Characterisation of a functional E box motif in the proximal rat preprotachykinin-A promoter

ELSEVIER

Neuroscience Letters 191 (1995) 185-188

NHROSCIHC[ LEIT[HS

Characllerisation of a functional E box motif in the proximal rat preprotachykinin-A promoter J.M. Paterson a, C.F. MorrisonL S.P. Dobson a, J. McAllister a, J.P. Q u i n n b,* aMRC Brain Metabolism Unit, Royal Edinburgh Hospital, Morningside Park, Edinburgh, EHIO 5HF, UK bDepartment of Veterinar~ Pathology, Royal (Dick) School of Veterinary Studies, University of Edinburgh, Summerhall, Edinburgh, EH9 1QH, UK Received l March 1995; revised version received 21 April 1995; accepted 21 April 1995

Abstract

Three E'box motifs, which are upstream of the major transcriptional start site, have previously been characterised in the rat preprotachykinin-A (rPPT) promoter. Only one of these, in the proximal promoter spanning nucleotides -67 to -47, has been demonstrated to support reporter gene expression in clonal cell lines under basal growth conditions. Here we demonstrate that the reporter gene expression can be further induced by the action of phorbol 12-myristate 13-acetate (TPA) and nerve growth factor (NGF), respectively, in both HeLa and the neuronally derived PC12 cells. This response is due to the E box motif and not an overlapping consensus sequence for a putative AP1 element, a class of element previously demonstrated to respond to both TPA and NGF in these cell lines. Finally, we demonstrate that this E box motif can support similar levels of reporter gene expression in primary cultures of dorsal root ganglion neurons as observed in clonal cell lines, demonstrating that E box binding complexes can (1) function as a transcriptional regulator in dorsal root glmglion neurons and (2) bind to and therefore presumably regulate rPPT promoter activity.

Keywords: Tachykinin; bHLH; E box; Substance P; Gene expression; Transcription; Neuropeptide

Tachykinins are a family of biologically active neuropeptides which are widely but selectively distributed throughout the nervous system, where they may function as neurotransmitters [8]. The rat preprotachykinin-A gene (rPPT) encodes the neuropeptides substance P, neurokinin A, neuropeptide K and neuropeptide y, which are derived by alternative splicing of primary RNA transcripts and post translational processing of the peptide precursors [5]. The promoter region spanning nucleotides -865 to +92 is sufficient for expression of a reporter gene in microinjected adult rat dorsal root ganglion (DRG) neurons grown in culture and electroporated into PC12 cells [9,14,15]. DNase I footprint analysis has delineated some of these cis acting regulatory sites within this region [10]. This analysis has determined multiple elements which might act as activator or enhancer elements. These elements where tested have functioned to support reporter gene expression in both clonal cell lines and primary cultures of DRG neurons [9,13,16]. We have also by a similar analysis, demonstrated that repression of rPPT * Corresponding author, Fax: +44 131 650 6511.

promoter activity in clonal cell lines (as assayed by reporter gene expression) is associated with multiple silencer regions [9,16]. Silencer or repressor domains have been demonstrated in a number of other neuropeptide genes studied [12,21]. One of the rPPT silencer elements which appears to act as a dominant repressor of rPPT promoter activity in PC12 cells is located between the TATA box and the major transcriptional start site [9]. For this reason we have excised domains from the rPPT promoter identified as sites for sequence-specific DNAbinding by transcription factors and inserted them into a heterologous promoter construct linked to a downstream reporter gene. This approach has been used successfully in the identification of multiple CRE/API-like enhancer elements present within the rPPT promoter [13,16]. We have previously demonstrated that there are three E box motifs located 5' of the rPPT transcriptional start site (Fig. 1) [9,10,16]. One of these elements lies within the proximal promoter spanning nucleotides - 6 7 to --47, whereas the other two are adjacent to characterised AP1 or CRE like enhancer elements [16]. These latter E box motifs failed to support measurable reporter gene expres-

0304-3940195/$09.50 © 1995 Elsevier Science Ireland Ltd. All rights reserved SSDI 0 3 0 4 - 3 9 4 0 ( 9 5 ) 1 1 5 8 8 - K

186

LOCATION E E E E

J.M. Paterson et al. / Neuroscience Letters 191 (1995) 185-188

OF

3 E BOX MOTIFS

box Consensus Box 3 -314 Box 2 -176 Box 1 69

Putative API(1) A P I (2)

API

5' O F T R A N S C R I P T I O N A L

TAATCT TTGGTC GGAGAGTGT

CANNTG CAGG~G CAGATO CACGTG

START

TCACTO TTATGG GCTCTCCAGG

SITE

297 -159 -46

motifs AGTGT

CA TG

GCTCT

Fig. 1. Location of the rPPT E box within the rPPT promoter. DNA sequence of the sense strand of the rat preprotachykinin A (rPPT) promoter from position -69 to --45 relative to the transcriptional start site is shown, termed El. The rPPT E box is marked in bold type. Invertedly repeated sequences which flank this E box motif are underlined. A pair of complementary oligonucleotides representing this sequence was termed 472/3 when used in EMSA. Shown for comparisonare the other two E box elements which are found 5' of the transcriptional start site, E2 and E3, in addition to two putative AP1 elements overlapping oligonucleotides 472/3. sion when they were cloned as individual elements upstream of a heterologous promoter [16]. This was in stark contrast to the proximal E box motif which supported high levels of reporter gene expression in both PC12 and HeLa cells [9]. This variation in the ability of these three E box motifs to regulate reporter gene expression is likely to be due to the exact sequence of the motif and its flanking sequence, which for the E box class of binding factor will determine the affinity and specificity with which a given E box binding complex will bind to a specific E box motif [3]. We have, therefore, further characterised the transcriptional properties of this proximal E box motif. The reporter construct, E-delta 56, containing an oligonucleotide corresponding to rPPT sequences spanning - 6 7 to - 4 7 linked to the c-fos minimal promoter (-56 to +109) at - 5 6 supporting expression of the chloramphenicol acetyltransferase gene has been described previously [9]. This construct was electroporated into both PC12 and HeLa cells which were exposed respectively to nerve growth factor (NGF) or the phorbol ester, phorbol 12myristate 13-acetate (TPA), and also microinjected into primary cultures of DRG neurons (Fig. 2). Electroporation of PC12 cells with the E-delta 56 promoter-reporter construct revealed that levels of reporter gene expression were increased approximately 5-fold by the upstream insertion of the rPPT E box element. Following exposure of the transfected cells to NGF, transcription was stimulated 10-fold by the rPPT E box. Levels of transcription driven by the minimal c-fos promoter alone remained unchanged when assayed under the same conditions. These results demonstrate that the rPPT E box is an activator of transcription in PC12 cells and its activity can be regulated by NGF. The same reporter gene construct in HeLa cells shows that the level of reporter gene expression driven by the rPPT E box was approximately 10-fold greater than that driven by the minimal c-fos promoter alone. Transcriptional activation by the rPPT E box was stimulated 30-fold following exposure of the cells to TPA. The E box motif in primary cultures of DRG sup-

ported a level of reporter gene expression approximately 11-fold greater than that driven by the minimal c-fos promoter alone. No increase in the levels of reporter gene activity supported by this element were observed when the DRG neurons were exposed to NGF after the microinjection. This may be due to overlap of signal transduction pathways activated by the process of microinjection and NGF, or NGF may regulate different pathways in DRG compared to PC12 cells. The use of clonal cell lines allowed us to obtain sufficient tissue extracts for biochemical characterisation of the transcription factors binding to this motif and correlation of changes in response to the action of these stimuli, which is not easily performed with the low number of cells and their heterogeneity in primary cultures of DRG. To determine whether sequence-specific DNA-binding activity is a target of this regulation, extracts were prepared from HeLa cells with and without TPA treatment and from PC12 cells with and without exposure to NGF. Interestingly, complex formation between the rPPT E box and cellular factors is increased following exposure of PC12 cells to NGF (Fig. 3, compare lanes 3 and 4). Exposure of HeLa cells to TPA, however, does not appear to greatly affect DNA binding to this element (Fig. 3, compare lanes 1 and 2). In this latter case post translation modification of the complex or compositional variation of the complex may correlate with increased levels of reporter gene expression. Similarly, these mechanisms may participate in the increased binding of complex to the E box motif in PC12 cells exposed to NGF. Expression of members of both the bHLH and A P I transcription factor families has been shown to be induced by both TPA and NGF [1,6,7,17]. Close examination of the rPPT promoter around position - 6 0 revealed the presence of two putative AP1 binding sites exhibiting a 5 out of 7 bp match with the consensus sequence 5 ' T G A C / GTCA3' (Fig. 1). These putative AP1 sites (API(1) and API(2)) overlap the rPPT E box element. To confirm or deny any sequence-specific DNA-binding by the AP1 complex to this region of the rPPT promoter we performed electromobility shift analysis (EMSA), shown in Fig. 4. In Fig. 4A the presence of specific complexes (indicated by the arrow) formed between the rPPT E box

Fig. 2. The rPPT E box activates transcription in HeLa and PC12 cells which can be further stimulated by TPA and NGF, respectively, in addition to DRG neurons. The reporter constructs delta 56 and E-delta 56 were electroporated into the clonal cell lines or microinjected into primary cultures of DRG. Electroporations were performed twice in duplicate and microinjections were performed in triplicate. The amount of chloramphenicol acetyltransferase (CAT) enzyme produced was measured in ELISA (CAT assay system, Boehringer Mannheim). Results are expressed in fold increase over the CAT produced by the delta 56 vector.

J.M. Paterson et al. I Neuroscience Letters 191 (1995) 185-188

HeLa I

TPA NGF

PC1 2 I

-

i

I

+ -

1

2

+

3

4

187

antibody (lane 2), This antibody did not recognise any of the complexes formed between the rPPT E box probe and HeLa or PC12 cell extract, in the presence of TPA or NGF, respectively (lanes 4 and 6). From these results, we conclude that the putative AP1 sites overlapping the rPPT E box element at - 6 0 are not recognised by the AP! complex and that specific protein complexes which recognise the proximal E box sequence in both HeLa and PC12 cells, do not contain c-fos. These results indicate that sequence-specific DNA-binding to this region of the rPPT promoter by factors in HeLa and PC12 ceils is dependent upon the E box consensus. E box elements have been shown to be important for the expression of calcitonin-gene related peptide (CGRP) [2,22] which like PPT, is expressed in a sub-population of neurons in rat DRG and can be regulated by NGF in vivo and in primary neuronal cultures. The relative position of the proximal rPPT E box to the start of transcription in the reporter gene construct, and in the endogenous promoter, is similar. This is suggestive that the E box element can be similarly regulated in the context of the rPPT promoter. The ability of an E box element to regulate transcription from such a promoter position has been well A

B

competitor

antl-c-fos TpA

HeLa

DNA

472/3 ~

G2992/3 ~

1 2 3 4 s 6 7

!!i¸!iIii~i~~i~ill:ii~~ii!i!!iii!!:~' l '~:ii~:, i i....

Fig. 3. NGF increases specific binding of the rPPT E box by proteins in PCI2 cells. EMSA using the rPPT E box oligonucleotide is shown. EMSA was performed as previously described [4.20]. Cell extract was included thus: lane 1; H e L a , lane 2; HeLa + TPA, lane 3; PCI2, lane 4; PC 12 + NGF.

probe and HeLa cell protems is specifically competed by homologous oligonucleotides (lanes 2--4) whereas oligonucleotides representing the putative API(2) site overlapping the E box at - 6 0 were unable to compete for this specific binding (lanes 5-7). Similar analysis using oligonucleotides corresponding to the API(1) site and the characterised GALV AP1 enhancer element failed to compete factor binding to the E box element (data not shown). In Fig. 4B, a complex formed between HeLa cell extract and a probe representing the GALV AP1 enhancer (lane 1) is specifically recognised by purified anti-c-fos

-

+

,

PC 12 + +

NGF

-1-2

-

+

÷

+

~ ~ s 6

ilj ¸ :

Fig. 4. Proteins binding the rPPT E box are not related to the API complex. (A) EMSA using HeLa cell extract and the rPPT E box probe are shown. Homologous competitor (oligos 472/3) was added at a molax excess of 10, 50 or 100 in lanes 2, 3 and 4, respectively. Heterologous competitor (oligos G2992/3), representing the putative API (2) site overlapping the rPPT E box at - 6 0 (5'TCGACGTGGCTCTCAGGY), was included at a molar excess of 10, 50 or 100 in lanes 5, 6 and 7, respectively. (B) Lanes l and 2 show EMSA using HeLa cell extract and a probe representing the previously characterised Gibbon Ape leukemia virus (GALV) API enhancer, sequence of 5'GAGAAATAGATGAGTCAACAGC [18]. Purified anti-c-fos antibody was included in lane 2. Lanes 3-6 show EMSA using PCI2 extract and the rPPT E box probe. Extracts were prepared from PCI2 cells with (lanes 5 and 6) or without (lanes 3 and 4) exposure to NGF. Purified anti-c-fos antibody was included in lanes 4 and 6.

188

J.M. Paterson et al. / Neuroscience Letters 191 (1995) 185-188

characterised for the Adenovirus major late promoter [11,19]. We believe this is the first direct evidence that the E box motif recognised by the bHLH family of transcription factors can act as an enhancer element in DRG neurons. We are addressing the action of this E box element in the context of the rPPT-A promoter, however this problem is complicated as stated previously, by the action of silencer elements within the promoter. We would like to thank Norma Brearley for the careful preparation of the manuscript. SPD was the recipient of an MRC PhD Fellowship. [I] Angel, P., Imagaway, M., Rahmsdorf, H.J., Jonat, C., Herrlich, P. and Karin, M., Phorbol ester-inducible genes contain a common Cis element recognized by a TPA-modulated trans-acting factor, Cell, 49 (1987) 729-740. [2] Bali, D.W., Compton, D., Nelkin, B.D., Baylin, S.B. and de Bustros, A., Human calcitonin gene regulation by helix-loop-helix recognition sequences, Nucleic Acids Res., 20 (1992) 117-123. [3] Fisher, F., Crouch, D.H., Jayaraman, P.-S., Clark, W., Gillespie, D.A.F. and Goding, C.R., Transcription activation by Myc and Max: flanking sequences target activation to a subset of CACGTG motifs in vivo, EMBO J., 12 (1993) 5075-5082. [4] Fried, M. and Crothers, D.M., Equilibria and kinetics of lac repressor-operator interactions by polyacrylamide gel electrophoresis, Nucleic Acids Res., 9 (1981) 6505-6525. [5] Helke, C.J., Krause, J.E., Mantyh, P.N., Couture, R. and Bannon, M.J., Diversity in mammalian tachykinin peptidergic neurons multiple peptides, receptors, and regulatory mechanisms, FASEB J., 4 (1990) 1606-1615. [6] Johnson, J.E., Birren, S.J. and Anderson, D.J., Two rat homologues of Drosophila achaete-scute specifically expressed in neuronal precursors, Nature, 346 (1990) 858-861. [7] Lee, W., Mitchell, P. and Tjian, R., Purified transcription factor interacts with TPA inducible enhancer elements, Cell, 49 (1987) 741-752. [8] Maggio, J.E., Tachykinins, Annu. Rev. Neurosci., 11 (1988) 1328. [9] Mendelson, S.C., Morrison, C.F., McAllister, J., Paterson, J.M., Dobson, S.P., Mulderry, P.K. and Quinn, J.P., Repression of the preprotachykinin-A promoter activity is mediated by a proximal promoter element, Neuroseience, 65 (1995) 837-847. [10] Mendeison, S.C. and Quinn, J.P., Characterisation of potential regulatory elements within the rat preprotachykinin-A promoter, Neurosci. Left., 184 (1995) 125-128.

[11] Miyamoto, N.G., Moncollin, V., Egly, J.M. and Chambon, P., Specific interaction between a transcription factor and the upstream element of the adenovirus-2 major late promoter, EMBO J., 4 (1985) 3563-3570. [12] Mori, N., Schoenherr, C., Vandenbergh, D.J. and Anderson, D.J., A common silencer element in the SCG10 and Type I1 Na+ channel genes binds a factor present in nonneuronal cells but not in neuronal cells, Neuron, 9 (1992) 45-54. [13] Morrison, C.F., McAllister, J., Dobson, S.P., Mulderry, P.K. and Quinn, J.P., An activator element within the preprotachykinin-A promoter, Mol. Cell. Neurosci., 5 (1994a) 165-175. [14] Morrison, C.F., McAllister, J., Lyons, V., Chapman, K. and Quinn, J.P., The rat preprotachykinin-A promoter is regulated in PC12 cells by the synergistic action of multiple stimuli, Neurosci. Lett., 181 (1994b) 117-120. [15] Mulderry, P.K., Chapman, K.E., Lyons, V. and Harmar, A.J., 5'Flanking sequences from the rat preprotachykinin gene direct high-level expression of a reporter gene in adult rat sensory neurons transfected in culture by microinjection, Mol. Cell. Neurosci., 4 (1993) 164-172. [16] Paterson, J., Mendelson, S.C., McAllister, J., Morrison, C.F., Grace, C. and Quinn, J.P., Three immediate early gene response elements in the proximal rat preprotachykinin-A promoter in two functionally distinct domains, Neuroscience, in press. [17] Quinn, J.P., Variation in the composition of the AP! complex in PC12 cells following induction by NGF and TPA, Mol. Cell. Neurosci., 2 (1991) 253-258. [18] Quinn, J.P., Farina, A.R., Gardiner, K., Krutzsch, H. and Levens, D., Multiple components are required for sequence recognition of the AP1 site in the Gibbon Ape leukemia virus enhancer, Mol. Cell. Biol., 9 (1989) 4713-4721. [19] Sawadogo, M. and Roeder, R.G., Interaction of a gene-specific transcription factor with the adenovirus major late promoter upstream of the TATA box, Cell, 43 (1985) 165-175. [20] Singh, H., Sen, R., Baltimore, D. and Sharp, P.A., A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobulin genes, Nature, 319 (1986) 154-158. [21] Symes, A.J., Craig, R.K. and Brickell, P.M., Loss of transcriptional repression contributes to the ectopic expression of the calcitonin/alpha-CGRP gene in a human lung carcinoma cell line, FEBS Lett., 306 (1992) 229-233. [22] Tverberg, L.A. and Russo, A.F., Regulation of the calcitonin/calcitonin gene-related peptide gene by cell-specific synergy between helix-loop-helix and octamer-binding transcription factors, J. Biol. Chem., 268 (1993) 15965-15973.