cDNA cloning and characterization of feline CYP1A1 and CYP1A2

Life Sciences 79 (2006) 2463 – 2473 www.elsevier.com/locate/lifescie

cDNA cloning and characterization of feline CYP1A1 and CYP1A2 Nagako Tanaka a , Taku Miyasho a , Raku Shinkyo b , Toshiyuki Sakaki c , Hiroshi Yokota a,⁎ a

b

Laboratory of Veterinary Biochemistry, Graduate School of Veterinary Medicine, Rakuno Gakuen University, Ebetsu, Hokkaido 069-8501, Japan Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Kitashirakawa-Oiwake-cho, Sakyo-ku, Kyoto 606-8502, Japan c Biotechnology Research Center, Faculty of Engineering, Toyama Prefectural University, Kosugi, Toyama 939-0398, Japan Received 27 April 2006; accepted 11 August 2006

Abstract Deficiency of drug glucuronidation in the cat is one of the major reasons why this animal is highly sensitive to the side effects of drugs. The characterization of cytochrome P450 isoforms belonging to the CYP1A subfamily, which exhibit important drug oxidation activities such as activation of pro-carcinogens, was investigated. Two cDNAs, designated CYP1A-a and CYP1A-b, corresponding to the CYP1A subfamily were obtained from feline liver. CYP1A-a and CYP1A-b cDNAs comprise coding regions of 1554 bp and 1539 bp, and encode predicted amino acid sequences of 517 and 512 residues, respectively. These amino acid sequences contain a heme-binding cysteine and a conserved threonine. The cDNA identities, as well as the predicted amino acid sequences containing six substrate recognition sites, suggest that CYP1A-a and CYP1A-b correspond to CYP1A1 and CYP1A2, respectively. This was confirmed by the kinetic parameters of the arylhydrocarbon hydroxylase and 7ethoxyresorufin O-deethylase activities of expressed CYPs in yeast AH22 cells and by the tissue distribution of each mRNA. However, theophylline 3-demethylation is believed to be catalyzed by CYP1A1 in cats, based on the high Vmax and low Km seen, in contrast to other animals. Because feline CYP1A2 had a higher Km for phenacetin O-deethylase activity with acetaminophen, which cannot be conjugated with glucuronic acid due to UDP-glucuronosyltransferase deficiency, it is supposed that the side effects of phenacetin as a result of toxic intermediates are severe and prolonged in cats. © 2006 Elsevier Inc. All rights reserved. Keywords: Cat; Cytochrome P450 (CYP); CYP1A1; CYP1A2

Introduction Side effects of drugs and sensitivity to drugs are well-known to vary among individuals. Domestic cats are a typical model of high sensitivity to the side effects of numerous drugs and toxins, unlike most other mammalian species. One of the reasons for this is their well-known deficiency in glucuronidation (Capel et al., 1972, 1974; Watkins and Klaassen, 1986; Court and Greenblatt, 1997a,b, 2000). Cytochrome P450s (CYPs), the first-phase enzymes of drug metabolism, also play important roles in sensitivity to drugs and toxins by producing active intermediates. Comparative studies of P450 drug oxidation activity in feline liver microsomes have been performed (Watkins and Klaassen, 1986; Eberhart et al., 1991; Pearce

⁎ Corresponding author. Tel./fax: +81 11 388 4743. E-mail address: [email protected] (H. Yokota). 0024-3205/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.lfs.2006.09.030

et al., 1992; Chauret et al., 1997; Court et al., 1997), but the feline CYP isoforms catalyzing various drugs have not been characterized in detail. CYPs comprise a gene superfamily encoding enzymes involved in the synthesis and metabolism of endogenous compounds as well as the metabolism of xenobiotics. The CYP superfamily is subdivided into families and subfamilies based on amino acid sequence identity. The CYP1, CYP2, CYP3, and CYP4 families in mammals are responsible for phase I drug metabolism (Nelson et al., 1996). In mammals, the CYP1A subfamily has two isoforms (CYP1A1 and CYP1A2), which have highly homologous amino acid sequences (more than 70% identity). The CYP1A subfamily is expressed in almost all tissues, but with marked differences between CYP1A1, which is mainly expressed in extrahepatic tissues, and CYP1A2, which is mainly expressed in the liver (Kimura et al., 1986; Omiecinski et al., 1990). CYP1A1 and CYP1A2 are distinct but have overlapping substrate specificities. CYP1A1 primarily

2464

N. Tanaka et al. / Life Sciences 79 (2006) 2463–2473

targets polycyclic aromatic hydrocarbons such as benzo[a] pyrene and 3-methylcholanthrene, whereas CYP1A2 catalyzes the metabolic activation of aryl and heterocyclic amines such as 2-acetylaminofluorene (Ioannides and Parke, 1990) and the oxidative metabolism of drugs including phenacetin (Butler et al., 1989; Sesardic et al., 1988), warfarin (Zhang et al., 1995), caffeine (Butler et al., 1989), and theophylline (Sarkar et al., 1992). Recent advances in molecular cloning and expression technology have allowed the elucidation of the roles and characteristics of each CYP, and confirmed the differences in drug metabolism between various species and genetic polymorphisms within species. We previously reported that the feline CYP2E subfamily has two similar isoforms (CYP2E1 and CYP2E2) encoded by different genes (Tanaka et al., 2005). Characterization of the feline CYP1A subfamily, which is commonly expressed in most animals, is useful in comparing the metabolism of carcinogens and drugs, and in understanding drug side effects. In this study, feline CYP1A subfamily members were characterized by cDNA cloning and expression, and drug toxicity in cats is discussed. Materials and methods Chemicals and reagents β-NADPH was purchased from Wako Pure Chemical Industries (Osaka, Japan). 7-Ethoxyresorufin, resorufin, benzo [a]pyrene, phenacetin, acetaminophen, theophylline, theobromine, 1-methylxanthine (1-X), 1,3-dimethyluric acid (1,3-DU), and cytochrome c were purchased from Sigma-Aldrich (St Louis, MO, USA). 3-Hydroxy-benzo[a]pyrene was obtained from the Midwest Research Institute (Kansas City, MO, USA). All other chemicals were of the best commercially available grade. Sep-Pak C18 cartridges (55–105 μm particle size, 100 mg) were purchased from Waters Assoc. (Milford, MA, USA). Animal tissues Tissues were obtained from five mature domestic short hair cats (mongrels, two females and three males) and Sprague– Dawley rats. The animals were euthanized under anesthesia, and prepared tissues were frozen immediately in liquid nitrogen and stored at − 80 °C. Total RNA preparation and reverse-transcription (RT) polymerase chain reaction (PCR) Total RNA was extracted from the tissues using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). First-strand cDNA was synthesized from total RNA with Superscript II (Invitrogen) and Oligo-dT primers according to the manufacturer's instructions. Forward and reverse oligonucleotide primers (HomoF and HomoR in Table 1) to amplify feline CYP1A partial cDNA were designed based on two regions of the CYP1A1 cDNA that

are highly homologous in humans [GenBank NM_000499] and animals such as rats [GenBank NM_012540], mice [GenBank NM_009992], and pigs [GenBank AB052254]. First-strand cDNA was used as a template and amplification was primed using the HomoF/HomoR primer pair. The PCR reaction mix contained 1× PCR buffer, 0.2 mM dNTPs, each primer at 0.3 μM, and 2.6 U of Expand High Fidelity PCR System enzyme mix (Roche Diagnostics, Somerville, NJ, USA) in a final volume of 100 μl. PCR was performed on a thermal cycler (iCycler™; BIO-RAD, Hercules, CA, USA) and consisted of an initial 2-min denaturation at 94 °C, followed by 35 cycles at 94 °C for 15 s, 52.6 °C for 30 s, and 72 °C for 90 s, with a final 5-min extension at 72 °C. The resulting 1214-base pair (bp) product was isolated by electrophoresis on a 1.5% TAE agarose gel and was gel-purified using a Zymoclean™ Gel DNA Recovery Kit (Zymo Research, Orange, California, USA), according to the manufacturer's instructions. 5′ Rapid amplification of cDNA ends (5′-RACE) Gene-specific primers (5′R1 and 5′R2 in Table 1) were designed based on the nucleotide sequence of the HomoF and HomoR cDNA fragments amplified by RT-PCR. cDNA for the 5′-RACE (Frohman et al., 1988) reaction was synthesized using the gene-specific 5′R1 primer. cDNA was purified using Microcon™-100 (TaKaRa BIO, Otsu, Shiga, Japan), according to the manufacturer's instructions. The terminal deoxynucleotidyl-transferase (Gibco, Grand Island, NY, USA) reaction was performed according to the manufacturer's instructions to add an anchor sequence, poly dA, to the 3′-flanking region of the first-strand cDNA. This cDNA with poly dA added to the 3′flanking region was used as a template, and amplification was primed with the 5′R2/Oligo-dT-ADP primer pair. The nested PCR reaction mix contained 1× PCR buffer, 0.2 mM dNTPs, each primer at 0.3 μM, and 2.6 U of Expand High Fidelity PCR System enzyme mix (Roche) in a final volume of 100 μl. PCR consisted of an initial 2-min denaturation at 94 °C, followed by 35 cycles at 94 °C for 15 s, 55 °C for 30 s, and 72 °C for 45 s, with a final 5-min extension at 72 °C. The resulting product was isolated by electrophoresis on a 1.5% TAE agarose gel and was gel-purified with a Zymoclean™ Gel DNA Recovery Kit (Zymo Research). 3′ Rapid amplification of cDNA ends (3′-RACE): CYP1A-a cDNA for the 3′-RACE (Frohman et al., 1988) reaction was synthesized using an oligo-dT-ADP primer (Table 1). Genespecific primers (3p′-1-F1 and 3′-1-F2 in Table 1) were designed based on the nucleotide sequences of the partial cDNA fragments amplified using the HomoF and HomoR primers. First-strand cDNA was used as a template and amplification was primed using the 3′-1-F1/RACE-AP primer pair (Table 1). The PCR reaction mix contained 1× PCR buffer, 0.2 mM dNTPs, each primer at 0.3 μM, and 2.6 U of Expand High Fidelity PCR System enzyme mix (Roche) in a final volume of 100 μl. PCR consisted of an initial 2-min denaturation at 94 °C, followed by 35 cycles at 94 °C for 15 s, 50 °C

N. Tanaka et al. / Life Sciences 79 (2006) 2463–2473

2465

Table 1 Details of oligonucleotide primers used in this study Primer 3′-RACE/5′-RACE Oligo-dT-ADP a

Primer sequence (5′ to 3′)

Annealing site

RACE-AP b 3′-1-F1 3′-1-F2 3′-2-F1 3′-2-F2 5′R1 5′R2

AGAGGAGCGCTAATACGACTAACTATAGGGCTA GTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTNV GGAGCGCTAATACGACTCACTATAGG AGATGGTCAAGGAACACTAC ACAACTGCCATCTCCTGGTG CTGCCATCAACAAGATCTTA AAGGTGATGATCTTTGGCCT TTGCCAGCACCAGATGTGG CAGCACATGCCCGAGCAGAG

Feline 1A amplification HomoF c HomoR d 2-ATG-F 2-Homo-R e Ca-1Fhid Ca-1Rhid Ca-2Fhid Ca-2Rhid

GCCACAGA(A/G)CT(G/T)CTCCTGGC GCCACTGGTTCACAAAGACAC ATGGCAATATCCCCAACGGC T(A/G)AA(T/C)TCCAG(A/T/C)TGCTG(T/C)AGCA TCTCTAAGCTTATGATGTTGTCTGTGTTTG TAGAAAGCTTCTAAGCTGCAGGGCTCTCA AGTTGAAGCTTATGGCAATATCCCCAACGG TGCTGAAGCTTTCACTTGATGGAGAAACGT

− 11–19 1558–1586 − 11–19 1521–1550

Rat CYP1A2 amplification Rat-2Fhind Rat-2Rhind

AGTCAAGCTTATGGCGTTCTCCCAGTATAT TCGGAAGCTTTCACTTGGAGAAGCGTGGCC

− 10–20 1523–1552

Feline CYP1As RT-PCR for tissue distribution 1-F 1-R 2-R CGA-F CGA-R

ATGATGTTGTCTGTGTTTGG CTAAGCTGCAGGGCTCTCAG TCACTTGATGGAGAAACGTG ATGGTGAAGGTCGGTGTGAAC TTACTCCTTGGAGGCCATGTG

1–20 1557–1579 1520–1539 1–21 981–1002

Rat CYP1As RT-PCR for tissue distribution r1-F r1-R r2-F r2-R RGA-F RGA-R

TGACCTCTTTGGAGCTGGTT CCAATGACTTTCGCTTGC ATGGCGTTCTCCCAGTATAT TCACTTGGAGAAGCGTGGCC ATGGTGAAGGTCGGTGTGAA TTACTCCTTGGAGGCCATGT

948–967 1370–1388 1–20 1523–1542 1–20 987–1002

806–825 982–1001 1301–1320 1327–1346 190–208 (169–187) 155–174 (134–153)

1–20

Underlined sequences indicate restriction enzyme (HindIII) sites. a Oligo-dT and adapter primer. b Reverse primer for 3′-RACE. c Forward and reverse primers to amplify feline CYP1A-a cDNA were designed based on two regions in CYP1A1 cDNA that are highly homologous in many animals. d See Footnote c. e Reverse primers to amplify feline CYP1A-b cDNA were designed based on a region in CYP1A2 cDNA that is highly homologous in many animals.

for 30 s, and 72 °C for 1 min, with a final 5-min extension at 72 °C. The resulting product was isolated by electrophoresis on a 1.5% TAE agarose gel and gel-purified with a Zymoclean™ Gel DNA Recovery Kit (Zymo Research). The PCR product was used as a template for nested PCR, and amplification was primed using the 3′-1-F2/RACE-AP primer pair. Nested PCR was performed using the same procedure as the first 3′-RACE PCR, except that an annealing temperature of 55 °C was used. 3′ Rapid amplification of cDNA ends (3′-RACE): CYP1A-b The gene-specific forward primer for feline CYP1A-b (2ATG-F in Table 1) was designed based on the resulting 5′-

RACE sequences. Reverse primer (2-Homo-R in Table 1) to amplify the feline CYP1A-b partial cDNA was designed based on regions of CYP1A2 cDNA that are highly homologous in many animals such as humans [GenBank NM_000761], rats [GenBank NM_012541], mice [GenBank NM_00993], and guinea pigs [GenBank D50457]. First-strand cDNA was used as a template and amplification was primed using the 2-ATG-F/2Homo-R primer pair. The PCR reaction mix contained 1× PCR buffer, 0.2 mM dNTPs, each primer at 0.3 μM, and 2.6 U of Expand High Fidelity PCR System enzyme mix (Roche) in a final volume of 100 μl. PCR was performed on a thermal cycler (iCycler™ BIO-RAD) and consisted of an initial 2-min denaturation at 94 °C, followed by 35 cycles at 94 °C for

2466

N. Tanaka et al. / Life Sciences 79 (2006) 2463–2473

15 s, 50 °C for 30 s, and 72 °C for 90 s, with a final 5-min extension at 72 °C. The resulting 1431-bp product was isolated by electrophoresis on a 1.5% TAE agarose gel and was gelpurified using a Zymoclean™ Gel DNA Recovery Kit (Zymo Research), according to the manufacturer's instructions. cDNA for 3′-RACE (Frohman et al., 1988) was synthesized using an oligo-dT-ADP primer (Table 1). Gene-specific primers (3′-2-F1 and 3′-2-F2 in Table 1) were designed based on the nucleotide sequences of partial cDNA fragments amplified using the 2ATG-F and 2-Homo-R primers. First-strand cDNA was used as a template and amplification was primed with the 3′-2-F1/ RACE-AP primer pair (Table 1). The PCR reaction mix contained 1× PCR buffer, 0.2 mM dNTPs, each primer at 0.3 μM, and 2.6 U of Expand High Fidelity PCR System enzyme mix (Roche) in a final volume of 100 μl. PCR consisted of an initial 2-min denaturation at 94 °C, followed by 35 cycles at 94 °C for 15 s, 50 °C for 30 s, and 72 °C for 1 min, with a final 5-min extension at 72 °C. The resulting product was isolated by electrophoresis on a 1.5% TAE agarose gel and gel-purified using a Zymoclean™ Gel DNA Recovery Kit (Zymo Research). The PCR product was used as a template for nested PCR, and amplification was primed using the 3′-2-F2/RACEAP primer pair. Nested PCR was performed using the same procedure as the first 3′-RACE PCR for feline CYP1A-b. Cytochrome P450 cDNA cloning First-strand cDNA was synthesized with Superscript II (Invitrogen) and oligo-dT primers. Forward and reverse oligonucleotide primers (CYP1A-a: Ca-1Fhin and Ca-1Rhin; CYP1A-b: Ca-2Fhin and Ca-2Rhin; Table 1) to amplify feline CYP1A-a and CYP1A-b cDNA were designed based on the resulting 3′-RACE and 5′-RACE sequences. First-strand cDNA was used as a template and the amplification of feline CYP1A-a and feline CYP1A-b was primed with these primer pairs. Rat CYP1A2 cDNA was amplified using the Rat-2Fhind and Rat2Rhind primer pairs (Table 1). The PCR reaction mix contained 1× PCR buffer, 0.2 mM dNTPs, each primer at 0.3 μM, and 2.5 U of PfuUltra™ High Fidelity DNA Polymerase (Stratagene, La Jolla, CA, USA) in a final volume of 100 μl. PCR consisted of an initial 2-min denaturation at 95 °C, followed by 35 cycles at 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 90 s, with a final 10-min extension at 72 °C. The resulting PCR product was isolated by electrophoresis on a 1.5% TAE agarose gel and was gel-purified with a Zymoclean™ Gel DNA Recovery Kit (Zymo Research). Taq DNA polymerase (Promega, Madison, WI, USA) was used for A-tailing of the 3′-flanking region. DNA sequencing and analysis All PCR products were ligated into pSTBlue-1 vectors (Novagen, Madison, WI, USA) using DNA Ligation Kit ver.2 (TaKaRa BIO) according to the manufacturer's instructions, followed by transformation of competent Escherichia coli cells, DH5α. Plasmids were isolated using a Quantum Prep Plasmid bMiniN Prep Kit (BIO-RAD).

PCR products cloned into the plasmid were sequenced in both directions by primer walking, starting with modified reverse and universal primers. Cycle sequencing using dyelabeled dideoxynucleotides was performed using an ABI Prism BigDye™ Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA, USA). Cloned cDNAs were autosequenced using an ABI PRISM® 310 Genetic Analyzer (Applied Biosystems). Tissue distribution of CYP1A mRNA by RT-PCR The first-strand cDNA was used as a template, and amplification of feline CYP1A-a, feline CYP1A-b, rat CYP1A1, and rat CYP1A2 was primed using 1-F/1-R, 2-ATG-F/2-R, r1-F/r1R, and r2-F/r2-R primer pairs, respectively (Table 1). Forward and reverse oligonucleotide primers (CGA-F/CGA-R and RGA-F/RGA-R; Table 1) to amplify feline GAPDH and rat GAPDH were based on the sequences of feline GAPDH [GenBank AB038241] and rat GAPDH [Genbank AB017801]. The PCR reaction mix contained 1× PCR buffer, 0.2 mM dNTPs, each primer at 0.3 μM, and 2.6 U of Expand High Fidelity PCR System (Roche) in a final volume of 50 μl. PCR for amplification of feline CYP1A-a consisted of an initial 2min denaturation at 94 °C followed by 35 cycles at 94 °C for 15 s, 50 °C for 30 s, and 72 °C for 1 min, with a final 7-min extension at 72 °C. PCR for amplification of feline CYP1A-b, feline GAPDH, and rat CYP1A2 consisted of an initial 2-min denaturation at 94 °C followed by 35 cycles at 94 °C for 15 s, 52 °C for 30 s, and 72 °C for 1 min, with a final 7-min extension at 72 °C. PCR methods for amplification of rat CYP1A1 and rat GAPDH were the same as described above, except that annealing temperatures of 55 °C and 53 °C were used for rat CYP1A1 and GAPDH, respectively. The resulting PCR products were isolated by electrophoresis on a 1.5% TAE agarose gel. To increase the sensitivity of RT-PCR, PCR–Southern blot analysis was performed using a digoxigenin-UTP-labeled antisense feline CYP1A cRNA probe with a DIG RNA labeling kit (Roche), according to the manufacturer's instructions. Construction of expression plasmid, cultivation of recombinant Saccharomyces cerevisiae cells, and preparation of microsomal fraction Co-expression plasmids for yeast NADPH-P450 reductase and feline CYP1A-a, feline CYP1A-b, rat CYP1A1, or rat CYP1A2 were constructed (Shinkyo et al., 2003). Recombinant S. cerevisiae AH22 cells expressing feline CYP1A-a, feline CYP1A-b, rat CYP1A1, and rat CYP1A2 were cultivated in synthetic minimal medium containing 8% glucose, 5.4% yeast nitrogen base without amino acids, and 160 mg/L-histidine. Microsomal fractions were prepared from recombinant S. cerevisiae cells (Sakaki et al., 1985). Preparation of microsomes from liver Feline and rat livers were minced and homogenized with four volumes of 0.15 M KCl solution containing 1 mM EDTA. The

N. Tanaka et al. / Life Sciences 79 (2006) 2463–2473

homogenate was centrifuged for 30 min at 9000 ×g, and the supernatant fraction was centrifuged at 105,000 ×g for 60 min to obtain microsomes (Yokota et al., 1989).

2467

was confirmed as 3-hydroxy benzo[a]pyrene using authentic reagent. Theophylline metabolism assay

Measurement of reduced CO-difference spectra Reduced CO-difference spectra were measured with a Shimadzu UV-1600 spectrophotometer (Kyoto, Japan) according to the method of Omura and Sato (1964). The concentrations of CYPs were determined based on the reduced COdifference spectrum using a difference of 91 mM− 1 cm− 1 for the extinction coefficients at 448 and 490 nm (Omura and Sato, 1964). 7-Ethoxyresorufin O-deethylation (EROD) assay The EROD assay was performed in a final volume of 200 μl. A reaction mixture containing 50 mM potassium phosphate buffer (pH 7.4), 7-ethoxyresorufin (final concentration, 0.02– 8.00 μM), and yeast microsomes containing 5.00–15.0 nM cytochrome P450, was pre-incubated for 3 min at 37 °C. After pre-incubation, the reaction was initiated by addition of NADPH at a final concentration of 1 mM. The resultant enzyme reaction product supplemented with an equal volume of 100% methanol was kept on ice for 30 min and then centrifuged for 20 min at 6000 ×g. The supernatant fraction was filtered using a disposable disk filter (HPLC-DISK 3; Kanto Co., Tokyo, Japan) and analyzed using an HPLC system (FS8020, DP8020, SD8022, CO8020; Tosoh, Japan) with a Tosoh TSKgel 80TS reverse-phase column (7.8 × 30 cm). The filtered sample was injected and eluted with 20 mM potassium phosphate buffer (pH 6.6)/methanol/acetonitrile (52:45:3, v:v:v) solution. The flow rate was 0.8 ml/min. For EROD, the resorufin formed was detected by fluorescence (λex, 560 nm; λem, 585 nm) (Burke et al., 1977). The column temperature was maintained at 40 °C. Peaks on the HPLC chromatogram were confirmed as resorufin using authentic reagent. Benzo[a]pyrene-hydroxylation (AHH) assay The AHH assay was performed in a final volume of 200 μl. A reaction mixture containing 50 mM potassium phosphate buffer (pH 7.4), benzo[a]pyrene (final concentration, 0.40– 100 μM), and yeast microsomes containing 25.0−75.0 nM cytochrome P450 was pre-incubated for 3 min at 37 °C. After pre-incubation, the reaction was initiated by adding NADPH at a final concentration of 1 mM. The resultant enzyme reaction product supplemented with three volumes of 100% methanol was kept on ice for 30 min and then centrifuged for 20 min at 6000 ×g. The supernatant fraction was filtered using a disposable disk filter and was analyzed by HPLC. The filtered sample was injected and eluted with methanol/water (90:10, v:v, with 0.1% acetic acid) solution. The flow rate was 1.0 ml/min. Metabolites were detected by fluorescence (λex, 396 nm; λem, 522 nm) (Nebert and Gelboin, 1968). The column temperature was maintained at 40 °C. The peak in the HPLC chromatogram

The theophylline 8-hydroxylation and 3-demethylation assay was performed in a final volume of 200 μl. A reaction mixture containing 50 mM potassium phosphate buffer (pH 7.4), theophylline (final concentration, 0.03–25 mM), and yeast microsomes containing 100–300 nM cytochrome P450 was pre-incubated for 3 min at 37 °C. After pre-incubation, the reaction was initiated by adding NADPH at a final concentration of 1 mM. The reaction was stopped by adding 20 μl of 15% trichloroacetic acid. Following the addition of 20 μl of theobromine (10 μg/ml) as an internal standard (IS), the mixture was cooled to facilitate deproteinization, and was then centrifuged for 10 min at 10,000 ×g to obtain supernatant. For analysis of all theophylline metabolites, the reaction mixtures were solid-phase extracted according to the method of Konishi and Yamaji (1994). The Sep-Pak C18 column was conditioned with 5 ml of methanol followed by 10 ml of distilled water. A 200-μl aliquot of the sample described above was then loaded onto the column, which was rinsed with 2.5 ml of distilled water. The described portions were eluted from the column with 2 ml of 40% methanol/water (v/v). The eluent was evaporated to dryness at 37 °C under reduced pressure. The residue was reconstituted in 200 μl of mobile phase and was analyzed by HPLC. Theophylline metabolites (1-X and 1,3-DU) were determined by reverse-phase HPLC, based on the method of Konishi and Yamaji (1994), with slight modifications. The mobile phase was 3.5% v/v acetonitrile and 96.5% v/v acetic buffer (0.01 M, pH 4.1) and the flow rate was 1.0 ml/min. Metabolites, theophylline, and IS were monitored at 275 nm. The column temperature was 30 °C. Peaks on the HPLC chromatogram were confirmed as 1-X and 1,3-DU using authentic reagent. Phenacetin O-deethylation (POD) assay The POD assay was performed in a final volume of 100 μl. A reaction mixture containing 50 mM potassium phosphate buffer (pH 7.4), phenacetin (final concentration, 2.00−1000 μM), and yeast microsomes containing 100−150 nM cytochrome P450 was pre-incubated for 3 min at 37 °C. After pre-incubation, the reaction was initiated by adding NADPH at a final concentration of 1 mM. The resultant enzyme reaction product supplemented with an equal volume of 100% acetonitrile was kept on ice for 30 min and then centrifuged for 10 min at 10,000 ×g. The supernatant fraction was filtered using a disposable disk filter and was analyzed by HPLC. POD activity was measured by reverse-phase HPLC, based on the method of Kobayashi et al. (1998). The mobile phase was acetonitrile/ water (25:75, v:v) containing 0.1 M ammonium acetate at pH 4.7 and the flow rate was 0.7 ml/min. Metabolites and phenacetin were monitored at 245 nm. The column temperature was 30 °C. Peaks in the HPLC chromatogram were confirmed as acetaminophen using authentic reagent.

2468

N. Tanaka et al. / Life Sciences 79 (2006) 2463–2473

Kinetic analysis Kinetic parameters were determined according to the enzymatic activity against seven–nine concentrations of 7-ethoxyresorufin (final concentration, 0.02–8.00 μM), benzo[a]pyrene (final concentration, 0.40–100 μM), phenacetin (final concentration, 2.00–1000 μM), and theophylline (final concentration, 0.03–25 mM). The reaction products were determined by HPLC analysis using the elution buffers described above. Apparent Km values were determined using a Lineweaver-Burk plot. Immunoblot analysis Microsomal protein samples were subjected to SDSpolyacrylamide slab gel electrophoresis. Separated polypeptide bands were transferred onto a nitrocellulose membrane, and immunoreactive bands were detected using polyclonal anti-rat CYP1A1 antibody (Ohgiya et al., 1989) according to the method of Howe and Hershey (1981), with slight modifications (Yokota et al., 1989). Other methods Protein concentration was determined by the method of Lowry et al. (1951), using bovine serum albumin as a standard. NADPH-P450 reductase content was estimated from cytochrome c reduction activity, as described elsewhere (Omura and Takesue, 1970). Results Monooxygenase activities in feline liver microsomes Feline liver microsomal drug monooxygenase activities such as EROD, AHH, theophylline 3-demethylase, theophylline 8Table 2 Cytochrome P450 contents and kinetic parameters of 7-ethoxyresorufin Odeethylation, benzo[a]pyrene-hydroxylation, phenacetin O-deethylation and theophylline metabolism in microsomes from feline and rat liver Cytochrome P450 contents and parameters

Feline liver

Rat liver

Cytochrome P450 contents a 7-Ethoxyresorufin O-deethylation

0.12 ± 0.02 0.15 1.14 ± 0.21 7.41 0.41 0.09 ± 0.01 0.33 73.1 2.58 ± 0.17 0.04 2.28 0.09 ± 0.02 0.04 3.18 0.34 ± 0.04 0.11

0.62 ± 0.03 0.02 0.15 ± 0.01 7.30 5.35 0.09 ± 0.01 0.02 14.0 1.74 ± 0.13 0.12 0.94 0.07 ± 0.01 0.07 2.43 0.54 ± 0.04 0.22

Benzo[a]pyrene-hydroxylation

Phenacetin O-deethylation

Theophylline 3-demethylation

Theophylline 8-hydroxylation

Data are presented as mean ± S.E. a P450 nmol/mg protein. b nmol/min/P450 nmol.

Km (μM) Vmax b Vmax/Km Km (μM) Vmax b Vmax/Km Km (μM) Vmax b Vmax/Km Km (mM) Vmax b Vmax/Km Km (mM) Vmax b Vmax/Km

Fig. 1. Deduced amino acid sequences of feline CYP1A. Two CYP1A cDNAs were cloned by RT-PCR, as described in Materials and methods. The deduced amino acid sequences of CYP1A-a and CYP1A-b are shown in the upper and lower lines, respectively. Stars indicate the same amino acid residues in the two CYP isoforms. Substrate recognition sites (SRSs) are as described for the CYP2 family by Gotoh (1992), based on alignment with CYP101A, modified for CYP1 family alignments with rabbit CYP2C5. Six SRSs are shown in the grey boxes. The conserved heme-binding region is boxed and the cysteine residue providing the thiolate ligand for the heme iron is shown in the shaded box.

oxidase, and POD were assayed and the results are shown in Table 2. Feline liver microsomes had a large Km against phenacetin, resulting in a lower turnover rate in POD activity (Table 2). Meanwhile, a lower Km and higher turnover rate of AHH were observed in feline liver microsomes.

Table 3 CYP1A protein sequence identity (%) between species

Feline CYP1A-a Feline CYP1A-b

Feline CYP1A a

CYP1A1 Dog

Pig

Human

Rat

Mouse

– 72.5

87.4 71.4

85.1 72.0

82.0 68.6

79.7 66.3

79.1 66.9

CYP1A2

Feline CYP1A-a Feline CYP1A-b

Dog

Human

Rat

Mouse

Guinea pig

70.2 82.4

73.3 79.8

68.3 73.0

68.3 72.8

68.1 72.1

GenBank accession numbers for the sequences are AB199730 (feline CYP1A1), AB199731 (feline CYP1A2), P56590 (dog CYP1A1), P56592 (dog CYP1A2), AB052254 (pig CYP1A1), NM_000499 (human CYP1A1), NM_000761 (human CYP1A2), NM_012540 (rat CYP1A1), NM_012541 (rat CYP1A2), NM_009992 (mouse Cyp1a1), NM_009993 (mouse Cyp1a2) and D50457 (guinea pig CYP1A2).

N. Tanaka et al. / Life Sciences 79 (2006) 2463–2473

2469

Table 4 Identity (%) and similarity (%) of CYP1A subfamily substrate recognition sites Feline CYP1A substrate recognition sites

Feline CYP1A-a

Feline CYP1A-b

SRS-1 GRPNLYSFTLISEGQSMSFSPDSG SRS-2 VNLSNEF SRS-3 FKDVNEK SRS-4 KIVNVVSDLFGAGFDTVTTA SRS-5 TSFVPFTIPHS SRS-6 TPIYGLTM SRS-1 GRPNLYSFSLVTDGHSMSFSPDSG SRS-2 IHSSNIF SRS-3 FKAFNQK SRS-4 KIVSLINDIFGAGFDTVTTA SRS-5 SSFIPFTVPHS SRS-6 TPIYGLTM

Feline CYP1A-b

Rat CYP1A1

CYP1A2

CYP1A1

Human CYP1A2

62.7 (95.8)

79.1 (91.7)

75.0 (87.5)

87.5 (91.7)

66.7 (87.5)

42.9 (57.1)

100 (100)

42.9 (57.1)

71.4 (85.7)

42.9 (57.1)

57.1 (71.4)

71.4 (85.7)

42.9 (71.4)

85.7 (100)

42.9 (71.4)

75.0 (100)

70.0 (95.0)

80.0 (100)

85.0 (95.0)

85.0 (100)

72.7 (100)

90.1 (100)

100 (100)

90.1 (100)

81.8 (100)

100 (100)

75.0 (100)

87.5 (87.5)

100 (100)

100 (100)

–

66.7 (83.3)

70.8 (91.7)

70.8 (87.5)

62.5 (83.3)

–

42.9 (57.1)

42.9 (71.4)

28.6 (57.1)

14.3 (71.4)

–

57.1 (71.4)

57.1 (57.1)

57.1 (71.4)

85.7 (100)

–

60.0 (65.0)

80.0 (100)

70.0 (95.0)

90.0 (100)

–

81.8 (100)

72.7 (100)

81.8 (100)

81.8 (100)

–

75.0 (100)

87.5 (87.5)

100 (100)

100 (100)

Substrate recognition sites (SRSs) are as described for the CYP2 family by Gotoh (1992), based on alignment with CYP101A [GenBank accession number; O4PSCP], as modified for CYP1 family alignment.

cDNA cloning of feline CYP1A family members

Tissue distribution of feline CYP1A

The properties of the feline CYP1A family members mediating drug metabolism were studied by cDNA cloning. Two CYP1A cDNAs (1A-a and 1A-b) were obtained from feline liver and lung by RT-PCR, using the primers described in Materials and methods. The CYP1A-a and CYP1A-b cDNAs with 1554-bp and 1539-bp coding regions and predicted amino acid sequences of 517 and 512 residues, respectively, contained the essential heme-binding cysteine that is conserved in CYPs (Fig. 1). The amino acid sequences had 72.5% identity (Table 3). These sequences were subsequently submitted to GenBank with accession numbers AB199730 (CYP1A-a) and AB199731 (CYP1A-b), and were then compared with those of other animals (Table 3). The amino acid sequence of CYP1A-a had high identity (79.1–87.4%) with the CYP1A1 sequences of dogs, pigs, humans, and rodents, while CYP1A-b had high identity (72.1–82.4%) with animal CYP1A2. CYP1A-a had the highest identity with canine CYP1A1 (87.4%), and CYP1A-b also had the highest identity with canine CYP1A2 (82.4%). Substrate recognition sites (SRSs) for the CYP1 family were determined based on the CYP2 SRS data reported by Gotoh (1992). Amino acid sequences of the SRSs of CYP1A-a and CYP1A-b were found to be highly similar (100% for SRS-4, SRS5, and SRS-6; 95.8% for SRS-1; 71.4% for SRS-3; 57.1% for SRS2), and the SRS sequences of feline CYP1A-a and CYP1A-b were also similar to those of rat CYP1A1 and CYP1A2, respectively (Table 4), suggesting that feline CYP1A-a and CYP1A-b have similar substrate specificities to those of the corresponding CYP1A isoforms.

The tissue distribution of CYP1A mRNA in the cat was analyzed by RT-PCR using specific primer pairs for each

Fig. 2. Tissue distribution of CYP1A mRNAs in cats. Feline CYP1A-a (panel A) and CYP1A-b (panel B), and rat CYP1A1 and CYP1A2 (panel C) PCR products were amplified using cDNA prepared from liver (Li), lung (Lu), kidney (Ki), stomach (St), pancreas (Pa), and small intestine (Int). M contains 1-kbp DNA ladder markers. In panel A, RT-PCR using cDNA prepared from four feline livers was performed. RT-PCR–Southern blot analysis using a feline CYP1A cRNA probe is shown in the middle of panels A and B.

2470

N. Tanaka et al. / Life Sciences 79 (2006) 2463–2473

isoform and was detected by PCR–Southern blot analysis using a feline CYP1A cRNA probe (Fig. 2). CYP1A-a mRNA was observed in feline liver, lung, stomach, small intestine, and pancreas (Fig. 2). In contrast, CYP1A-b mRNA was observed only in feline liver, even on highly sensitive PCR–Southern blot analysis (Fig. 2).

rat CYP1A1 (Table 5). Feline CYP1A-b exhibited lower theophylline 3-demethylation and 8-hydroxylation activities compared with rat CYP1A2 (Table 5). However, the kinetic parameters of theophylline metabolism in feline liver microsomes were similar to those in rat liver (Table 2). Discussion

cDNA expression and characterization Feline CYP1A was expressed in AH22 yeast cells and the expressed proteins were detected at about 54 kDa (CYP1A-a) and 56 kDa (CYP1A-b) by immunoblot analysis using anti-rat CYP1A1 antibody (data not shown). CO-difference spectra with a maximal wavelength of about 448 nm were observed for the microsomal proteins prepared from yeast AH22 cells expressing feline CYP1A (data not shown). The kinetic parameters of EROD, AHH, POD, and theophylline metabolism were analyzed using the microsomal fractions prepared from the yeast cells, and the data are shown in Table 5. CYP1Aa had Km and Vmax values for EROD, AHH, and POD activities that were similar to those of rat CYP1A1 (Table 5). The kinetic parameters for the EROD and AHH activities of CYP1A-b were equal to those of rat CYP1A2; however, the Km for POD activity was 10-fold higher than that of rat CYP1A2. The Km for POD in rat liver microsomes was similar to that of rat CYP1A2 expressed in yeast cells (Tables 2 and 5). The Km for the POD activity of feline liver microsomes was about fivefold higher than that of rat liver microsomes, and was the same as that of CYP1A-a and CYP1A-b (Tables 2 and 5). On the theophylline metabolism assay, the 3-demethylase activity of feline CYP1Aa was fourfold higher than 8-hydroxylase activity, in contrast to Table 5 Kinetic parameters of 7-ethoxyresorufin O-deethylation, benzo[a]pyrenehydroxylation and phenacetin O-deethylation in microsomes from yeast cells expressing CYP1A isoforms Parameters

Feline

7-Ethoxyresorufin O-deethylation

Km (μM) Vmax a

Benzo[a]pyrenehydroxylation

Vmax/Km Km (μM) Vmax a

Phenacetin O-deethylation

Vmax/Km Km (μM) Vmax a

Theophylline 3-demethylation

Vmax/Km Km (mM) Vmax a

Theophylline 8-hydroxylation

Vmax/Km Km (mM) Vmax a Vmax/Km

Rat

Monooxygenase activities in feline liver microsomes The cytochrome P450 contents and several monooxygenase activities of drugs in feline liver microsomes were observed to be at the same levels as in other animals previously reported by other investigators (Watkins and Klaassen, 1986; Chauret et al., 1997). In this study, we found that the Km values of AHH and POD were significantly low and high, respectively, unlike in other animals. These characteristics of feline monooxygenases indicate that cats activate benzo[a]pyrene to toxic oxidized intermediates efficiently and have a lower rate activity of phenacetin metabolism. To elucidate the characteristic properties of cat monooxygenases, cytochrome P450 isoforms mediating these enzyme reactions were cloned and characterized. Identification of feline CYP1A1 and CYP1A2

CYP1A-a

CYP1A-b

CYP1A1 CYP1A2

0.23 24.21 ± 4.14 105.27 21.02 0.94 ± 0.06 0.04 101.3 44.50 ± 3.37 0.44 0.29 2.63 ± 0.28 9.07 0.46 0.58 ± 0.05 1.25

0.68 1.45 ± 0.25 2.14 1.78 0.05 ± 0.01 0.03 71.2 6.76 ± 0.70 0.09 0.39 0.16 ± 0.02 0.4 1.03 1.13 ± 0.10 1.10

0.40 44.84 ± 3.49 112.11 13.29 0.97 ± 0.09 0.07 142.5 36.87 ± 1.51 0.26 0.51 0.58 ± 0.02 1.13 0.61 3.53 ± 0.35 5.78

Data are presented as mean ± S.E. a nmol/min/P450 nmol.

The domestic cat is deficient in the ability to form glucuronide conjugates of certain xenobiotics, particularly low molecular weight phenolic derivatives (Hartiala, 1955; Dutton and Greig, 1957; Robinson and Williams, 1958), and is highly susceptible to toxic effects from many drugs and toxins that are normally glucuronidated following oxidation. However, data on the detailed properties and cDNAs of cytochrome P450, which is involved in phase I drug metabolism, in the domestic cat are limited. In this study, cDNAs of feline CYP1A isoforms mediating the oxidation of many drugs and bioactivation of procarcinogens were cloned and characterized.

1.35 5.91 ± 0.48 4.38 2.09 0.03 ± 0.00 0.01 7.9 6.38 ± 0.73 0.81 1.65 4.05 ± 0.48 2.45 0.76 16.38 ± 1.37 21.55

Two cDNAs encoding the CYP1A isoforms were obtained from feline liver by RT-PCR. The CYP1A-a and CYP1A-b cDNAs included 1554 bp and 1539 bp with predicted amino acid sequences of 517 residues and 512 residues, respectively, containing six substrate recognition sites (SRSs) (Gotoh, 1992) and a heme-binding cysteine (Poulos et al., 1987). The amino acid sequences of CYP1A-a and CYP1A-b shared more than 72% identity with those of CYP1A1 and CYP1A2, respectively, obtained from other animals (Table 3). The tissue distribution of CYP1A-a and CYP1A-b mRNAs agrees with that in the rat; CYP1A1 mRNA is expressed in the liver and extrahepatic tissues, while CYP1A2 mRNA is expressed mainly in the liver (Kimura et al., 1986; Omiecinski et al., 1990) (Fig. 2). The kinetic parameters of CYP1A-a and CYP1A-b were found to be similar to those of the CYP1A1 and CYP1A2 of rats, respectively, with regard to EROD and AHH activities (Table 5), as previously reported for human EROD (Masimirembwa et al., 1999). These results indicate that CYP1A-a may be regarded as CYP1A1 and CYP1A-b as CYP1A2 in cats.

N. Tanaka et al. / Life Sciences 79 (2006) 2463–2473

2471

Fig. 3. Metabolic pathways of phenacetin. Phenacetin is mainly oxidized to acetaminophen by CYP1A2 and is then conjugated with glucuronic acid and sulfate in humans and rats. Phenacetin is also metabolized to toxic intermediates, such as p-phenetidin and 2-hydroxyphenacetin, and acetaminophen is metabolized to N-acetylp-benzoquinone-imine (NAPQI). It is thought to be oxidized slowly due to feline CYP1A2 having a low affinity for phenacetin, suggesting that toxic intermediates tend to be produced in cats.

Characterization of feline CYP1A1 and CYP1A2 Theophylline is extensively metabolized to 1,3-DU, 1-X, and 3-methylxanthine by CYP1A1 and CYP1A2. Feline CYP1A1 can catalyze theophylline 3-demethylation and 8-oxidation; however, the Vmax for 3-demethylation is higher than that for 8oxidation, in contrast to rat CYP1A1 (Table 5). The theophylline 3-demethylation and 8-oxidation activities of feline CYP1A2 were much lower than those of rat CYP1A2 (Table 5), while the 3-demethylation activity of feline CYP1A2 was 10fold lower than that of feline CYP1A1 (Table 5). Human CYP1A2 has been reported to catalyze all demethylations and 8-oxidation of theophylline, and to be associated with the highest intrinsic clearance, particularly regarding the formation of the major metabolite 1,3-DU (Ha et al., 1995; Zhang and Kaminsky, 1995). Rat CYP1A2 is also highly active in theophylline metabolism (Table 5). The kinetic parameters of theophylline metabolism in feline liver microsomes were similar to those of rat liver microsomes (Table 2). These data indicate that feline CYP1A1, which is constitutively expressed, may contribute to theophylline 3-demethylation in the liver, and suggest that in feline liver, 8-oxidation of theophylline is mediated by other CYP isoforms, such as CYP2E1, CYP2D6, and CYP3A4, as is the case in humans (Ha et al., 1995; Zhang and Kaminsky, 1995). CYP1A2 was found to be the only isoform with a lower Km for POD activity in human liver microsomes (Venkatakrishnan et al., 1998). Japanese monkeys possess another enzyme with a lower Km than CYP1A2 (Narimatsu et al., 2005), which has a similarly high Km as in cats. In this study, higher Km

values for phenacetin were found in feline liver microsomes (Table 2) and feline CYP1A2 (Table 5), suggesting that phenacetin is metabolized slowly in feline liver. The Km of feline liver microsomes for benzo[a]pyrene was 10-fold lower than that of rats (Table 4) (Wiersma and Roth, 1983); however, the Km values for feline CYP1A1 and CYP1A2 were found to be higher, similar to those of rat CYP1A1 and CYP1A2, respectively (Table 5), suggesting that benzo[a]pyrene is oxidized effectively by other CYP isoforms in domestic cats. Domestic cats are deficient in UDP-glucuronosyltransferase (UGT) isoforms such as UGT1A6, which catalyze the glucuronidation of many xenobiotics (Court and Greenblatt, 2000; Mackenzie et al., 1993; Hu and Wells, 1992, 1994; Zheng et al., 2001, 2002). These results suggest that domestic cats are highly sensitive to drug toxicity. As shown in Fig. 3, phenacetin is known to be metabolized to acetaminophen by O-deethylation, catalyzed by CYP1A2, and the metabolite is further metabolized to intermediates in humans and rats (Hinson, 1983; Veronese et al., 1985), with hepatotoxicity and nephrotoxicity (Eyanagi et al., 1985). There is no evidence regarding this, but it is possible to produce toxic metabolites in feline liver as in other animals. Acetaminophen is conjugated with glucuronic acid, sulfate, and glutathione. Peters et al. indicated that intermediate toxicity is reduced by efficient CYP1A2 O-deethylation of phenacetin to produce acetaminophen (Peters et al., 1999). It is known that domestic cats are deficient in acetaminophen glucuronidation (Court and Greenblatt, 1997a,b, 2000), which is the main pathway of phenacetin excretion in animals. CYP2E1 oxidizes acetaminophen primarily to the reactive

2472

N. Tanaka et al. / Life Sciences 79 (2006) 2463–2473

metabolite N-acetyl-p-benzoquinone-imine (NAPQI) (Patten et al., 1993; Chen et al., 1998). No evidence that cats can produce NAPQI has been reported, but we recently demonstrated the expression of CYP2E1 and CYP2E2 at normal levels (Tanaka et al., 2005). These results suggest that the toxic effects of phenacetin metabolites are prolonged and severe in domestic cats due to both glucuronidation deficiency and the catalytic properties of CYP1A2. Conclusion Cats tend to produce activated benzo[a]pyrene metabolites by CYP1A1, which has a low Km for benzo[a]pyrene hydroxylase, and to produce toxic byproducts with CYP1A2, which has a high Km for POD. High sensitivity to drug toxicity in cats is due not only to deficiency in glucuronidation but also to the kinetic properties of the phase I drug-metabolizing enzymes CYP1A1 and CYP1A2. These results show the significance of kinetic characterization of CYP isoforms in the determination of drug sensitivity in humans and animals. Acknowledgement This work was supported in part by Grants-in-Aid from the Ministry of Education, Science, Sports and Culture of Japan. References Burke, M.D., Mayer, R.T., Kouri, R.E., 1977. 3-methylcholanthrene-induced monooxygenase (O-deethylation) activity of human lymphocytes. Cancer Research 37, 460–463. Butler, M.A., Iwasaki, M., Guengerich, F.P., Kadlubar, F.F., 1989. Human cytochrome P-450PA (P-450IA2), the phenacetin O-deethylase, is primarily responsible for the hepatic 3-demethylation of caffeine and N-oxidation of carcinogenic arylamines. Proceedings of the National Academy of Sciences of the United States of America 86, 7696–7700. Capel, I.D., French, M.R., Millburn, P., Smith, R.L., Williams, R.T., 1972. The fate of (14C)phenol in various species. Xenobiotica 2, 25–34. Capel, I.D., Millburn, P., Williams, R.T., 1974. The conjugation of 1- and 2naphthols and other phenols in the cat and pig. Xenobiotica 4, 601–615. Chauret, N., Gauthier, A., Martin, J., Nicoll-Griffith, D.A., 1997. In vitro comparison of cytochrome P450-mediated metabolic activities in human, dog, cat, and horse. Drug Metabolism and Disposition 25, 1130–1136. Chen, W., Koenigs, L.L., Thompson, S.J., Peter, R.M., Rettie, A.E., Trager, W.F., Nelson, S.D., 1998. Oxidation of acetaminophen to its toxic quinone imine and nontoxic catechol metabolites by baculovirus-expressed and purified human cytochromes P450 2E1 and 2A6. Chemical Research in Toxicology 11, 295–301. Court, M.H., Greenblatt, D.J., 1997a. Biochemical basis for deficient paracetamol glucuronidation in cats: an interspecies comparison of enzyme constraint in liver microsomes. Journal of Pharmacy and Pharmacology 49, 446–449. Court, M.H., Greenblatt, D.J., 1997b. Molecular basis for deficient acetaminophen glucuronidation in cats. An interspecies comparison of enzyme kinetics in liver microsomes. Biochemical Pharmacology 53, 1041–1047. Court, M.H., Greenblatt, D.J., 2000. Molecular genetic basis for deficient acetaminophen glucuronidation by cats: UGT1A6 is a pseudogene, and evidence for reduced diversity of expressed hepatic UGT1A isoforms. Pharmacogenetics 10, 355–369. Court, M.H., Von Moltke, L.L., Shader, R.I., Greenblatt, D.J., 1997. Biotransformation of chlorzoxazone by hepatic microsomes from humans

and ten other mammalian species. Biopharmaceutics & Drug Disposition 18, 213–226. Dutton, G.J., Greig, C.G., 1957. Observations on the distribution of glucuronide synthesis in tissues. Biochemical Journal 66, 52p–53p. Eberhart, D.C., Gemzik, B., Halvorson, M.R., Parkinson, A., 1991. Species differences in the toxicity and cytochrome P450 IIIA-dependent metabolism of digitoxin. Molecular Pharmacology 40, 859–867. Eyanagi, R., Shigematsu, H., Yoshida, K., Yoshimura, H., 1985. Metabolism and nephrotoxicity of phenacetin and sulfanilamide. Journal of Pharmacobio-Dynamics 8, 95–105. Frohman, M.A., Dush, M.K., Martin, G.R., 1988. Rapid production of fulllength cDNAs from rare transcripts: amplification using a single genespecific oligonucleotide primer. Proceedings of the National Academy of Sciences of the United States of America 85, 8998–9002. Gotoh, O., 1992. Substrate recognition sites in cytochrome P450 family 2 (CYP2) proteins inferred from comparative analyses of amino acid and coding nucleotide sequences. Journal of Biological Chemistry 267, 83–90. Ha, H.R., Chen, J., Freiburghaus, A.U., Follath, F., 1995. Metabolism of theophylline by cDNA-expressed human cytochromes P-450. British Journal of Clinical Pharmacology 39, 321–326. Hartiala, K.J., 1955. Studies on detoxication mechanisms. III. Glucuronide synthesis of various organs with special reference to the detoxifying capacity of the mucous membrane of the alimentary canal. Annales Medicinae Experimentalis et Biologiae Fenniae 33, 239–245. Hinson, J.A., 1983. Reactive metabolites of phenacetin and acetaminophen: a review. Environmental Health Perspectives 49, 71–79. Howe, J.G., Hershey, J.W., 1981. A sensitive immunoblotting method for measuring protein synthesis initiation factor levels in lysates of Escherichia coli. Journal of Biological Chemistry 256, 12836–12839. Hu, Z., Wells, P.G., 1992. In vitro and in vivo biotransformation and covalent binding of benzo(a)pyrene in Gunn and RHA rats with a genetic deficiency in bilirubin uridine diphosphate-glucuronosyltransferase. Journal of Pharmacology and Experimental Therapeutics 263, 334–342. Hu, Z., Wells, P.G., 1994. Modulation of benzo(a)pyrene bioactivation by glucuronidation in lymphocytes and hepatic microsomes from rats with a hereditary deficiency in bilirubin UDP-glucuronosyltransferase. Toxicology and Applied Pharmacology 127, 306–313. Ioannides, C., Parke, D.V., 1990. The cytochrome P450 I gene family of microsomal hemoproteins and their role in the metabolic activation of chemicals. Drug Metabolism Reviews 22, 1–85. Kimura, S., Gonzalez, F.J., Nebert, D.W., 1986. Tissue-specific expression of the mouse dioxin-inducible P(1)450 and P(3)450 genes: differential transcriptional activation and mRNA stability in liver and extrahepatic tissues. Molecular and Cellular Biology 6, 1471–1477. Kobayashi, K., Nakajima, M., Chiba, K., Yamamoto, T., Tani, M., Ishizaki, T., Kuroiwa, Y., 1998. Inhibitory effects of antiarrhythmic drugs on phenacetin O-deethylation catalysed by human CYP1A2. British Journal of Clinical Pharmacology 45, 361–368. Konishi, H., Yamaji, A., 1994. Measurement of theophylline metabolites produced by reaction with hepatic microsome by high performance liquid chromatography following solid phase extraction. Biomedical Chromatography 8, 189–192. Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein measurement with the Folin phenol reagent. Journal of Biological Chemistry 193, 265–275. Mackenzie, P.I., Rodbourn, L., Iyanagi, T., 1993. Glucuronidation of carcinogen metabolites by complementary DNA-expressed uridine 5′-diphosphate glucuronosyltransferases. Cancer Research 53, 1529–1533. Masimirembwa, C.M., Otter, C., Berg, M., Jonsson, M., Leidvik, B., Jonsson, E., Johansson, T., Backman, A., Edlund, A., Andersson, T.B., 1999. Heterologous expression and kinetic characterization of human cytochromes P-450: validation of a pharmaceutical tool for drug metabolism research. Drug Metabolism and Disposition 27, 1117–1122. Narimatsu, S., Oda, M., Hichiya, H., Isobe, T., Asaoka, K., Hanioka, N., Yamano, S., Shinoda, S., Yamamoto, S., 2005. Molecular cloning and functional analysis of cytochrome P450 1A2 from Japanese monkey liver: comparison with marmoset cytochrome P450 1A2. Chemico-Biological Interactions 152, 1–12.

N. Tanaka et al. / Life Sciences 79 (2006) 2463–2473 Nebert, D.W., Gelboin, H.V., 1968. Substrate-inducible microsomal aryl hydroxylase in mammalian cell culture. I. Assay and properties of induced enzyme. Journal of Biological Chemistry 243, 6242–6249. Nelson, D.R., Koymans, L., Kamataki, T., Stegeman, J.J., Feyereisen, R., Waxman, D.J., Waterman, M.R., Gotoh, O., Coon, M.J., Estabrook, R.W., Gunsalus, I.C., Nebert, D.W., 1996. P450 superfamily: update on new sequences, gene mapping, accession numbers and nomenclature. Pharmacogenetics 6, 1–42. Ohgiya, N., Yokota, H., Yuasa, A., 1989. Purification and properties of cytochrome P-450 generally acting as a catalyst on benzo[a]pyrene hydroxylation from liver microsomes of untreated rats. Journal of Biochemistry 105, 234–238. Omiecinski, C.J., Redlich, C.A., Costa, P., 1990. Induction and developmental expression of cytochrome P450IA1 messenger RNA in rat and human tissues: detection by the polymerase chain reaction. Cancer Research 50, 4315–4321. Omura, T., Sato, R., 1964. The carbon monoxide-binding pigment of liver microsomes. I. Evidence for its hemoprotein nature. Journal of Biological Chemistry 239, 2370–2378. Omura, T., Takesue, S., 1970. A new method for simultaneous purification of cytochrome b5 and NADPH-cytochrome c reductase from rat liver microsomes. Journal of Biochemistry 67, 249–257. Patten, C.J., Thomas, P.E., Guy, R.L., Lee, M., Gonzalez, F.J., Guengerich, F.P., Yang, C.S., 1993. Cytochrome P450 enzymes involved in acetaminophen activation by rat and human liver microsomes and their kinetics. Chemical Research in Toxicology 6, 511–518. Pearce, R., Greenway, D., Parkinson, A., 1992. Species differences and interindividual variation in liver microsomal cytochrome P450 2A enzymes: effects on coumarin, dicumarol, and testosterone oxidation. Archives of Biochemistry and Biophysics 298, 211–225. Peters, J.M., Morishima, H., Ward, J.M., Coakley, C.J., Kimura, S., Gonzalez, F.J., 1999. Role of CYP1A2 in the toxicity of long-term phenacetin feeding in mice. Toxicological Sciences 50, 82–89. Poulos, T.L., Finzel, B.C., Howard, A.J., 1987. High-resolution crystal structure of cytochrome P450cam. Journal of Molecular Biology 195, 687–700. Robinson, D., Williams, R.T., 1958. Do cats form glucuronides? Biochemical Journal 66, 23p–24p. Sakaki, T., Oeda, K., Miyoshi, M., Ohkawa, H., 1998. Characterization of rat cytochrome P-450MC synthesized in Saccharomyces cerevisiae. Journal of Biochemistry 167–175. Sarkar, M.A., Hunt, C., Guzelian, P.S., Karnes, H.T., 1992. Characterization of human liver cytochromes P-450 involved in theophylline metabolism. Drug Metabolism and Disposition 20, 31–37.

2473

Sesardic, D., Boobis, A.R., Edwards, R.J., Davies, D.S., 1988. A form of cytochrome P450 in man, orthologous to form d in the rat, catalyses the Odeethylation of phenacetin and is inducible by cigarette smoking. British Journal of Clinical Pharmacology 26, 363–372. Shinkyo, R., Sakaki, T., Takita, T., Ohta, M., Inouye, K., 2003. Generation of 2,3,7,8-TCDD-metabolizing enzyme by modifying rat CYP1A1 through site-directed mutagenesis. Biochemical and Biophysical Research Communications 308, 511–517. Tanaka, N., Shinkyo, R., Sakaki, T., Kasamastu, M., Imaoka, S., Funae, Y., Yokota, H., 2005. Cytochrome P450 2E polymorphism in feline liver. Biochimica et Biophysica Acta 1726, 194–205. Venkatakrishnan, K., von Moltke, L.L., Greenblatt, D.J., 1998. Human cytochromes P450 mediating phenacetin O-deethylation in vitro: validation of the high affinity component as an index of CYP1A2 activity. Journal of Pharmaceutical Sciences 87, 1502–1507. Veronese, M.E., McLean, S., D'Souza, C.A., Davies, N.W., 1985. Formation of reactive metabolites of phenacetin in humans and rats. Xenobiotica 15, 929–940. Watkins III, J.B., Klaassen, C.D., 1986. Xenobiotic biotransformation in livestock: comparison to other species commonly used in toxicity testing. Journal of Animal Science 63, 933–942. Wiersma, D.A., Roth, R.A., 1983. The prediction of benzo[a]pyrene clearance by rat liver and lung from enzyme kinetic data. Molecular Pharmacology 24, 300–308. Yokota, H., Ohgiya, N., Ishihara, G., Ohta, K., Yuasa, A., 1989. Purification and properties of UDP-glucuronyltransferase from kidney microsomes of betanaphthoflavone-treated rat. Journal of Biochemistry 106, 248–252. Zhang, Z.Y., Kaminsky, L.S., 1995. Characterization of human cytochromes P450 involved in theophylline 8-hydroxylation. Biochemical Pharmacology 50, 205–211. Zhang, Z., Fasco, M.J., Huang, Z., Guengerich, F.P., Kaminsky, L.S., 1995. Human cytochromes P4501A1 and P4501A2: R-warfarin metabolism as a probe. Drug Metabolism and Disposition 23, 1339–1346. Zheng, Z., Park, J.Y., Guillemette, C., Schantz, S.P., Lazarus, P., 2001. Tobacco carcinogen-detoxifying enzyme UGT1A7 and its association with orolaryngeal cancer risk. Journal of the National Cancer Institute 93, 1411–1418. Zheng, Z., Fang, J.L., Lazarus, P., 2002. Glucuronidation: an important mechanism for detoxification of benzo[a]pyrene metabolites in aerodigestive tract tissues. Drug Metabolism and Disposition 30, 397–403.