- Email: [email protected]
Cell-free protein synthesis system from Escherichia coli cells cultured at decreased temperatures improves productivity by decreasing DNA template degradation
Analytical Biochemistry 377 (2008) 156–161
Contents lists available at ScienceDirect
Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio
Cell-free protein synthesis system from Escherichia coli cells cultured at decreased temperatures improves productivity by decreasing DNA template degradation Eiko Seki a,b,1, Natsuko Matsuda a,1, Shigeyuki Yokoyama a,c,*, Takanori Kigawa a,b,* a
Systems and Structural Biology Center, RIKEN Yokohama Institute, Tsurumi-ku, Yokohama 230-0045, Japan Department of Computational Intelligence and Systems Science, Interdisciplinary Graduate School of Science and Engineering, Tokyo Institute of Technology, Midori-ku, Yokohama 226-8502, Japan c Department of Biophysics and Biochemistry, Graduate School of Science, The University of Tokyo, Bunkyo-ku, Tokyo 113-0033, Japan b
a r t i c l e
i n f o
Article history: Received 28 November 2007 Available online 7 March 2008 Keywords: Cell-free protein synthesis PCR Nuclease RecBCD
a b s t r a c t Cell-free protein synthesis has become one of the standard methods for protein expression. One of the major advantages of this method is that PCR-amplified linear DNA fragments can be directly used as templates for protein synthesis. The productivity of cell-free protein synthesis using linear DNA templates is generally lower than that from plasmid DNA templates, especially when using an Escherichia coli cell extract. In the present study, we found that a simple modification of the protocol for cell extract preparation from E. coli, just by altering the cultivation temperature (37 °C) of the cells to a moderately lower range (20–34 °C), dramatically reduced the linear DNA degradation activity in the cell extract. This modification greatly improved the productivity of cell-free protein synthesis from linear DNA templates. The removal of the RecD protein, one of the components of exonuclease V, from the extract had almost the same effect, indicating that the linear DNA degradation activity in the extract was mainly due to the RecD protein and that its expression level was decreased at the lower cultivation temperature. Ó 2008 Elsevier Inc. All rights reserved.
Cell-free protein synthesis is a powerful protein production method with several advantages over the conventional recombinant protein production methods. We have been improving the cell-free system using an Escherichia coli cell extract [1–3], and succeeded in producing about 7 mg protein using a 1-ml reaction mixture, when plasmid DNA was used as the template [4]. We currently use the cell-free system for the production of various kinds of proteins [5], such as metal-binding proteins [6], stable-isotope-labeled proteins for NMR analysis [5], and seleno-methionine-substituted proteins for X-ray crystallography [7]. One of the major advantages of the cell-free system is that PCRamplified linear DNA fragments can be directly used as templates for protein synthesis, freeing us from the time-consuming cloning and fermentation steps [5,8–12]. However, the lifetime of linear DNA in the conventional E. coli cell extracts is relatively short due to the DNase activity in the extract [13,14]. Therefore, the productivity of the E. coli cell-free systems using linear DNA is generally lower than those using plasmid DNA. Several approaches have * Corresponding authors. Address: Systems and Structural Biology Center, Yokohama Institute, RIKEN 1-7-22 Suehiro, Tsurumi, Yokohama, 230-0045, Japan. Fax: +81 45 503 9195 (S. Yokoyama), +81 45 503 9643 (T. Kigawa). E-mail addresses: [email protected] (S. Yokoyama), kigawa@ jota.gsc.riken.jp (T. Kigawa). 1 These authors contributed equally to this work. 0003-2697/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.ab.2008.03.001
been developed for prolonging the lifetime of linear DNA. One is the preparation of a cell extract with lower DNase activity from a strain with a mutated nuclease gene. For example, a recB temperature-sensitive strain [8], a recD-deleted strain, and a strain in which the recBCD operon was replaced with the lambda phage Red recombination system [9] have been reported. By using these mutant strains, the lifetime of linear DNA in the cell-free system was improved, although these strains generally exhibit defects in cell growth [15] or translational activity [10]. Inhibiting the exonuclease activity in the cell extract is another approach. The addition of bacteriophage lambda Gam protein, which is a specific inhibitor of the RecBCD protein, prolonged the lifetime of the linear DNA in the extract and thus improved the productivity of the cell-free synthesis [16]. Another approach is increasing the resistance of linear DNA to degradation. A linear DNA fragment designed to self-circularize, by the endogenous ligase activity in the cell extract, achieved much longer stability [12]. Prolonging the lifetime of the mRNA also improves the productivity of the E. coli cell-free synthesis using linear DNA. By preparing an extract from an rne 131 mutant strain, such as the BL21 Star strain (Invitrogen), which has low RNase E activity, the productivity using linear DNA templates was increased [10,11]. The addition of poly(G) [10] or T7T [17] sequences at the 30 end of the mRNA reduced its 30 exonucleolytic degradation.
Productive cell-free protein synthesis using a PCR product / E. Seki et al. / Anal. Biochem. 377 (2008) 156–161
Most of these approaches are complicated, to some extent. In the present study, we found that a simple modification of the E. coli cell extract preparation, by altering the cultivation temperature (37 °C) of the E. coli cells to a moderately lower range (20– 34 °C), dramatically reduced the exonuclease activity in the extract and thus improved the productivity of cell-free synthesis using linear DNA as a template. Materials and methods E. coli strains The BL21 strain (Novagen) was used for the preparation of the standard cell extract and as the host for introducing mutations. The BL21 Star (DE3) strain (Invitrogen) was used as an RNase Emutant (rne 131). The BL21-RecD-SBP2 strain, in which the recD gene on the chromosome has an additional sequence for a streptavidin binding tag (SBP-tag) [18], encoding GGSGGSGGSGMDEKT TGWRGGHVVEGLAGELEQLRARLEHHPQGQREPDHH at its 30 terminus, was constructed from BL21 according to the Red/ET recombination method [19], as follows. A PCR fragment cassette with the sequence 50 -ctcgtactgagcggcgcagtggtctggcggcgttgtttagttcacgggaagg cggtagcggcggttcaggcggttctggtATGGATGAAAAAACGACTGGTTGGCGT GGTGGTCATGTTGTTGAAGGTCTGGCCGGTGAACTGGAGCAACTGCGT GCCCGTTTAGAACACCATCCGCAGGGTCAGCGTGAACCGGACCATCACta ataattgatacgtaattgtcgggatgcgacgcacgagtgttacgcatgtcgcatccgcg-30 (the homology arms [19] are shown in lowercase, the linker sequence is underlined, the SBP-tag sequence is in capitals, and the tandem stop codons are in boldface) was transformed into BL21, and the transformants were selected on LB medium with 7–15% sucrose. Preparation of the cell extract The E. coli cell extract for the cell-free protein synthesis (S30 extract) was prepared from the above-mentioned strains according to our standard protocol [1], except that different cultivation temperatures were used, as described in the text (20, 23, 26, 30, 32, 34, and 37 °C). The accuracy of the cultivation temperature is critical in this experiment, so the incubators were adjusted to the correct temperatures with a calibrated thermometer prior to the experiments. In some experiments, the S30 extract was additionally treated with Streptavidin Sepharose High Performance (SA-SHP) resin (GE Healthcare Biosciences), as follows: 1 ml of the S30 extract was mixed with 200 ll of SA-SHP resin, equilibrated with 10 mM Tris-acetate buffer (pH 8.2) containing 14 mM Mg(OAc)2 and 60 mM KOAc, and the mixture was incubated at 4 °C for 1 h with continuous rotation. The S30 extract was then centrifuged at 10,000g for 10 min, and the resultant supernatant was used as the treated S30 extract. Templates for cell-free protein synthesis A mutant green fluorescent protein (GFP), bearing the mutations F46L, S65T, F99S, M153T, V163A, and Y200C, was generated by introducing the mutations (F46L, S65T, and Y200C) into GFPuv (Clontech) to enhance the brightness and the maturation speed of GFP [20], and the resultant protein was named GFPS1. 2 Abbreviations used: GFP, green fluorescent protein; GFPS1, a mutant GFP (F46L, S65T, F99S, M153T, V163A, and Y200C); CAT, chloramphenicol acetyltransferase; FLDNA, fluorescently labeled PCR-amplified DNA; FL-mRNA, fluorescently labeled mRNA; SBP-tag, streptavidin binding tag; RecD-SBP, SBP-tagged RecD protein; S30Lt, S30 extract from Escherichia coli cultured at temperatures lower than 37 °C; S30T37, S30 extract from E. coli cultured at 37 °C; S30T30, S30 extract from E. coli cultured at 30 °C.
157
The DNA encoding GFPS1 was connected by PCR to a T7 promoter site and a ribosome-binding site at the 50 end and a T7 terminator site at the 30 end, and the resultant DNA product was subcloned into pCR2.1-TOPO (Invitrogen) to generate the pGFPS1 plasmid. For chloramphenicol acetyltransferase (CAT) synthesis, the pk7-CAT plasmid [21] was used. All of the linear DNA templates were amplified by PCR and used without purification. All of the mRNAs used were synthesized with a MEGAscript T7 kit (Ambion). Cell-free protein synthesis The composition of the coupled transcription–translation cellfree reaction was previously described [1,4]. For mRNA-directed protein synthesis, the batch-mode method was carried out at 30 °C for 2 h. For DNA-directed synthesis, the dialysis-mode method [22] using the small-scale dialysis unit [6] was carried out at 30 °C for 8 or 16 h. The CAT productivity was calculated as previously described [1]. After dilution in phosphate-buffered-saline (PBS), the fluorescence of GFPS1 was measured using an ARVO (Victor2 V Multilabel Counter; PerkinElmer) or an EnVision (PerkinElmer) fluorescence plate reader, with excitation at 485 nm and emission at 507 nm. Linear DNA degradation activity assay The linear DNA degradation activity in the S30 extract was measured using fluorescently labeled, PCR-amplified DNA (FL-DNA), prepared by a PCR with the Fluorescein Labeling Mix Kit (Roche), which incorporated Fluorescein-dUTP into the PCR product. In the final volume of 20 ll, the incubation buffer (58 mM Hepes– KOH buffer (pH 7.5) containing 10 mM ATP and 9.28 mM Mg(OAc)2), including the FL-DNA (600 ng) was mixed with 6 ll of the S30 extract. Incubations were carried out at 30 °C for 30 min. Reaction mixtures were treated with a GFX PCR DNA and Gel Band Purification Kit (GE Healthcare Biosciences) to remove the degraded DNA fragments smaller than 50 bp. After dilution in TE buffer, the amount of longer FL-DNA remaining was measured with the ARVO or the EnVision fluorescence plate reader, with excitation at 485 nm and emission at 507 nm. RNase activity assay The RNase activity in the S30 extract was measured using fluorescently labeled mRNA (FL-mRNA), prepared using the MEGAscript T7 kit with ChromaTide Alexa Fluor 546-14-UTP (Molecular Probes), which incorporated fluorophore-labeled UTP into the transcribed mRNA. The incorporation efficiency of the labeled UTP was almost the same as that of the mixed proportion of Alexa Fluor 546-14-UTP to nonlabeled UTP (data not shown). The batch-mode of cell-free protein synthesis, using the FL-mRNA as the template, was carried out at 30 °C for 30 min. The remaining long FL-mRNA was purified with an RNeasy MinElute Cleanup Kit (Qiagen), separated by gel electrophoresis, and detected with an LAS-3000 imaging system (FUJIFILM). Results and discussion Improved cell-free protein synthesis from linear DNA templates using S30 extracts prepared from E. coli cells cultured at moderately lower temperatures In the case of the dialysis-mode cell-free system, using the S30 extract prepared from E. coli BL21 cells cultured at 37 °C (S30T37), linear DNA-directed synthesis was less productive than plasmiddirected synthesis for the CAT protein (Fig. 1). When using the extracts prepared from BL21 cells cultured at lower temperatures
158
Productive cell-free protein synthesis using a PCR product / E. Seki et al. / Anal. Biochem. 377 (2008) 156–161
A
100
7
90
6 Remaining FL-DNA (%)
80
CAT (mg/ml)
5 4 3 2
70 60 50 40 30 20
1
10
0
0
18
20
22
24
26
28
30
32
34
36
38
Cultivation temperature (°C)
B Cultivation temperature (°C)
20
23
26
30
32
18
20
22
24
26
28
30
32
34
36
38
Cultivation temperature (°C) 34
37
Plasmid DNA Template
Linear DNA Template
Fig. 1. Cell-free protein syntheses using the S30 extracts from E. coli cells cultured at different temperatures. The dialysis-mode reactions were carried out at 30 °C for 16 h. Productivity (A) and SDS–PAGE analysis (B) of CAT protein synthesis, using plasmid DNA templates (filled circles in A, and noted in B) or linear DNA templates (open squares in A, and noted in B).
Fig. 2. Linear DNA degradation activity assay of the S30 extracts from E. coli cells cultured at different temperatures. The remaining FL-DNA is indicated as the % of the initial amount of FL-DNA.
stable plasmid and the linear DNA-directed syntheses decrease with temperature. This correlation between the linear DNA degradation activity and the protein productivity was also observed during the time course measurement of linear DNA-directed cell-free protein synthesis with S30T30 and S30T37 (Fig. 3). In the cell-free protein synthesis with S30T30, the linear DNA template was more stable and the protein synthesis continued longer than in the reaction with S30T37. mRNA degradation in the S30 extract
(20, 23, 26, 30, 32, and 34 °C) than 37 °C (S30LTs), the linear DNAdirected syntheses of CAT protein were significantly improved. In particular, with the S30 extract prepared from cells cultured at 30 °C (S30T30), the productivity of linear DNA-directed synthesis was improved more than three-fold over that by S30T37, which was about 70% of the optimal plasmid-directed synthesis with S30T37 (Fig. 1). This phenomenon was also observed with other E. coli strains, such as the A19 strain (data not shown), indicating that this result is not specific to the BL21 strain. Linear DNA degradation in the S30 extract Although FL-DNA contains a bulky fluorescein unit, the productivity of the cell-free synthesis using FL-DNA as the template was similar to that using the nonlabeled PCR product, and the degradation profiles of the FL-DNA during the cell-free reaction, detected by both agarose gel electrophoresis and Southern hybridization analysis, were almost the same as those of the nonlabeled PCR product (data not shown). These results indicated that the linear DNA degradation activity could be investigated by simply measuring the fluorescence of intact FL-DNA. The linear DNA degradation activity in the S30 extract was reduced as the cultivation temperature of the cells was lowered (Fig. 2), suggesting the strong correlation between the linear DNA degradation activity and the decreased productivity of linear DNA-directed synthesis at temperatures higher than 30 °C (Fig. 1). In Fig. 1, at cultivation temperatures higher than 30 °C, transcription activity seems to be the limiting factor because plasmid DNA-directed protein synthesis increases, whereas linear DNA-directed protein synthesis decreases. In contrast, the translational activity seems to be the limiting factor in the protein synthesis at cultivation temperatures lower than 30 °C because both the
The productivity of the cell-free synthesis using FL-mRNA was slightly lower than that using nonlabeled mRNA; however, the degradation profiles of the FL-mRNA during the cell-free reaction, detected by both agarose gel electrophoresis and Northern hybridization analysis, were almost the same as those of the nonlabeled mRNA (data not shown). Therefore, the RNase activity in the S30 extract was investigated by monitoring the degradation of FLmRNA during the cell-free synthesis reaction. The RNase activities in S30T37 and S30T30 were almost the same and were higher than those in the S30 extracts prepared from the the E. coli BL21 Star (DE3) cells, an RNase E-mutant (rne 131) strain with reduced mRNA degradation, cultured at both 30 and 37 °C (Fig. 4A). mRNA-directed cell-free protein synthesis The productivity of the mRNA-directed batch-mode of cell-free protein synthesis of GFPS1 using S30T37 was almost the same as that using S30T30 and was lower than those using the S30 extracts of the BL21 Star (DE3) strain cultured at both 30 and 37 °C (Fig. 4B). The productivity of mRNA-directed synthesis was strongly correlated with the RNase activity (Fig. 4A), suggesting that the translation activity did not significantly differ between S30T37 and S30T30. These results indicated that the improved productivity of linear DNA-directed cell-free syntheses using S30LTs is mainly due to the lower linear DNA degradation activity, rather than the lower RNase or translation activity in S30TLs than in S30T37. Variant BL21 strain harboring SBP-tagged RecD The heteromeric RecBCD enzyme, a component of exonuclease V, plays a major role in DNA degradation in E. coli cell extracts
159
Productive cell-free protein synthesis using a PCR product / E. Seki et al. / Anal. Biochem. 377 (2008) 156–161
A
10
120
Turbidity (OD600)
Remaining FL-DNA (%)
100
80
60
40
1
0.1
20 0.01
0 0
2
4
6
8
10
12
14
16
0
18
2
4
Incubation time (hr)
B
6
8
10
Cultivation Time (hr) Fig. 5. Growth curves of the BL21-RecD-SBP (open symbols) and BL21 (filled symbols) strains cultured at 30 °C (squares) and 37 °C (circles), respectively.
8
6 5 4 3 2 1 0 6
8
10
12
14
16
18
Incubation time (hr) Fig. 3. Time course analyses of linear DNA degradation (A) and linear DNA-directed cell-free protein syntheses of GFPS1 (B), using S30T30s (open squares) and S30T37s (filled circles). The dialysis-mode reactions were carried out at 30 °C.
A
B
16
8
14 GFP Fluorescence (x 103 )
12 10 8 6 4
7 6 5 4 3 2
0
BL21
S30T37
0 S30T30
1
S30T37
2
S30T30
Remaining FL-mRNA (%)
9
BL21Star
BL21
S30T37
4
S30T30
2
S30T37
0
[8,9,13]. We constructed a BL21 variant strain, named BL21-RecDSBP, by inserting an SBP-tag sequence at the 30 terminus of the recD ORF sequence in the chromosome. The BL21-RecD-SBP strain grew identically to the wild-type BL21 strain at both 30 and 37 °C (Fig. 5). The S30 extracts prepared from the BL21 and BL21RecD-SBP strains share similar linear DNA degradation activities (Fig. 6A) and linear DNA-directed cell-free protein synthesis productivities (Fig. 6B). We tried to investigate the expression level of the SBP-tagged RecD protein (RecD-SBP) in the S30 extract prepared from the BL21-RecD-SBP strain by a Western blot analysis, but failed to detect the RecD-SBP due to the high protein background and low expression level of the RecD protein in the E. coli cells (up to 10 copies per cell [23]). To confirm that the RecD-SBP was expressed in the untreated extract, we detected the RecDSBP protein bound to SA-SHP affinity resin after treatment with the RecD-SBP S30 extract (data not shown).
S30T30
GFP Fluorescence (x 103)
7
BL21Star
Fig. 4. RNase activities of the S30T30s and S30T37s from the BL21 and BL21 Star (DE3) strains (A) and mRNA-directed cell-free protein synthesis of GFPS1 (n = 9) using these extracts (B). The remaining FL-mRNA is indicated as the % of the initial amount of FL-mRNA in (A).
160
Remainig FL-DNA (%)
A
Productive cell-free protein synthesis using a PCR product / E. Seki et al. / Anal. Biochem. 377 (2008) 156–161
90
Table 1 Reproducibility of the S30 extract preparations
80
Average CAT synthesis (mg/ml)
70
Plasmid
Linear
Plasmid
Linear
5.4
4.1
9.0
10.5
Coefficient of variation (%)
60 50 40 30 20 10 0 BL21
RecD-SBP
BL21
B
25
GFP Fluorescence (x 103)
S30T30
20
RecD-SBP
S30T37
15
10
was investigated by preparing seven independent batches of S30T30. The averages of the CAT protein productivity from the plasmid DNA and the linear DNA template, in the dialysis-mode of cell-free protein syntheses, were 5.4 and 4.1 mg/ml, respectively, and their coefficients of variation were 9.0 and 10.5, respectively (Table 1). This indicates that our new extract preparation protocol presented in this study, in which the E. coli cells were cultured at moderately lower temperatures (20–34 °C) than 37 °C, generates a highly productive cell extract with excellent reproducibility. Among the several approaches for linear DNA-directed cell-free synthesis using an E. coli cell extract, our approach achieves the best productivity and employs the simplest protocol [9,11]. With our approach, we have performed many of our cell-free synthesis applications using linear DNA templates. The high-throughput protein expression systems, such as fully automated protein production starting from template DNA preparation using PCR to small-scale cell-free synthesis, and large-scale protein preparation of several mg from PCR-amplified linear DNA (M. Aoki et al., unpublished), are now routinely used. Acknowledgments
5
0 BL21
RecD-SBP
BL21
S30T30
RecD-SBP
S30T37
Fig. 6. Linear DNA degradation activities of the S30 extracts from the BL21 and BL21-RecD-SBP strains (A) and linear DNA-directed cell-free protein synthesis of GFPS1 using these extracts (B). The dialysis-mode reactions were carried out at 30 °C for 16 h. The remaining FL-DNA (n = 3) is indicated as the % of the initial amount of FL-DNA in (A). The SA-SHP-treated S30s (open bars) or nontreated S30s (filled bars) were used.
Removal of the RecD protein from the S30 extract The S30 extracts prepared from the BL21 and BL21-RecD-SBP strains were treated with SA-SHP affinity resin. As a result, dramatic improvements in both the lifetime of the linear DNA (Fig. 6A) and the productivity of linear DNA-directed cell-free protein synthesis (Fig. 6B) were observed for the extract prepared from BL21-RecD-SBP cells cultured at 37 °C. These results indicate that, first, the major linear DNA degradation activity in the S30 extract prepared from cells cultured at 37 °C is due to the RecD protein of exonuclease V, and, second, the primary reason for the higher productivity of the linear DNA-directed cell-free protein synthesis using S30Lts is the low expression level of the RecD protein. Because RecD is an essential subunit of exonuclease V [24] and its helicase activity is higher than that of RecB [25], the predominance of RecD function in linear DNA degradation in the S30 extract is convincing. Reproducibility of the S30 extract preparation The preparation of the cell extract is a crucial step in achieving a highly productive and reproducible workflow using cell-free protein synthesis. The reproducibility of our cell extract preparations
The authors thank Takashi Yabuki, Takayoshi Matsuda, and Satoru Watanabe for helpful discussions. This work was supported by the RIKEN Structural Genomics/Proteomics Initiative and the National Project on Protein Structural and Functional Analyses, Ministry of Education, Culture, Sports, Science and Technology of Japan. References [1] T. Kigawa, T. Yabuki, N. Matsuda, T. Matsuda, R. Nakajima, A. Tanaka, S. Yokoyama, Preparation of Escherichia coli cell extract for highly productive cell-free protein expression, J. Struct. Funct. Genomics 5 (2004) 63–68. [2] N. Chumpolkulwong, K. Sakamoto, A. Hayashi, F. Iraha, N. Shinya, N. Matsuda, D. Kiga, A. Urushibata, M. Shirouzu, K. Oki, T. Kigawa, S. Yokoyama, Translation of ‘rare’ codons in a cell-free protein synthesis system from Escherichia coli, J. Struct. Funct. Genomics 7 (2006) 31–36. [3] T. Kigawa, T. Yabuki, Y. Yoshida, M. Tsutsui, Y. Ito, T. Shibata, S. Yokoyama, Cellfree production and stable-isotope labeling of milligram quantities of proteins, FEBS Lett. 442 (1999) 15–19. [4] T. Matsuda, S. Koshiba, N. Tochio, E. Seki, N. Iwasaki, T. Yabuki, M. Inoue, S. Yokoyama, T. Kigawa, Improving cell-free protein synthesis for stable-isotope labeling, J. Biomol. NMR 37 (2007) 225–229. [5] S. Yokoyama, Protein expression systems for structural genomics and proteomics, Curr. Opin. Chem. Biol. 7 (2003) 39–43. [6] T. Matsuda, T. Kigawa, S. Koshiba, M. Inoue, M. Aoki, K. Yamasaki, M. Seki, K. Shinozaki, S. Yokoyama, Cell-free synthesis of zinc-binding proteins, J. Struct. Funct. Genomics 7 (2006) 93–100. [7] T. Kigawa, E. Yamaguchi-Nunokawa, K. Kodama, T. Matsuda, T. Yabuki, N. Matsuda, R. Ishitani, O. Nureki, S. Yokoyama, Selenomethionine incorporation into a protein by cell-free synthesis, J. Struct. Funct. Genomics 2 (2002) 29–35. [8] M. Jackson, J. Pratt, I. Holland, Enhanced polypeptide synthesis programmed by linear DNA fragments in cell-free extracts lacking exonuclease V, FEBS Lett. 163 (1983) 221–224. [9] N. Michel-Reydellet, K. Woodrow, J. Swartz, Increasing PCR fragment stability and protein yields in a cell-free system with genetically modified Escherichia coli extracts, J. Mol. Microbiol. Biotechnol. 9 (2005) 26–34. [10] J. Ahn, H. Chu, T. Kim, I. Oh, C. Choi, G. Hahn, C. Park, D. Kim, Cell-free synthesis of recombinant proteins from PCR-amplified genes at a comparable productivity to that of plasmid-based reactions, Biochem. Biophys. Res. Commun. 338 (2005) 1346–1352. [11] G. Hahn, D. Kim, Production of milligram quantities of recombinant proteins from PCR-amplified DNAs in a continuous-exchange cell-free protein synthesis system, Anal. Biochem. 355 (2006) 151–153.
Productive cell-free protein synthesis using a PCR product / E. Seki et al. / Anal. Biochem. 377 (2008) 156–161 [12] P. Wu, K. Ozawa, S. Lim, S. Vasudevan, N. Dixon, G. Otting, Cell-Free Transcription/Translation from PCR-Amplified DNA for High-Throughput NMR Studies, Angew. Chem. Int. Ed. Engl. 46 (18) (2007) 3356–3358. [13] H. Yang, L. Ivashkiv, H. Chen, G. Zubay, M. Cashel, Cell-free coupled transcription-translation system for investigation of linear DNA segments, Proc. Natl. Acad. Sci. USA 77 (1980) 7029–7033. [14] J. Pratt, G. Boulnois, V. Darby, E. Orr, E. Wahle, I. Holland, Identification of gene products programmed by restriction endonuclease DNA fragments using an E. coli in vitro system, Nucleic Acids Res. 9 (1981) 4459–4474. [15] D. Yu, H. Ellis, E. Lee, N. Jenkins, N. Copeland, D. Court, An efficient recombination system for chromosome engineering in Escherichia coli, Proc. Natl. Acad. Sci. USA 97 (2000) 5978–5983. [16] K. Sitaraman, D. Esposito, G. Klarmann, S. Le Grice, J. Hartley, D. Chatterjee, A novel cell-free protein synthesis system, J. Biotechnol. 110 (2004) 257–263. [17] K. Lee, S. Cohen, Effects of 30 terminus modifications on mRNA functional decay during in vitro protein synthesis, J. Biol. Chem. 276 (2001) 23268–23274. [18] A. Keefe, D. Wilson, B. Seelig, J. Szostak, One-step purification of recombinant proteins using a nanomolar-affinity streptavidin-binding peptide, the SBP-Tag, Protein Expr. Purif. 23 (2001) 440–446.
161
[19] J. Muyrers, Y. Zhang, V. Benes, G. Testa, W. Ansorge, A. Stewart, Point mutation of bacterial artificial chromosomes by ET recombination, EMBO Rep. 1 (2000) 239–243. [20] M. Zimmer, Green fluorescent protein (GFP): applications, structure, and related photophysical behavior, Chem. Rev. 102 (2002) 759–781. [21] D. Kim, T. Kigawa, C. Choi, S. Yokoyama, A highly efficient cell-free protein synthesis system from Escherichia coli, Eur. J. Biochem. 239 (1996) 881– 886. [22] A. Spirin, V. Baranov, L. Ryabova, S. Ovodov, Y. Alakhov, A continuous cell-free translation system capable of producing polypeptides in high yield, Science 242 (1988) 1162–1164. [23] D.A. Arnold, S.C. Kowalczykowski, RecBCD helicase/nuclease, ENCYCLOPAEDIA OF LIFE SCIENCES. John Wiley & Sons, Ltd., Chichester, (1999), http:// www.els.net/. [24] S. Amundsen, A. Taylor, A. Chaudhury, G. Smith, recD: the gene for an essential third subunit of exonuclease V, Proc. Natl. Acad. Sci. USA 83 (1986) 5558– 5562. [25] A. Taylor, G. Smith, RecBCD enzyme is a DNA helicase with fast and slow motors of opposite polarity, Nature 423 (2003) 889–893.
Contents lists available at ScienceDirect
Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio
Cell-free protein synthesis system from Escherichia coli cells cultured at decreased temperatures improves productivity by decreasing DNA template degradation Eiko Seki a,b,1, Natsuko Matsuda a,1, Shigeyuki Yokoyama a,c,*, Takanori Kigawa a,b,* a
Systems and Structural Biology Center, RIKEN Yokohama Institute, Tsurumi-ku, Yokohama 230-0045, Japan Department of Computational Intelligence and Systems Science, Interdisciplinary Graduate School of Science and Engineering, Tokyo Institute of Technology, Midori-ku, Yokohama 226-8502, Japan c Department of Biophysics and Biochemistry, Graduate School of Science, The University of Tokyo, Bunkyo-ku, Tokyo 113-0033, Japan b
a r t i c l e
i n f o
Article history: Received 28 November 2007 Available online 7 March 2008 Keywords: Cell-free protein synthesis PCR Nuclease RecBCD
a b s t r a c t Cell-free protein synthesis has become one of the standard methods for protein expression. One of the major advantages of this method is that PCR-amplified linear DNA fragments can be directly used as templates for protein synthesis. The productivity of cell-free protein synthesis using linear DNA templates is generally lower than that from plasmid DNA templates, especially when using an Escherichia coli cell extract. In the present study, we found that a simple modification of the protocol for cell extract preparation from E. coli, just by altering the cultivation temperature (37 °C) of the cells to a moderately lower range (20–34 °C), dramatically reduced the linear DNA degradation activity in the cell extract. This modification greatly improved the productivity of cell-free protein synthesis from linear DNA templates. The removal of the RecD protein, one of the components of exonuclease V, from the extract had almost the same effect, indicating that the linear DNA degradation activity in the extract was mainly due to the RecD protein and that its expression level was decreased at the lower cultivation temperature. Ó 2008 Elsevier Inc. All rights reserved.
Cell-free protein synthesis is a powerful protein production method with several advantages over the conventional recombinant protein production methods. We have been improving the cell-free system using an Escherichia coli cell extract [1–3], and succeeded in producing about 7 mg protein using a 1-ml reaction mixture, when plasmid DNA was used as the template [4]. We currently use the cell-free system for the production of various kinds of proteins [5], such as metal-binding proteins [6], stable-isotope-labeled proteins for NMR analysis [5], and seleno-methionine-substituted proteins for X-ray crystallography [7]. One of the major advantages of the cell-free system is that PCRamplified linear DNA fragments can be directly used as templates for protein synthesis, freeing us from the time-consuming cloning and fermentation steps [5,8–12]. However, the lifetime of linear DNA in the conventional E. coli cell extracts is relatively short due to the DNase activity in the extract [13,14]. Therefore, the productivity of the E. coli cell-free systems using linear DNA is generally lower than those using plasmid DNA. Several approaches have * Corresponding authors. Address: Systems and Structural Biology Center, Yokohama Institute, RIKEN 1-7-22 Suehiro, Tsurumi, Yokohama, 230-0045, Japan. Fax: +81 45 503 9195 (S. Yokoyama), +81 45 503 9643 (T. Kigawa). E-mail addresses: [email protected] (S. Yokoyama), kigawa@ jota.gsc.riken.jp (T. Kigawa). 1 These authors contributed equally to this work. 0003-2697/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.ab.2008.03.001
been developed for prolonging the lifetime of linear DNA. One is the preparation of a cell extract with lower DNase activity from a strain with a mutated nuclease gene. For example, a recB temperature-sensitive strain [8], a recD-deleted strain, and a strain in which the recBCD operon was replaced with the lambda phage Red recombination system [9] have been reported. By using these mutant strains, the lifetime of linear DNA in the cell-free system was improved, although these strains generally exhibit defects in cell growth [15] or translational activity [10]. Inhibiting the exonuclease activity in the cell extract is another approach. The addition of bacteriophage lambda Gam protein, which is a specific inhibitor of the RecBCD protein, prolonged the lifetime of the linear DNA in the extract and thus improved the productivity of the cell-free synthesis [16]. Another approach is increasing the resistance of linear DNA to degradation. A linear DNA fragment designed to self-circularize, by the endogenous ligase activity in the cell extract, achieved much longer stability [12]. Prolonging the lifetime of the mRNA also improves the productivity of the E. coli cell-free synthesis using linear DNA. By preparing an extract from an rne 131 mutant strain, such as the BL21 Star strain (Invitrogen), which has low RNase E activity, the productivity using linear DNA templates was increased [10,11]. The addition of poly(G) [10] or T7T [17] sequences at the 30 end of the mRNA reduced its 30 exonucleolytic degradation.
Productive cell-free protein synthesis using a PCR product / E. Seki et al. / Anal. Biochem. 377 (2008) 156–161
Most of these approaches are complicated, to some extent. In the present study, we found that a simple modification of the E. coli cell extract preparation, by altering the cultivation temperature (37 °C) of the E. coli cells to a moderately lower range (20– 34 °C), dramatically reduced the exonuclease activity in the extract and thus improved the productivity of cell-free synthesis using linear DNA as a template. Materials and methods E. coli strains The BL21 strain (Novagen) was used for the preparation of the standard cell extract and as the host for introducing mutations. The BL21 Star (DE3) strain (Invitrogen) was used as an RNase Emutant (rne 131). The BL21-RecD-SBP2 strain, in which the recD gene on the chromosome has an additional sequence for a streptavidin binding tag (SBP-tag) [18], encoding GGSGGSGGSGMDEKT TGWRGGHVVEGLAGELEQLRARLEHHPQGQREPDHH at its 30 terminus, was constructed from BL21 according to the Red/ET recombination method [19], as follows. A PCR fragment cassette with the sequence 50 -ctcgtactgagcggcgcagtggtctggcggcgttgtttagttcacgggaagg cggtagcggcggttcaggcggttctggtATGGATGAAAAAACGACTGGTTGGCGT GGTGGTCATGTTGTTGAAGGTCTGGCCGGTGAACTGGAGCAACTGCGT GCCCGTTTAGAACACCATCCGCAGGGTCAGCGTGAACCGGACCATCACta ataattgatacgtaattgtcgggatgcgacgcacgagtgttacgcatgtcgcatccgcg-30 (the homology arms [19] are shown in lowercase, the linker sequence is underlined, the SBP-tag sequence is in capitals, and the tandem stop codons are in boldface) was transformed into BL21, and the transformants were selected on LB medium with 7–15% sucrose. Preparation of the cell extract The E. coli cell extract for the cell-free protein synthesis (S30 extract) was prepared from the above-mentioned strains according to our standard protocol [1], except that different cultivation temperatures were used, as described in the text (20, 23, 26, 30, 32, 34, and 37 °C). The accuracy of the cultivation temperature is critical in this experiment, so the incubators were adjusted to the correct temperatures with a calibrated thermometer prior to the experiments. In some experiments, the S30 extract was additionally treated with Streptavidin Sepharose High Performance (SA-SHP) resin (GE Healthcare Biosciences), as follows: 1 ml of the S30 extract was mixed with 200 ll of SA-SHP resin, equilibrated with 10 mM Tris-acetate buffer (pH 8.2) containing 14 mM Mg(OAc)2 and 60 mM KOAc, and the mixture was incubated at 4 °C for 1 h with continuous rotation. The S30 extract was then centrifuged at 10,000g for 10 min, and the resultant supernatant was used as the treated S30 extract. Templates for cell-free protein synthesis A mutant green fluorescent protein (GFP), bearing the mutations F46L, S65T, F99S, M153T, V163A, and Y200C, was generated by introducing the mutations (F46L, S65T, and Y200C) into GFPuv (Clontech) to enhance the brightness and the maturation speed of GFP [20], and the resultant protein was named GFPS1. 2 Abbreviations used: GFP, green fluorescent protein; GFPS1, a mutant GFP (F46L, S65T, F99S, M153T, V163A, and Y200C); CAT, chloramphenicol acetyltransferase; FLDNA, fluorescently labeled PCR-amplified DNA; FL-mRNA, fluorescently labeled mRNA; SBP-tag, streptavidin binding tag; RecD-SBP, SBP-tagged RecD protein; S30Lt, S30 extract from Escherichia coli cultured at temperatures lower than 37 °C; S30T37, S30 extract from E. coli cultured at 37 °C; S30T30, S30 extract from E. coli cultured at 30 °C.
157
The DNA encoding GFPS1 was connected by PCR to a T7 promoter site and a ribosome-binding site at the 50 end and a T7 terminator site at the 30 end, and the resultant DNA product was subcloned into pCR2.1-TOPO (Invitrogen) to generate the pGFPS1 plasmid. For chloramphenicol acetyltransferase (CAT) synthesis, the pk7-CAT plasmid [21] was used. All of the linear DNA templates were amplified by PCR and used without purification. All of the mRNAs used were synthesized with a MEGAscript T7 kit (Ambion). Cell-free protein synthesis The composition of the coupled transcription–translation cellfree reaction was previously described [1,4]. For mRNA-directed protein synthesis, the batch-mode method was carried out at 30 °C for 2 h. For DNA-directed synthesis, the dialysis-mode method [22] using the small-scale dialysis unit [6] was carried out at 30 °C for 8 or 16 h. The CAT productivity was calculated as previously described [1]. After dilution in phosphate-buffered-saline (PBS), the fluorescence of GFPS1 was measured using an ARVO (Victor2 V Multilabel Counter; PerkinElmer) or an EnVision (PerkinElmer) fluorescence plate reader, with excitation at 485 nm and emission at 507 nm. Linear DNA degradation activity assay The linear DNA degradation activity in the S30 extract was measured using fluorescently labeled, PCR-amplified DNA (FL-DNA), prepared by a PCR with the Fluorescein Labeling Mix Kit (Roche), which incorporated Fluorescein-dUTP into the PCR product. In the final volume of 20 ll, the incubation buffer (58 mM Hepes– KOH buffer (pH 7.5) containing 10 mM ATP and 9.28 mM Mg(OAc)2), including the FL-DNA (600 ng) was mixed with 6 ll of the S30 extract. Incubations were carried out at 30 °C for 30 min. Reaction mixtures were treated with a GFX PCR DNA and Gel Band Purification Kit (GE Healthcare Biosciences) to remove the degraded DNA fragments smaller than 50 bp. After dilution in TE buffer, the amount of longer FL-DNA remaining was measured with the ARVO or the EnVision fluorescence plate reader, with excitation at 485 nm and emission at 507 nm. RNase activity assay The RNase activity in the S30 extract was measured using fluorescently labeled mRNA (FL-mRNA), prepared using the MEGAscript T7 kit with ChromaTide Alexa Fluor 546-14-UTP (Molecular Probes), which incorporated fluorophore-labeled UTP into the transcribed mRNA. The incorporation efficiency of the labeled UTP was almost the same as that of the mixed proportion of Alexa Fluor 546-14-UTP to nonlabeled UTP (data not shown). The batch-mode of cell-free protein synthesis, using the FL-mRNA as the template, was carried out at 30 °C for 30 min. The remaining long FL-mRNA was purified with an RNeasy MinElute Cleanup Kit (Qiagen), separated by gel electrophoresis, and detected with an LAS-3000 imaging system (FUJIFILM). Results and discussion Improved cell-free protein synthesis from linear DNA templates using S30 extracts prepared from E. coli cells cultured at moderately lower temperatures In the case of the dialysis-mode cell-free system, using the S30 extract prepared from E. coli BL21 cells cultured at 37 °C (S30T37), linear DNA-directed synthesis was less productive than plasmiddirected synthesis for the CAT protein (Fig. 1). When using the extracts prepared from BL21 cells cultured at lower temperatures
158
Productive cell-free protein synthesis using a PCR product / E. Seki et al. / Anal. Biochem. 377 (2008) 156–161
A
100
7
90
6 Remaining FL-DNA (%)
80
CAT (mg/ml)
5 4 3 2
70 60 50 40 30 20
1
10
0
0
18
20
22
24
26
28
30
32
34
36
38
Cultivation temperature (°C)
B Cultivation temperature (°C)
20
23
26
30
32
18
20
22
24
26
28
30
32
34
36
38
Cultivation temperature (°C) 34
37
Plasmid DNA Template
Linear DNA Template
Fig. 1. Cell-free protein syntheses using the S30 extracts from E. coli cells cultured at different temperatures. The dialysis-mode reactions were carried out at 30 °C for 16 h. Productivity (A) and SDS–PAGE analysis (B) of CAT protein synthesis, using plasmid DNA templates (filled circles in A, and noted in B) or linear DNA templates (open squares in A, and noted in B).
Fig. 2. Linear DNA degradation activity assay of the S30 extracts from E. coli cells cultured at different temperatures. The remaining FL-DNA is indicated as the % of the initial amount of FL-DNA.
stable plasmid and the linear DNA-directed syntheses decrease with temperature. This correlation between the linear DNA degradation activity and the protein productivity was also observed during the time course measurement of linear DNA-directed cell-free protein synthesis with S30T30 and S30T37 (Fig. 3). In the cell-free protein synthesis with S30T30, the linear DNA template was more stable and the protein synthesis continued longer than in the reaction with S30T37. mRNA degradation in the S30 extract
(20, 23, 26, 30, 32, and 34 °C) than 37 °C (S30LTs), the linear DNAdirected syntheses of CAT protein were significantly improved. In particular, with the S30 extract prepared from cells cultured at 30 °C (S30T30), the productivity of linear DNA-directed synthesis was improved more than three-fold over that by S30T37, which was about 70% of the optimal plasmid-directed synthesis with S30T37 (Fig. 1). This phenomenon was also observed with other E. coli strains, such as the A19 strain (data not shown), indicating that this result is not specific to the BL21 strain. Linear DNA degradation in the S30 extract Although FL-DNA contains a bulky fluorescein unit, the productivity of the cell-free synthesis using FL-DNA as the template was similar to that using the nonlabeled PCR product, and the degradation profiles of the FL-DNA during the cell-free reaction, detected by both agarose gel electrophoresis and Southern hybridization analysis, were almost the same as those of the nonlabeled PCR product (data not shown). These results indicated that the linear DNA degradation activity could be investigated by simply measuring the fluorescence of intact FL-DNA. The linear DNA degradation activity in the S30 extract was reduced as the cultivation temperature of the cells was lowered (Fig. 2), suggesting the strong correlation between the linear DNA degradation activity and the decreased productivity of linear DNA-directed synthesis at temperatures higher than 30 °C (Fig. 1). In Fig. 1, at cultivation temperatures higher than 30 °C, transcription activity seems to be the limiting factor because plasmid DNA-directed protein synthesis increases, whereas linear DNA-directed protein synthesis decreases. In contrast, the translational activity seems to be the limiting factor in the protein synthesis at cultivation temperatures lower than 30 °C because both the
The productivity of the cell-free synthesis using FL-mRNA was slightly lower than that using nonlabeled mRNA; however, the degradation profiles of the FL-mRNA during the cell-free reaction, detected by both agarose gel electrophoresis and Northern hybridization analysis, were almost the same as those of the nonlabeled mRNA (data not shown). Therefore, the RNase activity in the S30 extract was investigated by monitoring the degradation of FLmRNA during the cell-free synthesis reaction. The RNase activities in S30T37 and S30T30 were almost the same and were higher than those in the S30 extracts prepared from the the E. coli BL21 Star (DE3) cells, an RNase E-mutant (rne 131) strain with reduced mRNA degradation, cultured at both 30 and 37 °C (Fig. 4A). mRNA-directed cell-free protein synthesis The productivity of the mRNA-directed batch-mode of cell-free protein synthesis of GFPS1 using S30T37 was almost the same as that using S30T30 and was lower than those using the S30 extracts of the BL21 Star (DE3) strain cultured at both 30 and 37 °C (Fig. 4B). The productivity of mRNA-directed synthesis was strongly correlated with the RNase activity (Fig. 4A), suggesting that the translation activity did not significantly differ between S30T37 and S30T30. These results indicated that the improved productivity of linear DNA-directed cell-free syntheses using S30LTs is mainly due to the lower linear DNA degradation activity, rather than the lower RNase or translation activity in S30TLs than in S30T37. Variant BL21 strain harboring SBP-tagged RecD The heteromeric RecBCD enzyme, a component of exonuclease V, plays a major role in DNA degradation in E. coli cell extracts
159
Productive cell-free protein synthesis using a PCR product / E. Seki et al. / Anal. Biochem. 377 (2008) 156–161
A
10
120
Turbidity (OD600)
Remaining FL-DNA (%)
100
80
60
40
1
0.1
20 0.01
0 0
2
4
6
8
10
12
14
16
0
18
2
4
Incubation time (hr)
B
6
8
10
Cultivation Time (hr) Fig. 5. Growth curves of the BL21-RecD-SBP (open symbols) and BL21 (filled symbols) strains cultured at 30 °C (squares) and 37 °C (circles), respectively.
8
6 5 4 3 2 1 0 6
8
10
12
14
16
18
Incubation time (hr) Fig. 3. Time course analyses of linear DNA degradation (A) and linear DNA-directed cell-free protein syntheses of GFPS1 (B), using S30T30s (open squares) and S30T37s (filled circles). The dialysis-mode reactions were carried out at 30 °C.
A
B
16
8
14 GFP Fluorescence (x 103 )
12 10 8 6 4
7 6 5 4 3 2
0
BL21
S30T37
0 S30T30
1
S30T37
2
S30T30
Remaining FL-mRNA (%)
9
BL21Star
BL21
S30T37
4
S30T30
2
S30T37
0
[8,9,13]. We constructed a BL21 variant strain, named BL21-RecDSBP, by inserting an SBP-tag sequence at the 30 terminus of the recD ORF sequence in the chromosome. The BL21-RecD-SBP strain grew identically to the wild-type BL21 strain at both 30 and 37 °C (Fig. 5). The S30 extracts prepared from the BL21 and BL21RecD-SBP strains share similar linear DNA degradation activities (Fig. 6A) and linear DNA-directed cell-free protein synthesis productivities (Fig. 6B). We tried to investigate the expression level of the SBP-tagged RecD protein (RecD-SBP) in the S30 extract prepared from the BL21-RecD-SBP strain by a Western blot analysis, but failed to detect the RecD-SBP due to the high protein background and low expression level of the RecD protein in the E. coli cells (up to 10 copies per cell [23]). To confirm that the RecD-SBP was expressed in the untreated extract, we detected the RecDSBP protein bound to SA-SHP affinity resin after treatment with the RecD-SBP S30 extract (data not shown).
S30T30
GFP Fluorescence (x 103)
7
BL21Star
Fig. 4. RNase activities of the S30T30s and S30T37s from the BL21 and BL21 Star (DE3) strains (A) and mRNA-directed cell-free protein synthesis of GFPS1 (n = 9) using these extracts (B). The remaining FL-mRNA is indicated as the % of the initial amount of FL-mRNA in (A).
160
Remainig FL-DNA (%)
A
Productive cell-free protein synthesis using a PCR product / E. Seki et al. / Anal. Biochem. 377 (2008) 156–161
90
Table 1 Reproducibility of the S30 extract preparations
80
Average CAT synthesis (mg/ml)
70
Plasmid
Linear
Plasmid
Linear
5.4
4.1
9.0
10.5
Coefficient of variation (%)
60 50 40 30 20 10 0 BL21
RecD-SBP
BL21
B
25
GFP Fluorescence (x 103)
S30T30
20
RecD-SBP
S30T37
15
10
was investigated by preparing seven independent batches of S30T30. The averages of the CAT protein productivity from the plasmid DNA and the linear DNA template, in the dialysis-mode of cell-free protein syntheses, were 5.4 and 4.1 mg/ml, respectively, and their coefficients of variation were 9.0 and 10.5, respectively (Table 1). This indicates that our new extract preparation protocol presented in this study, in which the E. coli cells were cultured at moderately lower temperatures (20–34 °C) than 37 °C, generates a highly productive cell extract with excellent reproducibility. Among the several approaches for linear DNA-directed cell-free synthesis using an E. coli cell extract, our approach achieves the best productivity and employs the simplest protocol [9,11]. With our approach, we have performed many of our cell-free synthesis applications using linear DNA templates. The high-throughput protein expression systems, such as fully automated protein production starting from template DNA preparation using PCR to small-scale cell-free synthesis, and large-scale protein preparation of several mg from PCR-amplified linear DNA (M. Aoki et al., unpublished), are now routinely used. Acknowledgments
5
0 BL21
RecD-SBP
BL21
S30T30
RecD-SBP
S30T37
Fig. 6. Linear DNA degradation activities of the S30 extracts from the BL21 and BL21-RecD-SBP strains (A) and linear DNA-directed cell-free protein synthesis of GFPS1 using these extracts (B). The dialysis-mode reactions were carried out at 30 °C for 16 h. The remaining FL-DNA (n = 3) is indicated as the % of the initial amount of FL-DNA in (A). The SA-SHP-treated S30s (open bars) or nontreated S30s (filled bars) were used.
Removal of the RecD protein from the S30 extract The S30 extracts prepared from the BL21 and BL21-RecD-SBP strains were treated with SA-SHP affinity resin. As a result, dramatic improvements in both the lifetime of the linear DNA (Fig. 6A) and the productivity of linear DNA-directed cell-free protein synthesis (Fig. 6B) were observed for the extract prepared from BL21-RecD-SBP cells cultured at 37 °C. These results indicate that, first, the major linear DNA degradation activity in the S30 extract prepared from cells cultured at 37 °C is due to the RecD protein of exonuclease V, and, second, the primary reason for the higher productivity of the linear DNA-directed cell-free protein synthesis using S30Lts is the low expression level of the RecD protein. Because RecD is an essential subunit of exonuclease V [24] and its helicase activity is higher than that of RecB [25], the predominance of RecD function in linear DNA degradation in the S30 extract is convincing. Reproducibility of the S30 extract preparation The preparation of the cell extract is a crucial step in achieving a highly productive and reproducible workflow using cell-free protein synthesis. The reproducibility of our cell extract preparations
The authors thank Takashi Yabuki, Takayoshi Matsuda, and Satoru Watanabe for helpful discussions. This work was supported by the RIKEN Structural Genomics/Proteomics Initiative and the National Project on Protein Structural and Functional Analyses, Ministry of Education, Culture, Sports, Science and Technology of Japan. References [1] T. Kigawa, T. Yabuki, N. Matsuda, T. Matsuda, R. Nakajima, A. Tanaka, S. Yokoyama, Preparation of Escherichia coli cell extract for highly productive cell-free protein expression, J. Struct. Funct. Genomics 5 (2004) 63–68. [2] N. Chumpolkulwong, K. Sakamoto, A. Hayashi, F. Iraha, N. Shinya, N. Matsuda, D. Kiga, A. Urushibata, M. Shirouzu, K. Oki, T. Kigawa, S. Yokoyama, Translation of ‘rare’ codons in a cell-free protein synthesis system from Escherichia coli, J. Struct. Funct. Genomics 7 (2006) 31–36. [3] T. Kigawa, T. Yabuki, Y. Yoshida, M. Tsutsui, Y. Ito, T. Shibata, S. Yokoyama, Cellfree production and stable-isotope labeling of milligram quantities of proteins, FEBS Lett. 442 (1999) 15–19. [4] T. Matsuda, S. Koshiba, N. Tochio, E. Seki, N. Iwasaki, T. Yabuki, M. Inoue, S. Yokoyama, T. Kigawa, Improving cell-free protein synthesis for stable-isotope labeling, J. Biomol. NMR 37 (2007) 225–229. [5] S. Yokoyama, Protein expression systems for structural genomics and proteomics, Curr. Opin. Chem. Biol. 7 (2003) 39–43. [6] T. Matsuda, T. Kigawa, S. Koshiba, M. Inoue, M. Aoki, K. Yamasaki, M. Seki, K. Shinozaki, S. Yokoyama, Cell-free synthesis of zinc-binding proteins, J. Struct. Funct. Genomics 7 (2006) 93–100. [7] T. Kigawa, E. Yamaguchi-Nunokawa, K. Kodama, T. Matsuda, T. Yabuki, N. Matsuda, R. Ishitani, O. Nureki, S. Yokoyama, Selenomethionine incorporation into a protein by cell-free synthesis, J. Struct. Funct. Genomics 2 (2002) 29–35. [8] M. Jackson, J. Pratt, I. Holland, Enhanced polypeptide synthesis programmed by linear DNA fragments in cell-free extracts lacking exonuclease V, FEBS Lett. 163 (1983) 221–224. [9] N. Michel-Reydellet, K. Woodrow, J. Swartz, Increasing PCR fragment stability and protein yields in a cell-free system with genetically modified Escherichia coli extracts, J. Mol. Microbiol. Biotechnol. 9 (2005) 26–34. [10] J. Ahn, H. Chu, T. Kim, I. Oh, C. Choi, G. Hahn, C. Park, D. Kim, Cell-free synthesis of recombinant proteins from PCR-amplified genes at a comparable productivity to that of plasmid-based reactions, Biochem. Biophys. Res. Commun. 338 (2005) 1346–1352. [11] G. Hahn, D. Kim, Production of milligram quantities of recombinant proteins from PCR-amplified DNAs in a continuous-exchange cell-free protein synthesis system, Anal. Biochem. 355 (2006) 151–153.
Productive cell-free protein synthesis using a PCR product / E. Seki et al. / Anal. Biochem. 377 (2008) 156–161 [12] P. Wu, K. Ozawa, S. Lim, S. Vasudevan, N. Dixon, G. Otting, Cell-Free Transcription/Translation from PCR-Amplified DNA for High-Throughput NMR Studies, Angew. Chem. Int. Ed. Engl. 46 (18) (2007) 3356–3358. [13] H. Yang, L. Ivashkiv, H. Chen, G. Zubay, M. Cashel, Cell-free coupled transcription-translation system for investigation of linear DNA segments, Proc. Natl. Acad. Sci. USA 77 (1980) 7029–7033. [14] J. Pratt, G. Boulnois, V. Darby, E. Orr, E. Wahle, I. Holland, Identification of gene products programmed by restriction endonuclease DNA fragments using an E. coli in vitro system, Nucleic Acids Res. 9 (1981) 4459–4474. [15] D. Yu, H. Ellis, E. Lee, N. Jenkins, N. Copeland, D. Court, An efficient recombination system for chromosome engineering in Escherichia coli, Proc. Natl. Acad. Sci. USA 97 (2000) 5978–5983. [16] K. Sitaraman, D. Esposito, G. Klarmann, S. Le Grice, J. Hartley, D. Chatterjee, A novel cell-free protein synthesis system, J. Biotechnol. 110 (2004) 257–263. [17] K. Lee, S. Cohen, Effects of 30 terminus modifications on mRNA functional decay during in vitro protein synthesis, J. Biol. Chem. 276 (2001) 23268–23274. [18] A. Keefe, D. Wilson, B. Seelig, J. Szostak, One-step purification of recombinant proteins using a nanomolar-affinity streptavidin-binding peptide, the SBP-Tag, Protein Expr. Purif. 23 (2001) 440–446.
161
[19] J. Muyrers, Y. Zhang, V. Benes, G. Testa, W. Ansorge, A. Stewart, Point mutation of bacterial artificial chromosomes by ET recombination, EMBO Rep. 1 (2000) 239–243. [20] M. Zimmer, Green fluorescent protein (GFP): applications, structure, and related photophysical behavior, Chem. Rev. 102 (2002) 759–781. [21] D. Kim, T. Kigawa, C. Choi, S. Yokoyama, A highly efficient cell-free protein synthesis system from Escherichia coli, Eur. J. Biochem. 239 (1996) 881– 886. [22] A. Spirin, V. Baranov, L. Ryabova, S. Ovodov, Y. Alakhov, A continuous cell-free translation system capable of producing polypeptides in high yield, Science 242 (1988) 1162–1164. [23] D.A. Arnold, S.C. Kowalczykowski, RecBCD helicase/nuclease, ENCYCLOPAEDIA OF LIFE SCIENCES. John Wiley & Sons, Ltd., Chichester, (1999), http:// www.els.net/. [24] S. Amundsen, A. Taylor, A. Chaudhury, G. Smith, recD: the gene for an essential third subunit of exonuclease V, Proc. Natl. Acad. Sci. USA 83 (1986) 5558– 5562. [25] A. Taylor, G. Smith, RecBCD enzyme is a DNA helicase with fast and slow motors of opposite polarity, Nature 423 (2003) 889–893.