Emission of volatile esters and transcription of ethylene- and aroma-related genes during ripening of ‘Pingxiangli’ pear fruit (Pyrus ussuriensis Maxim)

Scientia Horticulturae 170 (2014) 17–23

Contents lists available at ScienceDirect

Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti

Emission of volatile esters and transcription of ethylene- and aroma-related genes during ripening of ‘Pingxiangli’ pear fruit (Pyrus ussuriensis Maxim) Guopeng Li a,b , Huijuan Jia a , Jihua Li b , Qiang Wang c , Maojun Zhang c , Yuanwen Teng a,∗ a Department of Horticulture, The State Agricultural Ministry Key Laboratory of Horticultural Plant Growth, Development & Quality Improvement, Zhejiang University, Hangzhou 310058, China b Agricultural Product Processing Research Institute, Chinese Academy of Tropical Agricultural Sciences, Zhanjiang 524001, Guangdong, China c Pomology Institute, Jilin Academy of Agricultural Sciences, Gongzhuling, Jilin 136100, China

a r t i c l e

i n f o

Article history: Received 19 November 2013 Received in revised form 26 February 2014 Accepted 3 March 2014 Available online 20 March 2014 Keywords: Pyrus ussuriensis, Ester, Ethylene, Volatile compounds Gene expression

a b s t r a c t The fruit of Pyrus ussuriensis Maxim produces an intense aroma, which is accompanied by elevated ethylene levels, during postharvest ripening. In this study, we evaluated the relationships between lipoxygenase (LOX) pathway-derived volatiles and the transcription of genes related to ethylene and ester biosynthesis during fruit ripening. The amount of esters produced by the fruit increased dramatically during ripening, while the amount of aldehydes decreased. During the 12-day ripening period, the transcript levels of PuACO2 and PuACO3 peaked on day 6, and then remained constant. The transcript levels of PuACO5 and PuACO6 peaked on day 6 and day 3, respectively, and subsequently decreased throughout the ripening period. PuLOX6 and PuLOX11 showed increased transcript levels as the fruit ripened, while the transcript levels of PuLOX1 and PuLOX8 peaked on day 3. The highest transcript levels of PuADH2, PuADH3, and PuADH5 were detected on day 6, day 3, and day 1, respectively, during the 12-day ripening period. The transcript levels of PuAAT first increased, and then decreased during ripening. Climacteric increases in ethylene production and volatile ester concentrations were observed during the ripening of P. ussuriensis, and PuLOX1, PuLOX8, PuADH3 and PuAAT may play important roles in ester formation. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Pears are among the most important fruit crops in China. There are four groups of commercial pear cultivars native to China: Pyrus pyrifolia Nakai (Chinese white pear group), P. ussuriensis Maxim, P. sinkangensis Yu, and P. pyrifolia Nakai (Teng and Tanabe, 2004). Although P. ussuriensis belongs to the Asian pear group, it resembles European pear in that it requires a ripening period to become soft and edible, and it produces an intense aroma in parallel with ethylene production during ripening (Li et al., 2012a,b). The consumption of P. ussuriensis has increased in recent years in northeastern China, mainly because of its unique flavor and strong aroma. Unlike other species of Asian pear, P. ussuriensis cultivars produce increased amounts of ethylene, which is accompanied by an intense aroma, during fruit ripening. Fruit aroma is an important factor affecting the final sensory quality of fruit and consequently,

∗ Corresponding author. Tel.: +86 571 88982803; fax: +86 571 88982803. E-mail address: [email protected] (Y. Teng). http://dx.doi.org/10.1016/j.scienta.2014.03.004 0304-4238/© 2014 Elsevier B.V. All rights reserved.

consumer satisfaction. The aroma of fruit represents a complex mixture of many volatile compounds (Baldwin, 2002; Lara et al., 2003). More than 300 volatile compounds have been identified in different pear cultivars, mainly cultivars of P. communis. These compounds include alcohols, aldehydes, esters, acids, ketones, and hydrocarbons (Rapparini and Predieris, 2003). However, studies on the volatile components produced by pear fruit, especially the odor-active compounds, are still scarce as compared with those on apple, strawberry, and melon (Rapparini and Predieris, 2003; Li et al., 2012a). There are some aromatic volatiles that are typically synthesized by, and emitted from, P. ussuriensis fruit during ripening. Among these volatiles are esters, which are known to impart characteristic fruity or sweet smells in apple and European pear cultivars (Moya-León et al., 2006; Echeverria et al., 2004; Villatoro et al., 2008). The composition of volatile esters in fruit is determined by the availability of substrates, namely alcohols and acyl-CoA, and the properties of alcohol acyltransferases (AATs), which transfer acyl-CoA onto the corresponding alcohol (Rapparini and Predieris, 2003; Brückner and Wyllie, 2008; González-Agüero et al., 2009). Ester formation may depend on the availability of precursors for AATs (Dudareva et al., 1998, 2004; Brückner and Wyllie, 2008). It

18

G. Li et al. / Scientia Horticulturae 170 (2014) 17–23

has been suggested that a restricted supply of substrates for esterification may be a major limiting factor for ester production in immature apple fruit (Song and Bangerth, 1994). In pear fruit, AAT activity increased as the alcohol carbon number increased from one to six, and then decreased (Rapparini and Predieris, 2003). In some climacteric fruits, the expression of genes involved in ester biosynthesis was dependent on the stage of fruit maturity (González-Agüero et al., 2009; Zhang et al., 2010). Although some studies have investigated the volatile compounds produced by Pyrus fruit, most have focused on the effects of various postharvest treatments or storage conditions on the aromatic profiles and on the activities of related enzymes, mainly in fruit of P. communis (Moya-León et al., 2006; Lara et al., 2003). Fruit of P. ussuriensis produces an intense aroma during ripening, and the generation of volatile esters accompanies ethylene production (Li et al., 2013). However, little is known about the relationship between the production of volatile compounds and the expression of genes related to the fatty acid pathway in pear (Zhu et al., 2008; Mukkun and Singh, 2009; Zhang et al., 2013). In this work, we analyzed the changes in the six main volatile compounds and the transcriptional patterns of various genes encoding enzymes related to the biosynthesis of esters and ethylene in ‘Pingxiangli’ pear (P. ussuriensis). The main aim of this study was to analyze the correlations between the temporal changes in gene transcription and the accumulation of ethylene and volatile esters in ripening pear fruit. 2. Materials and methods 2.1. Plant materials and sampling Fruits of ‘Pingxiangli’ (P. ussuriensis) were harvested from a commercial orchard in Jilin Province, Northeast China, at physiology maturity and transported to the laboratory on the day of harvest (19 September, 2010). Uniform fruits without visible defects were selected as the experimental materials. Fruits were incubated at room temperature (approx. 20 ◦ C) for 12 days and sampled on days 0, 3, 6, 9, and 12. Conventional indices including skin color, firmness, and ethylene production were used to determine the fruit ripening stage. Flesh sliced from fruit was immediately frozen in liquid nitrogen and stored at −80 ◦ C until further use.

penetration was 1 mm/s with a final penetration depth of 10 mm. Measurements were made on two sides of each fruit after removing a small piece of peel. Data are expressed as Newtons (N). 2.5. Determination of aroma volatiles Each sample of frozen flesh tissue (10 g) was ground to fine powder in liquid nitrogen and then transferred to a 20-mL vial. To minimize the loss of volatile components and avoid browning, 4 mL saturated sodium chloride solution was added to the vial. We added 5 ␮l 2-octanol as an internal standard. A stirring bar was used to maximize volatile production. The vial was sealed with a Teflon septum and an aluminum cap. The mixture was homogenized using a vortex oscillator. For the headspace solid-phase microextraction, the SPME holder for manual sampling and fibers used in the analysis were purchased from Supelco (Aldrich, Bellefonte, PA, USA). The fiber coating with 65 ␮m polydimethylsiloxane/divinylbenzene (PDMS/DVB) was selected as described elsewhere (Li et al., 2013). Before use, the fibers were conditioned at 250 ◦ C for 30 min to prevent contamination, according to the manufacturer’s instructions. The fiber was exposed to the headspace of the vials, which were placed in a thermostatic water bath at 50 ◦ C to equilibrate for 45 min. We used a Hewlett-Packard 6890 GC/MS (Hewlett-Packard, Palo Alto, CA, USA) with a flame ionization detector, with the injector and detector maintained at 250 ◦ C and 270 ◦ C, respectively. An Innowax capillary column (30 m × 0.5 ␮m × 0.32 mm) was used for all analyses. The column temperature program was as follows: 40 ◦ C for 2 min, raised to 220 ◦ C at 4 ◦ C min−1 , and then to 250 ◦ C at 15 ◦ C min−1 , then hold for 2 min. The splitless mode was used. Helium was used as the carrier gas at a flow rate of 1 ml min−1 . Mass spectra were obtained using an HP-5973 mass selective detector at 70 eV in the scan mode. Mass spectra were scanned in the range of m/z 30–500 amu. The temperatures of the ion source and connecting parts were set at 230 ◦ C and 280 ◦ C, respectively. Compounds were identified using NIST/WILEY MS Search 2.0 mass spectra libraries. The identities of most compounds were then confirmed by comparison of their linear retention indices and EI mass spectra with those of reference compounds. Compounds were quantified using the internal standard method, where the concentrations of various volatile compounds were normalized to that of 2-octanol.

2.2. Assessment of fruit color 2.6. RNA extraction and cDNA synthesis To analyze the development of fruit color, the color of the surface of the skin of pear fruit was measured with a colorimeter (MiniScan XE Plus, HunterLab, USA), which provided CIE L*, a*, and b* values. These values were converted to hue angle degree (ho = arctan [b*/a*]) and chroma values (C = [(a*)2 + (b*)2]1/2), which quantify the intensity or purity of the hue (McGuire, 1992). Each treatment consisted of 20 fruits. 2.3. Ethylene measurement A 2-L flask with five fruits (approx. 1 kg) was capped with a rubber stopper for 1 h. Ethylene was measured according to Zhang, with 1 mL of headspace gas from each flask sampled and analyzed using an SP 6800 gas chromatograph (Lu’nan Chemical Engineering, Shandong, China) fitted with a GDX-502 column and a detector, with oven temperatures set to 110 ◦ C, 140 ◦ C, and 90 ◦ C, respectively. 2.4. Measurement of fruit firmness Fruit firmness was measured at the equator of the fruit using a TA-XT2i Plus texture analyzer (Stable Micro Systems, Surrey, United Kingdom) fitted with a 7.9-mm diameter head. The rate of

Total RNA was isolated from flesh using a modified CTAB protocol (Zhang et al., 2012). Then, 4 ␮g total RNA was pretreated with RNase-free DNase I (Takara, Shiga, Japan) to remove the contaminating genomic DNA. The concentration of total RNA was measured using a spectrophotometer, and RNA integrity was checked by electrophoresis on agarose gels. First-strand cDNA was synthesized from 1.0 ␮g DNA-free RNA using a Revert AidTM First Strand cDNA Synthesis kit (Takara) according to the manufacturer’s instructions, and oligo d(T)20 in a total reaction volume of 10 ␮l. The cDNA was diluted 1:10 with water, and 1 ␮l of the diluted cDNA was used as the template for real-time quantitative PCR (q-PCR) analysis. 2.7. q-PCR analysis The q-PCR mixture (15 ␮l total volume) contained 7.5 ␮l SYBR Premix Ex Taq (Takara), 0.5 ␮l each primer (10 ␮M), 1 ␮l cDNA, and 5.5 ␮l RNase-free water. The reactions were performed on a LightCycler 1.5 instrument (Roche Applied Science, Basel, Switzerland) according to the manufacturer’s instructions. The two-step q-PCR program was initiated with a preliminary step of 30 s at 95 ◦ C, followed by 40 cycles of 95 ◦ C for 5 s and 60 ◦ C for 20 s. Notemplate controls for each primer pair were included in each run.

G. Li et al. / Scientia Horticulturae 170 (2014) 17–23

19

Table 1 Primers for real-time q-PCR analysis. Gene

Accession no.

Forward primer (5 to 3 )

Reverse primer (5 to 3 )

Product size (bp)

PuACS1 PuACS5 PuACO1 PuACO2 PuACO3 PuACO4 PuACO5 PuACO6 PuLOX1 PuLOX6 PuLOX8 PuLOX11 PuADH2 PuADH3 PuADH5 PuAAT ACTIN

AY388989 AY388987 EU333282 EF451060 M81794 AF015787 AB086888 CN907149 EF215448 EF215449 EF215450 AY742295 Z48234 AF031900 AF031099 AY534530 CN938023

TTCTCATCCTCCGAATTCAT CGCCATTTACTCCAACGAC GGGACCAGAATGTCGATAG GTTGTAGAACGAGGCTAT GTTCTACAACCCAGGCAACG TCGGACGGAACCAGAATG AGCAAAGGTTCAAGGAGCTG CTTGATGCCGTTCAGACAGA CTAGCCAAGGCGTCGAG GTACCTGAGACGCATAAACA CGAGGTAGGCCACAGCGACA GCCACAAACAGGCAACTAA CGGAAACTACAAGACTCGAA TGTGACCTCCTCAGGATAAA CACTTCCTCGGCACAT CTTGGGATACTATGGCAATG CCATCCAGGCTGTTCTCTC

CAGTGCCAACTCGAAAGC GGTTCTCGGCTATGTAGTTC AAACACAAACTTGGGATAAG GCACCACTCCATTGTCATAA TCTCAGAGCTCAGGCAGTTG CTCCTTGGCTTGGAATTTGA TCCAATTTCAATGCAAACTCC CCAAGATTCTCACACAACAAGC GAAGTTTGTGAATCGGGTGA CTTGATGCCTTGGCTAGA GGGTTGGGCGGTTTG CTCGGTGAAATTCCAATCC CGGATTATGCAACGAAGAC GCCAAGGGATTGATCTTAG CCCAAGTCCAAAGATAGCAA CTTCCGGTCGATGAA GCAAGGTCCAGACGAAGG

130 143 120 130 208 174 181 191 174 177 170 198 162 164 189 192 139

The primers for real-time q-PCR analysis were designed according to the reported sequences of related genes using Primer3 online (version 0.4.0, http://frodo.wi.mit.edu/primer3/input.htm). The sequences of all primers used for q-PCR are shown in Table 1. The specificity of q-PCR primers was confirmed by cloning and sequencing of q-PCR products. All q-PCR reactions were normalized using the Ct value corresponding to the Actin gene (PyActin, CN938023) of Pyrus. Three measurements for each biological replicate sample were performed.

produced in the greatest quantities was ethyl hexanoate; its concentration peaked at 247.17 ␮g·kg-1 on day 12 of the ripening period. Ethyl butanoate was the next most abundant ester, its concentration peaked at 119.24 ␮g kg−1 on day 12. The production of ethyl 2-methylbutanoate differed from those of the other esters. It showed the highest concentration on day 6, and then it remained at a stable level for the rest of the ripening period.

3.3. Transcript levels of genes related to ethylene biosynthesis 2.8. Statistical analysis

As expected, ethylene production in ‘Pingxiangli’ pear reached a peak (122.16 nL g−1 h−1 ) on day 6 of the 12-day ripening period, and then decreased (Fig. 1). The ethylene production rate decreased to 44.52 nL g−1 h−1 on day 12. Fruit firmness and hue angle decreased during fruit ripening. The change in hue angle reflected the change in the skin color of ‘Pingxiangli’ fruit from green to yellow-green. Similarly, fruit firmness decreased dramatically from 19.58 N at harvest (day 0) to 3.24 N on day 6, and then remained the same for the rest of the ripening period. 3.2. Production of volatile compounds during ripening of ‘Pingxiangli’ pear We identified 23 volatile compounds produced during ripening of ‘Pingxiangli’ pear:16 esters, two alcohols, two aldehydes, two terpenes, and one acid (data not shown). Six major volatile compounds were quantified: hexanal, E-2-hexenal, ethyl butanoate, ethyl 2methylbutanoate, ethyl hexanoate, and hexyl acetate (Fig. 2). The two aldehydes showed different patterns of production (Fig. 2); the concentration of hexanal increased initially, peaked on day 6 (307.74 ␮g kg−1 ), and then decreased, whereas the concentration of E-2-hexenal steadily decreased during fruit ripening. The total amount of esters increased during ripening. The ester

96 90

Hue

3.1. Physiological characterization of ripening stages

84 78

Ethylene production -1 -1 (nL g h )

3. Results

The transcript levels of genes related to ethylene biosynthesis showed various changes during ripening of ‘Pingxiangli’ pear. The transcript abundance data are shown in Fig. 3. The profiles for PuACO2 and PuACO3 were similar; their transcript levels slightly increased in the first 6 days of ripening, peaked on day 6, and then remained at approximately the same level for the rest of the ripening period. In contrast, the transcript level of PuACO4 continued to increase throughout the ripening period. The maximum levels of PuACO5 and PuACO6 transcripts in ‘Pingxiangli’ pear fruit were on day 6 and day 3, respectively, and then the levels of both transcripts decreased.

72 120 100 80 60 40

Fruit firmness (N)

Standard errors (SEs) were calculated and figures were constructed using OriginPro 7.5 G (Microcal Software, Inc., Northampton, MA, USA). Differences shown in figures were based on least significant difference (LSD) tests and LSDs (˛ = 0.05), which were calculated using Data Processing System (DPS) version 3.01 (Zhejiang University, Hangzhou, China).

25 20 15 10 5 0

0

3

6

9

12

Ripening period (d) Fig. 1. Changes in hue, fruit firmness, and ethylene production rates in ‘Pingxiangli’ pear fruit during postharvest ripening at 20 ◦ C.

20

G. Li et al. / Scientia Horticulturae 170 (2014) 17–23

E-2-Hexenal

Hexanal

300 240

40

180

30 20

120

10

60

0

Ethyl butanoate

Ethyl 2-methylbutanoate 60 48

75

36

50

24

25

12

0 300

-1

100

g kg )

125

)

Concentrations of volatile compounds

50

Ethyl hexanoate

Hexyl acetate

0 15

240

12

180

9

120

6

60

3

0

0

3

6

9

12

0

3

6

9

12

0

Ripening period (d) Fig. 2. Concentrations of six major volatile compounds in ‘Pingxiangli’ pear fruit during postharvest ripening at 20 ◦ C. Vertical bars represent means ± SE.

2.5 2.0

LSD 0.05=0.69

PuACS1

LSD 0.05=0.27

PuACS5

0.9

1.5

0.6

1.0

0.3

0.5

Relative intensity

0.0 2.0 1.6

1.2

LSD 0.05=0.44

PuACO1

PuACO2

LSD 0.05=0.37

0.0 2.4 1.8

1.2

1.2

0.8 0.4

0.6

0.0 2.5 LSD =0.60 0.05 2.0

PuACO3

PuACO4

LSD 0.05=0.92

0.0 5 4

1.5

3

1.0

2

0.5

1

0.0 3.5 LSD =0.55 0.05 2.8

PuACO5

PuACO6

LSD 0.05=0.70

0 4.0 3.2

2.1

2.4

1.4

1.6

0.7

0.8

0.0

0

3

6

9

12

0

3

6

9

12

0.0

Ripening period (d) Fig. 3. Changes in transcript levels of ethylene-related genes during stages of ripening of ‘Pingxiangli’ pear fruit at 20 ◦ C. Vertical bars represent means ± SE.

G. Li et al. / Scientia Horticulturae 170 (2014) 17–23

3.5 2.8

LSD 0.05=0.66

PuLOX1

LSD 0.05=1.60

20

PuLOX6

16

2.1

12

1.4

8

0.7

4

0.0 4.5 LSD 0.05=1.30 3.6

Relative intensity

21

PuLOX8

0 PuLOX11 5.5

LSD 0.05=0.94

4.4

2.7 1.8

3.3

0.9 0.0 2.4 LSD 0.05=0.60

1.1

2.2

PuADH2

PuADH3

LSD 0.05=0.24

1.8

1.6

0.6

0.8 LSD 0.05=0.04

PuADH5

LSD 0.05=0.71

PuAAT

0.9

0.0 2.5 2.0 1.5

0.6

1.0

0.3 0.0

3.2 2.4

1.2 0.0 1.2

0.0 4.0

0.5 0

3

6

9

12

0

3

6

9

12

0.0

Ripening period (d) Fig. 4. Changes in transcript levels of ester-related genes during stages of ripening of ‘Pingxiangli’ pear fruit at 20 ◦ C. Vertical bars represent means ± SE.

3.4. Transcript levels of genes related to ester formation To understand the roles of the ester biosynthesis-related genes (LOX, ADH, and AAT) in the production of ester volatile compounds during ripening of ‘Pingxiangli’ pear fruit, we analyzed their transcript levels at five different stages of ripening (Fig. 4). During postharvest ripening at 20 ◦ C, PuLOX6 and PuLOX11 showed similar transcriptional patterns. The transcript levels of PuLOX6 and PuLOX11 increased during all stages of fruit ripening and peaked on day 12 during the ripening period. In contrast, the highest transcript abundance of PuLOX1 and PuLOX8 was on day 3 of the ripening period. The transcript level of PuADH3 peaked on day 6 of ripening, and then dramatically decreased. There was no significant change in the abundance of PuADH2 transcripts during ripening. The transcript level of PuADH5 was higher at harvest (day 0) and then decreased as the fruit ripened. The transcript level of PuAAT increased rapidly during ripening and peaked on day 3, and then decreased throughout the rest of the ripening period. 4. Discussion Aroma volatiles represent a major quality attribute of pear fruit, especially for fruit of P. ussuriensis, which is known for its intense aroma. In the present study, we identified 23 volatile compounds produced during ripening of ‘Pingxiangli’ pear, including 16 esters, two alcohols, three aldehydes, two terpenes, and one acid. Esters were the main class of compounds produced in ‘Pingxiangli’ pear during ripening, particularly after the peak in ethylene production. Six volatiles including hexanal, E-2-hexenal, ethyl butanoate, ethyl 2-methylbutanoate, ethyl hexanoate, and hexyl acetate contributed to the aroma of the ‘Pingxiangli’ pear fruit at different stages of ripening. These volatiles have also been detected as important volatile constituents in other pear cultivars and other fruits (Ménager et al., 2004; Lara et al., 2007; Villatoro et al., 2008; Altisent

et al., 2011; Verzera et al., 2011). In addition, the production of esters significantly increased during fruit ripening, while that of aldehydes decreased. Similar changes have been reported previously for ‘Hayward’ kiwifruit (Young et al., 1995; Wang et al., 2011). Among the four esters, ethyl esters were more abundant than hexyl esters. These esters are presumably synthesized by esterification of the corresponding acids with alcohols, catalyzed by AAT. Therefore, the types of esters produced depend on the specificity of the AAT and the availability of substrates (Aharoni et al., 2000; Yahyaoui et al., 2002; Li et al., 2006). In strawberry, AAT showed the highest activity toward hexanol and acetyl-CoA, but the activity of AAT toward these substrates was lower in banana and apple (Olias et al., 1995, Holland et al., 2005). The availability of precursors may also affect the formation of esters. When there were lower concentrations of alcohol substrates, AAT showed a higher affinity for 2-methylbutanol than for hexanol and butanol. In contrast, when there were higher concentrations of substrates, hexanol was the preferred substrate for AAT in apple fruit (Souleyre et al., 2005). In summary, the concentration of aldehydes decreased, while that of esters increased dramatically during the ripening of ‘Pingxiangli’ pear fruit. The ripening of climacteric fruit is characterized by a high rate of ethylene production and a high respiration rate accompanying some physiological changes. As an important species of Asian pear, P. ussuriensis requires a period of ripening to become soft and edible. As it ripens, it produces an intense aroma in parallel with ethylene production. Non-climacteric pear cultivars show lower ethylene production and respiration rates. The fact that the intense aroma produced by fruit of P. ussuriensis is accompanied by an increase in ethylene production indicates that ethylene may play a role in modulating volatile compound biosynthesis during fruit ripening. There is evidence for a relationship between ethylene and ester biosynthesis in other types of fruit (Defilippi et al., 2005a,b; Schaffer et al., 2007). Our results showed that there were differences in the

22

G. Li et al. / Scientia Horticulturae 170 (2014) 17–23

transcriptional patterns of genes related to the synthesis of ethylene. For example, an increased transcript level of PuACS1 coincided with elevated ethylene production during ripening of ‘Pingxiangli’ pear fruit, whereas the transcript level of PuACS5 did not change during ripening. MdACS1 encodes the enzyme that catalyzes the rate-limiting step in ethylene biosynthesis in apple fruit (Harada et al., 2000). It was reported that the transcript level of PcACS1 increased during storage in ‘Passe-Crassane’ pear, whereas that of PcACS2 only increased during ripening of cold-independent genotypes (Pech et al., 2002; El-Sharkawy et al., 2004). The results of the present study showed that an increase in the transcript level of PuACS1 coincided with elevated ethylene production during fruit ripening. There were different transcriptional patterns of PuACOs during ripening, as shown in Fig. 3. In ripening climacteric pear fruit, PbACO1 transcript accumulation accompanied ethylene production, whereas other ACO mRNAs were not detected (Yamane et al., 2007). In the present study, the transcript levels of PuACO2, PuACO3, and PuACO5 peaked on day 6 during ripening, and coincided with the increase in ethylene production. However, the maximum transcript level of PuACO6 was before the peak in ethylene production. In conclusion, transcription of PuACSs and PuACOs appeared to be highly correlated with ethylene production during ripening of ‘Pingxiangli’ pear. Among the important volatile constituents, aldehydes are well known to impart ‘green’ and ‘fatty’ notes to the overall aroma of fruit (Nicolas et al., 2009). We evaluated changes in the levels of two aldehydes, hexanal and E-2-hexenal, during ripening of ‘Pingxiangli’ pear fruit. The presence of C6 aldehydes was probably due to the breakdown of fatty acids. LOX is involved in generating C6 aldehydes and alcohols (Baldwin et al., 1991; Chen et al., 2004). In our study, the transcriptional patterns of PuLOXs differed during ripening (Fig. 4). In kiwifruit, the transcript levels of AdLOX1 and AdLOX5 increased, and that of AdLOX6 decreased, during fruit ripening (Zhang et al., 2006), and it was noted that the concentration of aldehydes decreased fruit ripening. The lower capacity to synthesize precursors of fatty acids in apple fruit could be a major limiting factor for ester production in immature fruit (Song and Bangerth, 1994). The concentration of C6 aldehydes in tomato fruit declined when TomLOXC was down-regulated (Chen et al., 2004). Alcohol dehydrogenase (ADH) catalyzes the reduction of aldehydes into their corresponding alcohols, and this reaction is directly responsible for the composition of esters. ADH is also an important enzyme for the biosynthesis of alcohols. The expression of ADH has been shown to be tissue-specific and developmentally regulated, especially during fruit ripening (Echeverria et al., 2004). In transgenic ‘Greensleeves’ apples, ADH expression was not affected by changes in the levels of endogenous ethylene, whereas in ‘Delbarde Estivale’ apple, the application of ethylene inhibitors decreased expression of ADH (Defilippi et al., 2005b; Harb et al., 2011). As the major class of volatiles, esters are known to contribute sweet and fruity notes to the aroma of different types of fruit (Nicolas et al., 2009; MoyaLeón et al., 2006). Esters are synthesized via the action of AATs, which transfer an acyl moiety from acetyl-CoA or other acyl-CoA derivatives onto a corresponding alcohol (Bartley et al., 1985). Our results showed that the transcript level of PuAAT peaked on day 3 during the ripening period, when increasing concentrations of all four esters were detected (Fig. 4). It was reported that substrate specificity may affect the production of esters in banana and strawberry (Perez et al., 1996; Dixon and Hewett, 2000). The changes in the production of volatile esters suggested that AATs may be regulated by ethylene during pear ripening. Similar results have been reported for other climacteric fruit including apple (Song and Bangerth, 1994; Dandekar et al., 2004) and melon (Yahyaoui et al., 2002; El-Sharkawy et al., 2005). The role of ethylene in aromatic volatile biosynthesis in apple fruit was explored using transgenic lines and ethylene inhibitors. As reported by Defilippi et al. (2005b),

the expression of AAT was highly regulated by ethylene, whereas that of ADH was unaffected by changes in the levels of endogenous ethylene. Research on a transgenic line of apple showed that the first and last steps of the LOX pathway were regulated by ethylene (Schaffer et al., 2007). The production of esters was inhibited in climacteric fruit treated with ethylene inhibitors (Fan et al., 1998; Lurie et al., 2002; Yahyaoui et al., 2002; Balbontin et al., 2007; ˜ et al., 2011). Villalobos-Acuna The results of the present study showed that the concentration of esters increased, and that of aldehydes decreased, during ripening of ‘Pingxiangli’ pear fruit. Various genes related to the biosynthesis of ethylene and esters showed different transcriptional patterns during fruit ripening. PuACS1, PuACO5, and PuACO6 may play important roles in ethylene biosynthesis, and PuLOX1, PuLOX8, PuADH3 and PuAAT may be critical for ester formation. Acknowledgement This work was financed by the Earmarked Fund (nycytx-29) for Modern Agro-industry Technology Research System. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.scienta. 2014.03.004. References Aharoni, A., Keizer, L.C.P., Bouwmeester, H.J., Sun, Z., Alvarez-Huerta, M., Verhoeven, H.A., Blaas, J., van Houwelingen, A.M.M.L., De Vos, R.C.H., van der Voet, H., Jansen, R.C., Guis, M., Mol, J., Davis, R.W., Schena, M., van Tunen, A.J., O’Connell, A.P., 2000. Identification of the SAAT gene involved in strawberry flavor biogenesis by use of DNA microarrays. Plant Cell 12, 647–661. Altisent, R., Graell, J., Lara, I., López, L., Echeverria, G., 2011. Comparison of the volatile profile and sensory analysis of ‘Golden Reindeers’ apples after the application of a cold air period after ultralow oxygen (ULO) storage. J. Agric. Food Chem. 59, 6193–6201. Balbontin, C., Gaete-Eastmana, C., Vergara, M., Herrera, R., Moya-Leóna, M.A., 2007. Treatment with 1-MCP and the role of ethylene in aroma development of mountain papaya fruit. Postharvest Biol. Technol. 43, 67–77. Baldwin, E., 2002. Fruit flavour, volatile metabolism and consumer perceptions. In: Knee, M. (Ed.), Fruit Quality and its Biological Basis. CRC Press, Boca Raton, FL, pp. 89–106. Baldwin, E.A., Nisperos-Carriedo, M.O., Moshonas, M.G., 1991. Quantitative analysis of flavor and other volatiles and for certain constituents of two tomato cultivars during ripening. J. Am. Soc. Hortic. Sci. 116, 265–269. Bartley, I.M., Stoker, P.G., Martin, A.D.E., Hatfield, S.G.S., Knee, M., 1985. Synthesis of aroma compounds by apples supplied with alcohols and methyl esters of fatty acids. J. Sci. Food Agric. 36, 567–574. Brückner, B., Wyllie, S.G., 2008. Fruit and Vegetable Flavour: Recent Advances and Future Prospects. CRC Press, Boca Raton/New York, pp. 41–70. Chen, G.P., Hackett, R., Walker, D., Taylor, A., Lin, Z.F., Grierson, D., 2004. Identification of a specific isoform of tomato lipoxygenase (TomloxC) involved in the generation of fatty acid-derived flavor compounds. Plant Physiol. 136, 2641–2651. Dandekar, A.A., Teo, G., Defilippi, B.G., Uratsu, S.L., Passey, A.J., Kader, A.A., Stow, J.R., Colgan, R.J., James, D.J., 2004. Effect of down-regulation of ethylene biosynthesis on fruit flavour complex in apple fruit. Transgenic Res. 13, 373–384. Defilippi, B.G., Kader, A.A., Dandekar, A.M., 2005a. Apple aroma: alcohol acyltransferase, a rate limiting step for ester biosynthesis, is regulated by ethylene. Plant Sci. 168, 1199–1210. Defilippi, B.G., Dandekar, A.M., Kader, A.A., 2005b. Relationship of ethylene biosynthesis to volatile production, related enzymes, and precursor availability in apple peel and flesh tissues. J. Agric. Food Chem. 53, 3133–3141. Dixon, J., Hewett, E.W., 2000. Factors affecting apple Aroma/flavor volatile concentration: review. New Zeal. J. Crop Horti. 28, 155–173. Dudareva, N., Dauria, J.C., Nam, K.H., Raguso, R.A., Pichersky, E., 1998. Acetyl CoA: benzyl alcohol acetyltransferase: an enzyme involved in floral scent production in Clarkia breweri. Plant J. 14, 297–304. Dudareva, N., Pichersky, E., Gershenzon, J., 2004. Biochemistry of plant volatiles. Plant Physiol. 135, 1893–1902. Echeverria, G., Graell, J., López, M.L., Lara, I., 2004. Volatile production, quality and aroma-related enzyme activities during maturation of ‘Fuji’ apples. Postharvest Biol. Technol. 31, 217–227. El-Sharkawy, I., Jones, B., Gentzbittel, L., Lelievre, J.M., Pech, J.C., Latché, A., 2004. Differential regulation of ACC synthase genes in cold-dependent and independent ripening in pear fruit. Plant Cell Environ. 27, 1197–1210.

G. Li et al. / Scientia Horticulturae 170 (2014) 17–23 El-Sharkawy, I., Manríquez, D., Flores, F.B., Regad, F., Bouzayen, M., Latche, A., Pech, J., 2005. Functional characterization of a melon alcohol acyl-transferase gene family involved in the biosynthesis of ester volatiles. Identification of the crucial role of a threonine residue for enzyme activity. Plant Mol. Biol. 59, 345–362. Fan, X., Mattheis, J.P., Buchanan, D., 1998. Continuous requirement of ethylene for apple fruit volatile synthesis. J. Agric. Food Chem. 46, 1959–1963. González-Agüero, M., Troncoso, S., Gudenschwager, O., Campos-Vargas, R., MoyaLeón, M.A., Defilippi, B.G., 2009. Differential expression levels of aroma-related genes during ripening of apricot (Prunus armeniaca L.). Plant Physiol. Biochem. 47, 435–440. Harada, T., Sunako, T., Wakasa, Y., Soejima, J., Satoh, T., Niizeki, M., 2000. An allele of 1-aminocyclopropane-1-carboxylate synthase gene (Md-ACS1) accounts for the low ethylene production in climacteric fruit of some apple cultivars. Theor. Appl. Genet. 101, 742–746. Harb, J., Lara, I., Saleh, O., Streif, J., Khraiwesh, B., 2011. Treatments that suppress ethylene production or ethylene action modify ADH and AAT gene expression and aroma-related enzyme activities in ‘Delbarde Estivale’ apple: consequences for the aroma profiles of fruit. J. Hortic. Sci. Biotechnol. 86, 182–188. Holland, D., Larkov, O., Yaakov, I.B., Bar, E., Zax, A., Brandeis, E., Ravid, U., Lewinsohn, E., 2005. Developmental and varietal differences in volatile ester formation and acetyl-coA: alcohol acetyl transferase activities in apple (Malus domestica Borkh.) fruit. J. Agric. Food Chem. 53, 7198–7203. Lara, I., Echeverria, G., Graell, J., López, M.L., 2007. Volatile emission after controlled atmosphere storage of Mondial Gala apples (Malus domestica): relationship to some involved enzyme activities. J. Agric. Food Chem. 55, 6087–6095. Lara, I., Mio, R.M., Fuentes, T., Sayez, G., Graell, J., López, M.L., 2003. Biosynthesis of volatile aroma compounds in pear fruit stored under long-term controlledatmosphere conditions. Postharvest Biol. Technol. 29, 29–39. Li, D., Xu, Y., Xu, G., Gu, L., Li, D., Shu, H., 2006. Molecular cloning and expression of a gene encoding alcohol acyltransferase (MdAAT2) from apple (cv Golden Delicious). Phytochemistry 67, 658–667. Li, G., Jia, H., Wu, R., Hussain, S., Teng, Y., 2012a. Characterization of aromatic volatile constituents in 11 Asian pear cultivars belonging to different species. Afr. J. Agric. Res. 7, 4761–4770. Li, G., Jia, H., Wu, R., Teng, Y., 2013. Changes in volatile organic compound composition during the ripening of ‘Nanguoli’ pears (Pyrus ussuriensis Maxim) harvested at different growing locations. J. Hortic. Sci. Biotechnol. 88 (5), 563–570. Li, G., Jia, H., Wang, Q., Zhang, M., Teng, Y., 2012b. Analysis of volatile compounds of Pyrus ussuriensis ‘Xiaoxiangshui’ during ripening. Acta Hortic. Sin. 39, 151–158. Lurie, S., Pre-Aymard, C., Ravid, U., Larkov, O., Fallik, E., 2002. Effect of 1methylcyclopropene on volatile emission and aroma in Anna apples. J. Agric. Food Chem. 50, 4251–4256. McGuire, R.G., 1992. Reporting of objective color measurements. HortScience 27, 1254–1255. Ménager, I., Jost, M., Aubert, C., 2004. Changes in physicochemical characteristics and volatile constituents of strawberry (Cv Cigaline) during maturation. J. Agric. Food Chem. 52, 1248–1254. Moya-León, M.A., Vergara, M., Bravo, C., Montes, M.E., Moggia, C., 2006. 1-MCP treatment preserves aroma quality of ‘Packham’s Triumph’ pears during long-term storage. Postharvest Biol. Technol. 42, 185–197. Mukkun, L., Singh, Z., 2009. Methyl jasmonate plays a role in fruit ripening of ‘Pajaro’ strawberry through stimulation of ethylene biosynthesis. Sci. Hortic. 123, 5–10. Nicolas, J.M.L., Sevilla, A.J.A., Barrachina, A.A.C., Carmona, F.G., 2009. Effects of addition of á-cyclodextrin on the sensory quality, volatile compounds, and color parameter of fresh pear juice. J. Agric. Food Chem. 57, 9668–9675. Olias, J.M., Sanz, C., Rios, J.J., Pérez, A.G., 1995. Substrates specificity of alcohol acyltransferase from strawberry and banana fruit. ACS Symp. Ser., 134–141. Pech, J.C., Sharkawi, I., Chaves, A., Li, Z., Levièvre, J.M., Bouzayen, M., Frasse, P., Zegzouti, H., Latché, A., 2002. Recent developments on the role of ethylene in the ripening of climacteric fruit. Acta Hortic. 587, 489–495.

23

Perez, A.G., Sanz, C., Olias, R., Rkos, J.J., Olkas, J.M., 1996. Evolution of strawberry alcohol acyltransferase activity during fruit development and storage. J. Agric. Food Chem. 44, 3286–3290. Rapparini, F., Predieris, S., 2003. Pear fruit volatiles. Hortic. Rev. 28, 237–324. Schaffer, R.J., Friel, E.N., Souleyre, E.J.F., Bolitho, K., Thodey, K., Ledger, S., Bowen, J.H., Ma, J.H., Nain, B., Cohen, D., Gleave, A.P., Crowhurst, R.N., Janssen, B.J., Yao, J.L., Newcomb, R.D., 2007. A genomics approach reveals that aroma production in apple is controlled by ethylene predominantly at the final step in each biosynthetic pathway. Plant Physiol. 144, 1899–1912. Song, J., Bangerth, F., 1994. Production and development of volatile aroma compounds of apple fruit at different times of maturity. Acta Hort. 368, 150–159. Souleyre, E.J.F., Greenwood, D.R., Friel, E.N., KrunairetNam, S., Newcomb, R., 2005. An alcohol acyl transferase from apple (cv. Royal Gala) MpAAT1, produces esters involved in apple fruit flavor. FEBS J. 272, 3132–3144. Teng, Y., Tanabe, K., 2004. Reconsideration on the origin of cultivated pears native to East Asia. Acta Hortic. 634, 175–182. Verzera, A., Dima, G., Tripodi, G., Ziino, M., Lanza, C.M., Mazzaglia, A., 2011. Fast quantitative determination of aroma volatile constituents in melon fruit by headspace–solid-phase microextraction and gas chromatography–mass spectrometry. Food Anal. Methods 4, 141–149. ˜ M.G., Biasi, W.V., Mitcham, E.J., Holcroft, D., 2011. Fruit temperaVillalobos-Acuna, ture and ethylene modulate 1-MCP response in ‘Bartlett’ pears. Postharvest Biol. Technol. 60, 17–23. Villatoro, C., Altisent, R., Echeverria, G., Graell, J., López, M.L., Lara, I., 2008. Changes in biosynthesis of aroma volatile compounds during on-tree maturation of ‘Pink Lady® ’ apples. Postharvest Biol. Technol. 47, 286– 295. Wang, M.Y., MacRae, E., Wohlers, M., Marsh, K., 2011. Changes in volatile production and sensory quality of kiwifruit during fruit maturation in Actinidia deliciosa ‘Hayward’ and A. chinensis ‘Hort16A’. Postharvest Biol. Technol. 59, 16–24. Yahyaoui, F.E.L., Wongs-Aree, C., Latche, A., Hackett, R., Grierson, D., Pech, J., 2002. Molecular and biochemical characteristics of a gene encoding an alcohol acyltransferase involved in the generation of aroma volatile esters during melon ripening. Eur. J. Biochem. 269, 2359–2366. Yamane, M., Abe, D., Yasui, S., Yokotani, N., Kimata, W., Ushijima, K., Nakano, R., Kubo, Y., Inaba, A., 2007. Differential expression of ethylene biosynthetic genes in climacteric and non-climacteric Chinese pear fruit. Postharvest Biol. Technol. 44, 220–227. Young, H., Stec, M., Paterson, V.J., McMath, K., Ball, R., 1995. Volatile compounds affecting kiwifruit flavor. In: Symposium on Fruit Flavors-Biogenesis, Characterization, and Authentication, at the 206th National Meeting of the ACS, pp. 59–67. Zhang, B., Chen, K.S., Bowen, J., Allen, A., Espley, R., Karunairetnam, S., Ferguson, I.B., 2006. Differential expression within the LOX gene family in ripening kiwifruit. J. Expt. Bot. 57, 3825–3836. Zhang, B., Shen, J., Wei, W., Xi, W., Xu, C.J., Ferguson, I.B., Chen, K.S., 2010. Expression of genes associated with aroma formation derived from the fatty acid pathway during peach fruit ripening. J. Agric. Food Chem. 58, 6157–6165. Zhang, D., Yu, B., Bai, J., Qian, M., Shu, Q., Su, J., Teng, Y., 2012. Effects of high temperatures on UV-B visible irradiation induced postharvest anthocyanin accumulation in ‘Yunhongli No 1’ (Pyrus pyrifolia Nakai) pears. Sci. Hortic. 134, 53–59. Zhang, L.P., Shen, Y.X., Bu, Q.Z., Ji, S.J., 2013. Effects of 1-methylcyclopropene on the metabolic pathways of aroma-related compounds in Nanguo pear. J. Food Process., p.12138. Zhu, Y., Rudell, D.R., Mattheis, J.P., 2008. Characterization of cultivar differences in alcohol acyltransferase and 1-aminocyclopropane-1-carboxylate synthase gene expression and volatile ester emission during apple fruit maturation and ripening. Postharvest Biol. Technol. 49, 330–339.