Cellular transformation of human mammary epithelial cells by SATB2

Stem Cell Research 19 (2017) 139–147

Contents lists available at ScienceDirect

Stem Cell Research journal homepage: www.elsevier.com/locate/scr

Cellular transformation of human mammary epithelial cells by SATB2 Wei Yu a, Yiming Ma a, Augusto C. Ochoa b, Sharmila Shankar a,c,1, Rakesh K. Srivastava a,d,⁎,1 a

Kansas City VA Medical Center, 4801 Linwood Boulevard, Kansas City, MO 66128, United States Stanley S. Scott Cancer Center, Department of Pediatrics, Louisiana State University Health Sciences Center, New Orleans, LA 70112, United States c Department of Pathology, University of Missouri-School of Medicine, Kansas City, MO 64108, United States d Department of Pharmacology and Toxicology, University of Missouri, Kansas City, MO 64108, United States b

a r t i c l e

i n f o

Article history: Received 26 May 2016 Received in revised form 4 January 2017 Accepted 30 January 2017 Available online 1 February 2017

a b s t r a c t Breast tumors are heterogeneous and carry a small population of progenitor cells that can produce various subtypes of breast cancer. SATB2 (special AT-rich binding protein-2) is a newly identified transcription factor and epigenetic regulator. It is highly expressed in embryonic stem cells, but not in adult tissues, and regulates pluripotency-maintaining factors. However, the molecular mechanisms by which SATB2 induces transformation of human mammary epithelial cells (HMECs) leading to malignant phenotype are unknown. The main goal of this paper is to examine the molecular mechanisms by which SATB2 induces cellular transformation of HMECs into cells that are capable of self-renewal. SATB2-transformed HMECs gain the phenotype of breast progenitor cells by expressing markers of stem cells, pluripotency-maintaining factor, and epithelial to mesenchymal transition. SATB2 is highly expressed in human breast cancer cell lines, primary mammary tissues and cancer stem cells (CSCs), but not in HMECs and normal breast tissues. Chromatin Immunoprecipitation assays demonstrate that SATB2 can directly bind to promoters of Bcl-2, c-Myc, Nanog, Klf4, and XIAP, suggesting a role of SATB2 in regulation of pluripotency, cell survival and proliferation. Furthermore, inhibition of SATB2 by shRNA in breast cancer cell lines and CSCs attenuates cell proliferation and EMT phenotype. Our results suggest that SATB2 induces dedifferentiation/transformation of mature HMECs into progenitor-like cells. © 2017 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

1. Introduction Breast cancer is the most common cancer in American women (Siegel et al., 2016). According to American Cancer Society's estimates, 246,660 new cases of invasive breast cancer will be diagnosed in women, and about 40,450 women will die from breast cancer in 2016 (Siegel et al., 2016). Despite significant advances in diagnosis, surgical techniques, and the development of targeted and adjuvant therapies, metastatic breast cancer remains at the top of the current clinical challenges limiting the survival of breast cancer patients. Therefore, a deeper understanding of the metastatic cascade and identification of novel targets in the molecular network that could explain differences in the etiology of sporadic cases, may serve as a key factor to reduce morbidity and mortality in breast cancer patients. Furthermore, identifying such factors may provide new avenues for cancer detection, prevention and therapeutics.

⁎ Corresponding author at: Stanley S. Scott Cancer Center, Department of Genetics, Louisiana State University Health Sciences Center, New Orleans, LA 70112, United States. E-mail address: [email protected] (R.K. Srivastava). 1 Current address: Stanley S. Scott Cancer Center, and Department of Genetics, Louisiana State University Health Sciences Center, New Orleans, LA 70112, United States.

SATB2 (special AT-rich binding protein-2) is a transcription factor that binds DNA in nuclear matrix attachment regions (Dobreva et al., 2003), regulates gene expression both by modulating chromatin architecture and by functioning as a transcriptional co-factor (Cai et al., 2006; Dobreva et al., 2006; Britanova et al., 2005; Gyorgy et al., 2008; Notani et al., 2010). SATB2 gene is conserved in humans and mouse. In humans, there are three transcripts that encode for SATB2 protein. Human and mouse share three Oct-4, one Nanog and two c-Myc binding sites on chromosome 2. By promoter analysis, we have identified new SATB2 binding sites on Nanog, Oct-4, c-Myc, Sox-2 and Klf4 promoters. Thus, SATB2 can modulate the expression of pluripotency-maintaining factors Nanog, Oct-4, c-Myc, Sox-2 and Klf-4. SATB2−/− mice are defective in bone development and osteoblast differentiation (Dobreva et al., 2006). SATB2 is also linked to craniofacial patterning and osteoblast differentiation (Dobreva et al., 2006), and the development of cortical neurons (Britanova et al., 2005, 2008; Gyorgy et al., 2008; Notani et al., 2010). In cancer, SATB2 has been suggested as a diagnostic marker for colon cancer because it is overexpressed in 85% of CRC tumors (Magnusson et al., 2011). In breast cancer, the expression of SATB2 mRNA has been associated with increasing tumor grade and poorer survival (Patani et al., 2009). Transfection of Oct-4, c-Myc, Sox-2 and Klf-4 into mature fibroblasts leads to dedifferentiation and formation of progenitor cells with various functions. However, the role of a single

http://dx.doi.org/10.1016/j.scr.2017.01.011 1873-5061/© 2017 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

140

W. Yu et al. / Stem Cell Research 19 (2017) 139–147

factor like SATB2 which can regulate these genes in converting epithelial cells into mammary progenitor cells has not been demonstrated. Recent studies have proposed the involvement of CSCs/progenitor cells in cancer initiation, progression, metastasis and therapy failure (Cariati and Purushotham, 2008; Gonzalez-Sarmiento and Perez-Losada, 2008; Lawson et al., 2009; Liu et al., 2005; Lynch et al., 2006; Ponti et al., 2006). Normal stem cells share many common characteristics with CSCs e.g. expression of cell surface markers and pluripotency-maintaining factors. Stem cells heavily depend on the pluripotency-maintaining factors (c-Myc, Oct-4, Sox-2 and Klf-4) for their self-renewal and survival (Luo et al., 2010; Abdelalim et al., 2014; Dutta, 2013; Liu et al., 2013; Dalton, 2013; Shi and Jin, 2010). Since SATB2 regulates expression of cMyc, Oct-4, Sox-2 and Klf-4, we wondered if it can induce cellular transformation/dedifferentiation. The main objective of the paper was to examine the role of SATB2 in transformation/dedifferentiation of human mammary epithelial cells (HMECs) and to examine the molecular mechanisms by which SATB2 induces dedifferentiation/transformation of HMECs into mammary progenitor-like cells. Our data demonstrate that SATB2 is highly expressed in human breast cancer cells, CSCs, and primary breast cancer tissues. However, it is not expressed in human normal breast tissues and HMECs. Our studies suggest that SATB2 acting alone can transform HMECs under certain conditions. Inhibition of SATB2 by shRNA abolished the ability of breast CSCs to proliferate, self-renew and under go through EMT. Overall, our data demonstrate that SATB2 alone is capable of inducing dedifferentiation of normal HMECs into progenitor-like cells which are capable of forming mammospheres, self-renew and proliferate. 2. Materials and methods 2.1. Cell culture conditions and reagents MCF-7, MDA-MB-231 and human mammary epithelial cells (HMECs) were purchased from American Type Culture Collection (Manassas, VA). Breast cancer cell lines were grown in Dulbecco's Modified Eagle's Medium with 10% Fetal Bovine Serum with antibiotics. HMECs and culture medium were purchased from Lonza (Walkersville, MD). Human breast CSCs were characterized elsewhere (Kumar et al., 2013). Antibodies against SATB2, Bcl-2, c-Myc, Nanog, Klf4, Xiap, and β-actin were purchased from Cell Signaling Technology, Inc. (Danvers, MA). ChIP grade anti-SATB2 antibody was purchased from Abcam (Cambridge, MA). Enhanced chemiluminescence (ECL) Western blot detection reagents were purchased from Amersham Life Sciences Inc. (Arlington Heights, IL). PEG-it virus precipitation solution was purchased from SBI System Biosciences (Mountain View, CA). 2.2. Lentiviral particle production and transduction We have followed the protocol for lentivirus production and transduction as described elsewhere (Sethi et al., 2012; Waalkes et al., 1988a). In brief, purified plasmids (1 μg) were transfected into HEK293T cells using lipid transfection reagent (Lipofectamine-2000/Plus reagent, Invitrogen) along with helper plasmids psPAX2 and pMD2.G. We have used a mixture of validated plasmids targeting 4 different sites on SATB2 (pTRIPZ, GE Dharmacon, Lafayette, CO). Viral supernatants were collected, PEG-it virus precipitation solution (SBI System Biosciences) was added, and mixture was concentrated by ultracentrifugation to produce virus stocks with titers of 1 × 108 to 1 × 109 infectious units per ml. Lentiviral particles expressing gene of interest along with 8 μg/ml polybrene was used to transduce cells. Positive clones were obtained upon puromycin selection. 2.3. Wound-healing/motility assay We used wound-healing assay to monitor the horizontal movement of cells as described elsewhere (Waalkes et al., 1992). In brief, cells were

seeded in a 6-well plate to form a 100% confluent monolayer. A wound was introduced by running a 10-μl pipette tip homogeneously across the monolayer, followed by washing with PBS to remove cell debris. The wounded areas were photographed each day. Three replicate wells from a 6-well plate were used for each experimental condition. 2.4. Transwell migration assay Transwell migration assay was performed as described elsewhere (Sethi et al., 2012). In brief, 1 × 105 breast cancer cells and CSCs were plated in the top chamber onto the noncoated membrane (24-well insert; pore size, 8 μm; Corning Costar) and allowed to migrate toward serum-containing medium in the lower chamber. Cells were fixed after 24 h of incubation with methanol and stained with 0.1% crystal violet (2 mg/ml, Sigma-Aldrich). The number of cells invading through the membrane was counted under a light microscope. 2.5. Transwell invasion assay Transwell invasion assay was performed as described elsewhere (Sethi et al., 2012). In brief, 1 × 105 cells were plated in the top chamber onto the Matrigel coated Membrane (24-well insert; pore size, 8 μm; Corning Costar). Each well was coated freshly with Matrigel (60 μg; BD Bioscience) before the invasion assay. Breast cancer cells and CSCs were plated in medium without serum or growth factors, and medium supplemented with serum was used as a chemoattractant in the lower chamber. The cells were incubated for 48 h and cells that did not invade through the pores were removed by a cotton swab. Cells on the lower surface of the membrane were fixed with methanol and stained with crystal violet. The number of cells invading through the membrane was counted under a light microscope (40 × three random fields per well). 2.6. Western blot analysis The Western blot analysis was performed as we described earlier (Asara et al., 2013). In brief, cells were lysed in RIPA buffer (Thermo Fisher Scientific, Rockford, IL) with protease inhibitors (Complete Protease Inhibitor Cocktail Tablets, Roche) and phosphatase inhibitors (Phosphate Inhibitor, Thermo Fisher Scientific) and cleared by centrifugation. Proteins were quantified by BCA assay (Thermo Fisher Scientific). Cell lysates were diluted in reducing Laemmli buffer, denatured by incubation at 95 °C, run on SDS-PAGE, and transferred to a nitrocellulose membrane (Amersham Biosciences, Piscataway, NJ). The membranes were blocked with 5% BSA in Tris-Tween buffered saline at 37 °C for 2 h and then incubated with primary antibody diluted in tris-buffered saline (1:1000 dilutions) overnight at 4 °C. The membranes were then washed three times with tris-buffered saline-T (TBS-T), and incubated with horseradish peroxidase-conjugated secondary antibodies (1:5000) for 1 h. After incubation with secondary antibody, the membranes were washed again three times with TBS-T. Finally, protein antibody complexes were detected by the addition of ECL substrate (Thermo Fisher Scientific). 2.7. Chromatin Immunoprecipitation assay Chromatin Immunoprecipitation (ChIP) assays were performed as we described elsewhere (Yu et al., 2016). Breast CSCs were fixed with 1% formaldehyde for 15 min (RT), quenched with 125 mM glycine for 5 min (RT), centrifuged and resuspended in RIPA Buffer containing protease inhibitors and incubated on ice for 10 min. Samples were sonicated to shear chromatin to an average length of about 1 kb, transferred to 1.5 ml tubes, and microcentrifuged at 12,000 rpm for 10 min. Supernatants were collected in 1.5 ml tubes containing 1 ml of the Dilution Buffer (0.01% SDS, 1.1% Triton, 1.2 mM EDTA, 167 mM NaCl, 17 mM Tris, pH 8), and 3 μg of SATB2 antibody was added. Samples were incubated

W. Yu et al. / Stem Cell Research 19 (2017) 139–147

overnight at 4 °C, followed by addition of 5 μl of protein-A and protein-G magnetic beads (Invitrogen) for 2 h. Beads were collected, and washed 4 times with 1 ml of each of four Wash Buffers (Wash Buffer 1: 0.1% SDS, 1% Triton, 2 mM EDTA, 150 mM NaCl, 20 mM Tris, pH 8; Wash Buffer 2: 0.1% SDS, 1% Triton, 2 mM EDTA, 500 mM NaCl, 20 mM Tris, pH 8; Wash Buffer 3: 0.25 M LiCl, 1% NP-40, 1% deoxycholate, 1 mM EDTA, 10 mM Tris, pH 8; Wash Buffer 4: 10 mM Tris, pH 8, 1 mM EDTA). After the last wash, 50 μl of a 10% Chelex-100 (Bio-Rad) resin solution was added to the beads, samples were boiled for 10 min and microcentrifuged at 10,000 rpm for 1 min. Supernatants were collected, 50 μl of MQ water was added back to the beads, microcentrifuged again for 1 min, and the new supernatant was pooled with the previous one. 1–3 μl elutions were used for PCR reaction. NANOG promoter-ChIP-F, ACCTAGTCTGGGTTACTCTGC NANOG promoter-ChIP-R, TCAAGAAATTGGGATAAAGTG Bcl-2 promoter-ChIP-F, TTTCAGCATCACAGAGGAAG Bcl-2 promoter-ChIP-R, CAATCACGCGGAACACTTGATT Klf4 promoter-Chip-F, ACCGGACCTACTTACTCGCC Klf4 promoter-Chip-R, TCGGCAGCCCGAAGCAGCTGG Myc promoter-Chip-F, AATTAATGCCTGGAAGGCAGCC Myc promoter-ChIP-R, AGTCAGCAGAGACCCTTGTG Xiap promoter-Chip-F, TCCAAGAGAGATGCACTAGGGTC Xiap promoter-Chip-R, TTATGGCAAGATCTATGTGGAACTC 2.8. Quantitative real-time PCR Total RNA was isolated using an RNeasy Mini Kit (Qiagen, Valencia, CA). Briefly, cDNA was synthesized using a high capacity cDNA reverse transcription kit (Applied Biosystems). Primers specific for each of the signaling molecules were designed using NCBI/Primer-BLAST and used to generate the PCR products. For the quantification of gene amplification, real-time PCR was performed using an ABI 7300 Sequence Detection System in the presence of SYBR-Green. Relative expression of the mRNA was estimated using the 2− ΔΔCt method. The following genespecific primers were used: Snail (5′-ACC CCA CAT CCT TCT CAC TG-3′, 5′-TAC AAA AAC CCA CGC AGA CA-3′) Slug (5′-ACA CAC ACA CAC CCA CAG AG-3′, 5′-AAA TGA TTT GGC AGC AAT GT-3′) N-cadherin (5′-TGG ATG GAC CTT ATG TTG CT-3′, 5′-AAC ACC TGT CTT GGG ATC AA-3′) Lef1 (5′-ATGTCAACTCCAAACAAGGCA-3′, 5′-CCCGGAGACAAGGGA TAAAAAGT-3′) CD24 (5′-ATG GGA ACA AAC AGA TCG AA-3′, 5′-TTT GCT CTT TCA GCC ATT TC-3′) CD44 (5′-AGC AAC CAA GAG GCA AGA AA-3′, 5′-GTG TGG TTG AAA TGG TGC TG-3′) Nanog (5′-ACC TAC CTA CCC CAG CCT TT-3′, 5′-CAT GCA GGA CTG CAG AGA TT-3′) c-Myc (5′-CGA CGA GAC CTT CAT CAA AA-3′, 5′-TGC TGT CGT TGA GAG GGT AG-3′) SATB2 (5′-AGG GGC TCC CTC TCA AAT AA-3′, 5′-GAG CTG CAC AAC GAT TCA AA-3′) HK-GAPD (5′-GAG TCA ACG GAT TTG GTC GT-3′, 5′-TTG ATT TTG GAG GGA TCT CG-3′) 2.9. Immunofluorescence and immunohistochemistry We have used immunofluorescence technique as we described elsewhere (Kumar et al., 2013). Briefly, HMEC/SATB2 cells were grown on fibronectin-coated coverslips (Becton Dickinson, Bedford, MA). Cells were fixed with methanol, permeabilized with 1% NP-40, and blocked with 10% BSA, followed by incubating with anti-CD44 or anti-CD24 antibody (Santa Cruz Biotechnology). After washing, cells were incubated with FITC-labeled secondary antibody (Santa Cruz Biotechnology). Finally, coverslips were washed and mounted using Vectashield (Vector

141

Laboratories, Burlington, CA). Stained slides were examined under a fluorescence microscope. Cells without primary antibodies (secondary antibody alone), or with Isotype-specific control IgG, were used as negative controls. Human breast normal and cancer tissue arrays were purchased from (US Biomax, Inc., Rockville, MD). Immunohistochemistry of human breast normal and tumor tissues was performed as we described elsewhere (Shankar et al., 2011). 2.10. Statistical analysis Unless indicated otherwise, all the data shown represent mean with SD with four replicates. Differences between groups were analyzed by ANOVA, followed by Bonferroni's multiple comparison tests using PRISM statistical analysis software (GraphPad Software, Inc., San Diego, CA). Significant differences among groups were calculated at P b 0.05. 3. Results 3.1. SATB2 is highly expressed in breast cancer stem cells (CSCs), cell lines and mammary tissues, but not in human normal mammary epithelial cells (HMECs), and normal tissues We first compared the expression of SATB2 in human breast mammary epithelial cells (HMECs), breast cancer cell lines (MCF-7 and MDA-MB-231) and breast CSCs by q-RT-PCR. As shown in Fig. 1A, SATB2 is not expressed in HMECs. However, it is expressed in breast cancer MCF-7 and MDA-MB-231 cell lines and was the highest in breast CSCs. We confirmed the expression of SATB2 by Western blot analysis and immunocytochemistry (Fig. 1B and C), showing that SATB2 was highly expressed in breast CSCs compared to MCF-7 and MDA-MB231 cells, but not in HMECs. SATB2 was mainly localized to nuclei, and the nuclear expression was correlated with the mRNA and protein expression. These data suggest that the expression of SATB2 is tightly regulated in breast cancer/transformed cells. We next examined the expression of SATB2 in normal human breast and breast cancer tissues. SATB2 is highly expressed in human breast cancer tissues (Fig. 1D, middle and right panels). By comparison, the expression of SATB2 was not observed in human normal breast tissues (Fig. 1D, left panel). The expression of SATB2 in human breast cancer tissues and CSCs, but not in HMECs and normal breast tissue, suggest it may play a role in cancer growth and metastasis. 3.2. Overexpression of SATB2 in HMECs induces cellular transformation and stemness The characteristics of cell transformation are a high/indefinite saturation growth density, the lack of contact inhibition, the absence of an oriented growth, the loss of tight junction and the formation of colonies. To testify SATB2 induced cellular transformation and stemness, we overexpressed SATB2 in HMECs by lentiviral-mediated transduction, and measured the formation of colonies and mammospheres in suspension. Overexpression of SATB2 in HMECs (HMEC/SATB2) induces cellular transformation as evident by the formation of colonies and mammospheres in suspension (Fig. 2A, upper and lower right panels). HMEC/Empty Vector control cells were unable to form colonies and mammospheres in suspension as compared to HMEC/SATB2 cells (Fig. 2A). Lentiviral mediated infection of SATB2 gene in HMECs (HMEC/SATB2) resulted in an increased expression of SATB2 mRNA, as measured by q-RTPCR and immunocytochemistry (Fig. 2B and C). We next examined whether SATB2 induced transformation, and whether transformed cells gained the expression of stemness markers, pluripotency maintaining factors, stemness regulator and EMT. The TCF/LEF signaling pathway is a key regulator of self-renewal and cell fate determination in stem/progenitor cells. Overexpression of SATB2 in HMECs resulted in induction of pluripotency maintaining factors (c-

142

W. Yu et al. / Stem Cell Research 19 (2017) 139–147

Fig. 1. The expression of SATB2 in HMECs, breast cancer cell lines and breast CSCs. (A), Expression of SATB2 mRNA in human breast mammary epithelial cells (HMECs), breast cancer cell lines (MCF-7 and MDA-MB-231) and breast CSCs. RNA was isolated and the expression of SATB2 was measured by q-RT-PCR. GAPDH was used as an internal control. Data represent mean (n = 4) ± SD. *, # and % = significantly different from HMECs (P b 0.05). (B), Protein expression of SATB2 in HMECs, breast cancer cell lines and breast CSCs. Crude proteins were isolated and the expression of SATB2 was measured by the Western blot analysis. β-actin was used as a loading control. (C), Immunocytochemistry of SATB2. HMECs, breast cancer cell lines and breast CSCs were subjected to immunocytochemistry using anti-SATB2 antibody. Green color = SATB2; Red color = nucleus; Yellow color = overlay. (D), immunohistochemistry of SATB2 in human breast normal and cancer tissues. Human Breast Tissue Arrays containing normal and cancerous tissues were purchased from Biomax. Immunohistochemistry of human breast normal and cancer tissue arrays was performed. Representative pictures of 10 tissue samples from breast normal, and cancer (T2N0M0 and T2N1M0) are shown. Blue = nuclei, Brown/pink color = SATB2 expression.

Myc and Nanog), stem cell markers (CD44 and CD24), and stem cell regulator Lef1 (Fig. 2D and E). Furthermore, SATB2 also induces N-Cadherin (a mesenchymal gene) and Slug and Snail (EMT-inducing transcription factors) (Fig. 2F). We next examined whether SATB2-trasformed cells exhibited enhanced capability of cell proliferation compared to wild type HMECs. As shown in Fig. 2G, cell proliferation was significantly higher in HMEC/ SATB2 cells compared to HMEC/Empty vector cells. Overall, these data suggest that SATB2 can induce cellular transformation in HMECs and these transformed cells gain the characteristics of progenitor cells with higher rate of cell proliferation compared to wild type HMECs. 3.3. Knockdown of SATB2 in breast CSCs and cell lines inhibits mammosphere formation, cell proliferation, and colony formation SATB2 plays an important role in the chromatin remodeling and regulation of gene expression which participates in stemness, cell survival and differentiation. To further examine the role of SATB2, we inhibited SATB2 by shRNA and measured its expression by the Western blot analysis (Fig. 3A). Knockdown of SATB2 in breast CSCs, MCF-7 and MDA-MB231 cells by shRNA inhibited SATB2 protein expression as measured by the Western blot analysis (Fig. 3A). We next examined whether knockdown of SATB2 inhibits mammosphere formation by breast CSCs. The ability to form mammospheres in suspension by CSCs is the main characteristics of breast progenitor cells. Breast CSCs/Scrambled cells formed

mammospheres in suspension (Fig. 3B, left panel). In contrast, breast CSCs/SATB2 shRNA cells formed very few and smaller mammospheres (right panel). These data suggest that inhibition of SATB2 expression retarded the ability of breast CSCs to form mammospheres. We then tested whether inhibition of SATB2 attenuated the growth of breast cancer MCF-7 and MDA-MB-231 cell lines, and breast CSCs. Cells were transduced with either scrambled or SATB2 shRNA lentiviral particles, and cell proliferation was measured over 4 days period. MCF-7/ SATB2 shRNA, MDA-MB-231/SATB2 shRNA and breast CSCs/SATB2 shRNA cells had lower cell proliferation over time than MCF-7/Scrambled, MDA-MB-231/Scrambled, and breast CSCs/Scrambled cells, respectively (Fig. 3C). These data suggest that the knockdown of SATB2 in breast cancer cells and CSCs can suppress breast cancer cell proliferation. We next examined the effects of SATB2 inhibition on colony formation in soft agar. The inhibition SATB2 expression by shRNA attenuated colony formation in MCF-7/SATB2 shRNA, MDA-MB-231/SATB2 shRNA and breast CSCs cells compared to their scrambled control groups (Fig. 3D). These data suggest that inhibition of SATB2 expression in breast cancer cells and CSCs can retard cell proliferation and colony formation. 3.4. Knockdown of SATB2 in breast CSCs inhibits markers of stem cells, pluripotency maintaining factors and cell proliferation Since SATB2 shRNA inhibited mammosphere formatin by breast CSCs, we next examined the effects of inhibiting SATB2 on markers of

W. Yu et al. / Stem Cell Research 19 (2017) 139–147

143

Fig. 2. Overexpression of SATB2 in HMECs induces cellular transformation and stemness. (A), Colony and mammosphere formation. HMECs were stably transduced with lentiviral particles expressing either empty vector or SATB2 cDNA. Colony and mammosphere formation by HMEC/Empty Vector and HMEC/SATB2 overexpressing cells were visualized by microscopy. Note, HMEC/Empty Vector cells did not form colony and mammosphere. Upper panel – colony; Lower panel = mammosphere. (B), SATB2 Expression. SATB2 expression was measured by qRTPCR. Data represent mean (n = 4) ± SD. * = significantly different from each other, P b 0.05. (C), Immunocytochemstry of SATB2. HMEC/SATB2 cells were subjected to immunocytochemistry using anti-SATB2 antibody. Green color = SATB2; Red color = nucleus; Yellow color = overlay. (D–F) RNA was isolated, and the expression of pluripotency maintaining factors (c-Myc and Nanog), breast CSC markers (CD44 and CD24), Lef1, and EMT-related genes (Slug, Snail and N-cadherin) was measured by qRT-PCR analysis. Data represent mean (n = 4) ± SD. * = significantly different from HMEC/Empty Vector group (P b 0.05). Gene expression of HMEC/Empty Vector was normalized to 1. (G), Cell proliferation. HMEC/Empty Vector and HMEC/SATB2 cDNA cells were seeded in 6-well plates. Number of cells during 5-day period was counted by trypan blue assay. Data represent mean (n = 4) ± SD. *, #, and @ = significantly different from HMEC/Empty Vector group, P b 0.05.

stem cells (CD44), pluripotency maintaining transcription factors (Oct4, Nanog and c-Myc) and cell proliferation (Bcl-2). Transduction of breast CSCs with lentiviral particles expressing SATB2 shRNA inhibited the expression of CD44 mRNA and proteins compared to the scrambled group (Fig. 4A). These data suggest that SATB2 inhibition may results in reducing the CD44-positive CSCs. We next examined the effects of SATB2 shRNA on Oct-4, Nanog, and c-Myc (transcription factors required for maintaining pluripotency), and Bcl-2 (required for cell proliferation). SATB2 shRNA inhibited the expression of Oct-4, Nanog, c-Myc and Bcl-2 in CSCs/SATB2 shRNA group compared to that in CSCs/Scrambled group (Fig. 4B and C). Overall, these data suggest that SATB2 shRNA inhibits the expression of stem cell and pluripotency markers, and thus can inhibit the ability of breast CSCs to self-renew and proliferate.

3.5. SATB2 directly binds to promoters of Bcl-2, c-Myc, Nanog, Klf4, and XIAP in breast cancer stem cells We next used Chromatin Immunoprecipitation (ChIP) assay to determine if SATB2 directly bound to the regulatory DNA elements of these genes which play direct role in pluripotency (c-Myc, Klf4 and Nanog), cell survival (XIAP) and proliferation (Bcl-2). ChIP assays

were performed in breast CSCs to identify SATB2 binding partners (Fig. 5). The data demonstrate that SATB2 can directly bind to promoters of Bcl-2, c-Myc, Nanog, Klf4 and XIAP, suggesting the role of SATB2 in regulation of pluripotency, cell survival and proliferation.

3.6. Knockdown of SATB2 in breast CSCs and cancer cell lines inhibits motility, invasion and migration Finally we tested the effect of SATB2 inhibition on the cell function characteristic of EMT transformation. The EMT program has emerged as a central driver of tumor malignancy in which cancer stem cells (CSCs), a subpopulation of cancer cells that are responsible for initiating and propagating the disease, are generated (Ye and Weinberg, 2015). CSCs demonstrate mesenchymal phenotype with high expression of N-cadherin and EMT-inducing transcription factors such as Slug and Snail. We therefore examined whether inhibition of SATB2 attenuated cell motility, invasion and migration of breast CSCs and breast cancer cell lines. As shown in Fig. 6A, SATB2 shRNA inhibited cell motility, invasion and migration of breast CSCs. Similarly, MDA-MB-231/SATB2 shRNA and MCF-7/SATB2 shRNA cells were less motile compared to control groups (data not shown). Furthermore, MDA-MB-231/SATB2 shRNA and MCF-7/SATB2 shRNA cells demonstrate lower ability to

144

W. Yu et al. / Stem Cell Research 19 (2017) 139–147

Fig. 3. Knockdown of SATB2 in breast CSCs and cell lines inhibits mammosphere formation, cell proliferation, and colony formation. (A), Protein expression of SATB2. MCF-7, MDA-MB-231 and breast CSCs were transduced with lentiviral particles expressing either Scrambled or SATB2 shRNA. Western blot analysis was performed to measure the expression of SATB2. β-actin was used as a loading control. (B), Inhibition of mammosphere formation by SATB2 shRNA. Breast CSCs were transduced with either scrambled or SATB2 shRNA. Transduced CSCs were grown in suspension for one week, and mammospheres were photographed by microscope. Upper Panel = Mammospheres; Lower panel = DAPI stained same mammospheres. (C), MCF7, MDA-MB-231 and breast CSCs were transduced with lentiviral particles expressing either Scrambled or SATB2 shRNA. Cell proliferation of MCF-7/Scrambled, MDA-MB-231/Scrambled, Breast CSCs/Scrambled, MCF-7/SATB2 shRNA, MDA-MB-231/SATB2 shRNA and Breast CSCs/SATB2 shRNA groups was measured over 4-day period. Data represent mean (n = 4) ± SD. *, %, # = significantly different from Scrambled/control group (P b 0.05). (D), Colony formation Assay. MCF-7/Scrambled, MCF-7/SATB2 shRNA, MDA-MB-231/Scrambled, MDA-MB-231/ SATB2 shRNA, Breast CSCs/Scrambled, and Breast CSCs/SATB2 shRNA cells were seeded, and number of colonies formed at 21 days were counted (Shankar et al., 2011; Waalkes et al., 1988b). Data represent mean (n = 4) ± SD. * = significantly different from Scrambled group (P b 0.05).

invade and migrate compared to MDA-MB-231/Scrambled and MCF-7/ Scrambled cells, respectively (Fig. 6B and C). Since SATB2 inhibited cell motility, invasion and migration, we next measured the expression of EMT-related genes and proteins (Fig. 6D). Zeb1 is a transcription factor which is induced during EMT and thus inhibits the expression of Ecadherin. STAB2 shRNA induced the expression of E-cadherin, and inhibited the expression of N-cadherin and Zeb1 at mRNA and protein levels. These data suggest that inhibition of SATB2 expression in breast cancer cells can suppress EMT processes (cell motility, invasion and migration) by modulating the expression of cadherins and Zeb1. 4. Discussion Breast tumors are heterogeneous in nature and carry a small population of progenitor-like cells or cancer stem cells (Visvader and Stingl, 2014; Carrasco et al., 2014). SATB2 is highly expressed in embryonic stem cells, but not in adult tissues (Ordonez, 2014; Rosenfeld et al., 2009; Zhao et al., 2014). Our studies are the first one to examine the molecular mechanisms by which SATB2 induces cellular transformation of human mammary epithelial cells, and promotes breast cancer progression and EMT. Specifically, we have demonstrated that (i) overexpression of SATB2 can transform HMECs; (ii) SATB2-transformed HMECs gain the phenotypes of progenitor-like cells by expressing pluripotency maintaining factors, and markers of stem cell and EMT; (iii) SATB2 is

highly expressed in breast cancer cell lines, primary tissues and CSCs, and but not in HMECs and normal breast tissues; (iv) SATB2 can directly bind to promoters of Bcl-2, c-Myc, Nanog, Klf4 and XIAP, and (iv) inhibition of SATB2 by shRNA in breast cancer cell lines and CSCs attenuates cell proliferation and EMT. Taken together, our results suggest that SATB2 induces breast mammary epithelial cell transformation, and promotes cell growth and EMT by inducing mammary progenitor-like cells. Over study demonstrates that overexpression of SATB2 in human mammary epithelial cells alone is capable of forming progenitor-like cells. SATB2 overexpression in HMECs was associated with the induction of c-Myc and Nanog (pluripotency maintaining factors), CD44 (stem cell marker), and Lef-1 (a stem cell regulator). Our results are consistent with other published reports on breast CSCs which express high levels of CD44 and low levels of CD24. Lef-1 (Lymphoid enhancer factor-1), a Wnt-mediating transcription factor important for cell survival and metastasis in several malignancies, is produced via internal ribosome entry sites (IRES)-directed translation, and its mRNA is frequently upregulated in breast cancer (Petropoulos et al., 2008). Ligand-independent canonical Wnt activity in mammary tumor cells was associated with aberrant LEF1 expression (Gracanin et al., 2014; Cai et al., 2013; Yin et al., 2013; Nguyen et al., 2005; Hatsell et al., 2003; Miyoshi et al., 2002). In other studies, the contribution of Lef-1 in CSC's proliferation, migration, invasion, and self-renewal in various cancers have been reported (Cai et al., 2013; Yin et al., 2013; Gao et

W. Yu et al. / Stem Cell Research 19 (2017) 139–147

145

Fig. 4. Effects of SATB2 shRNA on markers of stem cells, pluripotency and cell proliferation. (A), Expression of CD44. RNA was isolated from breast CSCs/Scrambled and breast CSCs/SATB2 shRNA cells, and the expression of CD44 was measured by q-RT-PCR. GAPDH was used as an internal control. Data represent mean (n = 4) ± SD. * = significantly different between groups (P b 0.05). (B), Expression of c-Myc, Nanog and Oct-4. RNA was isolated from breast CSCs/Scrambled and breast CSCs/SATB2 shRNA cells, and the expression of c-Myc, Nanog, and Oc-4 was measured by q-RT-PCR. GAPDH was used as an internal control. Data represent mean (n = 4) ± SD. * = significantly different between groups (P b 0.05). (C), Expression of Bcl-2. RNA was isolated from breast CSCs/Scrambled and breast CSCs/SATB2 shRNA cells, and the expression of Bcl-2 was measured by q-RT-PCR. GAPDH was used as an internal control. Data represent mean (n = 4) ± SD. * = significantly different between groups (P b 0.05).

al., 2014; Tsai et al., 2014; Anderson et al., 2014; Ho et al., 2013; Reya et al., 2003; Kahler and Westendorf, 2003). These studies suggest that SATB2 can regulate progenitor-cell population and control breast carcinogenesis. Interestingly, SATB2 overexpressing cells demonstrated enhanced cell proliferation in a time-dependent manner, and were able to form

Fig. 5. SATB2 directly binds to promoters of Bcl-2, c-Myc, Nanog, Klf4, and XIAP in breast cancer stem cells. Nuclear extract were collected from Breast CSCs. Chromatin Immunoprecipitation (ChIP) assays in breast CSCs were performed as described in Material and Methods. SATB2 directly binds to promoters of Bcl-2, c-Myc, Nanog, Klf4 and XIAP.

colonies and mammospheres, which are the main characteristics of progenitor cells. Since CSCs are similar to stem cells, and CSCs are found in the breast cancer, we have inhibited the expression of SATB2 in breast CSCs and cancer cell lines. Downregulation of SATB2 shRNA inhibited cell proliferation in breast CSCs and breast cancer MCF-7 (ER positive) and MDA-MB-231 (triple negative) cells, self-renewal capacity of breast CSCs, and decreased the expression of progenitor-like cell marker CD44. These data suggest that SATB2 can regulate cell proliferation irrespective of ER expression. Furthermore, since breast cancer stem cell markers were inhibited by SATB2 shRNA, inhibition of SATB2 may have a direct role in regressing established tumors. However, detailed molecular mechanisms of SATB2 actions are unknown and warrant further investigation. SATB2 has been reported to trigger EMT and increase invasiveness in colon cancer (Yang et al., 2013, 2014). In the present study, we have demonstrated that SATB2 regulates cell motility, invasion and migration in breast cancer, and these phenomena were associated with the induction of mesenchymal marker N-cadherin and EMT transcription factor Slug and Snail. In contrast, SATB2 knockdown attenuated cell motility, invasion and migration in breast CSCs and cell lines and reversed EMT characteristics. Our studies suggest a role of SATB2 in EMT and generation of the progenitor cell-like phenotype which may be capable of breast cancer initiation, progression and metastasis. SATB2 acts as a master regulator by binding to genes which regulate embryonic development, cell differentiation, pluripotency, and cell survival (Ordonez, 2014; Rosenfeld et al., 2009; Zhao et al., 2014). We have discovered the SATB2 binding sites in the promoters of c-Myc, Nanog, Kl4, Bcl-2 and XIAP genes. These SATB2 target genes directly regulate pluripotency, cell survival, cell growth and differentiation in progenitor and transformed cells. Our Chip data confirmed that SATB2 can directly bind to these genes in breast cancer stem cells. The ability of SATB2 to induce transformation of mammary epithelial cells suggests that it is capable of regulating de-differentiation that results into formation of progenitor-like cells. Interestingly, these cells were capable of forming colonies and mammospheres. In an appropriate microenvironment,

146

W. Yu et al. / Stem Cell Research 19 (2017) 139–147

Fig. 6. SATB2 shRNA inhibits cell motility, migration and invasion, and regulates EMT-related gene express in breast CSCs. (A), Cell motility, transwell invasion and migration assays. Upper Panel, Breast CSCs/Scrambled and breast CSCs/SATB2 shRNA cells were grown. After 18 h of incubation, plates were scratched with the fine pipette tips. Phase contrast images of scratched cells were captured at 0 h, 24 and 48 h time points. Middle and Lower Panels, Transwell invasion and migration assays were performed as described elsewhere (Shankar et al., 2011; Waalkes et al., 1988b). Data represent mean (n = 4) ± SD. * = significantly different at P b 0.05. (B and C), Cell invasion and migration by breast cancer cell lines. MDA-MB-231/ Scrambled, MDA-MB-231/SATB2 shRNA, MCF7/Scrambled, and MCF7/SATB2 shRNA cells were seeded, and transwell migration and invasion assays were performed as described elsewhere (Shankar et al., 2011; Waalkes et al., 1988b). Data represent mean (n = 4) ± SD. * = significantly different at P b 0.05. (D), Expression of EMT-related genes in Breast CSCs expressing SATB2 shRNA. The expression of E-Cadherin, N-Cadherin and Zeb1 was measured by q-RT-PCR. GAPDH was used as an internal control. Data represent mean (n = 4) ± SD. * = significantly different between groups (P b 0.05). (E), Expression of EMT-related proteins in breast CSCs. The expression of E-Cadherin, N-Cadherin and Zeb1 was measured by the Western blot analysis. β-actin was used as a loading control.

these cells will be able to form pathologically similar breast cancer tissues. Further studies with SATB2 transgenic or knockout mice will be needed to confirm the role of SATB2 in breast cancer initiation, progression and metastasis. In conclusion, our data demonstrate for the first time that overexpression of SATB2 induces HMEC transformation, and these transformed cells gain the properties of mammary progenitor-like cells. The transformed HMECs appear to be genotypically and phenotypically similar to breast CSCs. Inhibition of SATB2 in breast cancer cells and CSCs suppresses cell proliferation, colony formation, cell motility, migration and invasion. Since SATB2 is not expressed in normal HMECs, but it is highly expressed in human breast cancer cell lines, CSCs and primary breast cancer tissues, it can serve as a diagnostic biomarker of breast cancer. Our findings provide a rationale for developing small molecules or biologic agents targeting SATB2 for therapeutic benefits of patients with breast cancer. The current study will also enhance our understanding of the role of SATB2 in breast cancer initiation, progression and metastasis.

Authors' contributions WY and YM = performed the experiments, analyzed the data, and wrote the manuscript. SS and RKS = designed the study and contributed reagents. All the authors approved the manuscript.

Disclosure of potential conflicts of interest The authors have declared that no competing interests exist. Acknowledgements We thank our lab members for critical reading of the manuscript. References Abdelalim, E.M., Emara, M.M., Kolatkar, P.R., 2014. The SOX transcription factors as key players in pluripotent stem cells. Stem Cells Dev. 23, 2687–2699. Anderson, K.M., Guinan, P., Rubenstein, M., 2014. Normoxic or hypoxic CD44/CD41 a(2) B(1) integrin-positive prostate PC3 cell side fractions and cancer stem cells. Med. Oncol. 31, 779. Asara, Y., Marchal, J.A., Carrasco, E., Boulaiz, H., Solinas, G., Bandiera, P., Garcia, M.A., Farace, C., Montella, A., Madeddu, R., 2013. Cadmium modifies the cell cycle and apoptotic profiles of human breast cancer cells treated with 5-fluorouracil. Int. J. Mol. Sci. 14, 16600–16616. Britanova, O., Akopov, S., Lukyanov, S., Gruss, P., Tarabykin, V., 2005. Novel transcription factor Satb2 interacts with matrix attachment region DNA elements in a tissue-specific manner and demonstrates cell-type-dependent expression in the developing mouse CNS. Eur. J. Neurosci. 21, 658–668. Britanova, O., de Juan Romero, C., Cheung, A., Kwan, K.Y., Schwark, M., Gyorgy, A., Vogel, T., Akopov, S., Mitkovski, M., Agoston, D., Sestan, N., Molnar, Z., Tarabykin, V., 2008. Satb2 is a postmitotic determinant for upper-layer neuron specification in the neocortex. Neuron 57, 378–392. Cai, S., Lee, C.C., Kohwi-Shigematsu, T., 2006. SATB1 packages densely looped, transcriptionally active chromatin for coordinated expression of cytokine genes. Nat. Genet. 38, 1278–1288.

W. Yu et al. / Stem Cell Research 19 (2017) 139–147 Cai, W.Y., Wei, T.Z., Luo, Q.C., Wu, Q.W., Liu, Q.F., Yang, M., Ye, G.D., Wu, J.F., Chen, Y.Y., Sun, G.B., Liu, Y.J., Zhao, W.X., Zhang, Z.M., Li, B.A., 2013. The Wnt-beta-catenin pathway represses let-7 microRNA expression through transactivation of Lin28 to augment breast cancer stem cell expansion. J. Cell Sci. 126, 2877–2889. Cariati, M., Purushotham, A.D., 2008. Stem cells and breast cancer. Histopathology 52, 99–107. Carrasco, E., Alvarez, P.J., Prados, J., Melguizo, C., Rama, A.R., Aranega, A., RodriguezSerrano, F., 2014. Cancer stem cells and their implication in breast cancer. Eur. J. Clin. Investig. 44, 678–687. Dalton, S., 2013. Signaling networks in human pluripotent stem cells. Curr. Opin. Cell Biol. 25, 241–246. Dobreva, G., Dambacher, J., Grosschedl, R., 2003. SUMO modification of a novel MARbinding protein, SATB2, modulates immunoglobulin mu gene expression. Genes Dev. 17, 3048–3061. Dobreva, G., Chahrour, M., Dautzenberg, M., Chirivella, L., Kanzler, B., Farinas, I., Karsenty, G., Grosschedl, R., 2006. SATB2 is a multifunctional determinant of craniofacial patterning and osteoblast differentiation. Cell 125, 971–986. Dutta, D., 2013. Signaling pathways dictating pluripotency in embryonic stem cells. Int. J. Dev. Biol. 57, 667–675. Gao, X., Mi, Y., Ma, Y., Jin, W., 2014. LEF1 regulates glioblastoma cell proliferation, migration, invasion, and cancer stem-like cell self-renewal. Tumour Biol. 35, 11505–11511. Gonzalez-Sarmiento, R., Perez-Losada, J., 2008. Breast cancer, a stem cell disease. Curr. Stem Cell Res. Ther. 3, 55–65. Gracanin, A., Timmermans-Sprang, E.P., van Wolferen, M.E., Rao, N.A., Grizelj, J., Vince, S., Hellmen, E., Mol, J.A., 2014. Ligand-independent canonical Wnt activity in canine mammary tumor cell lines associated with aberrant LEF1 expression. PLoS One 9, e98698. Gyorgy, A.B., Szemes, M., de Juan Romero, C., Tarabykin, V., Agoston, D.V., 2008. SATB2 interacts with chromatin-remodeling molecules in differentiating cortical neurons. Eur. J. Neurosci. 27, 865–873. Hatsell, S., Rowlands, T., Hiremath, M., Cowin, P., 2003. Beta-catenin and Tcfs in mammary development and cancer. J. Mammary Gland Biol. Neoplasia 8, 145–158. Ho, R., Papp, B., Hoffman, J.A., Merrill, B.J., Plath, K., 2013. Stage-specific regulation of reprogramming to induced pluripotent stem cells by Wnt signaling and T cell factor proteins. Cell Rep. 3, 2113–2126. Kahler, R.A., Westendorf, J.J., 2003. Lymphoid enhancer factor-1 and beta-catenin inhibit Runx2-dependent transcriptional activation of the osteocalcin promoter. J. Biol. Chem. 278, 11937–11944. Kumar, D., Shankar, S., Srivastava, R.K., 2013. Rottlerin-induced autophagy leads to the apoptosis in breast cancer stem cells: molecular mechanisms. Mol. Cancer 12, 171. Lawson, J.C., Blatch, G.L., Edkins, A.L., 2009. Cancer stem cells in breast cancer and metastasis. Breast Cancer Res. Treat. 118, 241–254. Liu, S., Dontu, G., Wicha, M.S., 2005. Mammary stem cells, self-renewal pathways, and carcinogenesis. Breast Cancer Res. 7, 86–95. Liu, A., Yu, X., Liu, S., 2013. Pluripotency transcription factors and cancer stem cells: small genes make a big difference. Chin. J. Cancer 32, 483–487. Luo, J., Yin, X., Ma, T., Lu, J., 2010. Stem cells in normal mammary gland and breast cancer. Am. J. Med. Sci. 339, 366–370. Lynch, M.D., Cariati, M., Purushotham, A.D., 2006. Breast cancer, stem cells and prospects for therapy. Breast Cancer Res. 8, 211. Magnusson, K., de Wit, M., Brennan, D.J., Johnson, L.B., McGee, S.F., Lundberg, E., Naicker, K., Klinger, R., Kampf, C., Asplund, A., Wester, K., Gry, M., Bjartell, A., Gallagher, W.M., Rexhepaj, E., Kilpinen, S., Kallioniemi, O.P., Belt, E., Goos, J., Meijer, G., Birgisson, H., Glimelius, B., Borrebaeck, C.A., Navani, S., Uhlen, M., O'Connor, D.P., Jirstrom, K., Ponten, F., 2011. SATB2 in combination with cytokeratin 20 identifies over 95% of all colorectal carcinomas. Am. J. Surg. Pathol. 35, 937–948. Miyoshi, K., Rosner, A., Nozawa, M., Byrd, C., Morgan, F., Landesman-Bollag, E., Xu, X., Seldin, D.C., Schmidt, E.V., Taketo, M.M., Robinson, G.W., Cardiff, R.D., Hennighausen, L., 2002. Activation of different Wnt/beta-catenin signaling components in mammary epithelium induces transdifferentiation and the formation of pilar tumors. Oncogene 21, 5548–5556. Nguyen, A., Rosner, A., Milovanovic, T., Hope, C., Planutis, K., Saha, B., Chaiwun, B., Lin, F., Imam, S.A., Marsh, J.L., Holcombe, R.F., 2005. Wnt pathway component LEF1 mediates

147

tumor cell invasion and is expressed in human and murine breast cancers lacking ErbB2 (her-2/neu) overexpression. Int. J. Oncol. 27, 949–956. Notani, D., Gottimukkala, K.P., Jayani, R.S., Limaye, A.S., Damle, M.V., Mehta, S., Purbey, P.K., Joseph, J., Galande, S., 2010. Global regulator SATB1 recruits beta-catenin and regulates T(H)2 differentiation in Wnt-dependent manner. PLoS Biol. 8, e1000296. Ordonez, N.G., 2014. SATB2 is a novel marker of osteoblastic differentiation and colorectal adenocarcinoma. Adv. Anat. Pathol. 21, 63–67. Patani, N., Jiang, W., Mansel, R., Newbold, R., Mokbel, K., 2009. The mRNA expression of SATB1 and SATB2 in human breast cancer. Cancer Cell Int. 9, 18. Petropoulos, K., Arseni, N., Schessl, C., Stadler, C.R., Rawat, V.P., Deshpande, A.J., Heilmeier, B., Hiddemann, W., Quintanilla-Martinez, L., Bohlander, S.K., Feuring-Buske, M., Buske, C., 2008. A novel role for Lef-1, a central transcription mediator of Wnt signaling, in leukemogenesis. J. Exp. Med. 205, 515–522. Ponti, D., Zaffaroni, N., Capelli, C., Daidone, M.G., 2006. Breast cancer stem cells: an overview. Eur. J. Cancer 42, 1219–1224. Reya, T., Duncan, A.W., Ailles, L., Domen, J., Scherer, D.C., Willert, K., Hintz, L., Nusse, R., Weissman, I.L., 2003. A role for Wnt signalling in self-renewal of haematopoietic stem cells. Nature 423, 409–414. Rosenfeld, J.A., Ballif, B.C., Lucas, A., Spence, E.J., Powell, C., Aylsworth, A.S., Torchia, B.A., Shaffer, L.G., 2009. Small deletions of SATB2 cause some of the clinical features of the 2q33.1 microdeletion syndrome. PLoS One 4, e6568. Sethi, T.K., El-Ghamry, M.N., Kloecker, G.H., 2012. Radon and lung cancer. Clin. Adv. Hematol. Oncol. 10, 157–164. Shankar, S., Nall, D., Tang, S.N., Meeker, D., Passarini, J., Sharma, J., Srivastava, R.K., 2011. Resveratrol inhibits pancreatic cancer stem cell characteristics in human and KrasG12D transgenic mice by inhibiting pluripotency maintaining factors and epithelial-mesenchymal transition. PLoS One 6, e16530. Shi, G., Jin, Y., 2010. Role of Oct4 in maintaining and regaining stem cell pluripotency. Stem Cell Res. Ther. 1, 39. Siegel, R.L., Miller, K.D., Jemal, A., 2016. Cancer statistics, 2016. CA Cancer J. Clin. 66, 7–30. Tsai, B.P., Jimenez, J., Lim, S., Fitzgerald, K.D., Zhang, M., Chuah, C.T., Axelrod, H., Wilson, L., Ong, S.T., Semler, B.L., Waterman, M.L., 2014. A novel Bcr-Abl-mTOR-eIF4A axis regulates IRES-mediated translation of LEF-1. Open Biol. 4, 140180. Visvader, J.E., Stingl, J., 2014. Mammary stem cells and the differentiation hierarchy: current status and perspectives. Genes Dev. 28, 1143–1158. Waalkes, M.P., Rehm, S., Riggs, C.W., Bare, R.M., Devor, D.E., Poirier, L.A., Wenk, M.L., Henneman, J.R., Balaschak, M.S., 1988a. Cadmium carcinogenesis in male Wistar [Crl:(WI)BR] rats: dose-response analysis of tumor induction in the prostate and testes and at the injection site. Cancer Res. 48, 4656–4663. Waalkes, M.P., Perantoni, A., Bhave, M.R., Rehm, S., 1988b. Strain dependence in mice of resistance and susceptibility to the testicular effects of cadmium: assessment of the role of testicular cadmium-binding proteins. Toxicol. Appl. Pharmacol. 93, 47–61. Waalkes, M.P., Rehm, S., Perantoni, A.O., Coogan, T.P., 1992. Cadmium exposure in rats and tumours of the prostate. IARC Sci. Publ. 391–400. Yang, M.H., Yu, J., Chen, N., Wang, X.Y., Liu, X.Y., Wang, S., Ding, Y.Q., 2013. Elevated MicroRNA-31 expression regulates colorectal cancer progression by repressing its target Gene SATB2. PLoS One 8, e85353. Yang, M.H., Yu, J., Jiang, D.M., Li, W.L., Wang, S., Ding, Y.Q., 2014. microRNA-182 targets special AT-rich sequence-binding protein 2 to promote colorectal cancer proliferation and metastasis. J. Transl. Med. 12, 109. Ye, X., Weinberg, R.A., 2015. Epithelial-mesenchymal plasticity: a central regulator of cancer progression. Trends Cell Biol. 25, 675–686. Yin, S., Xu, L., Bonfil, R.D., Banerjee, S., Sarkar, F.H., Sethi, S., Reddy, K.B., 2013. Tumor-initiating cells and FZD8 play a major role in drug resistance in triple-negative breast cancer. Mol. Cancer Ther. 12, 491–498. Yu, W., Ma, Y., Shankar, S., Srivastava, R.K., 2016. Role of SATB2 in human pancreatic cancer: implications in transformation and a promising biomarker. Oncotarget 7, 57783–57797. Zhao, X., Qu, Z., Tickner, J., Xu, J., Dai, K., Zhang, X., 2014. The role of SATB2 in skeletogenesis and human disease. Cytokine Growth Factor Rev. 25, 35–44.