- Email: [email protected]
Ras‐Driven Transformation of Human Nestin‐Positive Pancreatic Epithelial Cells
C H A P T E R
T H I R T Y- O N E
Ras-Driven Transformation of Human Nestin-Positive Pancreatic Epithelial Cells Paul M. Campbell,* Kwang M. Lee,† Michel M. Ouellette,† Hong Jin Kim,* Angela L. Groehler,* Vladimir Khazak,‡ and Channing J. Der* Contents 1. Introduction 2. Isolation and Immortalization of Primary Pancreatic Ductal Cells 3. Additional Genetic Steps Required to Transform Pancreatic Duct-Derived Cells 3.1. Preparing viral supernatants carrying HPV16 E6/E7 3.2. Preparing viral supernatants carrying oncogenic Ras and the SV40 small t antigen 3.3. Tranducing hTERT-HPNE cells 4. Analysis of K-Ras Effector Pathways in Pancreatic Cell Transformation 4.1. Growth transformation assays 4.2. Signaling protein expression and activation 4.3. Migration assays 5. Discussion Acknowledgments References
* {
{
452 453 455 457 457 458 459 459 460 461 462 463 463
Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina Eppley Institute for Research in Cancer and Allied Diseases, University of Nebraska Medical Center, Omaha, Nebraska NexusPharma, Inc., Langhorne, Pennsylvania
Methods in Enzymology, Volume 439 ISSN 0076-6879, DOI: 10.1016/S0076-6879(07)00431-4
#
2008 Elsevier Inc. All rights reserved.
451
452
Paul M. Campbell et al.
Abstract Mutational activation of the K-Ras oncogene is well established as a key genetic step in the development and growth of pancreatic adenocarcinomas. However, the means by which aberrant Ras signaling promotes uncontrolled pancreatic tumor cell growth remains to be fully elucidated. The recent use of primary human cells to study Ras-mediated oncogenesis provides important model cell systems to dissect this signaling biology. This chapter describes the establishment and characterization of telomerase-immortalized human pancreatic ductderived cells to study mechanisms of Ras growth transformation. An important strength of this model system is the ability of mutationally activated K-Ras to cause potent growth transformation in vitro and in vivo. We have utilized this cell system to evaluate the antitumor activity of small molecule inhibitors of the RafMEK-ERK mitogen-activated protein kinase cascade. This model will be useful for genetic and pharmacologic dissection of the contribution of downstream effector signaling in Ras-dependent growth transformation.
1. Introduction Pancreatic ductal adenocarcinoma (PDA) represents one of the most lethal forms of cancer, with a 5-year mortality risk of greater than 95% (Jemal et al., 2005; Warshaw and Fernandez-del Castillo, 1992). While the prognosis is better for patients with surgically resectable disease, this cohort unfortunately represents only about 10% of all PDA patients (Ahrendt and Pitt, 2002). The vast majority of PDA cases present in later stages with metastatic or recurrent disease (Allison et al., 1998). As such, it is imperative to understand the nature of PDA so that better therapeutic interventions can be uncovered. A common progression demonstrated for PDA links changes in the genetic makeup of tumor cells with alterations in cancer stage (Hruban et al., 2000a,b). A mutation of the K-Ras gene is seen early in the initiation of pancreatic ductal cell dysplasia at the pancreatic intraepithelial neoplasia (PanIN) 1 stage. Single base pair substitutions at the 12, 13, or 61 codons of K-Ras result in constitutive activation of the protein and continuous signaling (Malumbres and Barbacid, 2003). These mutations are seen in more than 90% of PDA cases (Malumbres and Barbacid, 2003), but because the signaling cascades downstream of Ras activation are so varied (Repasky et al., 2004), it remains unclear which effector pathways are required for both initiation of PanINs and subsequent development of PDA (Yeh and Der, 2007). As a result, experimental models designed to elucidate the pertinent role of K-Ras are necessary to help guide future molecularly targeted anti-Ras therapy (Cox and Der, 2002).
Mutant K-Ras Transforms Primary Pancreatic Cells
453
One approach to understanding cancer cell behavior is to look at the genetic events in a stepwise manner in differentiated but untransformed epithelial cells to determine the specific cellular consequences of defined genetic lesions that initiate and maintain the cancerous phenotype. Much progress in this cell-based tactic has been facilitated by the work of Weinberg and colleagues, who helped design the immortalization of epithelial cells via expression of the catalytic subunit of human telomerase (hTERT) (Elenbaas et al., 2001; Hahn and Weinberg, 2002; Hahn et al., 1999). After primary cells have been made immortal, subpopulations of these cells can be further manipulated by exogenous expression of putative oncogenes or other genes, or selected elimination of potential tumor suppressors to reveal which changes are required for transformation. This chapter discusses one such system that has been devised as a human cell model for studying PDA progression and growth. Methodologies that detail the isolation of ductal cells from the pancreas, their immortalization, and the steps required to make these cells tumorigenic, as well as elements of Ras signaling that contribute to this transformation, are presented.
2. Isolation and Immortalization of Primary Pancreatic Ductal Cells The partial digestion of a healthy pancreas (Lee et al., 2003), excised following the accidental death of a 52-year-old man, was accomplished with the use of liberase (Linetsky et al., 1997). This enzymatic treatment reduces the organ to large structural components, which are separated by centrifugation on a Ficoll gradient. The band containing large ducts is harvested and further sorted under microscopy to remove pancreatic islets, stroma, acini, and blood vessels. The ductal tissue is rocked in growth medium D [125 ml M3F base medium (InCell), 375 ml Dulbecco’s modified Eagle’s medium (DMEM) with L-glutamine and low glucose, 25 ml fetal calf serum (FCS), 50 ml of epidermal growth factor (EGF; 100 mg/ml in dH2O), and 500 ml gentamicin (50 mg/ml, Invitrogen)] at 37 for 2 weeks, with the larger ducts removed by handpicking every other day. The remaining ducts are harvested and seeded onto tissue culture dishes in growth medium at a density of 500 fragments/25 cm2. Epithelial cell sheets are propagated from these fragments, and cultures are cleared of fibroblasts by trypsinizing the sheets, replating, and treating the new cultures with a rabbit antibody raised against human fibroblasts and a preparation of rabbit complement ( Jesnowski et al., 1999). Cells are grown in growth medium at 37 and 5% CO2. To maintain log-phase growth, cells are trypsinized once a week and replated at a density of 100,000 cells/25 cm2.
454
Paul M. Campbell et al.
Initially, the primary pancreatic duct-derived cells are transduced with an expression vector for hTERT (Ouellette et al., 1999). First, a portion of the hTERT cDNA (Nakamura et al., 1997) lacking 50 and 30 UTRs is cloned into the EcoRI site of the retroviral vector pBabe-puro (Morgenstern and Land, 1990). fNX-A packaging cells are transiently transfected with calcium phosphate (MBS kit; Stratagene) to generate infectious virus supernatants. The resulting amphotropic virus particle supernatants are supplemented with 4 mg/ml polybrene (Sigma) to facilitate infection efficiency, and primary pancreatic duct-derived cells are infected at population doubling day (PD) 19. Mass populations of cells with stable viral integration are then selected for by maintaining the infected cultures in growth medium supplemented with 750 ng/ml puromycin. Multiple drug-resistant colonies are then pooled together to establish cells stably expressing ectopic hTERT. Telomerase gene transcription is assayed by reverse transcription polymerase chain reaction (RT-PCR) using 50 ACTCGACACCGTGTCACCTA 30 and 50 GTGACAGGGCTGCTGGTGTC 30 as primers for hTERT. Total RNA is obtained from cells using the guanidium/acid phenol procedure. In a final volume of 20 ml, each reverse transcription reaction contains 0.5 mg of heat-denatured RNA, 50 ng of random hexamers, 10 mM dithiothreitol, 500 mM of each dNTP, 50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2, and either 1 ml of SuperScript III reverse transcriptase (200 U/ml; Gibco-BRL) or 1 ml of water (mock reactions). After 1 h at 37 , RT reactions are diluted to 100 ml and denatured at 95 for 10 min. In a final volume of 50 ml, each PCR contains 5 ml of the diluted RT reaction, 1 mM of each PCR primer, 200 mM of each dNTP, 1.5 mM MgCl2, 20 mM Tris-HCl, pH 8.4, and 50 mM KCl. PCR are initiated at 95 by the addition of Taq DNA polymerase (2.5 U; Gibco-BRL) and allowed to cycle as follows: 45 s at 94 , 45 s at the annealing temperature, and 1 min at 72 . Ten microliters of the PCR products is resolved by agarose gel electrophoresis and visualized with ethidium bromide staining (0.5 mg/ml). Additionally, telomerase activity is verified as described previously (Ouellette et al., 1999) using the TRAP-eze telomerase detection kit (Intergen). Control primary pancreatic duct cells normally undergo senescence at around PD 25, but those populations expressing exogenous hTERT are immortalized and show unlimited proliferative capacity (Lee et al., 2003). While cancer-related phenotypic changes were not seen in these immortal cells, a loss of the epithelial cell markers carbonic anhydrase II and cytokeratin 19 (Vila et al., 1994) (using primers 50 -AAGGAACCCATCAGCG TCAG-30 /50 -AAAGCACCAACCAGCCACAG-30 and 50 -GCCACT ACTACACGACCATCC-30 /50 -GAATCCACCTCCACACTGACC-30 , respectively) was evident. Concurrently, immortal clones analyzed at all time points expressed nestin, a putative marker for pluripotent stem cells (Hunziker and Stein, 2000; Zulewski et al., 2001). These cells are now denoted as human pancreatic nestin-expressing (hTERT-HPNE) cells.
Mutant K-Ras Transforms Primary Pancreatic Cells
455
3. Additional Genetic Steps Required to Transform Pancreatic Duct-Derived Cells Because the hTERT-HPNE cells showed no phenotypic changes characteristic of cancer cells [soft agar colony formation, p53 and p21WAF1 mutation or p16INK4a loss (Lee et al., 2003)], we sought to drive these cells toward a cancerous transformation by the introduction of additional genes known to be functionally perturbed in PDA. The E6 and E7 proteins of the HPV16 virus were used to emulate the loss of p53 and inactivation of the p16INK4a/Rb pathway, respectively. Oncogenic versions of H-Ras, K-Ras, and N-Ras were compared for their capacity to emulate the activation of K-Ras seen in early PanINs. Finally, the SV40 small t (st) antigen, which had been reported to be required for the malignant transformation of primary human cells, was also used. To prevent Ras-induced senescence, as well as toxicities associated with the expression of the SV40 st antigen, E6 and E7 were transduced prior to the introduction of these oncogenes. In all, eight derivatives of hTERT-HPNE cells were made expressing the following combinations of oncogenes: E6/E7, E6/E7/st, E6/E7/K-Ras12D, E6/ E7/H-Ras12V, E6/E7/N-Ras12D, E6/E7/K-Ras12D/st, E6/E7/HRas12V/st, or E6/E7/N-Ras12D/st (Fig. 31.1). A brief description of the construction of the retrovirus expression plasmid DNAs used in our studies is presented next. Plasmid pBabeZeo-st: A BamHI–BglII fragment from pCMV5-small t (Sontag et al., 1993) is cloned into the BamHI site of pBabe Zeo. Plasmid pBabe Zeo is a derivative of pBabe Puro (Morgenstern and Land, 1990) in which the Puror cassette is inactivated by deletion of an EcoRI–ClaI fragment and replacement with an EcoRI–AccI segment from pKS-Zeo. Plasmid pKS-Zeo is made by insertion in the BamHI site of pBluescript KS II of a BglII–BamHI fragment from plasmid pZeoSV (Invitrogen). Plasmid pLXSH-N-RasG12D: A BamHI fragment from pBabePuro-NRas(G12D) (Fiordalisi et al., 2001) is inserted in the BamHI site of pLXSH. Plasmid pLXSH is a derivative of pLXSN (Miller and Rosman, 1989) in which the neor cassette is inactivated by deletion of a HindIII–NaeI fragment and replacement with a HindIII–BglII segment from pSV2-Hygro (Maione et al., 1992). Plasmid pLXSH-K-RasG12D: A cDNA fragment encoding K-RasG12D is RT-PCR amplified from PANC-1 cells with primers 50 -CTTGCTA GGATCCTGCTGAAAATGACTGAATATA-30 and 50 -GCTAGGA TCCGTATGCCTTAAGAAAAAAGTACAA-30 . The resultant PCR product is digested with BamHI and inserted into the BamHI site of plasmid pLXSH.
456
Paul M. Campbell et al.
A
Human primary pancreatic duct cells + hTERT hTERT-HPNE + E6/E7 + H-Ras12V/K-Ras12D/N-Ras12D
E6/E7
E6/E7/Ras
+ SV40 st
+ SV40 st
E6/E7/st
Cells (⫻ 105 + SEM)
B
C
8 7 6 5 4 3 2 1 0
E6/E7/Ras/st
E6/E7/st E6/E7/K-Ras12D/st
Plate
1 2 4 Days post plate
E6/E7/st
6
E6/E7/K-Ras12D/st
D
E
Figure 31.1 Immortalization and transformation of primary pancreatic duct-drived cells. (A) Ectopic expression of hTERTwas used to immortalize a primary pancreatic duct cell culture, generating hTERT-HPNE cells. These cells were then sequentially infected to express first the human papilloma virus proteins E6 and E7 (E6/E7) and then constitutively active forms of H-Ras12V, K-Ras12D, or N-Ras12D. E6/E7 and E6/E7/Ras
Mutant K-Ras Transforms Primary Pancreatic Cells
457
3.1. Preparing viral supernatants carrying HPV16 E6/E7 PA317 LXSN 16E6E7 cells expressing HPV16 E6/E7 [ATCC (Halbert et al., 1991)] are thawed in DMEM supplemented with 10% FCS and 50 mg/ml gentamicin. Fresh medium is replaced the following day. Upon confluence, cells are split with trypsin-EDTA to split ratios of 1:6 to 1:12. Cells are plated in a 150-mm dish and grown until 80% confluent. These are washed once with Medium D, and then a minimal volume of Medium D (12 ml/150-mm plate) is used to collect viruses overnight. The supernatant is cleared through a 0.45-mm polysulfone filter to remove any suspended cells, and polybrene is added to a final concentration of 4 mg/ml. Supernatants are used immediately or frozen for future experiments.
3.2. Preparing viral supernatants carrying oncogenic Ras and the SV40 small t antigen fNX-A cells are grown in DMEM supplemented with 10% FCS and 50 mg/ml gentamicin and are split with trypsin-EDTA 1:4 to 1:6, avoiding >90% confluence. Cells are seeded into two 100-mm plates at 5106 cells/ plate. On the following day, fNX-A cells (80% confluent) are transfected with retroviral vectors (pBabeZeo-st, pBabeHygro ras, pLXSH-NRasG12D, or pLXSH-K-RasG12D). fNX-A cells are transfected most easily using the CaPO4 method, but other methods can be used as well. To calcium transfect the cells, we use Stratagene’s MBS mammalian transfection kit following the manufacturer’s instructions. In a 5-ml Falcon polystyrene tube, a calcium–DNA precipitate is prepared by mixing plasmid DNA (10 mg in 450 ml of sterile water) with 50 ml of solution I (2.5 M CaCl2) and then adding 500 ml of solution II (N,N-bis(2-hydroxyethyl)-2aminoethanesulfonic acid in buffered saline). The calcium–DNA mix is incubated at room temperature for 10 to 20 min. fNX-A cells are washed once with warm phosphate-buffered saline (PBS) and fed with 10 ml/dish of DMEM supplemented with 6% modified bovine serum (as provided by the kit). The precipitated DNA is gently resuspended and added to the fNX-A cells drop wise in a circular motion to distribute the DNA evenly. Dishes of fNX-A cells are swirled once and incubated at 37 and 5% CO2 for 3 h. Cells are washed once with warm PBS and fed DMEM supplemented with 10% FCS and 50 mg/ml gentamicin. Viruses are collected in three consecutive harvests over the next 72 h. To collect the viruses, 4 to 5 ml of fresh Medium D is used for each harvest, cells were then infected with retrovirus encoding SV40 st to establish E6/E7/st and E6/E7/ Ras/st cells, respectively. Examples of K-Ras12D-transformed cells show increased proliferation (B), contact-independent growth (C), invasion (D), and migration (E).
458
Paul M. Campbell et al.
with supernatants exposed to virus-producing cells for 8 to 16 h. Supernatants are cleared through 0.45-mm filters and either kept on ice and used within the hour or frozen at 80 , where the virus titer is stable for approximately 6 months.
3.3. Tranducing hTERT-HPNE cells hTERT-HPNE cells are thawed in Medium D and expanded by trypsinizing and replating at split ratios of 1:3 to 1:4. Viral E6/E7 supernatants (2 ml/ 100-mm plate) are added to 80% confluent cultures, and cells are incubated overnight at 37 . The viral supernatant is replaced with fresh growth medium, and cells are split at a ratio of 1:3 to 1:4 over 2 to 3 days. Selection for viral gene integration is accomplished by treating infected cultures with 400 mg/ml G418 for 2 to 3 weeks, changing the medium every 3 to 4 days. Cohorts of these resultant cell populations are further transduced in the same manner for expression of oncogenic Ras isoforms (using 200 mg/ml hygromycin B for selection) or SV40 st antigen (using 50 mg/ml zeocin). To verify expression of these cDNA constructs, total RNA is extracted from cells with TRIzol (1 ml/100-mm plate, Invitrogen), and RT-PCR is performed as described earlier using the following forward/reverse 50 -30 primers: K-Ras— CTTGCTGAATTCCTGCTGAAAATGACTG AATATA/GCTACTCGAGGTATGCCTTAAGAAAAAAGTACAA; b\actin—CGGGACCTGACTGACTACCT/CAGCACTGTGTTGGCG TACA; E6—GAACAGCAATACAACAAACCG/GCAACAAGAC ATACATCGACC; E7— AGGAGGAGGATGAAATAGATGG/TGG TTTCTGAGAACAGATGGG; and SV40 st— GAAGCAGTAGCAA TCAACCC/GCTTCTTCCTTAAATCCTGGTG. Annealing temperatures are set to either 55 (E6, st, K-Ras) or 57 (E7). Amplifications are done for 25 to 35 cycles, depending on the primer pair. The sizes of the expected PCR products are 351 bp (b-actin), 156 bp (E6), 197 bp (E7), 171 bp (SV40 st), and 250 bp (K-Ras). Results show equal signal for b-actin and confirm the presence or absence of each oncogene in the different hTERT-HPNE derivatives. PCR products of K-Ras cDNA are digested with BccI and resolved on ethidium bromide-agarose gels to differentiate between the expression of wild type and exogenous mutated K-Ras. The G12D mutation creates an additional BccI site, which gives digestion patterns that differ for wild type (154 þ 96 bp) and oncogenic (104 þ 50 þ 96 bp) K-Ras. Digestion is done overnight at 37 in PCR buffer. K-Ras protein expression and activation are assayed by pull-down assays using the pGEX-Raf-RBD glutathione-S-transferase-bound fusion protein containing the Ras-binding domain of Raf-1 as described previously (Peterson et al., 1996); expression of b-actin serves as a loading control (antibody AC-15; Sigma).
Mutant K-Ras Transforms Primary Pancreatic Cells
459
The HPV proteins E6 and E7 inactivate the cell cycle genes p53 and pRb, elements that are often disrupted in cancer (Munger et al., 1989; Werness et al., 1990), but the exogenous expression of these genes in hTERT-HPNE cells did not cause morphological or phenotypical changes. Because the mutation of Ras is an early event in more than 90% of PDA cases, we introduced oncogenic forms of H-, K-, and N-Ras into E6/E7 cells. Even the expression of these oncogenes failed to lead to soft agar colony growth. However, expression of SV40 st in E6/E7/Ras cells leads to significant transformation, as illustrated by contact-independent growth in soft agar. Because K-Ras is mutated in almost all PDA patients’ tumors, we decided to focus on this cell line for further studies. The amount of total K-Ras expressed was similar in the matched E6/E7/st and E6/E7/Ras/st pair of cell lines; however, cells with mutant K-Ras12D expression exhibited significantly more GTP-bound K-Ras. This observation contrasts with other human model cell systems described, where the exogenous Ras gene resulted in significantly greater protein expression than is typically seen in human tumor cells. Thus, the matched pair of E6/E7/st and E6/E7/ Ras/st cells provided us with a well-defined system to assess the signaling repercussions of mutant K-Ras expressed at physiologic levels.
4. Analysis of K-Ras Effector Pathways in Pancreatic Cell Transformation 4.1. Growth transformation assays Initially, we looked at the growth of E6/E7/st and E6/E7/Ras/st under normal culture conditions [four parts high glucose DMEM to one part M3F (InCell) supplemented with 5% FCS, 100 U/ml penicillin, and 100 mg/ml streptomycin]. Ten thousand cells are seeded onto plastic in triplicate, and cells are trypsinized and counted after 24, 48, 96, and 144 h. For analysis of anchorage-independent growth, six-well plates are initially coated with 1 ml of autoclaved 1.8 g/ml agar and allowed to cool and gel. This thin dense bottom layer of agar prevents cell adherence to the plastic. Log-phase growing cells are trypsinized, and triplicates of 3103 cells per well are suspended in 3 ml of enriched medium (supplemented with an additional 10% FCS), mixed quickly with 1 ml of warm (65 ) sterile 1.5% agar, and plated onto the agar-coated six-well plates (Campbell and Szyf, 2003). This layer is allowed to set at room temperature for 30 min before 1 ml of standard growth medium is added to the top of the gelled matrix and colonies are grown for 21 days. To assess the contributions of different effectors downstream of oncogenic K-Ras12D signaling, we utilized established pharmacologic inhibitors. MCP110 disrupts the physical interaction between Ras and Raf, with
460
Paul M. Campbell et al.
MCP122 as a negative control inactive analog (Kato-Stankiewicz et al., 2002), and U0126 is a highly specific inhibitor of MEK1/2. LY294004 blocks the activity of PI3K to prevent activation of Akt and other signaling proteins. Stock solutions of inhibitors are dissolved in dimethyl sulfoxide (DMSO) and added to both the agar containing the cells and the feeding medium at the following final concentrations: MCP110/122 (NexusPharma) at 10 mM, LY294002 (Promega) at 10 mM, or U0126 (Promega) at 30 mM. Plates are refed with fresh growth medium including inhibitors or DMSO once per week. After 21 days in culture, colonies are stained with 0.5 ml/well of 1 mg/ml 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, counted in five random three-dimensional microscopic fields per well, and photographed. Cells with K-Ras12D expression show extensive colony formation within a week of suspension and large colonies visible to the naked eye within 14 days. For tumorigenicity analysis, E6/E7/st or E6/E7/Ras/st cells are injected subcutaneously into the flanks of Hsd:Athymic Nude-Foxn1nu nude mice (Harlan) at seeding densities of 0.2, 0.5, 1, or 2106 cells per site. Tumor measurements are taken by calipers three times per week over 8 weeks or until the tumor burden reaches 1 cm3. Tumor volumes are calculated by estimation of an ellipsoid using (4/3)p(xyx/6), where x is length, y is width, and z is depth of the tumor. For histology analysis, tumors are excised immediately following euthanization and fixed in 10% buffered formalin. Tumor tissue is embedded in paraffin, and sections are cut and stained for cytoarchitecture with hematoxylin and eosin. Sections are additionally stained for cytokeratins with AE1/AE3 antibodies (Listrom and Dalton, 1987) and vimentin (Fig. 31.2). In agreement with Western blot analysis, xenograft tumors arising from E6/E7/Ras/st cells show low levels of cytokeratin expression and strong vimentin expression, and histology reveals that the tumors resemble more of a sarcomatoid pancreatic cancer than classic PDA.
4.2. Signaling protein expression and activation Cells growing in log phase are incubated for 24 h in starvation medium (normal medium with serum replaced by 1 g/ml bovine serum albumin, 10 mM HEPES) before adding inhibitors for an additional 24 h. Western blot analyses are done using primary antibodies against ERK1/2 (9102, Cell Signaling), phospho-ERK1/2 (9106, Cell Signaling), phospho-MEK1/2 (9121, Cell Signaling), MKP-2 (sc-1200, Santa Cruz), Akt (9272, Cell Signaling), and phospho-Akt (9271, Cell Signaling). Pull-down assays used to detect formation of active GTP-bound RalA are performed as described previously (Wolthuis et al., 1998), with glutathione-S-transferase fusion protein containing the Ral-GTP-binding domain (pGEX RalBD). Beads sequestering activated Ral proteins are separated by SDS-PAGE and
Mutant K-Ras Transforms Primary Pancreatic Cells
A
Pancreatic ductal adenocarcinoma (H & E) C
E6/E7/Ras/st AE1/AE3 cytokeratin
461
B
E6/E7/Ras/st (H & E) D
E6/E7/Ras/st vimentin
Figure 31.2 Histology of E6/E7Ras/st xenografts. Xenograft tumors derived from E6/ E7/Ras/st cells were excised and fixed in formalin. Following postfixation embedding in paraffin, sections were stained for hematoxylin and eosin (H&E, B), AE1/AE3-sensitive cytokeratins (C), or vimentin (D). E6/E7/st cells did not form tumors in mice. A section of human PDA is shown for cytoarchitecture comparison (A).
probed with anti-RalA antibodies (BD Biosciences). The total cell lysate is also blotted to determine total Ral protein levels.
4.3. Migration assays Cells grown to 90% confluence are starved as described earlier for 24 h. At t ¼ 0, cells are treated with inhibitors of the Raf-MEK-ERK or PI3K-Akt pathways as described previously, and a ‘‘wound’’ is created by scoring a line across the monolayer of cells with a pipette tip (Valster et al., 2005). At 12 h, cells are fixed and stained with Diff-Quik (Dade-Behring), a modified fixation and Wright Giemsa stain protocol, and digital micrographs are taken with a 40 objective. Wounds fixed and stained at t ¼ 0 are used as the reference against which migration of treated cells is compared. Cells that have migrated into the space of by the wound are counted manually. Triplicate wells for each treatment group are stained and scored. For transwell invasion assays, cells are starved and treated with inhibitors as described earlier for 24 h. Because trypsin can activate extracellular enzymes such as metallomatrix proteases and promote invasion (Soreide et al., 2006), we avoid its use so as to not obscure the inherent invasive
462
Paul M. Campbell et al.
ability of the cells. Cells are suspended from adherent cultures with 1 ml TrypLE Express trypsin-free dissociation solution (Invitrogen) and counted. Twenty thousand cells are loaded into 500 ml of starvation medium and inhibitors in the top well of Biocoat chambers. These wells contain a layer of growth factor-reduced Matrigel extracellular basement membrane proteins over a polyethylene terephthalate membrane with 8-mm pores (BD Biosciences). The bottom chamber contains the same medium and inhibitor concentration. Cells are allowed to invade through the Matrigel for 24 h before the Matrigel is removed with moistened cotton swabs, and cells that have migrated to the underside of the membrane are fixed and stained with Diff-Quik. Cells adhering to the bottom surface of the membrane are counted under microscopy.
5. Discussion This chapter focused on the stepwise transformation of the nestinexpressing cells from the human pancreas and the steps required to make them tumorigenic, as well as elements of Ras signaling that contribute to their transformation. In recent reports, this cell type was identified as both an adult stem cell and a putative precursor of PanIN lesions (Carriere et al., 2007). Most significant were results of knock-in experiments, which took advantage of endogenous promoters to drive the expression of oncogenic K-Ras in selected mouse tissues. Despite its ductal characteristics, PDA failed to be recapitulated in mice engineered to express oncogenic K-Ras in pancreatic ductal epithelial cells (Brembeck et al., 2003). Forced expression under the control of the endogenous nestin promoter, however, results in a phenotype that reconstitutes the course of the disease from PanIN lesions to invasive PDA (Carriere et al., 2007). Similar results had been reported previously in a mouse model that instead used promoters of the p48 and PDX-1 genes (Aguirre et al., 2003; Hingorani et al., 2005). Nestin, PDX-1, and p48 are expressed in developmental precursors of the exocrine pancreas (Dutta et al., 2001; Herrera et al., 2002; Hunziker and Stein, 2000; Selander and Edlund, 2002). In the adult pancreas, reexpression of these markers accompanied regenerative processes that follow tissue injury (Delacour et al., 2004; Fernandes et al., 1997). Previously, we used the catalytic subunit of telomerase (hTERT) to immortalize nestin-expressing cells isolated from the pancreatic ducts of a 52-year-old organ donor (Lee et al., 2003). We subsequently described in these cells the expression of other markers of putative stem cells, as well as a capacity to give rise to pancreatic ductal cells (Lee et al., 2005). Using oncogenic insults designed to emulate those detected in PDA, Campbell et al. (2007) described the stepwise transformation of these cells to a tumorigenic phenotype. This
Mutant K-Ras Transforms Primary Pancreatic Cells
463
chapter detailed the procedures used for manipulation of these cells and characterization of their transformed phenotype, including growth properties, motility, invasiveness, and expression of tumor markers. These cells provide an additional tool to be used to discover the relative roles of Ras and other oncogenes in the initiation and progression of PDA and to elucidate the signaling mechanisms caused by oncogenic Ras necessary and sufficient for oncogenic growth transformation.
ACKNOWLEDGMENTS Our research studies were supported by National Institutes of Health grants to C.J.D. (CA42978, CA71341, and CA109550), the Lustgarten Foundation for Pancreatic Cancer Research (LF 01–040) and Early Detection Research Network (U01 CA111294) to M.M.O., and the National Cancer Institute Gastrointestinal SPORE (P50-CA106991–02) to P.M.C.
REFERENCES Aguirre, A. J., Bardeesy, N., Sinha, M., Lopez, L., Tuveson, D. A., Horner, J., Redston, M. S., and DePinho, R. A. (2003). Activated Kras and Ink4a/Arf deficiency cooperate to produce metastatic pancreatic ductal adenocarcinoma. Genes Dev. 17, 3112–3126. Ahrendt, S. A., and Pitt, H. A. (2002). Surgical management of pancreatic cancer. Oncology 16, 725–734; discussion 734, 736–738, 740, 743. Allison, D. C., Piantadosi, S., Hruban, R. H., Dooley, W. C., Fishman, E. K., Yeo, C. J., Lillemoe, K. D., Pitt, H. A., Lin, P., and Cameron, J. L. (1998). DNA content and other factors associated with ten-year survival after resection of pancreatic carcinoma. J. Surg. Oncol. 67, 151–159. Brembeck, F. H., Schreiber, F. S., Deramaudt, T. B., Craig, L., Rhoades, B., Swain, G., Grippo, P., Stoffers, D. A., Silberg, D. G., and Rustgi, A. K. (2003). The mutant K-ras oncogene causes pancreatic periductal lymphocytic infiltration and gastric mucous neck cell hyperplasia in transgenic mice. Cancer Res. 63, 2005–2009. Campbell, P. M., Groehler, A. L., Lee, K. M., Ouellette, M. M., Khazak, V., and Der, C. J. (2007). K-Ras promotes growth transformation and invasion of immortalized human pancreatic cells by Raf and phosphatidylinositol 3-kinase signaling. Cancer Res. 67, 2098–2106. Campbell, P. M., and Szyf, M. (2003). Human DNA methyltransferase gene DNMT1 is regulated by the APC pathway. Carcinogenesis 24, 17–24. Carriere, C., Seeley, E. S., Goetze, T., Longnecker, D. S., and Korc, M. (2007). The Nestin progenitor lineage is the compartment of origin for pancreatic intraepithelial neoplasia. Proc. Natl. Acad. Sci. USA 104, 4437–4442. Cox, A. D., and Der, C. J. (2002). Ras family signaling: Therapeutic targeting. Cancer Biol. Ther. 1, 599–606. Delacour, A., Nepote, V., Trumpp, A., and Herrera, P. L. (2004). Nestin expression in pancreatic exocrine cell lineages. Mech. Dev. 121, 3–14. Dutta, S., Gannon, M., Peers, B., Wright, C., Bonner-Weir, S., and Montminy, M. (2001). PDX:PBX complexes are required for normal proliferation of pancreatic cells during development. Proc. Natl. Acad. Sci. USA 98, 1065–1070.
464
Paul M. Campbell et al.
Elenbaas, B., Spirio, L., Koerner, F., Fleming, M. D., Zimonjic, D. B., Donaher, J. L., Popescu, N. C., Hahn, W. C., and Weinberg, R. A. (2001). Human breast cancer cells generated by oncogenic transformation of primary mammary epithelial cells. Genes Dev. 15, 50–65. Fernandes, A., King, L. C., Guz, Y., Stein, R., Wright, C. V., and Teitelman, G. (1997). Differentiation of new insulin-producing cells is induced by injury in adult pancreatic islets. Endocrinology 138, 1750–1762. Fiordalisi, J. J., Johnson, R. L., 2nd, Ulku¨, A. S., Der, C. J., and Cox, A. D. (2001). Mammalian expression vectors for Ras family proteins: Generation and use of expression constructs to analyze Ras family function. Methods Enzymol. 332, 3–36. Hahn, W. C., Counter, C. M., Lundberg, A. S., Beijersbergen, R. L., Brooks, M. W., and Weinberg, R. A. (1999). Creation of human tumour cells with defined genetic elements. Nature 400, 464–468. Hahn, W. C., and Weinberg, R. A. (2002). Rules for making human tumor cells. N. Engl. J. Med. 347, 1593–1603. Halbert, C. L., Demers, G. W., and Galloway, D. A. (1991). The E7 gene of human papillomavirus type 16 is sufficient for immortalization of human epithelial cells. J. Virol. 65, 473–478. Herrera, P. L., Nepote, V., and Delacour, A. (2002). Pancreatic cell lineage analyses in mice. Endocrine 19, 267–278. Hingorani, S. R., Wang, L., Multani, A. S., Combs, C., Deramaudt, T. B., Hruban, R. H., Rustgi, A.K, Chang, S., and Tuveson, D. A. (2005). Trp53R172H and KrasG12D cooperate to promote chromosomal instability and widely metastatic pancreatic ductal adenocarcinoma in mice. Cancer Cell. 7, 469–483. Hruban, R. H., Goggins, M., Parsons, J., and Kern, S. E. (2000a). Progression model for pancreatic cancer. Clin. Cancer Res. 6, 2969–2972. Hruban, R. H., Wilentz, R. E., and Kern, S. E. (2000b). Genetic progression in the pancreatic ducts. Am. J. Pathol. 156, 1821–1825. Hunziker, E., and Stein, M. (2000). Nestin-expressing cells in the pancreatic islets of Langerhans. Biochem. Biophys. Res. Commun. 271, 116–119. Jemal, A., Murray, T., Ward, E., Samuels, A., Tiwari, R. C., Ghafoor, A., Feuer, E. J., and Thun, M. J. (2005). Cancer statistics, 2005. CA Cancer J. Clin. 55, 10–30. Jesnowski, R., Mu¨ller, P., Schareck, W., Liebe, S., and Lo¨hr, M. (1999). Immortalized pancreatic duct cells in vitro and in vivo. Ann. N.Y. Acad. Sci. 880, 50–65. Kato-Stankiewicz, J., Hakimi, I., Zhi, G., Zhang, J., Serebriiskii, I., Guo, L., Edamatsu, H., Koide, H., Menon, S., Eckl, R., Sakamuri, S., Lu, Y., et al. (2002). Inhibitors of Ras/Raf-1 interaction identified by two-hybrid screening revert Ras-dependent transformation phenotypes in human cancer cells. Proc. Natl. Acad. Sci. USA 99, 14398–14403. Lee, K. M., Nguyen, C., Ulrich, A. B., Pour, P. M., and Ouellette, M. M. (2003). Immortalization with telomerase of the Nestin-positive cells of the human pancreas. Biochem. Biophys. Res. Commun. 301, 1038–1044. Lee, K. M., Yasuda, H., Hollingsworth, M. A., and Ouellette, M. M. (2005). Notch 2-positive progenitors with the intrinsic ability to give rise to pancreatic ductal cells. Lab. Invest. 85, 1003–1012. Linetsky, E., Bottino, R., Lehmann, R., Alejandro, R., Inverardi, L., and Ricordi, C. (1997). Improved human islet isolation using a new enzyme blend, liberase. Diabetes 46, 1120–1123. Listrom, M. B., and Dalton, L. W. (1987). Comparison of keratin monoclonal antibodies MAK-6, AE1:AE3, and CAM-5.2. Am. J. Clin. Pathol. 88, 297–301. Maione, R., Fimia, G. M., and Amati, P. (1992). Inhibition of in vitro myogenic differentiation by a polyomavirus early function. Oncogene 7, 85–93.
Mutant K-Ras Transforms Primary Pancreatic Cells
465
Malumbres, M., and Barbacid, M. (2003). RAS oncogenes: The first 30 years. Nat. Rev. Cancer 3, 459–465. Miller, A. D., and Rosman, G. J. (1989). Improved retroviral vectors for gene transfer and expression. Biotechniques 7, 980–982, 984–986, 989–990. Morgenstern, J. P., and Land, H., (1990). Advanced mammalian gene transfer: High titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line. Nucleic Acids Res. 18, 3587–3596. Mu¨nger, K., Werness, B. A., Dyson, N., Phelps, W. C., Harlow, E., and Howley, P. M. (1989). Complex formation of human papillomavirus E7 proteins with the retinoblastoma tumor suppressor gene product. EMBO J. 8, 4099–4105. Nakamura, T. M., Morin, G. B., Chapman, K. B., Weinrich, S. L., Andrews, W. H., Lingner, J., Harley, C. B., and Cech, T. R. (1997). Telomerase catalytic subunit homologs from fission yeast and human. Science 277, 955–959. Ouellette, M. M., Aisner, D. L., Savre-Train, I., Wright, W. E., and Shay, J. W. (1999). Telomerase activity does not always imply telomere maintenance. Biochem. Biophys. Res. Commun. 254, 795–803. Peterson, S. N., Trabalzini, L., Brtva, T. R., Fischer, T., Altschuler, D. L., Martelli, P., Lapetina, E. G., Der, C. J., and White, G. C., 2nd (1996). Identification of a novel RalGDS-related protein as a candidate effector for Ras and Rap1. J. Biol. Chem. 271, 29903–29908. Repasky, G. A., Chenette, E. J., and Der, C. J. (2004). Renewing the conspiracy theory debate: Does Raf function alone to mediate Ras oncogenesis? Trends Cell Biol. 14, 639–647. Selander, L., and Edlund, H. (2002). Nestin is expressed in mesenchymal and not epithelial cells of the developing mouse pancreas. Mech. Dev. 113, 189–192. Sontag, E., Fedorov, S., Kamibayashi, C., Robbins, D., Cobb, M., and Mumby, M. (1993). The interaction of SV40 small tumor antigen with protein phosphatase 2A stimulates the map kinase pathway and induces cell proliferation. Cell 75, 887–897. Soreide, K., Janssen, E. A., Ko¨rner, H., and Baak, J. P. (2006). Trypsin in colorectal cancer: Molecular biological mechanisms of proliferation, invasion, and metastasis. J. Pathol. 209, 147–156. Valster, A., Tran, N. L., Nakada, M., Berens, M. E., Chan, A. Y., and Symons, M. (2005). Cell migration and invasion assays. Methods 37, 208–215. Vila´, M. R., Balague´, C., and Real, F. X. (1994). Cytokeratins and mucins as molecular markers of cell differentiation and neoplastic transformation in the exocrine pancreas. Zentralbl. Pathol. 140, 225–235. Warshaw, A. L., and Fernandez-del Castillo, C. (1992). Pancreatic carcinoma. N. Engl. J. Med. 326, 455–465. Werness, B. A., Levine, A. J., and Howley, P. M. (1990). Association of human papillomavirus types 16 and 18 E6 proteins with p53. Science 248, 76–79. Wolthuis, R. M., Zwartkruis, F., Moen, T. C., and Bos, J. L. (1998). Ras-dependent activation of the small GTPase Ral. Curr. Biol. 8, 471–474. Yeh, J. J., and Der, C. J. (2007). Targeting signal transduction in pancreatic cancer treatment. Expert Opin. Ther. Targets 11, 673–694. Zulewski, H., Abraham, E. J., Gerlach, M. J., Daniel, P. B., Moritz, W., Mu¨ller, B., Vallejo, M., Thomas, M. K., and Habener, J. F. (2001). Multipotential nestin-positive stem cells isolated from adult pancreatic islets differentiate ex vivo into pancreatic endocrine, exocrine, and hepatic phenotypes. Diabetes 50, 521–533.
T H I R T Y- O N E
Ras-Driven Transformation of Human Nestin-Positive Pancreatic Epithelial Cells Paul M. Campbell,* Kwang M. Lee,† Michel M. Ouellette,† Hong Jin Kim,* Angela L. Groehler,* Vladimir Khazak,‡ and Channing J. Der* Contents 1. Introduction 2. Isolation and Immortalization of Primary Pancreatic Ductal Cells 3. Additional Genetic Steps Required to Transform Pancreatic Duct-Derived Cells 3.1. Preparing viral supernatants carrying HPV16 E6/E7 3.2. Preparing viral supernatants carrying oncogenic Ras and the SV40 small t antigen 3.3. Tranducing hTERT-HPNE cells 4. Analysis of K-Ras Effector Pathways in Pancreatic Cell Transformation 4.1. Growth transformation assays 4.2. Signaling protein expression and activation 4.3. Migration assays 5. Discussion Acknowledgments References
* {
{
452 453 455 457 457 458 459 459 460 461 462 463 463
Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina Eppley Institute for Research in Cancer and Allied Diseases, University of Nebraska Medical Center, Omaha, Nebraska NexusPharma, Inc., Langhorne, Pennsylvania
Methods in Enzymology, Volume 439 ISSN 0076-6879, DOI: 10.1016/S0076-6879(07)00431-4
#
2008 Elsevier Inc. All rights reserved.
451
452
Paul M. Campbell et al.
Abstract Mutational activation of the K-Ras oncogene is well established as a key genetic step in the development and growth of pancreatic adenocarcinomas. However, the means by which aberrant Ras signaling promotes uncontrolled pancreatic tumor cell growth remains to be fully elucidated. The recent use of primary human cells to study Ras-mediated oncogenesis provides important model cell systems to dissect this signaling biology. This chapter describes the establishment and characterization of telomerase-immortalized human pancreatic ductderived cells to study mechanisms of Ras growth transformation. An important strength of this model system is the ability of mutationally activated K-Ras to cause potent growth transformation in vitro and in vivo. We have utilized this cell system to evaluate the antitumor activity of small molecule inhibitors of the RafMEK-ERK mitogen-activated protein kinase cascade. This model will be useful for genetic and pharmacologic dissection of the contribution of downstream effector signaling in Ras-dependent growth transformation.
1. Introduction Pancreatic ductal adenocarcinoma (PDA) represents one of the most lethal forms of cancer, with a 5-year mortality risk of greater than 95% (Jemal et al., 2005; Warshaw and Fernandez-del Castillo, 1992). While the prognosis is better for patients with surgically resectable disease, this cohort unfortunately represents only about 10% of all PDA patients (Ahrendt and Pitt, 2002). The vast majority of PDA cases present in later stages with metastatic or recurrent disease (Allison et al., 1998). As such, it is imperative to understand the nature of PDA so that better therapeutic interventions can be uncovered. A common progression demonstrated for PDA links changes in the genetic makeup of tumor cells with alterations in cancer stage (Hruban et al., 2000a,b). A mutation of the K-Ras gene is seen early in the initiation of pancreatic ductal cell dysplasia at the pancreatic intraepithelial neoplasia (PanIN) 1 stage. Single base pair substitutions at the 12, 13, or 61 codons of K-Ras result in constitutive activation of the protein and continuous signaling (Malumbres and Barbacid, 2003). These mutations are seen in more than 90% of PDA cases (Malumbres and Barbacid, 2003), but because the signaling cascades downstream of Ras activation are so varied (Repasky et al., 2004), it remains unclear which effector pathways are required for both initiation of PanINs and subsequent development of PDA (Yeh and Der, 2007). As a result, experimental models designed to elucidate the pertinent role of K-Ras are necessary to help guide future molecularly targeted anti-Ras therapy (Cox and Der, 2002).
Mutant K-Ras Transforms Primary Pancreatic Cells
453
One approach to understanding cancer cell behavior is to look at the genetic events in a stepwise manner in differentiated but untransformed epithelial cells to determine the specific cellular consequences of defined genetic lesions that initiate and maintain the cancerous phenotype. Much progress in this cell-based tactic has been facilitated by the work of Weinberg and colleagues, who helped design the immortalization of epithelial cells via expression of the catalytic subunit of human telomerase (hTERT) (Elenbaas et al., 2001; Hahn and Weinberg, 2002; Hahn et al., 1999). After primary cells have been made immortal, subpopulations of these cells can be further manipulated by exogenous expression of putative oncogenes or other genes, or selected elimination of potential tumor suppressors to reveal which changes are required for transformation. This chapter discusses one such system that has been devised as a human cell model for studying PDA progression and growth. Methodologies that detail the isolation of ductal cells from the pancreas, their immortalization, and the steps required to make these cells tumorigenic, as well as elements of Ras signaling that contribute to this transformation, are presented.
2. Isolation and Immortalization of Primary Pancreatic Ductal Cells The partial digestion of a healthy pancreas (Lee et al., 2003), excised following the accidental death of a 52-year-old man, was accomplished with the use of liberase (Linetsky et al., 1997). This enzymatic treatment reduces the organ to large structural components, which are separated by centrifugation on a Ficoll gradient. The band containing large ducts is harvested and further sorted under microscopy to remove pancreatic islets, stroma, acini, and blood vessels. The ductal tissue is rocked in growth medium D [125 ml M3F base medium (InCell), 375 ml Dulbecco’s modified Eagle’s medium (DMEM) with L-glutamine and low glucose, 25 ml fetal calf serum (FCS), 50 ml of epidermal growth factor (EGF; 100 mg/ml in dH2O), and 500 ml gentamicin (50 mg/ml, Invitrogen)] at 37 for 2 weeks, with the larger ducts removed by handpicking every other day. The remaining ducts are harvested and seeded onto tissue culture dishes in growth medium at a density of 500 fragments/25 cm2. Epithelial cell sheets are propagated from these fragments, and cultures are cleared of fibroblasts by trypsinizing the sheets, replating, and treating the new cultures with a rabbit antibody raised against human fibroblasts and a preparation of rabbit complement ( Jesnowski et al., 1999). Cells are grown in growth medium at 37 and 5% CO2. To maintain log-phase growth, cells are trypsinized once a week and replated at a density of 100,000 cells/25 cm2.
454
Paul M. Campbell et al.
Initially, the primary pancreatic duct-derived cells are transduced with an expression vector for hTERT (Ouellette et al., 1999). First, a portion of the hTERT cDNA (Nakamura et al., 1997) lacking 50 and 30 UTRs is cloned into the EcoRI site of the retroviral vector pBabe-puro (Morgenstern and Land, 1990). fNX-A packaging cells are transiently transfected with calcium phosphate (MBS kit; Stratagene) to generate infectious virus supernatants. The resulting amphotropic virus particle supernatants are supplemented with 4 mg/ml polybrene (Sigma) to facilitate infection efficiency, and primary pancreatic duct-derived cells are infected at population doubling day (PD) 19. Mass populations of cells with stable viral integration are then selected for by maintaining the infected cultures in growth medium supplemented with 750 ng/ml puromycin. Multiple drug-resistant colonies are then pooled together to establish cells stably expressing ectopic hTERT. Telomerase gene transcription is assayed by reverse transcription polymerase chain reaction (RT-PCR) using 50 ACTCGACACCGTGTCACCTA 30 and 50 GTGACAGGGCTGCTGGTGTC 30 as primers for hTERT. Total RNA is obtained from cells using the guanidium/acid phenol procedure. In a final volume of 20 ml, each reverse transcription reaction contains 0.5 mg of heat-denatured RNA, 50 ng of random hexamers, 10 mM dithiothreitol, 500 mM of each dNTP, 50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2, and either 1 ml of SuperScript III reverse transcriptase (200 U/ml; Gibco-BRL) or 1 ml of water (mock reactions). After 1 h at 37 , RT reactions are diluted to 100 ml and denatured at 95 for 10 min. In a final volume of 50 ml, each PCR contains 5 ml of the diluted RT reaction, 1 mM of each PCR primer, 200 mM of each dNTP, 1.5 mM MgCl2, 20 mM Tris-HCl, pH 8.4, and 50 mM KCl. PCR are initiated at 95 by the addition of Taq DNA polymerase (2.5 U; Gibco-BRL) and allowed to cycle as follows: 45 s at 94 , 45 s at the annealing temperature, and 1 min at 72 . Ten microliters of the PCR products is resolved by agarose gel electrophoresis and visualized with ethidium bromide staining (0.5 mg/ml). Additionally, telomerase activity is verified as described previously (Ouellette et al., 1999) using the TRAP-eze telomerase detection kit (Intergen). Control primary pancreatic duct cells normally undergo senescence at around PD 25, but those populations expressing exogenous hTERT are immortalized and show unlimited proliferative capacity (Lee et al., 2003). While cancer-related phenotypic changes were not seen in these immortal cells, a loss of the epithelial cell markers carbonic anhydrase II and cytokeratin 19 (Vila et al., 1994) (using primers 50 -AAGGAACCCATCAGCG TCAG-30 /50 -AAAGCACCAACCAGCCACAG-30 and 50 -GCCACT ACTACACGACCATCC-30 /50 -GAATCCACCTCCACACTGACC-30 , respectively) was evident. Concurrently, immortal clones analyzed at all time points expressed nestin, a putative marker for pluripotent stem cells (Hunziker and Stein, 2000; Zulewski et al., 2001). These cells are now denoted as human pancreatic nestin-expressing (hTERT-HPNE) cells.
Mutant K-Ras Transforms Primary Pancreatic Cells
455
3. Additional Genetic Steps Required to Transform Pancreatic Duct-Derived Cells Because the hTERT-HPNE cells showed no phenotypic changes characteristic of cancer cells [soft agar colony formation, p53 and p21WAF1 mutation or p16INK4a loss (Lee et al., 2003)], we sought to drive these cells toward a cancerous transformation by the introduction of additional genes known to be functionally perturbed in PDA. The E6 and E7 proteins of the HPV16 virus were used to emulate the loss of p53 and inactivation of the p16INK4a/Rb pathway, respectively. Oncogenic versions of H-Ras, K-Ras, and N-Ras were compared for their capacity to emulate the activation of K-Ras seen in early PanINs. Finally, the SV40 small t (st) antigen, which had been reported to be required for the malignant transformation of primary human cells, was also used. To prevent Ras-induced senescence, as well as toxicities associated with the expression of the SV40 st antigen, E6 and E7 were transduced prior to the introduction of these oncogenes. In all, eight derivatives of hTERT-HPNE cells were made expressing the following combinations of oncogenes: E6/E7, E6/E7/st, E6/E7/K-Ras12D, E6/ E7/H-Ras12V, E6/E7/N-Ras12D, E6/E7/K-Ras12D/st, E6/E7/HRas12V/st, or E6/E7/N-Ras12D/st (Fig. 31.1). A brief description of the construction of the retrovirus expression plasmid DNAs used in our studies is presented next. Plasmid pBabeZeo-st: A BamHI–BglII fragment from pCMV5-small t (Sontag et al., 1993) is cloned into the BamHI site of pBabe Zeo. Plasmid pBabe Zeo is a derivative of pBabe Puro (Morgenstern and Land, 1990) in which the Puror cassette is inactivated by deletion of an EcoRI–ClaI fragment and replacement with an EcoRI–AccI segment from pKS-Zeo. Plasmid pKS-Zeo is made by insertion in the BamHI site of pBluescript KS II of a BglII–BamHI fragment from plasmid pZeoSV (Invitrogen). Plasmid pLXSH-N-RasG12D: A BamHI fragment from pBabePuro-NRas(G12D) (Fiordalisi et al., 2001) is inserted in the BamHI site of pLXSH. Plasmid pLXSH is a derivative of pLXSN (Miller and Rosman, 1989) in which the neor cassette is inactivated by deletion of a HindIII–NaeI fragment and replacement with a HindIII–BglII segment from pSV2-Hygro (Maione et al., 1992). Plasmid pLXSH-K-RasG12D: A cDNA fragment encoding K-RasG12D is RT-PCR amplified from PANC-1 cells with primers 50 -CTTGCTA GGATCCTGCTGAAAATGACTGAATATA-30 and 50 -GCTAGGA TCCGTATGCCTTAAGAAAAAAGTACAA-30 . The resultant PCR product is digested with BamHI and inserted into the BamHI site of plasmid pLXSH.
456
Paul M. Campbell et al.
A
Human primary pancreatic duct cells + hTERT hTERT-HPNE + E6/E7 + H-Ras12V/K-Ras12D/N-Ras12D
E6/E7
E6/E7/Ras
+ SV40 st
+ SV40 st
E6/E7/st
Cells (⫻ 105 + SEM)
B
C
8 7 6 5 4 3 2 1 0
E6/E7/Ras/st
E6/E7/st E6/E7/K-Ras12D/st
Plate
1 2 4 Days post plate
E6/E7/st
6
E6/E7/K-Ras12D/st
D
E
Figure 31.1 Immortalization and transformation of primary pancreatic duct-drived cells. (A) Ectopic expression of hTERTwas used to immortalize a primary pancreatic duct cell culture, generating hTERT-HPNE cells. These cells were then sequentially infected to express first the human papilloma virus proteins E6 and E7 (E6/E7) and then constitutively active forms of H-Ras12V, K-Ras12D, or N-Ras12D. E6/E7 and E6/E7/Ras
Mutant K-Ras Transforms Primary Pancreatic Cells
457
3.1. Preparing viral supernatants carrying HPV16 E6/E7 PA317 LXSN 16E6E7 cells expressing HPV16 E6/E7 [ATCC (Halbert et al., 1991)] are thawed in DMEM supplemented with 10% FCS and 50 mg/ml gentamicin. Fresh medium is replaced the following day. Upon confluence, cells are split with trypsin-EDTA to split ratios of 1:6 to 1:12. Cells are plated in a 150-mm dish and grown until 80% confluent. These are washed once with Medium D, and then a minimal volume of Medium D (12 ml/150-mm plate) is used to collect viruses overnight. The supernatant is cleared through a 0.45-mm polysulfone filter to remove any suspended cells, and polybrene is added to a final concentration of 4 mg/ml. Supernatants are used immediately or frozen for future experiments.
3.2. Preparing viral supernatants carrying oncogenic Ras and the SV40 small t antigen fNX-A cells are grown in DMEM supplemented with 10% FCS and 50 mg/ml gentamicin and are split with trypsin-EDTA 1:4 to 1:6, avoiding >90% confluence. Cells are seeded into two 100-mm plates at 5106 cells/ plate. On the following day, fNX-A cells (80% confluent) are transfected with retroviral vectors (pBabeZeo-st, pBabeHygro ras, pLXSH-NRasG12D, or pLXSH-K-RasG12D). fNX-A cells are transfected most easily using the CaPO4 method, but other methods can be used as well. To calcium transfect the cells, we use Stratagene’s MBS mammalian transfection kit following the manufacturer’s instructions. In a 5-ml Falcon polystyrene tube, a calcium–DNA precipitate is prepared by mixing plasmid DNA (10 mg in 450 ml of sterile water) with 50 ml of solution I (2.5 M CaCl2) and then adding 500 ml of solution II (N,N-bis(2-hydroxyethyl)-2aminoethanesulfonic acid in buffered saline). The calcium–DNA mix is incubated at room temperature for 10 to 20 min. fNX-A cells are washed once with warm phosphate-buffered saline (PBS) and fed with 10 ml/dish of DMEM supplemented with 6% modified bovine serum (as provided by the kit). The precipitated DNA is gently resuspended and added to the fNX-A cells drop wise in a circular motion to distribute the DNA evenly. Dishes of fNX-A cells are swirled once and incubated at 37 and 5% CO2 for 3 h. Cells are washed once with warm PBS and fed DMEM supplemented with 10% FCS and 50 mg/ml gentamicin. Viruses are collected in three consecutive harvests over the next 72 h. To collect the viruses, 4 to 5 ml of fresh Medium D is used for each harvest, cells were then infected with retrovirus encoding SV40 st to establish E6/E7/st and E6/E7/ Ras/st cells, respectively. Examples of K-Ras12D-transformed cells show increased proliferation (B), contact-independent growth (C), invasion (D), and migration (E).
458
Paul M. Campbell et al.
with supernatants exposed to virus-producing cells for 8 to 16 h. Supernatants are cleared through 0.45-mm filters and either kept on ice and used within the hour or frozen at 80 , where the virus titer is stable for approximately 6 months.
3.3. Tranducing hTERT-HPNE cells hTERT-HPNE cells are thawed in Medium D and expanded by trypsinizing and replating at split ratios of 1:3 to 1:4. Viral E6/E7 supernatants (2 ml/ 100-mm plate) are added to 80% confluent cultures, and cells are incubated overnight at 37 . The viral supernatant is replaced with fresh growth medium, and cells are split at a ratio of 1:3 to 1:4 over 2 to 3 days. Selection for viral gene integration is accomplished by treating infected cultures with 400 mg/ml G418 for 2 to 3 weeks, changing the medium every 3 to 4 days. Cohorts of these resultant cell populations are further transduced in the same manner for expression of oncogenic Ras isoforms (using 200 mg/ml hygromycin B for selection) or SV40 st antigen (using 50 mg/ml zeocin). To verify expression of these cDNA constructs, total RNA is extracted from cells with TRIzol (1 ml/100-mm plate, Invitrogen), and RT-PCR is performed as described earlier using the following forward/reverse 50 -30 primers: K-Ras— CTTGCTGAATTCCTGCTGAAAATGACTG AATATA/GCTACTCGAGGTATGCCTTAAGAAAAAAGTACAA; b\actin—CGGGACCTGACTGACTACCT/CAGCACTGTGTTGGCG TACA; E6—GAACAGCAATACAACAAACCG/GCAACAAGAC ATACATCGACC; E7— AGGAGGAGGATGAAATAGATGG/TGG TTTCTGAGAACAGATGGG; and SV40 st— GAAGCAGTAGCAA TCAACCC/GCTTCTTCCTTAAATCCTGGTG. Annealing temperatures are set to either 55 (E6, st, K-Ras) or 57 (E7). Amplifications are done for 25 to 35 cycles, depending on the primer pair. The sizes of the expected PCR products are 351 bp (b-actin), 156 bp (E6), 197 bp (E7), 171 bp (SV40 st), and 250 bp (K-Ras). Results show equal signal for b-actin and confirm the presence or absence of each oncogene in the different hTERT-HPNE derivatives. PCR products of K-Ras cDNA are digested with BccI and resolved on ethidium bromide-agarose gels to differentiate between the expression of wild type and exogenous mutated K-Ras. The G12D mutation creates an additional BccI site, which gives digestion patterns that differ for wild type (154 þ 96 bp) and oncogenic (104 þ 50 þ 96 bp) K-Ras. Digestion is done overnight at 37 in PCR buffer. K-Ras protein expression and activation are assayed by pull-down assays using the pGEX-Raf-RBD glutathione-S-transferase-bound fusion protein containing the Ras-binding domain of Raf-1 as described previously (Peterson et al., 1996); expression of b-actin serves as a loading control (antibody AC-15; Sigma).
Mutant K-Ras Transforms Primary Pancreatic Cells
459
The HPV proteins E6 and E7 inactivate the cell cycle genes p53 and pRb, elements that are often disrupted in cancer (Munger et al., 1989; Werness et al., 1990), but the exogenous expression of these genes in hTERT-HPNE cells did not cause morphological or phenotypical changes. Because the mutation of Ras is an early event in more than 90% of PDA cases, we introduced oncogenic forms of H-, K-, and N-Ras into E6/E7 cells. Even the expression of these oncogenes failed to lead to soft agar colony growth. However, expression of SV40 st in E6/E7/Ras cells leads to significant transformation, as illustrated by contact-independent growth in soft agar. Because K-Ras is mutated in almost all PDA patients’ tumors, we decided to focus on this cell line for further studies. The amount of total K-Ras expressed was similar in the matched E6/E7/st and E6/E7/Ras/st pair of cell lines; however, cells with mutant K-Ras12D expression exhibited significantly more GTP-bound K-Ras. This observation contrasts with other human model cell systems described, where the exogenous Ras gene resulted in significantly greater protein expression than is typically seen in human tumor cells. Thus, the matched pair of E6/E7/st and E6/E7/ Ras/st cells provided us with a well-defined system to assess the signaling repercussions of mutant K-Ras expressed at physiologic levels.
4. Analysis of K-Ras Effector Pathways in Pancreatic Cell Transformation 4.1. Growth transformation assays Initially, we looked at the growth of E6/E7/st and E6/E7/Ras/st under normal culture conditions [four parts high glucose DMEM to one part M3F (InCell) supplemented with 5% FCS, 100 U/ml penicillin, and 100 mg/ml streptomycin]. Ten thousand cells are seeded onto plastic in triplicate, and cells are trypsinized and counted after 24, 48, 96, and 144 h. For analysis of anchorage-independent growth, six-well plates are initially coated with 1 ml of autoclaved 1.8 g/ml agar and allowed to cool and gel. This thin dense bottom layer of agar prevents cell adherence to the plastic. Log-phase growing cells are trypsinized, and triplicates of 3103 cells per well are suspended in 3 ml of enriched medium (supplemented with an additional 10% FCS), mixed quickly with 1 ml of warm (65 ) sterile 1.5% agar, and plated onto the agar-coated six-well plates (Campbell and Szyf, 2003). This layer is allowed to set at room temperature for 30 min before 1 ml of standard growth medium is added to the top of the gelled matrix and colonies are grown for 21 days. To assess the contributions of different effectors downstream of oncogenic K-Ras12D signaling, we utilized established pharmacologic inhibitors. MCP110 disrupts the physical interaction between Ras and Raf, with
460
Paul M. Campbell et al.
MCP122 as a negative control inactive analog (Kato-Stankiewicz et al., 2002), and U0126 is a highly specific inhibitor of MEK1/2. LY294004 blocks the activity of PI3K to prevent activation of Akt and other signaling proteins. Stock solutions of inhibitors are dissolved in dimethyl sulfoxide (DMSO) and added to both the agar containing the cells and the feeding medium at the following final concentrations: MCP110/122 (NexusPharma) at 10 mM, LY294002 (Promega) at 10 mM, or U0126 (Promega) at 30 mM. Plates are refed with fresh growth medium including inhibitors or DMSO once per week. After 21 days in culture, colonies are stained with 0.5 ml/well of 1 mg/ml 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, counted in five random three-dimensional microscopic fields per well, and photographed. Cells with K-Ras12D expression show extensive colony formation within a week of suspension and large colonies visible to the naked eye within 14 days. For tumorigenicity analysis, E6/E7/st or E6/E7/Ras/st cells are injected subcutaneously into the flanks of Hsd:Athymic Nude-Foxn1nu nude mice (Harlan) at seeding densities of 0.2, 0.5, 1, or 2106 cells per site. Tumor measurements are taken by calipers three times per week over 8 weeks or until the tumor burden reaches 1 cm3. Tumor volumes are calculated by estimation of an ellipsoid using (4/3)p(xyx/6), where x is length, y is width, and z is depth of the tumor. For histology analysis, tumors are excised immediately following euthanization and fixed in 10% buffered formalin. Tumor tissue is embedded in paraffin, and sections are cut and stained for cytoarchitecture with hematoxylin and eosin. Sections are additionally stained for cytokeratins with AE1/AE3 antibodies (Listrom and Dalton, 1987) and vimentin (Fig. 31.2). In agreement with Western blot analysis, xenograft tumors arising from E6/E7/Ras/st cells show low levels of cytokeratin expression and strong vimentin expression, and histology reveals that the tumors resemble more of a sarcomatoid pancreatic cancer than classic PDA.
4.2. Signaling protein expression and activation Cells growing in log phase are incubated for 24 h in starvation medium (normal medium with serum replaced by 1 g/ml bovine serum albumin, 10 mM HEPES) before adding inhibitors for an additional 24 h. Western blot analyses are done using primary antibodies against ERK1/2 (9102, Cell Signaling), phospho-ERK1/2 (9106, Cell Signaling), phospho-MEK1/2 (9121, Cell Signaling), MKP-2 (sc-1200, Santa Cruz), Akt (9272, Cell Signaling), and phospho-Akt (9271, Cell Signaling). Pull-down assays used to detect formation of active GTP-bound RalA are performed as described previously (Wolthuis et al., 1998), with glutathione-S-transferase fusion protein containing the Ral-GTP-binding domain (pGEX RalBD). Beads sequestering activated Ral proteins are separated by SDS-PAGE and
Mutant K-Ras Transforms Primary Pancreatic Cells
A
Pancreatic ductal adenocarcinoma (H & E) C
E6/E7/Ras/st AE1/AE3 cytokeratin
461
B
E6/E7/Ras/st (H & E) D
E6/E7/Ras/st vimentin
Figure 31.2 Histology of E6/E7Ras/st xenografts. Xenograft tumors derived from E6/ E7/Ras/st cells were excised and fixed in formalin. Following postfixation embedding in paraffin, sections were stained for hematoxylin and eosin (H&E, B), AE1/AE3-sensitive cytokeratins (C), or vimentin (D). E6/E7/st cells did not form tumors in mice. A section of human PDA is shown for cytoarchitecture comparison (A).
probed with anti-RalA antibodies (BD Biosciences). The total cell lysate is also blotted to determine total Ral protein levels.
4.3. Migration assays Cells grown to 90% confluence are starved as described earlier for 24 h. At t ¼ 0, cells are treated with inhibitors of the Raf-MEK-ERK or PI3K-Akt pathways as described previously, and a ‘‘wound’’ is created by scoring a line across the monolayer of cells with a pipette tip (Valster et al., 2005). At 12 h, cells are fixed and stained with Diff-Quik (Dade-Behring), a modified fixation and Wright Giemsa stain protocol, and digital micrographs are taken with a 40 objective. Wounds fixed and stained at t ¼ 0 are used as the reference against which migration of treated cells is compared. Cells that have migrated into the space of by the wound are counted manually. Triplicate wells for each treatment group are stained and scored. For transwell invasion assays, cells are starved and treated with inhibitors as described earlier for 24 h. Because trypsin can activate extracellular enzymes such as metallomatrix proteases and promote invasion (Soreide et al., 2006), we avoid its use so as to not obscure the inherent invasive
462
Paul M. Campbell et al.
ability of the cells. Cells are suspended from adherent cultures with 1 ml TrypLE Express trypsin-free dissociation solution (Invitrogen) and counted. Twenty thousand cells are loaded into 500 ml of starvation medium and inhibitors in the top well of Biocoat chambers. These wells contain a layer of growth factor-reduced Matrigel extracellular basement membrane proteins over a polyethylene terephthalate membrane with 8-mm pores (BD Biosciences). The bottom chamber contains the same medium and inhibitor concentration. Cells are allowed to invade through the Matrigel for 24 h before the Matrigel is removed with moistened cotton swabs, and cells that have migrated to the underside of the membrane are fixed and stained with Diff-Quik. Cells adhering to the bottom surface of the membrane are counted under microscopy.
5. Discussion This chapter focused on the stepwise transformation of the nestinexpressing cells from the human pancreas and the steps required to make them tumorigenic, as well as elements of Ras signaling that contribute to their transformation. In recent reports, this cell type was identified as both an adult stem cell and a putative precursor of PanIN lesions (Carriere et al., 2007). Most significant were results of knock-in experiments, which took advantage of endogenous promoters to drive the expression of oncogenic K-Ras in selected mouse tissues. Despite its ductal characteristics, PDA failed to be recapitulated in mice engineered to express oncogenic K-Ras in pancreatic ductal epithelial cells (Brembeck et al., 2003). Forced expression under the control of the endogenous nestin promoter, however, results in a phenotype that reconstitutes the course of the disease from PanIN lesions to invasive PDA (Carriere et al., 2007). Similar results had been reported previously in a mouse model that instead used promoters of the p48 and PDX-1 genes (Aguirre et al., 2003; Hingorani et al., 2005). Nestin, PDX-1, and p48 are expressed in developmental precursors of the exocrine pancreas (Dutta et al., 2001; Herrera et al., 2002; Hunziker and Stein, 2000; Selander and Edlund, 2002). In the adult pancreas, reexpression of these markers accompanied regenerative processes that follow tissue injury (Delacour et al., 2004; Fernandes et al., 1997). Previously, we used the catalytic subunit of telomerase (hTERT) to immortalize nestin-expressing cells isolated from the pancreatic ducts of a 52-year-old organ donor (Lee et al., 2003). We subsequently described in these cells the expression of other markers of putative stem cells, as well as a capacity to give rise to pancreatic ductal cells (Lee et al., 2005). Using oncogenic insults designed to emulate those detected in PDA, Campbell et al. (2007) described the stepwise transformation of these cells to a tumorigenic phenotype. This
Mutant K-Ras Transforms Primary Pancreatic Cells
463
chapter detailed the procedures used for manipulation of these cells and characterization of their transformed phenotype, including growth properties, motility, invasiveness, and expression of tumor markers. These cells provide an additional tool to be used to discover the relative roles of Ras and other oncogenes in the initiation and progression of PDA and to elucidate the signaling mechanisms caused by oncogenic Ras necessary and sufficient for oncogenic growth transformation.
ACKNOWLEDGMENTS Our research studies were supported by National Institutes of Health grants to C.J.D. (CA42978, CA71341, and CA109550), the Lustgarten Foundation for Pancreatic Cancer Research (LF 01–040) and Early Detection Research Network (U01 CA111294) to M.M.O., and the National Cancer Institute Gastrointestinal SPORE (P50-CA106991–02) to P.M.C.
REFERENCES Aguirre, A. J., Bardeesy, N., Sinha, M., Lopez, L., Tuveson, D. A., Horner, J., Redston, M. S., and DePinho, R. A. (2003). Activated Kras and Ink4a/Arf deficiency cooperate to produce metastatic pancreatic ductal adenocarcinoma. Genes Dev. 17, 3112–3126. Ahrendt, S. A., and Pitt, H. A. (2002). Surgical management of pancreatic cancer. Oncology 16, 725–734; discussion 734, 736–738, 740, 743. Allison, D. C., Piantadosi, S., Hruban, R. H., Dooley, W. C., Fishman, E. K., Yeo, C. J., Lillemoe, K. D., Pitt, H. A., Lin, P., and Cameron, J. L. (1998). DNA content and other factors associated with ten-year survival after resection of pancreatic carcinoma. J. Surg. Oncol. 67, 151–159. Brembeck, F. H., Schreiber, F. S., Deramaudt, T. B., Craig, L., Rhoades, B., Swain, G., Grippo, P., Stoffers, D. A., Silberg, D. G., and Rustgi, A. K. (2003). The mutant K-ras oncogene causes pancreatic periductal lymphocytic infiltration and gastric mucous neck cell hyperplasia in transgenic mice. Cancer Res. 63, 2005–2009. Campbell, P. M., Groehler, A. L., Lee, K. M., Ouellette, M. M., Khazak, V., and Der, C. J. (2007). K-Ras promotes growth transformation and invasion of immortalized human pancreatic cells by Raf and phosphatidylinositol 3-kinase signaling. Cancer Res. 67, 2098–2106. Campbell, P. M., and Szyf, M. (2003). Human DNA methyltransferase gene DNMT1 is regulated by the APC pathway. Carcinogenesis 24, 17–24. Carriere, C., Seeley, E. S., Goetze, T., Longnecker, D. S., and Korc, M. (2007). The Nestin progenitor lineage is the compartment of origin for pancreatic intraepithelial neoplasia. Proc. Natl. Acad. Sci. USA 104, 4437–4442. Cox, A. D., and Der, C. J. (2002). Ras family signaling: Therapeutic targeting. Cancer Biol. Ther. 1, 599–606. Delacour, A., Nepote, V., Trumpp, A., and Herrera, P. L. (2004). Nestin expression in pancreatic exocrine cell lineages. Mech. Dev. 121, 3–14. Dutta, S., Gannon, M., Peers, B., Wright, C., Bonner-Weir, S., and Montminy, M. (2001). PDX:PBX complexes are required for normal proliferation of pancreatic cells during development. Proc. Natl. Acad. Sci. USA 98, 1065–1070.
464
Paul M. Campbell et al.
Elenbaas, B., Spirio, L., Koerner, F., Fleming, M. D., Zimonjic, D. B., Donaher, J. L., Popescu, N. C., Hahn, W. C., and Weinberg, R. A. (2001). Human breast cancer cells generated by oncogenic transformation of primary mammary epithelial cells. Genes Dev. 15, 50–65. Fernandes, A., King, L. C., Guz, Y., Stein, R., Wright, C. V., and Teitelman, G. (1997). Differentiation of new insulin-producing cells is induced by injury in adult pancreatic islets. Endocrinology 138, 1750–1762. Fiordalisi, J. J., Johnson, R. L., 2nd, Ulku¨, A. S., Der, C. J., and Cox, A. D. (2001). Mammalian expression vectors for Ras family proteins: Generation and use of expression constructs to analyze Ras family function. Methods Enzymol. 332, 3–36. Hahn, W. C., Counter, C. M., Lundberg, A. S., Beijersbergen, R. L., Brooks, M. W., and Weinberg, R. A. (1999). Creation of human tumour cells with defined genetic elements. Nature 400, 464–468. Hahn, W. C., and Weinberg, R. A. (2002). Rules for making human tumor cells. N. Engl. J. Med. 347, 1593–1603. Halbert, C. L., Demers, G. W., and Galloway, D. A. (1991). The E7 gene of human papillomavirus type 16 is sufficient for immortalization of human epithelial cells. J. Virol. 65, 473–478. Herrera, P. L., Nepote, V., and Delacour, A. (2002). Pancreatic cell lineage analyses in mice. Endocrine 19, 267–278. Hingorani, S. R., Wang, L., Multani, A. S., Combs, C., Deramaudt, T. B., Hruban, R. H., Rustgi, A.K, Chang, S., and Tuveson, D. A. (2005). Trp53R172H and KrasG12D cooperate to promote chromosomal instability and widely metastatic pancreatic ductal adenocarcinoma in mice. Cancer Cell. 7, 469–483. Hruban, R. H., Goggins, M., Parsons, J., and Kern, S. E. (2000a). Progression model for pancreatic cancer. Clin. Cancer Res. 6, 2969–2972. Hruban, R. H., Wilentz, R. E., and Kern, S. E. (2000b). Genetic progression in the pancreatic ducts. Am. J. Pathol. 156, 1821–1825. Hunziker, E., and Stein, M. (2000). Nestin-expressing cells in the pancreatic islets of Langerhans. Biochem. Biophys. Res. Commun. 271, 116–119. Jemal, A., Murray, T., Ward, E., Samuels, A., Tiwari, R. C., Ghafoor, A., Feuer, E. J., and Thun, M. J. (2005). Cancer statistics, 2005. CA Cancer J. Clin. 55, 10–30. Jesnowski, R., Mu¨ller, P., Schareck, W., Liebe, S., and Lo¨hr, M. (1999). Immortalized pancreatic duct cells in vitro and in vivo. Ann. N.Y. Acad. Sci. 880, 50–65. Kato-Stankiewicz, J., Hakimi, I., Zhi, G., Zhang, J., Serebriiskii, I., Guo, L., Edamatsu, H., Koide, H., Menon, S., Eckl, R., Sakamuri, S., Lu, Y., et al. (2002). Inhibitors of Ras/Raf-1 interaction identified by two-hybrid screening revert Ras-dependent transformation phenotypes in human cancer cells. Proc. Natl. Acad. Sci. USA 99, 14398–14403. Lee, K. M., Nguyen, C., Ulrich, A. B., Pour, P. M., and Ouellette, M. M. (2003). Immortalization with telomerase of the Nestin-positive cells of the human pancreas. Biochem. Biophys. Res. Commun. 301, 1038–1044. Lee, K. M., Yasuda, H., Hollingsworth, M. A., and Ouellette, M. M. (2005). Notch 2-positive progenitors with the intrinsic ability to give rise to pancreatic ductal cells. Lab. Invest. 85, 1003–1012. Linetsky, E., Bottino, R., Lehmann, R., Alejandro, R., Inverardi, L., and Ricordi, C. (1997). Improved human islet isolation using a new enzyme blend, liberase. Diabetes 46, 1120–1123. Listrom, M. B., and Dalton, L. W. (1987). Comparison of keratin monoclonal antibodies MAK-6, AE1:AE3, and CAM-5.2. Am. J. Clin. Pathol. 88, 297–301. Maione, R., Fimia, G. M., and Amati, P. (1992). Inhibition of in vitro myogenic differentiation by a polyomavirus early function. Oncogene 7, 85–93.
Mutant K-Ras Transforms Primary Pancreatic Cells
465
Malumbres, M., and Barbacid, M. (2003). RAS oncogenes: The first 30 years. Nat. Rev. Cancer 3, 459–465. Miller, A. D., and Rosman, G. J. (1989). Improved retroviral vectors for gene transfer and expression. Biotechniques 7, 980–982, 984–986, 989–990. Morgenstern, J. P., and Land, H., (1990). Advanced mammalian gene transfer: High titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line. Nucleic Acids Res. 18, 3587–3596. Mu¨nger, K., Werness, B. A., Dyson, N., Phelps, W. C., Harlow, E., and Howley, P. M. (1989). Complex formation of human papillomavirus E7 proteins with the retinoblastoma tumor suppressor gene product. EMBO J. 8, 4099–4105. Nakamura, T. M., Morin, G. B., Chapman, K. B., Weinrich, S. L., Andrews, W. H., Lingner, J., Harley, C. B., and Cech, T. R. (1997). Telomerase catalytic subunit homologs from fission yeast and human. Science 277, 955–959. Ouellette, M. M., Aisner, D. L., Savre-Train, I., Wright, W. E., and Shay, J. W. (1999). Telomerase activity does not always imply telomere maintenance. Biochem. Biophys. Res. Commun. 254, 795–803. Peterson, S. N., Trabalzini, L., Brtva, T. R., Fischer, T., Altschuler, D. L., Martelli, P., Lapetina, E. G., Der, C. J., and White, G. C., 2nd (1996). Identification of a novel RalGDS-related protein as a candidate effector for Ras and Rap1. J. Biol. Chem. 271, 29903–29908. Repasky, G. A., Chenette, E. J., and Der, C. J. (2004). Renewing the conspiracy theory debate: Does Raf function alone to mediate Ras oncogenesis? Trends Cell Biol. 14, 639–647. Selander, L., and Edlund, H. (2002). Nestin is expressed in mesenchymal and not epithelial cells of the developing mouse pancreas. Mech. Dev. 113, 189–192. Sontag, E., Fedorov, S., Kamibayashi, C., Robbins, D., Cobb, M., and Mumby, M. (1993). The interaction of SV40 small tumor antigen with protein phosphatase 2A stimulates the map kinase pathway and induces cell proliferation. Cell 75, 887–897. Soreide, K., Janssen, E. A., Ko¨rner, H., and Baak, J. P. (2006). Trypsin in colorectal cancer: Molecular biological mechanisms of proliferation, invasion, and metastasis. J. Pathol. 209, 147–156. Valster, A., Tran, N. L., Nakada, M., Berens, M. E., Chan, A. Y., and Symons, M. (2005). Cell migration and invasion assays. Methods 37, 208–215. Vila´, M. R., Balague´, C., and Real, F. X. (1994). Cytokeratins and mucins as molecular markers of cell differentiation and neoplastic transformation in the exocrine pancreas. Zentralbl. Pathol. 140, 225–235. Warshaw, A. L., and Fernandez-del Castillo, C. (1992). Pancreatic carcinoma. N. Engl. J. Med. 326, 455–465. Werness, B. A., Levine, A. J., and Howley, P. M. (1990). Association of human papillomavirus types 16 and 18 E6 proteins with p53. Science 248, 76–79. Wolthuis, R. M., Zwartkruis, F., Moen, T. C., and Bos, J. L. (1998). Ras-dependent activation of the small GTPase Ral. Curr. Biol. 8, 471–474. Yeh, J. J., and Der, C. J. (2007). Targeting signal transduction in pancreatic cancer treatment. Expert Opin. Ther. Targets 11, 673–694. Zulewski, H., Abraham, E. J., Gerlach, M. J., Daniel, P. B., Moritz, W., Mu¨ller, B., Vallejo, M., Thomas, M. K., and Habener, J. F. (2001). Multipotential nestin-positive stem cells isolated from adult pancreatic islets differentiate ex vivo into pancreatic endocrine, exocrine, and hepatic phenotypes. Diabetes 50, 521–533.