ± 8.89 408.4 ± 14.44 1355.75C 7.60 ± 0.26 7.6B 2.20 ± 0.21 – 951.4 ± 23.35 – 5.10 ± 0.24 7.85 ± 0.99 – 4.40 ± 0.36 6.60 ± 0.57 977.55A 3323.15D

4.25 ± 0.17 – 268.95 ± 9.55 – 19.20 ± 1.01 637.90 ± 8.98 – 1.9 ± 0.14 – – – 2.30 ± 0.15 81.15 ± 3.33 9.25 ± 0.74 22.10 ± 1.87 – 319.30 ± 13.37 – – – 3.65 ± 0.44 2.80 ± 0.23 15.85 ± 1.97 173.8 ± 13.54 8.70 ± 0.89 – 57.90 ± 4.99 – – – – – – – – 1629C 1.00 ± 0.09 – 37.00 ± 4.70 – 2.95 ± 0.23 40.95A 200.7 ± 12.43 – – – 606.2 ± 24.11 334 ± 18.77 1140.9E 2.75 ± 0.22 2.75C – 3.60 ± 0.18 388.5 ± 11.76 20.50 ± 1.67 – 21.25 ± 1.68 4.60 ± 0.33 7.65 ± 0.57 14.95 ± 0.98 461.05B 3274.65D

19.10 ± 2.87 – 170.05 ± 11.9 – 14.35 ± 1.11 589.90 ± 19.9 – – – – – 2.55 ± 0.22 104.40 ± 4.4 5.85 ± 0.39 18.95 ± 2.23 – 446.90 ± 11.8 – – – 3.90 ± 0.24 3.70 ± 0.27 14.50 ± 1.19 186.60 ± 14.43 11.00 ± 1.07 – 128.45 ± 9.95 – – – – – – – – 1720.2C 2.80 ± 0.25 0.90 ± 0.02 37.90 ± 3.80 0.85 ± 0.06 – 42.45A 227.8 ± 14.55 – – 0.60 ± 0.05 700.10 ± 32.12 365.05 ± 15.34 1293.55D 3.45 ± 0.25 3.45C 1.50 ± 0.11 2.80 ± 0.19 812.90 ± 16.55 28.95 ± 1.73 14.85 ± 1.19 37.60 ± 2.59 1.50 ± 0.14 – – 900.10A 3959.75C

22.14 ± 3.11 1.62 ± 0.17 70.44 ± 5.48 – 10.80 ± 0.99 541.86 ± 17.76 12.48 ± 1.18 – 6.72 ± 0.55 – 3.24 ± 0.22 8.70 ± 0.69 184.68 ± 7.77 – – – 20.40 ± 1.17 0.96 ± 0.02 1.02 ± 0.02 2.82±0.16 – 14.64 ± 1.33 144.12 ± 11.20 2295.72 ± 25.66 – 7.32 ± 0.58 15.78 ± 1.14 4.86 ± 0.38 13.02 ± 1.27 – 7.86 ± 0.86 131.10 ± 9.65 12.72 ± 1.19 4.38 ± 0.38 14.92 ± 1.18 3554.22B 6.36 ± 0.46 – 9.42 ± 5.11 – – 15.78D 115.31 ± 9.76 2.64 ± 0.2 9.54 ± 0.89 2.28 ± 0.11 1202.17 ± 35.67 300.48 ± 13.53 1632.42B 10.50 ± 1.13 10.5A 3.06 ± 0.32 1.80 ± 0.09 159.78 ± 9.35 – – – – – – 164.64C 5377.56B

68.34 ± 4.35 – 126.66 ± 8.79 2.82 ± 0.17 12.96 ± 1.07 388.20 ± 11.37 8.28 ± 0.66 4.26 ± 0.37 5.46 ± 0.49 2.22 ± 0.17 38.46 ± 2.15 16.38 ± 1.16 390.06 ± 9.79 – 2.40 ± 0.19 1.86 ± 0.11 14.82 ± 1.19 3.9 ± 0.29 2.64 ± 0.17 27.6±2.11 – 25.20 ± 0.22 191.94 ± 14.33 2755.08 ± 29.86 – 7.74 ± 0.67 – 4.68 ± 0.48 17.16 ± 2.10 8.58 ± 0.79 – 55.02 ± 4.99 6.12 ± 0.55 – 18.36 ± 1.78 4207.2A 12.84 ± 1.09 – 10.92 ± 1.32 – – 23.76CD 126.22 ± 11.33 – – – 1670.24 ± 37.88 355.53 ± 15.56 2152.8A 7.02 ± 0.56 7.02B 2.52 ± 0.26 5.94 ± 0.33 277.56 ± 1.57 – – – – – – 286.02C 6676.80A

Note: −, Not detected. Capitals denote a significant difference in a line for one treatment at P < 0.01, according to Duncan’s test; 15 fruits of each treatments were analyzed.

Table 3 Effects of Ca treatments on key enzyme activities (U/mg protein) of aroma synthesis. Fruit parts

Treatments

LOX

HPL

ADH

AAT

PDC

Flesh

CK 4%CaCl2

49.25 ± 9.28 51.80 ± 21.83

93.40 ± 1.52 128.22 ± 25.06

3.58 ± 2.19 5.38 ± 1.24

0.63 ± 0.07 0.65 ± 0.04

9.13 ± 1.52 21.28 ± 0.38*

Peel

CK 4%CaCl2

21.80 ± 12.98 45.00 ± 5.73

120.45 ± 18.69 121.98 ± 1.07

2.64 ± 1.53 16.89 ± 3.75∗

0.64 ± 0.15 0.67 ± 0.00

13.21 ± 2.80 24.13 ± 5.66

Note: * denotes a significant difference between treatment and CK at P < 0.01; 15 fruits of each treatments were analysed.

S. Wei et al. / Scientia Horticulturae 215 (2017) 102–111

umn(0.53 mm × 30 m, Nanjing Jianuo Instrument Co. Ltd., China) was used to separate ethylene; and N2 was used as the carrier gas at a rate of 45 ml min−1 . The column, injector and detector temperatures were 45, 150 and 220 ◦ C, respectively. Five repetitions were taken and results were expressed as means (␮l g−1 h−1 ) of the repetitions. Ethylene samples of known concentration (0.5 nl L−1 ) were routinely used for calibration. The external standard was used for calculating ethylene concentration. According to Ortiz et al. (2010a), for each treatment, freezedried pulp tissue was obtained from five individual fruit per batch (Ca treatment × storage period). This pulp was submitted to acid digestion and analyzed using inductively coupled plasma emission spectroscopy (ICP-OES). Analyses were carried out in triplicate and results expressed as mg 100 g FW−1 . 2.5. ˇ-Glucosidase assay The ␤-glucosidase assays were performed according to the ´ et al. (2001) with the following modifications: method of Orruno flesh of pear fruit at the three ripening stages was chopped, frozen in liquid nitrogen and kept at −80 ◦ C until use. The crude enzymatic extract was prepared by homogenizing 5 g of pear fruit tissue with 5 ml of 0.1 M citrate–0.2 M phosphate buffer (pH 4.0), followed by centrifugation at 5000 rpm and 4 ◦ C for 20 min. The supernatant was filtered through muslin cloth and kept on ice. For the enzymatic assay, 100 ␮l of crude extract was mixed with 500 ␮l of 40 mM p-nitrophenyl-␤-d-glucopyranoside solution and 400 ␮l of 0.1 M citrate–0.2 M phosphate buffer (pH 4.0), followed by incubation at 40 ◦ C for 30 min. Next, 2 ml of 3 M sodium carbonate solution was added to stop the reaction. The resulting mixture was transferred into a 96-well microplate and read at 405 nm against 0.1 M citrate–0.2 M phosphate buffer as a blank, using a SPECTRAmax PLUS 384 spectrophotometer (Molecular Devices Corporation, Sunnyvale, CA, USA). The protein content of the extracts was determined with a NanoDrop ND-1000 spectrophotometer (Wilmington, DE, USA). Results (specific activities) were expressed as means of triplicate experiments. 2.6. Analysis of the bound volatile fraction 1.5 The bound volatile (Table 4) extracts were analyzed as described by Garcia et al. (2012). A Shimadzu QP2010 Plus gas chromatograph (GC)-mass spectrometer (Kyoto, Japan), fitted with a Stabilwax column (Restek, Bellefonte, PA, USA; 30 m × 0.25 mm × 0.25 lm) was used. The GC oven program was as follows: initial temperature 50 ◦ C, kept for 2 min, increased at 5 ◦ C/min to 150 ◦ C, 10 ◦ C/min to 200 ◦ C and 20 ◦ C/min to 247 ◦ C, and kept at 247 ◦ C for 10 min. A 1-␮l sample was injected, and mass spectra were acquired over the range m/z 40–400. Identification of the compounds was achieved by comparison of mass spectra and retention indices with those in the literature, or by using authentic standards, when available. Semi-quantification was achieved by comparing the areas of the peaks to that of an internal standard of cyclohexanone. 2.7. QRT-PCR analysis The RNA were extracted from the individual fruit samples using Plant RNA Isolation Kit (AutoLab), followed by RNA purification with RNeasy MiniElute Cleanup Kit (Qiagen), according to the manufacturer’s instructions, 8 aroma synthesis related genes were analyzed using quantitative real-time PCR, qRT-PCR analysis was conducted using the Lightcycle-480 (Roche),the qPCR was performed on 3 biological sample replicates. The primers used for amplifying each structural gene and transcript factor are presented in Table 5. qRT-PCR amplification and analysis were performed

105

using a Roche LightCycler480. All reactions were performed using a SYBR Green MasterMix (SYBR Premix EX TaqTM , TaKaRa) according to the manufacturer’s instructions. The PCR reaction conditions were as follows: preincubation at 95 ◦ C for 5 min, then 45 cycles of 94 ◦ C for 10 s, 60 ◦ C for 30 s, 72 ◦ C for 30 s, and a final extension at 72 ◦ C for 3 min. Fluorescence was measured at the end of each annealing step. Amplification was followed by a melting curve analysis with continual fluorescence data acquisition during the 56–61 ◦ C melt. The raw data were analyzed with iQ5 software (version 2.0, Bio-Rad), and the relative expression levels were calculated with the 2−CT method (Livak and Schmittgen 2001). Tubulin (AY338250) was used as the internal control (Chen et al., 2015). qPCR data are technical replicates (n = 3) with error bars, representing means ± standard error (SE). Statistical and correlation analyses were performed with SPSS for Windows NT (release 8.0.0). The data was log2 transformed and median centered by genes using the Adjust Data function of CLUSTER 3.0 software, then further analyzed with hierarchical clustering with average linkage (Eisen et al., 1998). Finally, we performed tree visualization using Java Treeview (Stanford University School of Medicine, Stanford, CA, USA). The figure of time course genes was analyzed by MevSOM software. 2.8. Statistical analysis All data were generated by triplicate experiments and concentrations were reported as the average of three replications. The SPSS16.0 statistical software package (IBM Software Group) was used for all statistical analysis. Analysis of variance was performed and the significant differences were detected using Duncan’s test (P < 0.05). 3. Results and discussion 3.1. Effect of ca treatments on Ca concentrations and ethylene (C2 H4 ) production of pear fruit Significant (P < 0.01) increases of Ca content were found in Catreated fruit at harvest (Fig. 1A), showing that exogenous Ca was efficiently absorbed by ‘Nanguoli’ fruit tissue. C2 H4 plays an important role in regulating aroma metabolites and emission: for example, volatile levels of tomato fruit were changed by C2 H4 treatment (McDonald et al., 1996); 1-methylcyclopropene (1-MCP) treated peach fruit ‘Tardibelle’ altered the supply of alcohol and acyl-CoA precursors, leading to significant changes in emission of some volatile esters, particularly of the straight-chain type (Ortiz et al., 2010b); and C2 H4 also influenced several metabolic pathways (fatty acid and amino acid metabolic pathways) leading to volatile formation in mountain papaya fruit (Cristian et al., 2007). In the present study, pre-harvest Ca treatment suppressed C2 H4 production (Fig. 1B)-in agreement with Wójcik et al. (2014), who found that spray treatments of calcium chloride (CaCl2 ) inhibited production rates of C2 H4 of ‘Conference’ pear fruit. We found C2 H4 production of ‘Nanguoli’ fruit T6 was 105.0 ␮l/kg/h, which was 22.22% less than for T5 (135.0 ␮l/kg/h). Peel color, soluble solids (SS), titratable acid (TA) of ‘Nanguoli’ fruit were influenced by Ca treatment (Table 7), especially, a significant difference in SS/TA were found (at P < 0.01). 3.2. Effects of Ca treatment on the free aroma composition of ‘Nanguoli’ fruit Volatile esters are reportedly the most important contributors to ripe pear fruit aroma, which endows them a ‘fruity’ flavor note (Chen et al., 2005). It was reported that pre-harvest Ca sprays enhanced the emission of key volatile esters in ripe fruit of ‘Fuji Kiku-8 apples (Ortiz et al., 2011). In the present study, 32 kinds

106

S. Wei et al. / Scientia Horticulturae 215 (2017) 102–111

Table 4 Effects of Ca treatment on the content of bound aroma volatiles (ng/g). Compounds

Flesh

benzyl alcohol Eugenol Vanillin 3,4-dihydro-2,2-dimethyl- 2H-1-benzopyran 4-hydroxyacetophenone dibutylhydroxytoluene Total

Peel

CK

4%CaCl2

CK

4%CaCl2

5.11 ± 0.3 – – 261.2 ± 2.33 – 444.9 ± 3.38 711.21 ± 4.43C

1.32 ± 0.11 – – 213.9 ± 1.98 – 417.2 ± 3.59 632.42 ± 5.44C

16.5 ± 1.12 99.8 ± 4.56 4.1± 2054.6 ± 15.98 151.3 ± 4.34 577.4 ± 6.78 2903.7 ± 24.87 A

4.3 ± 0.22 90.1 ± 3.23 3 ± 0.15 1444.8 ± 13.67 72.5 ± 3.89 512.6 ± 8.78 2127.3 ± 22.98 B

Note: –, not detected. Different capitals denote a significant difference in a line for one cultivar at P < 0.01, according to Duncan’s test; 15 fruits of each treatments were analysed.

Table 5 Primer details for genes selected for quantitative real-time PCR analysis from results of digital transcript abundance measurements. This is the primer list of seven genes selected for the quantitative real-time PCR assay to confirm the reliability of digital transcript abundance measurements. Gene ID and forward and reverse primers are shown. Gene ID

Gene

Forward primer

Reverse primer

pbr020361.1 pbr041820.1 Pbr019445.1 pbr004967.1 pbr008100.1 Pbr027302.1 Pbr039379.1 Pbr033732.1

Beta-glucosidase 44 HPL PDC1 LOX21 LOX5 AAT Alcohol dehydrogenase Omega-3 fatty acid desaturase

TACTTTGCTTGGTCGTTG CGGTGTTCCGCACAAATA TATGCTGCTGACGGCTACG GACTACTTTCACCATCCCAGC GCAAGAGAGGAATGGCAGTT AAGGGCCTAACAGAATGC TGCTGGTCAGGTCATACGC AGAAGTCCAGGGAAGAAA

GCGGACATCTTTGGGTAT AAGCGCAGGTCCTCAAGTC CCGTAATCGTTGGAGTTCG CAACCCACTTGGTGTCTCTG GTCCTGGAGTTCAAAATCACCT CCTCCACAAGTAAGACGG CACGCCCTCACCAATACTC CATCATAGTCCAGCAAGTAG

Fig. 1. A: Ca concentrations of pears (mg/g DW). B: C2 H4 production of ‘Nanguoli’ fruit. Note: **Denotes a significant difference between treatment and CK at P < 0.01.

of esters were identified from Ca-treated ‘Nanguoli’ fruit, while 31 esters were identified from the control (Table 2). Acetic acid, isobutyl ester, methyl pentanoate and 2-methyl-1-butyl acetate were only detected in the Ca-treated fruit; while 4-octenoic acid, ethyl ether and propyl acetate were only found in control fruit. Ca treatment significantly increased the total ester aroma (Table 2) content of ‘Nanguoli’ fruit: T6 was increased by 652.98 ng/g (18.37%) more than control, and T4 increased by 91.2 ng/g (5.59%), with the esters that mainly increased including ethyl caproate, hexyl acetate, hexyl butanoate and butyl acetate. The ethyl ester content of T6 ‘Nanguoli’ fruit increased 26.37% more than T5, and T4 by 19.77% more than T3. Thus, Ca treatment promoted the formation of esters in ‘Nanguoli’ fruit-notably ethyl ester compounds significantly increased-which made the fruit flavor more concentrated. Qin et al. (2014) reported that hexanal and hexanol were important intermediates of the fatty acid metabolic pathway and were more efficient metabolic intermediates for volatile synthesis than linoleic and linolenic acids. Hexanol can be directly used to synthesize volatile esters, and hexanal is also an important substrate of

volatile ester biosynthesis. In the present study, Ca treatment significantly increased the total aldehyde contents of ‘Nanguoli’ fruit compared with controls, for instance T6 increased by 520.38 ng/g (31.88%) more than T5, and T4 by 151.65 ng/g (13.28%) more than T3. Hexanal, acetaldehyde and (E)-2-hexenal were significantly increased by Ca treatment, while content of isobutyraldehyde and 2-methyl-butanal were lower than in controls. Ca treatment also significantly increased the content of alcohols in ‘Nanguoli’ fruit compared to controls: ethanol content of T6 was 2.02 times that of T5, the hexanol content was improved and (E)-2-hexen-1-ol and 1-pentanol were only detected in the Ca-treated ‘Nanguoli’ fruit.

3.3. Effects of Ca treatment on the content of bound aroma volatiles There are two kinds of aroma compounds in plants: free aroma compounds and bound aroma volatiles, which are bound to sugars as glycosides or glucosinolates. The proportion of glycosidically bound volatiles is usually greater than that of free volatiles, making them an important potential source of flavor compounds.

S. Wei et al. / Scientia Horticulturae 215 (2017) 102–111

107

Fig. 2. A: Effects of Ca treatment on ␤-glucosidase activity (U/mg protein) of pears; B: Effects of different Ca concentrations on ␤-glucosidase activity (U/mg protein) of pears. Note: Different lowercase letters indicate a significant difference at P < 0.05 and capital letters at P < 0.01.

Fig. 3. Effects of Ca treatments on esters of different origins in ‘Nanguoli’ pear fruit. (A): Contents of esters. (B): Numbers of esters.

The odorous aglycones (Reineccius, 2006) may be released from sugar moieties during maturation, processing and storage, or by the action of enzymes, acids or heat. In the present study, we found seven bound aroma volatiles (Table 3), including benzyl alcohol, eugenol, 3,4-dihydro-2,2-dimethyl-2H-1-benzopyran, 4hydroxyacetophenone and dibutylhydroxytoluene. Ca treatment significantly reduced the contents of 3,4-dihydro-2,2-dimethyl2H-1-benzopyran and dibutylhydroxytoluene in ‘Nanguoli’ fruit, and the total content of bound aroma volatiles of Ca-treated ‘Nanguoli’ pear fruit peel was reduced by 26.74% compared to controls. It was reported that ˇ-glucosidase functions in release of bound aroma volatiles in plants (García-Carpintero et al., 2012; Sarry and Gunata, 2004), and Ca treatment can also improve production of ˇ-glucosidase (Gupte and Madamwar, 1997). In the present study, we found that ˇ-glucosidase activity of ‘Nanguoli’ fruit was significantly enhanced by Ca treatment (Fig. 2A), the ˇ-glucosidase activity of Ca-treated peel was improved by 27.08% compared to controls and ˇ-glucosidase activity of pulp (Fig. 2B)was improved by 11.08% compared to controls, which would have contributed to hydrolysis of bound aroma substances. 2.4 This study showed that Ca enhanced the ˇ-glucosidase activity of pear, likely because Ca2+ acts as a ˇ-glucosidase activity modulator and increases ˇ-glucosidase activity. The ˇ-glucosidase activity of pear fruit was significantly enhanced by Ca treatment, and increased ˇ-glucosidase activity would mean more glucoside-

bound alcohol compounds were hydrolyzed to free forms or metabolic substrates for further participation in the reaction. 3.4. Effects of Ca treatments on content of esters of different origins in ‘Nanguoli’ pear Sanz et al. (1997) reported that fatty acids were major precursors of aroma volatiles in most fruit. Fatty acid-derived straight-chain esters (Schwab and Schreier, 2002) and branched chain volatile esters arise from branched chain amino acids (Goff and Klee, 2006; Perez et al., 2002; Wyllie and Fellman, 2000). In the present study (Fig. 3A,B), fatty acid-derived esters of T6 increased by 3235.48 ng/g more than T5, while amino acid-derived esters of T6 only increased by 36.42 ng/g more than T5. Esters of ‘Nanguoli’ fruit mainly arose from fatty acid metabolism pathways, and Ca treatment mainly increased the esters derived from fatty acids, such as ethyl acetate, butyl acetate, hexyl acetate, hexyl butanoate and ethyl caproate. Ca regulation of aroma of ‘Nanguoli’ fruit was mainly through fatty acid metabolic pathways, rather than amino acid pathways. In pear fruit, amino acid metabolism is another important path for synthesis of volatile aromatic substances. Ca treatment slightly improved the content of amino acid-derived aroma in ‘Nanguoli’ fruit but not to a significant extent. This indicated that Ca treatment had little effect on amino acid metabolism in pear fruit, and that content of amino acids was not the main factor limiting the

108

S. Wei et al. / Scientia Horticulturae 215 (2017) 102–111

Table 6 Effect of Ca on relative content of ‘Nanguoli’ pear fruit fatty acids (%). Fatty acids

T1

T2

T3

T4

T5

T6

C14:1 C15:1 C16:1 C18:0 C17:1 C18:1 C18:2 C18:3 C24:3 C22:6

20.84 ± 1.34A 3.40 ± 0.22D 2.60 ± 0.15C 5.09 ± 0.34C 17.31 ± 0.98B 4.40 ± 0.27C 5.07 ± 0.12F 5.50 ± 0.23D 8. 60 ± 0.76C 15.26 ± 1.33B

20.38 ± 1.87AB 3.04 ± 0.11D 3.50 ± 0.12B 4.06 ± 0.24D 18.90 ± 1.55A 4.10 ± 0.24C 10.11 ± 0.54B 6.10 ± 0.33D 7.68 ± 0.35D 15.84 ± 1.89A

18.16 ± 1.87B 2.28 ± 0.11E 2.92 ± 0.18C 3.03 ± 0.24E 17.46 ± 1.75B 5.76 ± 0.33B 8.4 ± 0.23D 2.06 ± 0.11E 14.10 ± 1.44A 4.04 ± 0.25E

10.49 ± 0.98C 4.74 ± 0.33C 3.97 ± 0.13A 5.07 ± 0.23C 12.82 ± 1.15D 5.52 ± 0.22B 18.76 ± 0.76A 15.24 ± 0.65A 6.80 ± 0.38E 4.69 ± 0.26D

6.94 ± 0.46D 6.72 ± 0.56B 0.78 ± 0.02D 12.80 ± 1.11A 16.11 ± 1.89C 7.24 ± 0.65A 8.05 ± 0.44E 7.70 ± 0.33C 9.40 ± 0.76B 15.78 ± 1.45A

6.98 ± 0.57D 13.12 ± 1.47A 3.69 ± 0.26AB 11.92 ± 1.18B 13.09 ± 1.29D 3.40 ± 0.28D 10.08 ± 0.89C 9.79 ± 0.67B 8.80 ± 0.75BC 11.03 ± 1.09C

Note: myristic acid; pentadecenoic acid (c15:1); palmitoleic (c16:1); stearic (c18:0); oleic (c18:1); linoleic (c18:2); linolenic (c18:3); lignoceric acid (c24:3); 4-7-10-13-16-19 docosahexaenoic (c22:6).Different capitals denote a significant difference in a line for one treatment at P < 0.01, according to Duncan’s test; 15 fruits of each treatments were analysed.

Table 7 Effect of Ca on fruit qualtiy of postharvest ‘Nanguoli’ pear. Qualtiy paremetres Peel color

4%CaCl2 Yellow

CK Green yellow

Soluble solids(SS) Titratable acid(TA) SS/TA

14.41 ± 1.18A 0.80 ± 0.03A 17.93A

12.70 ± 1.53A 0.89 ± 0.08A 14.22B

Note: Different capitals denote a significant difference in a line for one treatment at P < 0.01.

formation of volatile aroma esters derived from amino acids. 3.5. Effects of Ca treatments on key enzyme activities of aroma synthesis Increased PDC and ADH activities levels were observed in CaCl2 treated ‘Golden Reinders’ apple (Ortiz et al., 2010a), which possibly led to improved substrate availability for AAT action during the shelf-life period. In the present study, Ca treatment significantly improved the ADH and PDC activities in ‘Nanguoli’ fruit (Table 4), the ADH and PDC activities of Ca treated peel were improved 639.77% and 182.66% compared to controls, which promoting the synthesis of ethanol and acetaldehyde in fruit, and also improving synthesis of hexanal and hexanol, eventually forming a large number of ester compounds. We also found that Ca treatment significantly improved LOX activity in peel, but non-significantly improved AAT and HPL activities of ‘Nanguoli’ fruit. The results showed that Ca treatment may promote the content of esters in ‘Nanguoli’ fruit, especially for acetyl ester, which made the fruit flavor more concentrated. The C2 H4 production and key enzyme activity of aroma synthesis together showed that C2 H4 production was reduced, ADH activity was improved and AAT activity was not significantly improved. Our data were in agreement with Defilippi et al. (2005) and Cristian et al., (2007), who concluded that ADH was not affected by changes in the level of endogenous C2 H4 , whereas AAT was regulated by C2 H4 . Biosynthesis of esters is subject to the combined effects of substrate availability, enzyme activity and substrate specificity of AAT isozymes. The isozymes of AAT have a wide range of substrate specificity on a series of alcohols and acetyl coenzyme A (acetyl CoA). Biochemical and genetic studies have shown that esters can be produced from fatty acids and amino acids (Song and Bangerth, 2003; Wang et al., 2001), and ADH, PDC and LOX catalyze the upstream of fatty acid and amino acid metabolism-thus enzyme activity plays a very important role in fruit ester biosynthesis. The results showed that Ca could increase LOX activity, which is the first key enzyme catalyzing unsaturated fatty acid cleavage in the fatty acid metabolism pathway, indicating that Ca treatment could accelerate the start of the aroma fatty acid metabolism pathway.

AAT can catalyze conversion of acetyl groups of acetyl CoA to esters with a certain source of alcohols. In this study, Ca treatment had little impact on AAT activity of ‘Nanguoli’ pear fruit peel and pulp, but the content of ester substances significantly increasedthis finding suggests that AAT activity could satisfy the immediate needs of ester synthesis in pear fruit. However, availability of alcohol may be the main limiting factor for ester formation, which is agreement with results of Lara et al. (2008) and Zhu et al. (2008). Improved ADH activity and ester content may be because Ca promoted ADH activity to produce more alcohols used for ester biosynthesis. PDC is one key enzyme in the degradation of amino acids, it use pyruvic acid as catalytic precursor and removal its acid forming acetaldehyde, ADH acts in formation of ethanol, or acetyl CoA is formed by acetaldehyde dehydrogenase, which can be used for the formation of ester compounds. Ca treatment improved PDC activity, meaning that PDC had a very important role in formation of ethyl esters. In addition, the biosynthesis of ethanol and acetaldehyde were increased by Ca treatment, and ethyl esters also increased, further showing that precursor availability determined the biosynthesis of fruit volatile substances. 3.6. Effect of Ca treatment on relative content of fatty acids in ‘Nanguoli’ fruit An important step in the biosynthetic pathway of aroma compounds is the availability of primary precursor substrates, including fatty acids, which are highly regulated during fruit development in terms of amount and composition (Song and Bangerth, 2003). Fatty acids are major precursors of aroma volatiles in most fruit (Sanz et al., 1997). Fatty acid deficiency in fruit is the primary cause of poor aroma (Harb et al., 2000; Wang et al., 2001). It was also reported that increased fatty acid supply (Qin et al., 2014) could enhance biosynthesis of volatile esters in pear fruit. In the present study, content of linoleic and linolenic acids in ‘Nanguoli’ fruit was significantly increased by Ca treatment (Table 6), linoleic acid and linolenic acid fatty acid contents were improved 223% and 740% compared to controls at harvest, respectively. Increased linoleic and linolenic acid contents provided ample substrate for aroma synthesis, and may be one reason for Ca treatment improving the aroma synthesis of ‘Nanguoli’ fruit. 3.7. Expression of aroma synthesis related genes 3 As reported by Defilippi et al. (2005), AAT expression is highly regulated by C2 H4 , whereas ADH expression is unaffected by changes in the levels of endogenous C2 H4 . We analyzed the expression of aroma synthesis related genes with quantitative real-time PCR (Fig. 4; Table 6), and the results showed that the trends of gene expression variation were basically the same as for enzyme activ-

S. Wei et al. / Scientia Horticulturae 215 (2017) 102–111

109

Fig. 4. Real-time quantitative PCR analysis of aroma-related genes. Representative genes selected for the analysis were genes encoding Alcohol dehydrogenase (ADH), ˇ-glucosidase 44, PDC1, AAT, Omega-3 fatty acid desaturase, HPL, LOX5, LOX21 involved in the fatty acid pathway.

ities. Ca treatment resulted in up-regulated expression of genes for ADH, PDC, ˇ-glucosidase 44 and omega-3 fatty acid desaturase (omega-3 FAD), significantly improved expression of genes for

LOX5 and LOX21 only at 5 d before harvest, no significant change in expression of genes for AAT and HPL compared to controls, slightly higher expression of the gene for AAT compared to controls only at

110

S. Wei et al. / Scientia Horticulturae 215 (2017) 102–111

5 d post-harvest and in contrast lower expression of the gene for HPL compared to controls at 5 d post-harvest.

4. Discussion Aroma is the product of a complex mixture of aromatic volatile compounds, and many factors including calcium affect aroma volatiles. There are several pathways (Hadi et al., 2013) involved in aroma volatile biosynthesis starting from lipids, amino acids, terpenoids and carotenoids in plant. Fatty acid metabolism is an important metabolic pathway involved in the biosynthesis of aroma volatiles in fruits(Qin et al., 2014). Fatty acids liberated by lipase activity and those further metabolized by ˇ-oxidative enzymes and/or lipoxygenase (LOX) are generally regarded as the initial precursors of straight-chain esters, alcohols, and aldehydes produced in fruits during development and maturation (Bartley et al., 1985; Fellman et al., 2000; Song and Bangerth, 2003). Previous studies have reported that the core reactions of the LOX pathway consist of the sequential action of LOX, hydroperoxide lyase (HPL) and alcohol dehydrogenase (ADH) (Matsui et al., 2000). The LOX biosynthetic pathway has the potential to provide substrates for ester production. Decreased LOX activity possibly leads to a shortage of lipid precursors for pear fruit ester biosynthesis (Lara et al., 2003). The majority of plant aroma volatiles originate on a quantitative and qualitative basis from saturated and unsaturated fatty acids (Schwab et al., 2008). According to Ortiz et al. (2011), pre-harvest calcium treatment can improve volatile emissions at commercial harvest of apple (Malus × domestica Borkh., also known as M. pumila) – most of the compounds contributing to overall flavor in ripe fruit were enhanced in response to calcium applications, with the acetate esters particularly favored. These effects may have arisen from increased PDC and ADH activities, possibly leading to a better supply of alcohols and acyl CoAs for ester biosynthesis. In the present study, we found that the activities of ADH, PDC and LOX were significantly improved by calcium treatment, which was consistent with the results of Ortiz et al. (2011). Interestingly, we also found that the content of straight chain ester was significantly heigher than branched chain esters in calcium treatment ‘Naguoli’ pear fruit, which suggesting that calcium treatment to improve the ‘Naguoli” pear fruit aroma was mainly by fatty acid metabolic pathways.

5. Conclusion Ca treatment increased ‘Nanguoli’ pear fruit aroma mainly in three ways. First, Ca increased ␤-glucosidase activity and released more bound aroma compounds. Second, Ca treatment significantly increased the activities of ADH, PDC and LOX in fruit, thereby promoting synthesis of ethanol and acetaldehyde in fruit (improved synthetic ester substrate availability), eventually forming a large number of ester compounds. Third, Ca treatment increased amounts of metabolic substrates, especially of unsaturated fatty acids, providing more precursors for ester metabolic process needs. Ca treatment increased the content of volatile aromatic substances, both because Ca promoted the decomposition of bound aroma substance into free forms, and the synthesis of volatile aromatic substances in ‘Nanguoli’ pear fruit.

Competing interests The authors declare that they have no competing interests.

Authors’ contributions SWW contributed to the experimental design and management, quantitative RT-PCR, data analysis and manuscript preparation. STT conducted the data analysis and organized and reviewed the manuscript. GHQ, HPZ contributed to data analysis. JWand SMW prepared the plant materials and tissue collection. SLZ designed and managed the experiments. All authors have read and approved the final manuscript. Data archiving statement Gene sequences of pear were obtained from the Pear Genome Project website (http://peargenome.njau.edu.cn/). Acknowledgements The work was financially supported by the National Science Foundation of China (31601708, 31230063, 31471839 and 31301739), National ‘863 project’ (2013AA102606-02), the Earmarked Fund for China Agriculture Research System (CARS-29), the Youth Foundation of Shandong Academy of Agricultural Sciences (2015YQN40), science and technology development plan of Tai’an city (201440774). References Bartley, I.M., Stoker, P.G., Martin, A.D.E., Hatfield, S.G.S., Knee, M., 1985. Synthesis of aroma compounds by apples supplied with alcohols and methyl esters of fatty acids. J. Sci. Food Agric. 36, 567–574. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Chen, J.L., Zhou, S., Yan, S.J., Ma, Y.K., Hu, X.S., 2005. Analysis of aroma components of fengshui dangshan and nanguo pear by SPME/GC/MS. Acta Hortic. Sin. 32, 301–303. Chen, F., Liu, H., Yang, H., Lai, S., Cheng, X., Xin, Y., Yang, B., Hou, H., Yao, Y., Zhang, S., 2010. Quality attributes and cell wall properties of strawberries (Fragaria annanassa Duch.) under calcium chloride treatment. Food Chem. 126, 450–459. Chen, J.Q., Li, X.Y., Wang, D.Q., Li, L.T., Zhou, H.S., Liu, Z., Wu, J., Wang, P., Jiang, X., Musana, T., Fabrice, R., Zhang, S.L., Wu, J.Y., 2015. Identification and testing of reference genes for gene expression analysis in pollen of Pyrus bretschneideri. Sci. Hort. 190, 43–56. Chyau, C.C., Ko, P.T., Chang, C.H., Mau, J.L., 2003. Free and glycosidically bound aroma compounds in lychee (Litchi chinensis Sonn). Food Chem. 80, 387–392. Balbont´ıın, Cristian, Gaete-Eastman, Carlos, Vergara, Mireya, Herrera, Ra´ıul, Moya-Le´ıon, Mar´ııa Alejandra, 2007. Treatment with 1-MCP and the role of ethylene in aroma development of mountain papaya fruit. Postharvest Biol. Technol. 43, 67–77. Defilippi, B.G., Dandekar, A.M., Kader, A.A., 2005. Relationship of ethylene biosynthesis to volatile production, related enzymes, and precursor availability in apple peel and flesh tissues. J. Agric. Food Chem. 53, 133–3141. Eisen, M.B., Spellman, P.T., Brown, P.O., Botstein, D., 1998. Cluster analysis and display of genome-wide expression patterns. Proc. Natl. Acad. Sci. 95, 14863–14868. Fallahi, E., Conway, W., Hickey, K.D., Sams, C.C., 1997. The role of calcium and nitrogen in postharvest quality and disease resistance of apple. HortScience 32, 831–835. Fellman, J.K., Miller, T.W., Mattinson, D.S., Mattheis, J.P., 2000. Factors that influence biosynthesis of volatile flavor compounds in apple fruits. HortiScience 35, 1026–1033. Gómez García-Carpintero, E., Sánchez-Palomo, E., Gómez Gallego, M., ˜ M., 2012. Free and bound volatile compounds as markers of González-Vinas, aromatic typicalness of Moravia Dulce, Rojal and Tortosí red wines. Food Chem. 131, 90–98. Garcia, C.V., Quek, S.Y., Stevenson, R.J., Winz, R.A., 2012. Characterisation of bound volatile compounds of a low flavour kiwifruit species: actinidia eriantha. Food Chem. 134, 655–661. Goff, S.A., Klee, H.J., 2006. Plant volatile compounds: sensory cues for health and nutritional value. Science 311, 815–819. Gupte, A., Madamwar, D., 1997. Solid state fermentation of lignocellulosic waste for cellulase and ␤-glucosidase production by cocultivation of Aspergillus ellipticusand aspergillus fumigatus. Biotechnol. Progr. 13, 166–169. Muna Hadi, A.M.E., Zhang, F.J., Wu, F.F., Zhou, C.H., Tao, J., 2013. Advances in fruit aroma volatile research [J]. Molecules 18, 8200–8229. Harb, J., Streif, J., Bangerth, F., 2000. Response of controlled atmosphere (CA) stored ‘Golden Delicious’apples to the treatments with alcohols and aldehydes as aroma precursors. Gartenbauwissenschaft 65, 154–161.

S. Wei et al. / Scientia Horticulturae 215 (2017) 102–111 Lara, I., Miro´ı, R.M., Fuentes, T.G., Sayez, J., 2003. Biosynthesis of volatile aroma compounds in pear fruit stored under long-term controlled-atmosphere conditions. Postharvest Biol. Technol. 29, 29–39. Lara, I., Ortiz, A., Echeverria, G., Lopez, M., Graell, J., 2008. Development of aroma-synthesising capacity throughout fruit maturation of ‘Mondial Gala’ apples. J. Hortic. Sci. Biotechnol. 83, 253–259. Liu, H., Chen, F., Yang, H., Yao, Y., Gong, X., Xin, Y., Ding, C., 2009. Effect of calcium treatment on nanostructure of chelate-soluble pectin and physicochemical and textural properties of apricot fruits. Food Res. Int. 42, 1131–1140. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−CT method. Methods 25, 402–408. Malakouti, M.J., Tabatabaei, S.J., Shahabil, A., Fallahi, E., 1999. Effects of calcium chloride on apple fruit quality of trees grown in calcareous soil. J. Plant Nutr. 22, 1451–1456. Matsui, M., Kurishita, S., Hisamitsu, A., Kajiwara, T., 2000. A lipid-hydrolysing activity involved in hexenal formation. Biochem. Soc. Trans. 28, 857–860. McDonald, R.E., McCollum, T.G., Baldwin, E.A., 1996. Prestorage heat treatments influence free sterols and flavor volatiles of tomatoes stored at chilling temperature. J. Am. Soc. Hortic. Sci. 12, 531–536. Morales, A.L., Duque, C., 2002. Free and glycosidically bound volatiles in the mammee apple (Mammea americana) fruit[J]. Eur. Food Res. Technol. 215, 221–226. Omaima, M., Hamouda, H., Abd-El-Mageed, M.A., 2010. Effect of calcium and some antioxidants treatments on storability of Le Conte pear fruits and its volatile components. Science 8, 109–126. ´ E., Apenten, R.O., Zabetakis, I., 2001. The role of n-glucosidase ´ Orruno, in the biosynthesis of 2, 5-dimethyl- 4-hydroxy-3(2H)-furanone in strawberry (Fragaria × ananassa cv. Elsanta). Flavour Fragance J. 16, 81–84. Ortiz, A., Echeverri´ıa, G., Graell, J., Lara, I., 2009. Calcium dips enhance volatile emission of cold-stored ‘Fuji Kiku-8’ Apples[J]. J. Agric. Food Chem. 57, 4931–4938. Ortiz, A., Echeverría, G., Graell, J., Lara, I., 2010a. The emission of flavour-contributing volatile esters by ‘Golden Reinders’ apples is improved after mid-term storage by postharvest calcium treatment. Postharvest Biol. Technol. 57, 114–123. Ortiz, A., Graell, J., López, M.L., Echeverría, G., Lara, I., 2010b. Volatile ester-synthesising capacity in Tardibelle peach fruit in response to controlled atmosphere and 1-MCP treatment. Food Chem. 123, 698–704. Ortiz, A., Graell, J., Lara, I., 2011. Preharvest calcium sprays improve volatile emission at commercial harvest of ‘Fuji Kiku-8’Apples. J. Agric. Food Chem. 59, 335–341.

111

Perez, A.G., Olias, R., Luaces, P., Sanz, C., 2002. Biosynthesis of strawberry aroma compounds through amino acid metabolism. J. Agric. Food Chem. 50, 4037–4042. Qin, G.H., Tao, S.T., Cao, Y.F., Wu, J.Y., Zhang, H.P., Huang, W.J., Zhang, S.L., 2012. Evaluation of the volatile profile of 33 Pyrus ussuriensis cultivars by HS-SPME with GC–MS. Food Chem. 134, 2367–2382. Qin, G.H., Tao, S.T., Zhang, H.P., Huang, W.J., Wu, J.Y., Xu, Y.L., Zhang, S.L., 2014. Evolution of the aroma volatiles of pear fruits supplemented with fatty acid metabolic precursors. Molecules 19, 20183–20196. Reineccius, G., 2006. Flavor Chemistry and Technology, 2nd. CRC Press, Boca Raton, FL, USA. Sanz, C., Olias, J.M., Perez, A.G., 1997. Aroma biochemistry of fruits and vegetables. In: Phytochemistry of Fruit and Vegetables. Oxford University Press Inc, New York, NY, USA, pp. 125–155. Sarry, J.E., Gunata, Z., 2004. Plant and microbial glycoside hydrolases: volatile release from glycosidic aroma precursors. Food Chem. 87, 509–521. Schwab, W., Schreier, P., 2002. Enzymic formation of flavor volatiles from lipids. In: Lipid Biotechnology. Schwab, W., Davidovich-Rikanati, R., Lewinsohn, E., 2008. Biosynthesis of plant-derived flavor compounds. Plant J. 54, 712–732. Song, J., Bangerth, F., 2003. Fatty acids as precursors for aroma volatile biosynthesis in pre-climacteric and climacteric apple fruit. Postharvest Biol. Technol. 30, 113–121. Verdini, R., Zorrilla, S., Rubiolo, A., 2008. Calcium uptake during immersion of strawberries in CaCl2 solutions. J. Food Sci. 73, 533–539. Vick, B.A., 1991. A spectrophotometric assay for hydroperoxide lyase. Lipids 26, 315–320. ´ Wójcik, P., Skorupinska, A., Filipczak, J., 2014. Impacts of preharvest fall sprays of calcium chloride at high rates on quality and ‘Conference’ pear storability. Sci. Hortic. 168, 51–57. Wang, C.L., Xing, J.S., Chin, C.K., Ho, C.T., Martin, C.E., 2001. Modification of fatty acids changes the flavor volatiles in tomato leaves. Phytochemistry 58, 227–232. Wyllie, S.G., Fellman, J.K., 2000. Formation of volatile branched chain esters in bananas (Musa sapientum L). J. Agric. Food Chem. 48, 3493–3496. Zhu, Y., Rudell, D.R., Mattheis, J.P., 2008. Characterization of cultivar differences in alcohol acyltransferase and 1-aminocyclopropane-1-carboxylate synthase gene expression and volatile ester emission during apple fruit maturation and ripening. Postharvest Biol. Technol. 49, 330–339.