Cell-type-specific early response gene expression during plasmacytoid differentiation of human B lymphocytic leukemia cells

Biochimica et Biophysica Acta, 1049 (1990) 261-271

261

Elsevier BBAEXP 92078

Cell-type-specific early response gene expression during plasmacytoid differentiation of human B lymphocytic leukemia cells John J. Murphy and John D. Norton Department of Haematology, Royal Free Hospital School of Medicine, London (U.K.)

(Received6 November1989)

Key words: Gene regulationpathway; Phorbol ester; Lymphocyte,B, maturation

Monoclonal B lymphocytes from B cell chronic lymphocytic leukemia (B-CLL) can be induced to undergo plasmacytoid differentiation in vitro by the phorbol ester, phorbol 12-myristate 13-acetate (PMA). By differential screening of a cDNA library derived from cells treated with phorbol ester we have isolated and characterised a set of early response genes (ERGs) displaying rapid transient up-regulation of expression in response to PMA. Cross-hyhridisation studies showed that PMA probably induces the expression of over one hundred distinct genes, implying an ERG complexity comparable to that activated by mitogenic stimulation of fibroblasts and normal T lymphocytes. Of 13 genes analysed in detail, most were induced by PMA without a reguirement for de novo protein synthesis, whilst nuclear run-on analysis showed that at least some of the more abundant classes of ERG were up-regulated through transcriptional mechanisms. In a proliferating variant B-CLL population, few differences in ERG expression were seen, suggesting that these genes are part of a gene regulatory pathway coupled to the differentiative rather than the proliferative response of B-CLL cells. However, studies in a range of cell types revealed a suprisingly diverse pattern of PMA-induced expression where most ERGs were relatively B-CLL-specific. This implies an extreme diversity of gene regulatory pathways activated in the primary response by phorbol ester generally and suggests that the onset of PMA-induced plasmacytoid differentiation of B-CLL cells is preceded by activation of a complex gene regulatory program that is largely unique to this maturation-arrested B cell.

Introduction Accumulating evidence suggests that the processes of proliferation and differentiation in many cell types are preceded by rapid, often transient, changes in the expression of a set of genes whose products may mediate programmed events in the cell in response to extracellular signals. The most widely studied genes of this type are represented by the nuclear protooncogene families, c-myc, c-fos and c-jun (AP1) which display rapid, transient induction of expression in response to mitogenic/ differentiative stimuli in a broad range of cell types [1-5]. By using c D N A cloning methods several groups have reported the isolation of novel genes which, like the nuclear protooncogenes are rapidly induced in re-

Abbreviations: B-CLL, B cell chronic lymphocyticleukemia; PMA, phorbol 12-myristate 13-acetate; ERGs, early response genes.

Correspondence: J.D. Norton, Department of Haematology, Royal Free Hospital School of Medicine, Hampstead, London NW3 2QG, U.K.

sponse to extracellular stimuli without a requirement for de novo protein synthesis [6-15]. These genes have been variously termed immediate early [11], competence [7] and progression [16] genes or, collectively, early response genes (ERGs). In mouse fibroblasts, estimates of the total number of ERGs induced by mitogenic/ growth factor stimulation vary, but even excluding those encoding very low abundance transcripts, there are probably in excess of one hundred distinct genes [6]. Structural analysis of several cloned examples of these, mostly from mouse fibroblasts, has shown that they encode proteins with, for example, D N A binding [9], growth f a c t o r / c y t o k i n e [17,18] or cell surface receptor [19] properties suggesting that many classes of E R G specify translated gene products which, like the nuclear oncoproteins, perform essential cell growth or differentiative regulatory functions. In addition, panels of 'anonymous' E R G probes provide a useful resource for mapping different regulatory pathways involved in the coordinate and sequential expression of sets of genes in response to extracellular signals. Although data on ERGs induced by mitogenic stimulation of fibroblasts

0167-4781/90/$03.50 © 1990 ElsevierScience Publishers B.V. (BiomedicalDivision)

262 [6] and more recently in T lymphocytes [15] are now quite extensive, relatively few studies have focussed on ERG expression in different cell types particularly during processes of induced differentiation. Malignant cells from patients with B cell chronic lymphocytic leukemia (B-CLL) represent a monoclonal expansion of committed lymphocyte precursors arrested at a stage of differentiation intermediate between the immature pre-B cell and resting mature peripheral blood B lymphocytes [20]. This differentiation arrest can be overcome in vitro by treatment of the cells with a variety of agents of which the phorbol ester, phorbol 12-myristate 13-acetate (PMA) is the most potent [2124]. B-CLL cells respond to PMA by undergoing plasmacytoid differentiation usually without significant DNA synthesis or cellular proliferation [25,26]. PMAinduced differentiation of B-CLL cells results in marked changes in cell ultrastructure and surface markers as the cells acquire features, after about 3 days, resembling those of mature plasma cells [23,27]. Loss of immunoglobulin protein on the cell surface membrane is accompanied by an increase in secretion and a switch in mRNA from that specifying membrane-bound heavy chain immunoglobulin to that encoding the secreted form [28,29]. Induced plasmacytoid differentiation of B-CLL cells thus provides a useful in vitro model system to study the process of terminal differentiation in B lymphocytes which we have used to explore gene regulatory pathways involved in the differentiation of a highly developmentally committed, specialised cell type. Earlier studies from our laboratory [30] and others [29] have shown that, in common with most other cell types, phorbol ester induces a rapid, transient up-regulation of genes encoding the nuclear oncoproteins c-myc and c-fos in B-CLL cells. We now describe the isolation and characterisation of a set of 'anonymous' ERGs from B-CLL cells displaying a similar rapid, transient induction of expression in response to PMA-induced differentiation. In particular we were interested in determining the extent to which these genes were PMA-inducible in closely or more distantly related cell types. Our results reveal a suprisingly diverse pattern of PMA-responsive expression amongst different cell types where most ERGs were relatively B-CLL-specific. This implies an extreme diversity of gene regulatory pathways activated in the primary response by phorbol ester and suggests that the onset of PMA-induced plasmacytoid differentiation of B-CLL cells is preceded by activation of a complex gene regulatory program that is largely unique to this maturation-arrested B cell. Materials and Methods

Cell culture and characterisation. Mononuclear cells were purified from peripheral blood of B-CLL patients with lymphocyte counts greater than 60-109/1 by

single-step Ficoll-Hypaque gradient centrifugation (Lymphoprep, Nyegaard, The Netherlands) and left overnight in serum-free medium before use. B-CLL cells, normal peripheral blood lymphocytes (PBL), Daudi B lymphoblastoid, HL-60 promyelocytic, HeLa epithelial and TE671 medulloblastoma cells were cultured in tissue culture flasks (Nunc) or in 96-well flatbottomed microculture plates (Nunc). B-CLL cells, PBL, Daudi and HL-60 cells were maintained in RPMI 1640 medium (GIBCO, Grand Island, NY, U.S.A) supplemented with 10% fetal calf serum (GIBCO, Grand Island, NY, U.S.A.), 2 mM glutamine and 20 /~g/ml gentamicin. HeLa and TE671 cells were maintained in D M E M medium (GIBCO, Grand Island, NY, U.S.A.) supplemented with 10% fetal calf serum, 2 mM glutamine and 20/~g/ml gentamicin. Cultures of anchoragedependent cell lines were brought to a quiescent, G o state by growth in serum free medium for 2 days. Cultures were incubated with or without 30 nM PMA (Sigma, Poole, U.K.) at 37°C in a humidified incubator containing 5% CO 2 in air. In several experiments, 10 /~g/ml cycloheximide (Sigma, Poole, U.K.) was included in the cell cultures. Cells were harvested either following trypsinisation (for anchorage-dependent cells) or directly by centrifugation at 500 × g for 5 rain. RNA and D N A synthesis were measured by adding [3H]uridine (1 /~Ci, 1.55 T B q / m m o l , Amersham, U.K.) or [3H]thymidine (1 /aCi, 1.78 T B q / m m o l , Amersham, U.K.), respectively, to cells (200 /d, 105 cells per well) and harvesting the cells after 2 h ([3H]uridine) or 6 h ([3H]thymidine) using a cell harvester (Multimash 2000, Dynatech, U.K.). Radioactivity in cells was counted on a beta liquid scintillation counter. Cell morphology was observed by preparing cytospins on a centrifuge (Shandon-Elliott, Sewickley, PA, U.S.A.), staining with standard May Grunwald Giemsa and examination by light microscopy. For immunophenotypic analysis, cells were stained with a panel of monoclonal antibodies by indirect immunofluorescence and viewed under ultraviolet light with appropriate filters and objective on a Nikon AFX-II microscope as described elsewhere [31]. The percentage of positive cells was assessed by counting at least 200 cells.

Construction and differential screening of cDNA library from phorbol ester-induced B-CLL cells. Total RNA was isolated from B-CLL cells stimulated with PMA for 3 h by lysis in 4 M guanidium isothiocyanate and ultracentrifugation through 5.7 M cesium chloride [32]. Poly(A) + RNA was purified from total RNA after two cycles of selection on an oligo(dT)-cellulose column [33]. c D N A was synthesised from 1 /xg of poly(A) + RNA essentially as described by Gubler and Hoffman [34] then, after ligation of EcoRI linkers, was inserted into arms of the phage lambda vector gtl0 [35]. Recombinant phage were identified by plating out on the E. coli hflA mutant strain, NM514.

263 50 000 recombinant phage were plated out at medium density (approx. 10000 plaques per 20 cm2 plate) and screened by differential plaque hybridisation [36]. Duplicate sets of nitrocellulose filter lifts were taken from agar plates and denatured with 0.5 M NaOH, 1.5 M NaC1 and then neutralised in 0.5 M Tris, 1.5 M NaC1. Filters were baked at 80°C in a vacuum oven for 2 h. 32p-labelled cDNA probes were made by reverse transcription of 1 ~tg poly(A) ÷ RNA from either quiescent B-CLL cells or from B-CLL cells treated with PMA for 3 h. Conditions for cDNA probe synthesis were essentially as described previously [37]. Duplicate filters from each plate were hybridised sequentially with each of the two cDNA probes (106 cpm/ml) in standard saline citrate, (150 mM NaC1, 15 mM trisodium citrate = SSC), 1 x Denhart's solution, 0.1% sodium dodecyl sulphate (SDS), 9% dextran sulphate, 500/~g/ml yeast RNA and 10/~g/ml salmon sperm DNA at 65°C for 24 h. Filters were then washed four times (30 s) in 2 x S S C , then five times (20 min) in 1 x S S C , 1 x Denhart's solution, 0.1% SDS and 25/~g/ml yeast RNA, followed by a final wash at 65°C in 0.1 x SSC (twice for 20 min). Individual plaques which hybridised differentially with cDNA probe from phorbol ester-treated cells were selected, replated at low density and rescreened with the cDNA probes as above. For cross-hybridisation studies, single differentially hybridising plaques from the secondary screening were transferred in a grid array to agar plates (9 cm2) and probed with individual 32p. labelled cDNA inserts from minilysates of phage cultures prepared as described previously [38]. DNA inserts were 32p-labelled by a modified oligo-priming reaction [39]. Selected cDNA inserts representative of each cross-hybridising insert were sub-cloned into the EcoRI site of the plasmid vector pUC9 by standard procedures [38] and limited sequence analysis was performed (approx. 150-250 nucleotides from one end of the insert) by standard dideoxy chain termination using plasmid templates essentially as described elsewhere [40]. To determine the frequency of representation of each clone in the cDNA library, 32p-labelled inserts were used as probes to screen approx. 104 plaques from the original library under the hybridisation conditions described above. Hybridisation analysis of cell RNA. Total cell RNA was prepared as described above, then 1.5 ~tg samples (estimated from absorbance at 260 nm) were denatured in 69% formamide, 12% formaldehyde in H20 at 650C for 10 min before being dot-blotted on nylon membrane filters (NEN, Dupont, Boston, MA, U.S.A.) using a dot-blotting manifold (Schleicher and Schuell, Dassel, F.R.G.). Alternatively, 2 /~g samples were electrophoresed through 1% agarose gels in 0.8 M formaldehyde [41]. After staining with ethidium bromide to monitor equivalence of loading, RNA was blotted on

nylon filters using 10 X SSC. Blots were baked at 80°C for 2 h in a vacuum oven and hybridised to 32P-labelled probes (106 cpm/ml) at 60°C in 1 M NaC1, 1% SDS 10% dextran sulphate, 10 mM Hepes (pH 7.0), 200 /xg/ml yeast RNA, and 20/Lg/ml salmon sperm DNA for 24 h. Filters were then washed with 2 x SSC, four times (30 s), with 2 x SSC four times (20 min), 1% SDS, in 2 x SSC at 60°C for 20 min and finally at 60°C in 0.1 x SSC (20 min). Autoradiography was performed at - 7 0 ° C using Dupont, 'Lighting Plus' intensifying screens for 1-14 days. In some experiments, a 1.3 kb insert of the immunoglobulin heavy chain (IgH) C/~ region locus [42] and a 1.5 kb cDNA clone of the c-los protooncogene (Murphy, J. and Norton, J., unpublished results) were used as probes. Hybridisation signals on autoradiograms were quantitated by spectrophotometric determination of absorbance at 620 nm after overnight elution from X-ray film in 0.4 ml of 0.5 M NaOH. The cellular abundance of individual transcripts was determined by reference to a standard calibration curve obtained by hybridising serial dilutions of cloned c-fos DNA with c-fos probe. After correcting values for size of cloned probe and transcript, the number of copies per cell was estimated assuming a total RNA content per lymphocyte of 1.0 pg [43]. Nuclear run-on transcription analysis of ERGs. 108 B-CLL cells were harvested at various times following culture in the presence of 30 nM PMA by centrifugation at 200 X g for 5 min then washed twice in ice-cold phosphate-buffered saline. The cell pellet was resuspended in 1 ml of lysis buffer (10 mM Hepes (pH 7.9) 10 mM NaC1, 50 mM KC1, 3.0 mM MgC12, 0.15 mM spermine, 0.5 mM spermidine) and gently disrupted in a glass homogeniser. Lysis was achieved by the addition of Nonidet P40 to 0.2% (v/v) and nuclei were pelleted through a 30% (w/v) sucrose cushion (made up in lysis buffer) by centrifugation at 10000 x g for 5 min. Nuclei were resuspended in 100/~1 of 50 mM Hepes (pH 7.9), 5 mM MgC12, 0.1 mM EDTA, 40% (v/v) glycerol and stored at - 70°C. Nuclear run-on transcription was carried out in a final volume of 20/~1 by addition of a 2 × transcription mix to 10 #1 of thawed nuclei so that the final composition was 50 mM Hepes, (pH 7.9), 20 mM KC1, 2 mM dithiothritol, 30 mM fl-mercaptoethanol, 50 mM magnesium acetate, 2 mM MnC12, 0.1 mM EDTA, 8 nM phosphoenolpyruvate, 6/~g/ml pyruvate kinase, 2 mM fructose 1,6-diphosphate, 1% Tween 80, 2 mM thyrrfidine diphosphate, 1 mM CTP, ATP and GTP, 1000 U / m l placental RNAase inhibitor (GIBCO-BRL, Paisley, U.K.), 0.4/~g/ml heparin (Sigma, Poole, U.K.) and 30 /~Ci [a-32p]UTP (spec. act. 400 Ci/mmol). After incubation at 20°C for 45 min, elongated, labelled transcripts were purified by digestion with RNAase-free DNAase I (20 units, Amersham, U.K.) for 30 rain at

264 20 ° C in the presence of 10 /~g of t R N A carrier then digested with 0.5 m g / m l proteinase K at 3 7 ° C for 30 rain after addition of 20/~1 of 20 m M Tris (pH 7.5), 10 m M EDTA, 2% SDS. R N A was further purified by phenol extraction, chromotagraphy through Sephadex G-50 then ethanol precipitated. Plasmid DNAs (5 /~g) were linearised with EcoRI, heat-denatured then immobilised on nitrocellulose filters in 10 × SSC using a Schleicher and Schuell dot-blot manifold. Filters were pre-hybridised overnight at 45°C in 50 m M Hepes (pH 7.0) 2 x SSC 1.0% SDS, 50% ( v / v ) formamide, then hybridised with labelled run-on transcripts under the same conditions at 2- 106 cpm of probe per ml in sealed polythene bags for 24 h. Filters were washed exhaustively in 2 x SSC at room temperature then treated with RNAase A (10 /~g/ml) for 20 min and washed in 0.1 x SSC, 0.5% SDS at 40°C before being autoradiographed. Results

Characterisation of ERG clones 500 differentially hybridising plaques were identified and 77 of these were selected randomly (based on hybridisation signals). To determine how m a n y distinct genes were represented in our clone collection, we examined the inserts for sequence homology by cross hybridisation analysis. The 77 clones could be grouped into 13 unique sequence families. On this basis and taking into account that we have screened only one tenth of our total library (500 000 clones) we estimate that the total number of E R G s up-regulated in response to PMA in B-CLL cells is of the order of several hundred. Individual )~gtl0 clones from each of the 13 crosshybridising families which gave the strongest signals on differential screening were selected and the inserts were subcloned into pUC9. Table I gives the insert sizes and the abundance of each sequence estimated from the frequency of representation in the c D N A library. To characterise the R N A transcripts corresponding to the 13 c D N A clones, total R N A from quiescent or PMAstimulated B-CLL cells was analysed by Northern blotting. Each clone recognised one or at most two size classes of R N A transcript of varying size (Table I). Under conditions of reduced hybridisation stringency, two clones, 3L3 and 5L3, were exceptional in that they both detected a broad size range of R N A transcripts (data not shown). Southern blot analysis of human peripheral blood lymphocyte D N A showed that all of the clones detected only one or two fragments, indicating that they represent single copy genes (data not shown). In addition, none of the 13 clones hybridised with several oncogenes/growth regulated genes such as c-myc, c-fos and c-jun nor with a synthetic 20 mer consensus zinc finger motif probe [44] (data not shown).

TABLE I

Summary of ERG clones Clone

Insert size (kb)

Transcript " size (kb)

Abundanceb

1L4 1R21 3L3 10A 19A 5L3 1R19 1R20 3Lll 3L2 4B1 2L12 1L3

1.3 1.0 0.8 1.5 1.0 1.0 1.3 1.1 0.8 1.5 1.0 1.5 2.5

3.0 1.5 3.0 4.0 (1.8) c 3.5 1.8 (4.0) 1.8 2.0 4.0 (2.0) 4.5 3.5 4.0 3.5

0.270 0.250 0.230 6.230 0.200 0.170 0.150 0.140 0.130 0.050 0.010 0.005 < 0.010

a Estimated from electrophoretic mobility relative to 28 S and 18 S rRNA. b Abundance was measured by frequency of occurence in original library. Numbers shown are the percentage of plaques hybridising to clones at 3 h after PMA stimulation. c Sizes of minor transcripts are given in parentheses. Limited D N A sequence analysis (approx. 150-250 nucleotides) of all c D N A clones (Fig. 1) and data base searches (EMBL version 16, Sept. 1988) showed that all except one (1R19) corresponded to genes that have not been previously cloned and sequenced 1R19 gave a close match with the alpha chain of H L A D C class II histocompatability antigen [45], known to be up-regulated by P M A in B-CLL cells [46]. In addition, some limited homology of questionable significance was found between 5L3 and the human tissue plasminogen activator gene [47], and 1R20 and the mouse pim-1 protooncogene exon [48].

Kinetics and temporal regulation of ERG expression To determine the time course of PMA-induced E R G expression, total cellular R N A was prepared from BCLL cells at various times after exposure to PMA. R N A was dot-blotted on nylon filters and hybridised with each plasmid insert. In addition, the kinetics of induced expression for all E R G s were confirmed by Northern blot time course experiments. As shown in Fig. 2, all R N A s showed a transient peak of expression between 1 and 8 h after P M A stimulation. In resting B-CLL cells, the level of constitutive expression of the the various genes was either undetectable or very low, so that the smallest degree of induction (clone 1L4) was about 18-fold. The relative abundance of different E R G s at 3 h post-induction showed a good correlation with the representation of clones in the c D N A library (compare Fig. 2 with Table I). At the time points of maximal expression, the abundance of different R N A s varied over a wide range (Fig. 2). Nine clones detected transcripts in the range 10-40 copies per cell, whilst four

265

IL4

1 60 120 180

CACTGCACTGAGCATGATATTATGTACATCTTGTGTCATGTGTGACAATTCTCTTGGGTT CTTTTCAGCAGTGTTGAGAAGGTGGTGTAAAGGACAGCTGGTCCAGGGCCCTCAGCAACA TTTGAccAGTCTTGGTAGAATTTCGAGGAGGAAACGCTATAAGTGTGCGAGGTGACAAAT GGGGCAAGACATCTGA

IR21

1 60 120

CATGAGTATGGAAGGAATGGCTTGCTCTCCAACTAATCCAAGACGCAGGCAGAGCTGGTC TTCTGGTCTCCTTGGAGAAAGGTTCTGTTGCCCTGATTTATGAACTCTATAATAGAGTAT ATAGGTTTTGTACCTTTTTTACAGGAAGGTGAC

3L3

1 60 120

AATTAGATTGTTTACAAATTTAACAGGATGGCTACAAAGAGATCTTATTTTAAAAGCAGC TGATGGTTTGGAAATGAGACAACTACAGTGGTGAAGAGACCAGGAGGCAGCTCTCAGTGA AACCAACATTGCGGATGCCTTCGTGAGCCTTCTCAGTCCCAGCAGGAAACCCACAACA

10A

1 60 120

GTGTCACATATGAACTGGGGAACTTTAGCACCAAAATCAAGTCTCTCCTATGCCATCTAG CTACCCCTAACATCCCACTTAAAAAAAAGAAAAAATTAAATCACAAAGACCCACTTAAGT CAAATCTTCGTCCGCTTTTCAGCTTCTTCTGCAGACTAAAAGCCAGGAAGATAGCA

19A

1 60 120 180

GCCGAATTGTTTTTTTTTTGAGCAGAGACTTAGGGGAGTGCACTGCTGTCTAGATAACAT TCTCATAGGCAAATAGCCTTGGTGTGTCTGGCATCGTGAGCAGTGAGTGGGGATTTTCCA TCTTTTTCGGTATTTCCACAGTGGAGTAAACCGTATTTGCTGGATCTTCCTATGATTGTT CTATTAGTGTGAGGGATTG

5L3

1 60 120

AGCTTCATGAAATGCCTGATGACACATTCCCAGGGTAAGTTGGGCGCACAGGCTTGGTTT TATACGATTTAGGGAGACATGAATGAGACATTCAATCAATATACGTAAGAACGTACATTC GGTTTGGTCTTGGAAAGGCAGGACAGCTTGAAACAAT

IRI9

1 60 120

GGCTTGACTGAACCGTGGCTAAGAATTGGATGCTCTCTTGTTTTGCATTTACCAGATCAT TTGTCATGTCCAGTAACACAGAAGCAACCAACTACAGTATAGCCTGATAACATGAGTTTC TTAGCATGACATTAATATTTCTTTCTTTCCTTGTGTTCCCACCCTTCCATTGCC

IR20

1 60 120 180

GCTGGCTTGTGAAGACTATAAGAAAACAGAGTCTGATCTTTTGCCCTGTAAAGCAGAAGA GATATATAAAGCATTTGTGCATTCAGATGCTGCTAAACAAATCAATATTGACTTCCGCAC TCGAGAATCTACAGCCAAGAAGATTAAAGCACATTTCCACGTGTTTTGATGAAGCACAAA AGTCATATATACTCTTATGGAAAGGACTCTAA

3LII

1 60 120

CATGCTTTCTTCCCTGGGTTTTAAACTTCATATAACTTTCAGAAATTGGAGAGCAAAAAT TTTGCTTGTCACTGCACATCAATATAAAAAAGCTTATTTAACTTATCAAAACGTATTTAT TGCCAAACTATGCTTTTTTTTGTTAATTTTGTTCATATTTATCGGGATGACA

3L2

1 60 120 180 240

CCGAGAAGGCTATACTAGAACGTTTGAATGTGCAAATGGTATGACGAAAGATGTAGGGCT CTTTCGTTGAACTTCTCTACGGCGGGCGGGCGGACACGTGTTCCAGGTGGACTTGCCTGC CGGCCAGCGTTTGAGTCTGAACTTCCTCTAACTGCAGCTGGGCTCCTGGCACATGCGGTC CTGGCATGATGGTCCTCCTGGCCAGGAGCGAGTCCTAAGGAAATTCATTCATTGACGGAC ATCATCCATGATAGGCCATGTTCTCTGCT

4B1

1 60 120 180 240

AAACAATTTAATATAAAAAATGCCATTTTTTGTCCATACAATATTTATAAAAAAGTACAT AGTGGTTAGTTTTGCAATAATTTCTTTTTAGCCAGATGTCATATCATCATATAAATCTAT GAATATAACAAATGACATAAGAACAGTATAAGTTTTTGTAGTATTTACACTTACACAGAA ACTAGCCCAAATGGTGTCCTAAGAAATTGTTTACAGTTAAAGTGAAACTACTGATTCAAC ATACTGACA

2L12

1 60 120 180

CCCTACTTATCACAGATTCATTCAATGCTACATATGTACAGCCTATAATAAAACAGAGAG ATGAGCAGCTTCTGACAAATGTCCTGGAAACACTTCGAGGTGATGGAAATGTGTTAATAG CAGTGGACACAGCAGGCAGAGTTTTGGAACTTGCTCAACTTCTTGATCAGATTTGGAGGA CTAAAGATGCAGGATTGGGTGTTTACTCATT

1L3

1 60 120

GAGTATCAGGTTGGGCAGCTTTACTCTGTTGCAGAAGCTAGTAAGAATGAGACTGGTGGT GGAGAAGGAATTGAAGTCTTAAAGAATGAACCTTATGAGAAGGATGGAGAAAAGGGACAG TATACGCACAAAATTTATCACCTAAAGAGCAAAGTGCCTGCATTCGTGAGGATGATTGCT Fig. l . P ~ t i ~ D N A s ~ u ~ of ERGs.

266 19A 3O

2O

3L2

i2oJ

0

119

2

4

6

8

1

24

2

4

6

8

24

increased expression depends on the activity of pre-existing trans-acting transcriptional regulatory factors [49]. Furthermore, many transiently expressed genes display a superinduction of expression when cells are stimulated in the presence of protein synthesis inhibitors, a phenomenon attributed to enhanced stabilisation of the mRNA [6,10,11,15]. We tested whether de novo protein synthesis was required for induced expression of our ERGs in a series of time-course experiments where cells from the same B-CLL population were incubated in parallel with either PMA alone, PMA and cycloheximide together, or with cycloheximide alone. Fig. 3B. shows the results which are representative of the spectrum of responses seen. Only one ERG, IOA, displayed a markedly diminished degree of induction in response to PMA with cycloheximide present, whilst for the majority of genes, protein synthesis inhibition had no

DURATION(HOURS)or STIMULATION Fig. 2. Kinetics and temporal regulation of E R G expression. Total R N A was prepared from B-CLL cells stimulated for different times with PMA (10 8 cells for each time point). R N A (1.5/~g for each time point) was dot-bloned on nylon filters and hybridised with 32p-labelled c D N A clones. The levels of each R N A were quantified from the autoradiograms by reference to a standard calibration relating the intensity of the hybridisation signal to the amount of specific sequence present as described in the Materials and Methods section. The data were taken as representative of several independent experiments.

A.

B.

0 control plas. Cu

1

2

24

0

c los

cfos 10A

19A

Mechanisms regulating ERG expression To determine whether PMA-induced E R G expression was regulated by transcriptional or post-transcriptional mechanisms, nuclear run-on transcription analysis following PMA induction was performed for all 13 clones. Because of the relatively low abundance and small sizes of some of the cDNA inserts, we were able to detect nuclear run-on transcription for only four of the most abundant class of RNAs (10A, 19A, 1L4, 1R20). Fig. 3A shows a comparison of this analysis with run-on data for the E R G c-fos and for the IgH C/~ gene. In contrast to C/~ gene transcription which, like the steady-state level of its RNA [30], showed no marked change during plasmacytoid differentiation, all four of our ERGs displayed some up-regulation of transcription some time after that of the c-los gene, at a point around or prior to the peaks of RNA abundance (Fig 2). We conclude from this that the increase in mRNA levels for these ERGs is mediated, at least in part, through transcriptional up-regulation. A characteristic of most ERGs described in other systems is a lack of dependence of increased expression on de novo protein synthesis [6,10,11,15], implying that

1

2

4

8

24

Time(hours)

b c a

~L4

b

3L3

b c

19A

b

1RZ0

RNAs were induced to a level of no more than two copies per cell. By comparison, the ERGs c-fos and c-myc showed a peak abundance of seven (0.5 h) and eight (2 h) copies per cell, respectively (data not shown).

0"5

a

1L4

"

•

e~iO0

a

c

a SL3

b c a

1R20

b c a

3LII

b c a

3L2

b c a

10A

b c

MD.

Fig. 3. Regulation of PMA-induced E R G expression. (A). Nuclear run-on analysis of ERGs. Following P M A stimulation, nuclei were isolated from B-CLL cells at the times indicated and in vitro labelled nuclear R N A (2-10 6 c p m / m l ) was hybridised with excess filter bound, linearised plasmid DNAs. Control plasmids containing either no insert, c-los insert or IgH C/~ insert were analysed in parallel. Plasraids 1R20 and 1L4 were analysed in a separate experiment. (B) Effect of cycloheximide on PMA-induced E R G expression. R N A from BCLL cells (10 8 cells for each time point) stimulated with PMA for the times shown was dot-blotted on nylon filters and hybridised to 3ap-labelled c D N A clones. (a) R N A levels after addition of PMA alone (b) R N A levels after addition of P M A and cycloheximide (10 ~ g / m l ) at the same time. (c) R N A levels when cycloheximide alone was present throughout the culture period. Clone 10A consistently gave a high backround signal on dot blots which was not seen on Northern blot analysis. N.D., not determined.

267

@ 4

@ Q

Fig. 4. Morphology of B-CLL cells. B-CLL cells were isolated from peripheral blood by centrifugation on a single-step Ficoll-Hypaque gradient and cultured at 106 cells/ml (200/xl) in fiat-bottomed microculture plates. (A) freshly isolated B-CLL cells from CLL 1. (B) freshly isolated cells from CLL 7. (C) CLL 1 cells after incubation in medium containing PMA (30 nM) for 72 h. (D) CLL 7 cells after incubation in medium containing PMA (30 nM) for 72 h. effect on P M A induction. Two genes, 1L4 and 1R20, were superinduced by cycloheximide, though this was less marked than the superinduction seen with c-fos (Fig. 3B). P M A - i n d u c e d expression of the c-myc protooncogene was unaffected by protein synthesis inhibition (data not shown). Thus, we conclude that up-regulation of expression of most E R G s induced by P M A in B - C L L cells does not require de novo protein synthesis.

case, C L L 1, for comparison. Although, C L L 7 cells shared the characteristic H L A - D R , weak surface Ig positivity and C D 5 positivity with C L L 1, cells from C L L 7 showed strong expression of the mature B cellassociated marker, F M C - 7 [52]. Morphologically, C L L 7 cells were also larger than typical B - C L L cells (Fig 4 panels A and B) and, following P M A - i n d u c e d differ-

Expression of ERGs in different B - C L L populations Leukemic B cells from different B - C L L patients are k n o w n to display considerable heterogeneity both phenotypically, in terms of the stage of cell maturation arrest, and functionally in response to various inducing agents including phorbol esters [27,50,51]. Over the duration of these studies, we examined P M A - i n d u c e d E R G expression in six different B-CLLs and noted no significant quantitative or qualitative differences in the pattern of gene expression seen (data not shown). However, we encountered a single rare case of B - C L L ( C L L 7) which appeared phenotypically and morphologically unusual in displaying p r o l y m p h o c y t o i d features reminiscent of a more mature stage of B cell differentiation. Table II summarises the surface marker data for cells from C L L 7 together with data from a more typical

TABLE II

Immunophenotypes of B-CLL 1 and B-CLL 7 cellpopulations Reagent

CD a

RFDR2, GRB1

-

UCHT2, RFT1 FMC7 SmlgK

CD5 -

Smlgk

-

Reactivity pattern HLA-DR class II antigen Pan-T, B-CLL B cell associated Surface Ig kappa light chain Surface Ig lambda light chain

B-CLL

B-CLL

1

7

97 b 98 0

84 72 69

99

77

1

0

a Cluster of differentiation antigens (CD) as defined by the First, Second and Third International Workshop on Leukocyte Differentiation Antigens (Paris, 1982; Boston, 1980; Oxford, 1986). b Percent positive cells analysed by immunofluorescence.

268 CLL

I

CLL

7

higher level in C L L 7 cells was the c-myc protooncogene (Murphy, J. and Norton, J., unpublished data) whose product has recently been implicated, if controversially, in D N A replicative function [53,54]. Interestingly, PMA-induced expression of one ERG, 5L3, was significantly lower in C L L 7 than C L L 1 cells (Fig. 6). We infer from these experiments that PMA-induced expression of our E R G s is coupled to gene regulatory pathways associated with the differentiative rather than the proliferative response of B-CLL cells and that this may vary as a function of the stage of maturation arrest of the cell.

20

%

~

6a

~ 4o

2 E ~

2o

24 h

72 h

24 h

72 h

Fig. 5. PMA stimulation of RNA and DNA synthesis in CLL 1 and CLL 7 cells. Cells (200/~1, 106 cells/ml) were cultured in microtitre plates and pulsed with [3H]uridine (1/~Ci per well, 1.55 TBq/mmol) or [3H]tbymidine (1 #Ci per well, 1.78 TBq/mmol) for 2 and 6 h, respectively. Cells were harvested at the times shown and radioactivity in the cells was measured by hquid scintillation counting. Open columns represent cells cultured in medium alone. Cross-hatched columns show results for cells cultured in the presence of PMA. Each column height represents the mean of three separate estimations.

entiation, acquired features more closely resembling plasma cells with an increased cytoplasmic/nuclear ratio and more prominent organellar structure (Fig. 4 panel D). This enhanced morphological differentiation was accompanied by a 7-fold higher rate of total R N A synthesis in cells from CLL 7 compared with CLL 1 (Fig. 5) and, most significantly, the rate of D N A synthesis was dramatically increased (Fig. 5), a response most unusual for B-CLL cells, which are rarely stimulated to significant D N A synthesis by PMA [25,51]. Consistent with the marked stimulation of D N A synthesis in CLL 7, in further experiments we found these cells to undergo a limited proliferation in response to PMA (data not shown). We exploited the proliferating variant CLL 7 cells to investigate whether PMA-induced expression of any of the ERGs was significantly enhanced in these cells and, therefore, likely to be coupled to gene regulatory pathways associated with the proliferative response of B-CLL cells. Northern and dot-blot analysis of R N A from PMA-stimulated time courses of CLL 1 and CLL 7 were performed in parallel with each of the 13 E R G probes. Fig. 6 illustrates some of the results from these experiments. None of the 13 E R G s was induced to a higher level in C L L 7 than in C L L 1 cells in response to PMA treatment; only minor differences were seen for 12 of the genes (shown for 1L4 and 1R20 in Fig. 6). In fact, the only gene found to be induced at a markedly

Cell type specificity of PMA-induced E R G expression The lack of significant widespread variation in pattern of E R G expression amongst different B-CLLs would be consistent with their regulation being mediated through a more general lymphocyte activation programme or even, by analogy with c-fos, with them being part of a 'universal' signal transduction pathway activated by phorbol esters in many kinds of cells. To explore this we examined the expression of each gene in a spectrum of h u m a n cell types of both haemopoietic and non-haemopoietic origin after stimulation with PMA. These experiments also served to determine, at a general level, whether the PMA-activated E R G regulatory pathways in B-CLL cells resemble those in more closely or distantly related cell types. The following cell types were studied: (1) peripheral blood lymphocytes, representing predominantly resting T lymphocytes, (2) Daudi B lymphoblastoid cells, (3) HL60 promyelocytic

PROBE

kb.

CLL 1 0061 2 4

CLL7 0061 2 4 824 Time (hours)

24

1

..........•

1R20 49

1L4

J

00"51 2 4 8 24 ""-'4.9~

~

5L3 1L4

"---4.9

~

]

~ '

~ 7

~

Fig. 6. Northern blot time courses of PMA induced expression of 1R20, 1L4 and 5L3 in different B-CLL populations. Total RNA was isolated from cells (108 cells for each time point) at the times indicated after PMA addition and different size classes of RNA (2 /~g for each time point) were separated by formaldehyde-agarose(1%) gel electrophoresis, blotted on nylon filters and hybridised with 32p. labelled probes. Filters representing CLL 1 and 7 were probed with either 1R20 or 5L3 then reprobed with 1L4.

269 cells, (4) HeLa epithelial carcinoma cells, and (5) TE671 medulloblastoma cells with neuronal like properties [55]. Since fresh B-CLL cells are in a quiescent (Go) state, we induced the anchorage-dependent cell lines, HeLa and TE671, to a G O stage by serum starvation in order to investigate the phorbol ester responses in a more physiologically comparable cell state. PMA is known to induce monocyte/macrophage differentiation in HL60 cells [56] and to induce a 'plasmacytoid-like' differentiation in Daudi B lymphoblastoid cells [57]. Following culture of each cell type in the presence of PMA, total RNA was isolated at various times and analysed by both dot-blot and Northern blot analysis. In control experiments, all cell types displayed a rapid transient induction in c-fos expression in response to PMA, comparable to that seen in B-CLL cells (data not shown). Fig. 7 illustrates the spectrum of responses seen with the different cell lines and Table III summarises the data obtained for the 13 clones from all cell types. Two ERGs, IOA and 5L3, were induced by PMA exclusively PROBE

CLL

CELL LINES TE671 HeLa HL60 Da~di

00"5 1 2 4 8 24

kb.

0 4 0 4 0 4 04

Time (houm)

IOA

2~N~

TE671 HeLa HL60 I~uda

00.51 2 4 824

04 04 0404

1L4

'I'E~71 Neha

00"51 2 4 824

~

0 4 0 4 0 4

Da~[i

4

TA B LE III

Ceil-type specificity of phorbol ester-induced ERG expression Clone

1L4 1R21 3L3 10A 19A 5L3 1R19 1R20 3Lll 3L2 4B1 2L12 1L3 a b c d

Cell type Daudi

PBL a

HL60

HeLa

TE671

+ b + + 0 0 + 0 + + + + + 0 0 N.D. 0

_~_ 0 0 0 N.D. d 0 + N.D + N.D. 0 N.D. 0

0 0 + + + 0 0 0 0 + + 0 + 0 N.D. 0

0 + 0* ~ 0 0 0 0 0 + 0 + N.D. + +

0 0 0* 0 0 0 0 0 0* 0 0 N.D. 0*

Peripheral blood lymphocytes. Responses relative to B-CLL response ( + + • = constitutive expression. N ot determined.

+).

in B-CLL cells (shown for IOA in Fig. 7). As illustrated for 1L4 in Fig. 7, six ERGs displayed a modest level of inducibility in one or more of the haemopoietic cell types, whilst expression of the remaining ERGs was inducible in both haemopoietic and non-haemopoietic cells (1R21 in Fig. 7) or exclusively in cells of nonhaemopoietic lineage (4B1, 1L3). Interestingly, three ERGs, 3L3, 3Lll and 1L3 were constitutively expressed in one or both of the non-haemopoietic cell types (Table III) as shown for 3L3 in Fig. 7. Thus, none of the ERGs appear to be part of a universal phorbol ester activated regulatory pathway. Overall their pattern of expression appears to be remarkably specific for B-CLL cells and their patterns of expression amongst different cell types is very diverse. Discussion

IR21

N TE6"/I I'leLa HI.~I0 Daudi

00.51 ~.4 824

04 04 04 04

31,3

Fig. 7. Northern blots showing cell type specificity of PMA-induced E R G expression. Total R N A was isolated from B-CLL cells, Daudi B lymphoblastoid, HL60, HeLa or TE671 cells at the times shown after PMA addition and analysed by Northern blot analysis as described in the legend to Fig. 6. Autoradiographs for each probe were obtained from filters hybridised in parallel.

In this study we describe the isolation and characterisation of a set of genes that are rapidly and transient ly induced following PMA stimulation ef B-CLL cells. The temporal regulation of expression, absence of requirement for de novo protein synthesis and transcriptional upregulation, demonstratable at least in some cases, are features consistent with most of these genes being classified as ERGs analogous to those previously cloned from other cell types after growth f a c t o r / mitogen stimulation [6-15]. None of the clones hybridised to representatives of previously cloned classes of E R G and, moreover, limited nucleotide sequence analysis of all clones and data base searches has indicated that 12 of these ERGs do not correspond to previously cloned and sequenced genes. Whilst we have no information on the nature of the proteins encoded

270 by these ERGs, it seems quite possible that some may specify translated gene products performing specialised regulatory functions in B tymphocytes. Previous studies on fibroblasts [6] and more recently on T lymphocytes [15] have shown that the number of mitogen/growth factor-induced ERGs is very large, probably exceeding one hundred, suggesting that the tightly regulated cascade of transcriptional gene activation events preceding G o to G1 transition is part of a highly complex genetic program. In our studies, we estimated that the number of ERGs induced by PMA stimulation of B-CLL cells is of a similar order. This observation, together with the diversity of kinetics of induction and temporal regulation amongst the 13 genes studied in detail rather implies that despite B-CLL cells being a highly developmentally committed, specialised cell type, phorbol ester-mediated plasmacytoid differentiation is preceded by activation of a gene regulatory network of comparable complexity to that associated with induced proliferation of fibroblasts and T lymphocytes [6,15]. In contrast to the cloning strategies employed in other studies [6,10,15], we did not use protein synthesis inhibition to facilitate the detection of 'immediate early' response genes (analogous to the c-fos, c-jun(AP1) families) and to select for genes that are upregulated specifically without a requirement for de novo protein synthesis. At the expense of not detecting such immediate ERGs, we were interested in determining the extent to which the overall expression of ERGs is dependent on de novo protein synthesis. Perhaps surprisingly, PMA-induced expression of only one of the 13 genes was significantly inhibited by cycloheximide. This implies that, at least in PMA stimulated B lymphocyte differentiation, induced expression of the majority of ERGs depends on pre-existing trans-acting transcription factors. Since the majority of our ERGs were induced somewhat later than the c-fos/c-jun (AP1) class of ERG (Ref. 11 and Murphy, J. and Norton, J., unpublished observations) this perhaps raises some doubts about the postulated significance of transiently increased expression of c-fos/c-jun (AP1)-type genes in mediating PMA-induced gene expression [58,59], at least in B-CLL cells. Since most B-CLL populations do not divide in response to PMA, expression of our ERGs would appear to be insufficient for induction of D N A synthesis. In a proliferating variant B-CLL population there was no enhancement of PMA-induced expression for any of the 13 ERGs, arguing that their expression is coupled to gene regulatory pathways associated with differentiative rather than the proliferative response of B-CLL cells. However, since PMA also induces a G 0 to G 1 transition in B-CLL cells [26], it remained possible that induced expression of our ERGs was simply a manifestation of a more general cell activation programme. In three differ-

ent G0-arrested cell types, peripheral blood T lymphocytes, HeLa epithelial and TE671 medulloblastoma cells, PMA did not induce significant expression of the majority of ERGs under conditions which gave a strong, transient up-regulation of the c-fos gene. This would suggest that if E R G expression in B-CLL cells is coupled to a G 0 - G 1 cell activation process, then it is highly cell lineage/differentiation stage specific. It should of course be emphasised that although the PMA-activated intracellular signal transduction pathway (through protein kinase C) is probably universal [60], we cannot exclude the possibtity that some of our ERGs may be induced in heterologous cells by different ligands via alternative regulatory pathways, since clear precedents for this phenomena have recently been reported [61,62]. Few members of our set of ERGs were induced in response to PMA-stimulated monocyte-macrophage differentiation of promyelocytic HL60 cells. Even in Daudi B lymphoblastoid cells in which PMA induces a 'plasmacytoid-like' differentiation with the appearance of some phenotypic markers of mature plasma cells [57], significant expression of only a minority of our ERGs was seen. Interestingly, these ERGs were, for the most part, distinct from those induced by PMA in HL60 cells further highlighting the cell-type specificity of induced expression of these genes. This cell-type specificity rather suggests that PMA-induced plasmacytoid differentiation of B-CLL cells is mediated through gene regulatory pathways that are largely unique to this maturationarrested B cell. Recently Zipfel et al. [15] showed that, in common with our findings in terminal B lymphocyte differentiation, a sizeable proportion of ERGs activated in response to mitogenic stimulation of T lymphocytes also display cell type specificity in not being induced by growth factor/mitogen stimulation of primary fibroblasts. Taken together these observations imply that gene regulatory pathways activated in the primary response through universal signal transduction pathways such as that mediated through protein kinase C are extremely diverse, even between closely related cell types.

Acknowledgements We thank several colleagues for supplying patient material and Drs. P. Browett and B. Leber for helpful discussions. This work was supported by the U.K. Medical Research Council.

References 1 Greenberg, M.E. and Ziff, E.B. (1984) Nature (London) 311, 433-438. 2 Kelly, K., Cochran, B.H., Stiles, C.D. and Leder, P. (1983) Cell 35, 603-610. 3 Lamph, W.W., Wamsley, P., Sassoni-Corsi, P. and Verma, 1.M. (1988) Nature (London) 334, 629-631.

271 4 Muller, R.R., Bravo, J., Burckhart, J. and Curran, T. (1984) Nature (London) 312, 716-720. 5 Ryseck, R-P., Hirai, S.I., Yaniv, M. and Bravo, R. (1988) Nature (London) 334, 535-539. 6 Almendral, J.M., Sommer, D., Macdonald-Bravo, H., Burckhart, J., Perera, J. and Bravo, R. (1988) Mol. Cell. Biol. 8, 2140-2148. 7 Cochran, B.H., Reffel, A.C. and Stiles, C.D. (1983) Cell 33, 939-947. 8 Johnson, M.D., Housey, G.M., Kirchmeier, P.T and Weinstein, I.B. (1987) Mol. Cell. Biol. 7, 2821-2829. 9 Joseph, L.J., Le Beau, M.M., Jameson Jr., G.A., Acharya, S., Shows, T.B., Rowley, J.D. and Sukhatme, V.P. (1988) Proc. Natl. Acad. Sci. USA.85, 7164-7168. 10 Lau, L.F. and Nathans, D. (1985) EMBO J. 4, 3145-3151. 11 Lau, L.F. and Nathans, D. (1987) Proc. Natl. Acad. Sci. USA 80, 4271-4275. 12 Lim, R.W., Varnum, B.C. and Herschman, H.R. (1987) Oncogene 1,263-270. 13 Lipes, M.A., Napolitano, M., Jeang, K-T., Chang, N.J. and Leonard, W.T. (1988) Proc. Natl. Acad. Sci. USA 85, 9704-9708. 14 Sukhatme, V.P., Kartha, S., Toback, F.G., Taub, K., Hoover R.G. and Tsai-Morris, C-H. (1987) Oncogene Res. 1, 343-355. 15 Zipfel, P.F., Irving, S.G., Kelly, K. and Siebenlist, U. (1989) Mol. Cell. Biol. 9, 1041-1048. 16 Pledger, W.J., Stiles, C.D., Antoniades, H.N. and Scher, C.D. (1977) Proc. Natl. Acad. Sci. USA 74, 4481-4485. 17 Rollins, B.J., Morrison, E.D. and Stiles, C.D. (1988) Proc. Natl. Acad. Sci. USA 85, 3738-3742. 18 Zipfel, P.E., Balke, J., Irving, S.G., Kelly, K. and Siebenlist, U. (1989) J. Immunol. 142, 1582-1591. 19 Lindsten, T., June, C.H., Thompson, C.B. and Leiden, J.M. (1988) Mol. Cell. Biol. 8, 3820-3826. 20 Johnstone, A.P. (1982) Immunol. Today 3, 343-348. 21 Lantz, O., Grillot-Courvalin, C., Schmitt, C., Fermand, J. and Brouet, J. (1985) J. Exp. Med. 161, 1225-1230. 22 Robert, K-H., Einhorn, S., Juliusson, G., Ostlund, L. and Biberfeld, P. (1985) Clin. Exp. Immunol. 62, 530-534. 23 Totterman, T.H., Nilsson, K. and Sundstrom, C. (1980) Nature (London) 288, 176-178. 24 Yoshizaki, K., Nakagawa, T., Kaedia, T., Muraguchi, A., Yamamura, Y. and Kishimoto, T. (1982) J. Immunol. 128, 12961301. 25 Carlsson, M., Totterman, T.H., Matsson, P. and Nilsson, K. (1988) Blood 71,415-421. 26 Nilsson, K., Larsson, L-G, Carlsson, M., Danursund, A., Forsbeck, K., Hellman, L., Totterman, T. and Petersson, U. (1986) Current Topics Microbiol. and Immunol. 132, 2810-2819. 27 Gordon J., Mellstedt, H., Aman, P., Biberfeld, P. and Klein, G. (1984) J. Immunol. 134, 541-547. 28 Forsbeck, K., Hellman, L., Danursund, A., Totterman, T.H., Petterson, U. and Nilsson, K. (1987) Leukemia 1, 38-43. 29 Larsson, L-G., Gray, H.E., Totterman, T., Petterson, U. and Nilsson, K. (1987) Proc. Natl. Acad. Sci. USA 84, 223-227. 30 Norton, J.D., Leber, B. and Yaxley, J.C. (1987) FEBS Lett. 215, 127-131. 31 Janossy, G., Campana, D. and Bollum, F.J. (1986) in Methods in Haematology (Beverley, P., ed.), Vol. 13, pp.97-131, Churchill Livingston, New York. 32 Chirgwin, J.M., Przbyla, A.E., MacDonald, R.J. and Rutter, W.J. (1979) Biochemistry 18, 5294-5299.

33 Aviv, H. and Leder, P. (1982) Proc. Natl. Acad. Sci. USA 69, 1408-1412. 34 Gubler, W. and Hoffman, B.J. (1983) Gene 25, 265-269. 35 Hyunh, T.V., Young, R.A. and Davis, R.W. (1985) in DNA Cloning Techniques (Glover, D., ed.), Vol. 1, pp. 49-71, IRL Press, Oxford. 36 Benton, W.D. and Davis, R.W. (1977) Science 196, 180-182. 37 Carter, A.T., Norton, J.D. and Avery, R.J. (1983) Nucleic Acids Res. 11, 6243-6254. 38 Maniatis, T., Fritsch, E.F. and Sambrook, J. (1989) In Molecular Cloning a Laboratory Manual, Cold Spring Harbor Laboratories, Cold Spring Harbour, NY. 39 Feinberg, A.P. and Vogelstein, B. (1983) Analyt. Biochem. 132, 6-11. 40 Norton, J.D., Connor, J. and Avery, R.J. (1984) Nucleic Acids Res. 12, 3445-3460. 41 Lehrach, H., Diamond, D., Wozney, J.M. and Boedtker, H. (1977) Biochemistry 16, 4743-4751. 42 Ravetch, J.V., Siebenlist, U., Korsmeyer, S., Waldmann, T. and Leder, P. (1981) Cell 27, 583-591. 43 Von Euler H. and Hahn, L. (1948) Arch. Biochem. 17, 285-291. 44 Pannuti, A., Lanfrancone, L., Pascucci, A., Pelicci, P-G., La Mantia, G. and Lania, L. (1988) Nucleic Acids Res. 16, 4227-4237. 45 Schenning, L., Larhammar, D., Bill, P. Wiman, J.G., Jonsson, A.-K., Rask, L. and Peterson, P.A. (1984) EMBO J. 3, 447-452. 46 Guy, K., Van Heningen, V., Newman, R. and Steel, C.M. (1982) Eur. J. Immunol. 12, 942-948. 47 Friezner Degen, S.J., Rajput, B. and Reich, E. (1986) J. Biol. Chem. 261, 6972-6985. 48 Selton, G., Cuypers, H.T., Boelens, W., Robanus-Maandag, E., Verbeek, J., Domen, J., Van Beveren, C. and Berns, A. (1986) Cell 46, 603-611. 49 Sen, R. and Baltimore, D. (1986) Cell 47, 921-928. 50 Gale, R.P. and Foon, K.A. (1985) Ann. Intern. Med. 103, 101-120. 51 Nilsson. K., Totterman, T.H., Danersund, A., Forsbeck, K., Helman, L. and Petersson, U. (1985) in Molecular Biology of Tumor Cells (Wahren, B., ed.), pp. 232-242, Raven Press, New York. 52 Catovsky, D., Cherchi, M., Brooks, D., Bradley, J. and Zola, H. (1981) Blood 58, 406-408. 53 Heikkila, R., Schwab, G., Wickstrom, E., Loke, S.L., Pluznik, D.M., Watt, R. and Neckers, L.M. (1987) Nature (London) 328, 445-449. 54 Iguchi-Ariga, S.M.M., Itani, T., Kiji, Y. and Ariga, M. (1987) EMBO J. 6, 2365-2371. 55 Syapin, P.J., Savaterra, P.M. and Engelhardt, J.K. (1982) Brain Res. 231, 365-377. 56 Rovera G., Santoli, D. and Damsky, C. (1979) Proc. Natl. Acad. Sci. USA 76, 2779-2783. 57 Exley R., Gordon, J. and Clemens, M.J. (1988) Proc. Natl. Acad. Sci. USA 84, 6467-6470. 58 Angel, P., Imagawa, M., Chiu, R., Stein, B., Imbra, R.J., Rahmsdorf, H.J., Jonat, C., Herrlich, P. and Karin, M. (1987) Cell 49, 729-739. 59 Chiu, R., Boyle, W.T., Meek, J., Smeal, T., Hunter, T. and Karin, M. (1988) Cell 54, 542-552. 60 Nishizuka, Y. (1984) Nature (London) 308, 693-698. 61 Irving, S.G., June, C.H., Zipfel, P.F., Siebenlist, U. and Kelly, K. (1989) Mol. Cell. Biol. 9, 1034-1040. 62 White, M.W., Oberhauser, A.Y., Kuepfer, C.A. and Morris, D.R. (1987) Mol. Cell. Biol. 7, 3004-3007.