- Email: [email protected]
Systematic characterisation of the rat and human CYP24A1 promoter
Molecular and Cellular Endocrinology 325 (2010) 46–53
Contents lists available at ScienceDirect
Molecular and Cellular Endocrinology journal homepage: www.elsevier.com/locate/mce
Systematic characterisation of the rat and human CYP24A1 promoter R. Kumar a,∗ , D.N. Iachini a , P.M. Neilsen a , J. Kaplan b , J. Michalakas a , P.H. Anderson c , B.K. May d , H.A. Morris c,e , D.F. Callen a a
Breast Cancer Genetics Group, Discipline of Medicine, University of Adelaide and Hanson Institute, SA Pathology, Frome Road, Adelaide, SA 5000, Australia Department of Orthopedic Surgery, University of Pennsylvania, Philadelphia, USA c Endocrine Bone Research Laboratory, Hanson Institute, SA Pathology, Adelaide, SA, Australia d School of Molecular and Biomedical Sciences, University of Adelaide, Australia e School of Pharmacy and Medical Sciences, University of South Australia, Australia b
a r t i c l e
i n f o
Article history: Received 29 December 2009 Received in revised form 22 March 2010 Accepted 27 April 2010 Keywords: Promoter CYP24A1 Vitamin D VSE Stimulation
a b s t r a c t The biologically active form of vitamin D, 1,25-dihydroxyvitamin D (1,25D) ligands VDR (vitamin D receptor) and binds to the vitamin D response element (VDRE) located within target genes to regulate their transcription. Previously we showed that 1,25D-mediated rat CYP24A1 induction via the two critical VDREs is dependent on a short stretch of nucleotides called vitamin D stimulating element (VSE), located approximately 30 bp upstream of VDRE-1 in the rat CYP24A1 promoter. We have now undertaken systematic analysis of the human CYP24A1 and rat CYP24A1 promoters to determine if the VSE is present in the human promoter. Using electrophoretic mobility shift and dual-luciferase reporter assays, we show that the VSE is absent in the human CYP24A1 promoter. In addition, we show that 1,25D-mediated induction of human CYP24A1 is dependant upon a promoter region spanning nucleotides −470 to −392 of the human CYP24A1 promoter. Crown Copyright © 2010 Published by Elsevier Ireland Ltd. All rights reserved.
1. Introduction Vitamin D in mammals arises from ultraviolet B exposure of the skin, although it can be obtained from the diet (Deeb et al., 2007; Jones et al., 1998). Metabolism through sequential hydroxylations of vitamin D is essential for generating the hormonally-active form known as 1,25-dihydroxyvitamin D (calcitriol, 1,25D); first hydroxylation of vitamin D by the enzyme 25-hydroxylase (CYP27A1) results in the formation of 25-hydroxyvitamin D (25D), a circulating prohormone. A second hydroxylation by the enzyme 25-hydroxyvitamin D-1␣-hydroxylase (CYP27B1) generates 1,25D, the biologically active form of steroid hormone that directs transcriptional regulation of a large number of target genes (Deeb et al., 2007). 1,25D is subsequently inactivated by 25-hydroxyvitamin D 24-hydroxylase (CYP24A1) (Omdahl et al., 2002). The blood levels of 25D and 1,25D arise from metabolism in the liver and kidney, respectively, and blood levels of 1,25D are determined by the balance of the CYP27B1 and CYP24A1 enzyme activities in the kidney, the genetic expression of which are inversely related to each other (Anderson et al., 2004, 2005). The biological action of 1,25D is mediated through the vitamin D receptor (VDR) (Deeb et al., 2007). 1,25D binding activates VDR, and together with the retinoid-X recep-
∗ Corresponding author. Tel.: +61 8 8222 3450; fax: +61 8 8222 3217. E-mail address: [email protected] (R. Kumar).
tor (RXR), binds to vitamin D response elements (VDREs) located within promoters of the target genes to regulate their transcription. There is now strong evidence that this hormone acts in many tissues to modulate cell proliferation, apoptosis and the immune system (Deeb et al., 2007; Jones et al., 1998). In these tissues 1,25D is locally produced through metabolism of circulating levels of the prohormone 25D since these tissues also express CYP27B1. The levels of 1,25D in the tissue are critically dependent on the balance of localised activation of 25D by CYP27B1 and the subsequent catabolism by CYP24A1. In these tissues, unlike in the kidney, the genetic expression of CYP27B1 and CYP24A1 are positively related consistent with an autocrine signaling paradigm (Anderson et al., 2005). The levels of CYP24A1 expression are repressed through the action of the unliganded VDR (Dwivedi et al., 1998) but are rapidly and highly induced in the presence of 1,25D. Since high levels of 1,25D are toxic to cells, this provides a negative regulatory mechanism for initiating intracellular autocrine signaling, and minimises cell toxicity resulting from elevated levels of 1,25D. This rapid induction of CYP24A1 by 1,25D has led to an in depth analysis of the CYP24A1 promoter. Several groups independently showed that the rat promoter of CYP24A1 contained two VDREs which were critical for the 1,25D induction of CYP24A1 expression (Zierold et al., 1995). Similar results were described for the human CYP24A1 promoter with two classical VDREs located within 300 bp upstream of the
0303-7207/$ – see front matter. Crown Copyright © 2010 Published by Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.mce.2010.04.023
R. Kumar et al. / Molecular and Cellular Endocrinology 325 (2010) 46–53
transcriptional start site (Chen and DeLuca, 1995). Despite the demonstration of additional classical VDREs at nucleotide positions −2640 and −3950 (Vaisanen et al., 2005) those in the first 300 bp of the promoter have the highest binding efficiency to VDR/RXR and efficiently recruit co-activator proteins. Luciferase reporter assays have defined that the region of the human CYP24A1 promoter from −548 to −294 bp interacts synergistically with the two adjacent VDREs to achieve maximum induction of CYP24A1 (Tashiro et al., 2007). Further upstream regions to −1918 bp have no major influence on the induction of CYP24A1 by 1,25D. The rat CYP24A1 promoter has also been extensively investigated to identify enhancer elements through which 1,25D-VDRmediated expression is stimulated. 1,25D up-regulation of rat CYP24A1 is synergistically potentiated by the phorbol ester PMA via a protein kinase C (PKC) dependent mechanism (Armbrecht et al., 2001). Further studies defined an element termed the vitamin D stimulating element (VSE). Luciferase reporter assays utilising the rat CYP24A1 promoter showed mutation of the VSE drastically reduced both 1,25D-based stimulation of the promoter and the PMA-based synergistic induction (Nutchey et al., 2005). The VSE is a short 5 -TGTCGGTCA motif located approximately 30 bp upstream of VDRE-1 at nucleotides −171 to −163 within the rat CYP24A1 promoter (Nutchey et al., 2005). Electrophoretic mobility shift assay (EMSA) detected the presence of protein binding activity to the rat VSE in human and rat nuclear extracts although the identity of the transcription factor that binds the VSE is unknown. A number of published studies have investigated the transcriptional regulation of CYP24A1. Such studies have utilised both rat and human promoter constructs and reporter assays in rat and/or human cells. Since the rat and human CYP24A1 promoter homology is only approximately 50%, the transcription factor binding sites in the rat promoter are not necessarily relevant to the human pro-
47
moter. For example, the C/EPB binding site at −395 to −388 defined in the rat CYP24A1 promoter is not conserved in the homologous region of the human promoter (Dhawan et al., 2005). The present study determines if in humans CYP24A1 induction by 1,25D is also dependent on a sequence similar to the VSE motif present within the rat CYP24A1 promoter. The present study also defines a new region of the human CYP24A1 promoter that further potentiates the 1,25D induction of the VDRs. 2. Materials and methods 2.1. Cell lines HEK293T (adherent human embryonic kidney), MCF-10A (immortalized human breast epithelial), ROS 17/2.8 (adherent rat osteosarcoma) and MCF-7, MDA-MB231, BT-20, ZR75-1, SK-BR-3 (human breast cancer) cell lines were obtained from the American Type Culture Collection (ATCC, Manassa, VA, USA) and maintained as recommended by ATCC. 2.2. Reporter constructs The rat pCYP24A1(−298)-Luc (WT-VSE) and pCYP24A1(−298)-Luc (MT-VSE) reporter constructs were as previously reported (Nutchey et al., 2005). For the remaining constructs, promoter sequences were PCR amplified from MCF7 genomic DNA with the GC-RICH PCR System (Roche) using primers listed in Table 1 and cloned at KpnI-BglII sites of pGL3-Basic vector (Promega) to generate human pCYP24A1(−392)-Luc (WT-VSE), pCYP24A1(−392)-Luc (MTVSE), pCYP24A1(−392)-Luc (with Rat WT-VSE), pCYP24A1(−451)-Luc (WT-VSE), pCYP24A1(−470)-Luc (WT-VSE), pCYP24A1(−482)-Luc and pCYP24A1(−496)-Luc (WT-VSE). 2.3. EMSA For nuclear protein extractions, nuclei isolated by a published method (Wysocka et al., 2001) were resuspended in high salt buffer (Andrews and Faller, 1991), centrifuged and aliquots of the supernatants stored at −80 ◦ C until use. Annealed short double stranded oligonucleotides were end-filled ([␣32 P]-dCTP) with Klenow frag-
Table 1 List of oligonucleotides used in this study. Construct Human pCYP24A1(−392)-Luc (WT-VSE) Human pCYP24A1(−451)-Luc Human pCYP24A1(−482)-Luc Human pCYP24A1(−470)-Luc Human pCYP24A1(−496)-Luc Human pCYP24A1(−392)-Luc (with Rat WT-VSE) Human pCYP24A1(−392)-Luc (MT-VSE) EMSA oligonucleotides hCYP24A1-WT-VSE rCyp24a1-WT-VSE rCyp24a1-MT-VSE-1 rCyp24a1-MT-VSE-2 rCyp24a1-MT-VSE-3 rCyp24a1-MT-VSE-4 rCyp24a1-MT-VSE-5 qRT-PCR hCYP24A1 PPIG
Primers (5 → 3 ) hCYP24A1p-392-F hCYP24A1p-R hCYP24A1p-451-F hCYP24A1p-R hCYP24A1p-482-F hCYP24A1p -R hCYP24A1p-470-F hCYP24A1p-R hCYP24A1p-497-F hCYP24A1p-R hCyp24A1-R-to-h-VSE-F hCyp24A1-R-to-h-VSE-R hCyp24A1-MT-VSE-F hCyp24A1-MT-VSE-R
CACACACACAGGTACCTCGCCCGCCCGGCATCGCGATTGTGCAA CACACACACAAGATCTTGGAGCCACGGGGAGGTGTCAAGGAGGGTA CACACACACAGGTACCCGGGCTCCCCGGGGCCCTGGCAGACGCCGGCAGCTTTTC CACACACACAAGATCTTGGAGCCACGGGGAGGTGTCAAGGAGGGTA CACACACACAGGTACCGCTGGGGGTATCTGGCTCCCCGGGA CACACACACAAGATCTTGGAGCCACGGGGAGGTGTCAAGGAGGGTA CACACACACAGGTACCTGGCTCCCCGGGAGGCGCCCGGGCTCCCCGGGGCCCTGGCAGA CACACACACAAGATCTTGGAGCCACGGGGAGGTGTCAAGGAGGGTA CACACACACAGGTACCTCACTTCAGTCCAGGCTGGGGGTA CACACACACAAGATCTTGGAGCCACGGGGAGGTGTCAAGGAGGGTA AGCGAACAGCGTGTCGGTCACCGCAGGCCCGGACGCCCTCGCTCACCT TCCGGGCCTGCGGTGACCGACACGCTGTTCGCTGGGCGCGGGAGGT AGCGAACATAGCCCAAGCTTCCCCAGGCCCGGACGCCCTCGCTCACCT TCCGGGCCTGGGGAAGCTTGGGCTATGTTCGCTGGGCGCGGGAGGT
Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
GTAGCCCCGGTCACCC GGGGTGACCGGGGCTA GGCGTGTCGGTCACCG GCGGTGACCGACACGC GGCGATGCGGTCACCG GCGGTGACCGCATCGC GGCGTGTAAGCTTCCG GCGGAAGCTTACACGC GCACTGTCGGTCACCG GCGGTGACCGACAGTG GGCGTGTCGGTCATTA GTAATGACCGACACGC GGCGTGTCGGCTTCCG GCGGAAGCCGACACGC
Forward Reverse Forward Reverse
AGCTTCAACTGCATTTGGCT AAATACCACCATCTGAGGCG TGGACAAGTAATCTCTGGTCAA GTATCCGTACCTCCGCAAA
48
R. Kumar et al. / Molecular and Cellular Endocrinology 325 (2010) 46–53
ment, purified and used as probes (see Table 1 for oligonucleotide sequences). Binding reactions containing 5 g nuclear extract, 1× binding buffer (25 mM Tris–HCl pH 7.6, 100 mM KCl, 52.5 mM NaCl, 0.5 mM DTT, 5 mM MgCl2 , 0.5 mM EDTA, 10% glycerol, 30 g/ml dI-dC) and radiolabeled probe were incubated at room temperature for 15 min, and then resolved on 4% 0.5× TBE gel. For competitive EMSA, 10–100× molar excess of the unlabeled competitor probe was mixed with the [32 P]-labelled probe before adding to the nuclear extracts. 2.4. Dual-luciferase reporter (DLR) assay HEK293T, MCF-7 or ROS 17/2.8 at 2 × 105 cells/well were seeded into 24-well trays in appropriate culture media with 10% charcoal-stripped foetal calf serum. Next day, cells were transfected with 400 ng of reporter construct and 25 ng of pGL4.74-hRLuc (Rinella Luc driven by TK promoter) as an internal transfection control using lipofectamine 2000 transfection agent (Invitrogen). Eight hours after transfection, cells were supplemented with 10−7 M 1,25D (Wako Pure Chemical Industries, Osaka, Japan) or vehicle (ethanol). Sixteen hours later cells were harvested and assayed using dual-luciferase reporter assay system (Promega, Madison, USA). Firefly luciferase activity was normalised to the Rinella luciferase activity and expressed as relative luciferase units (RLU). Each experiment was repeated three times and values presented as mean of all experiments ± SE. 2.5. Induction and assay of endogenous CYP24A1 expression in breast cell lines MCF-10A, BT-20, MDA-MB-231, MCF-7, SK-BR-3 and ZR75-1 cells were seeded in 6 well plates in appropriate culture media with 10% charcoal-stripped foetal calf serum, and when 80% confluent, were supplemented with either 10−7 M 1,25D or vehicle (ethanol). Sixteen hours later cells were harvested and assayed for level of mRNA by qRT-PCR as reported previously (Kumar et al., 2006). The housekeeping gene peptidyl-prolyl isomerase G (PPIG) was used to normalise the CYP24A1 cDNA expression. CYP24A1 and PPIG primers used are listed in Table 1. Protein extraction, assay and Western blotting were performed as reported previously (Kumar et al., 2006). Ten micrograms protein of each sample was used. CYP24A1 was detected by mouse monoclonal anti-CYP24A1 clone 1F8 (Sigma) antibody and rabbit anti--tubulin antibody (abcam) was used to confirm equal loading among samples.
3. Results 3.1. Is there a VSE in the human CYP24A1 promoter? We aligned rat and human CYP24A1 promoter sequences and looked for the presence of a possible human VSE. Indeed, we identified a putative human VSE that is located between the two VDREs that is conserved between the rat and human CYP24A1 promoters (Fig. 1A). Homology between the human and rat sequences 5 to the VDRE1 and 3 to the VDRE2, and the location of the putative human VSE suggests that this is the correct human sequence. There are no other sequences in the human CYP24A1 promoter that are homologous to the rat VSE. We have previously shown that unknown rat and human proteins bind to the rat VSE. However, such binding studies on the human sequence homologous to the rat VSE are lacking. We performed experiments to characterise the putative human VSE. The human (HEK293T) nuclear extracts were shown to have protein binding activity to the rat VSE probe suggesting that the human cells possess the proteins that specifically bind this sequence (Nutchey et al., 2005). EMSA and competitive EMSA were performed to determine the presence of binding activity to the putative human VSE in the human nuclear extracts (Fig. 1B). EMSA of rat nuclear extracts incubated with the radiolabeled rat VSE probe, and competitive EMSA where rat VSE was competed with 20× or 100× molar excess of unlabeled human VSE probe were included (Fig. 1B, lanes 8–12). No specific human nuclear protein binding activity to the human putative VSE sequence was detected (Fig. 1B, lanes 2–6). There was some binding activity that was not reduced or abolished when competed with the unlabeled human or rat VSE probes confirming that this activity was due to non-specific human protein binding to the human VSE probe. A specific binding activity was observed when the rat VSE probe was incubated with the rat nuclear extracts (Fig. 1B, lane
8). That rat nuclear extract exhibits a rat VSE-specific activity was also supported by the observation showing loss of this signal in the presence of 20× or 100× molar excess of unlabeled rat VSE probe (Fig. 1B, lanes 9–10). As this binding was not competed by unlabeled human VSE probe (Fig. 1B, lanes 11–12), this further confirmed binding of specific rat derived protein/s to the rat VSE probe. An EMSA using various mutated versions (MT1-5) of the rat 5 GCGTGTCGGTCACCG sequence showed that all nine rat core VSE nucleotides are required for binding of the rat protein (Fig. 1C). Whereas MT1 (TGT mutated to ATG), although difficult to see in the gel, abolished formation of the complex A whilst enhancing complex B binding (Fig. 1C, lane 2), MT2 (CGGTCA mutated to AAGCTT; Fig. 1C, lane 3) or MT5 (CGGTCA mutated to CGGCTT; Fig. 1C, lane 6) abolished binding of both complexes A and B. Furthermore, MT3 and MT4 showed formation of complexes A and B, as mutations in these two probes were located outside the nine nucleotides VSE region (Fig. 1C, lanes 4–5). An additional EMSA was performed to show that complex A is specific and requires the presence of a full length rat VSE (Fig. 1D). As expected, the binding activity of rat nuclear proteins to the WT rat CYP24A1 VSE radiolabeled probe was completely abolished when this probe pre-mixed with 10× or 50× molar excess of unlabeled WT probe was used in a competitive EMSA (Fig. 1D, lanes 2–3). However, when competed with MT1 unlabeled probe (Fig. 1D, lanes 4–5), only complex A, and when competed with MT2 (Fig. 1D, lanes 6–7) both complexes A and B, remained unaffected. These results show that a full length rat VSE is required for binding of the rat protein to the WT CYP24A1 VSE. Furthermore, these results would explain the absence of binding of any human protein to the putative human VSE 5 -CCCCGGTCA. This is because substitution of 5 -TGT of the rat VSE by 5 -CCC in the human VSE results in loss of an intact rat-like VSE. The third band was considered to be non-specific as intensity of this band was significantly reduced in the presence of both rat and human unlabeled competitor VSE probes (Fig. 1B, lanes 9–12). Taken together, both rat and human cells contain a specific protein that binds to the rat VSE motif; however, the homologous human VSE motif does not bind any human proteins. This suggests that the 5 -TGT of the VSE located within the rat CYP24A1 promoter is critical to the function of the VSE, and its loss is sufficient to cause a complete inactivation of the VSE binding motif in the human CYP24A1 promoter. To confirm our EMSA results and further investigate the role of the rat and human VSEs in 1,25D-mediated CYP24A1 stimulation, we performed dual-luciferase reporter assays. Reporter constructs were generated with rat and human CYP24A1 promoters incorporating either wild type or mutated VSE sequences (see Table 1). We also generated a construct with a human CYP24A1 promoter where putative human VSE was replaced with the rat VSE sequence (Fig. 2A). Each construct was transfected into both rat (ROS 17/2.8) and human (HEK293T) cells pre-cultured in serum-free medium (see materials and methods), treated with either 1,25D or vehicle (ethanol) and assayed for promoter activity. pGL3-basic plasmid used as a control showed no basal or 1,25D induced activity (data not presented). The patterns of relative CYP24A1 transcriptional activity of all reporter constructs in both rat and human cells are presented in Fig. 2. The promoters with putative human WT-VSE, putative human VSE replaced with a rat WT-VSE and human mutant-VSE, in the presence of 1,25D, all showed moderate and comparable activation of reporter activity in human cells (Fig. 2B). Therefore, the human element that is homologous to the rat VSE is not functional. Since in human cells, substitution of putative human WT-VSE with the rat WT-VSE did not restore 1,25D-mediated activation to levels comparable to the rat CYP24A1 promoter (WT-VSE), this activation is independent of VSE sequences. In contrast, rat CYP24A1 promoter with wild type rat VSE showed a substantial increase in 1,25D-mediated activation in both rat and
R. Kumar et al. / Molecular and Cellular Endocrinology 325 (2010) 46–53
49
Fig. 1. Rat and human CYP24A1 promoters have regions with high homology and human nuclear extract does not exhibit binding activity for the putative human VSE sequence. (A) Structural elements of the rat and human CYP24A1 promoter. Conserved nucleotides within human and rat VDRE1, VDRE2 and VSE are shown with asterisks. Sequences of the rat and human CYP24A1 probes used in B–D are also shown. The mutated nucleotides in each MT probe sequence are underlined. (B) Human- or rat-specific wild type (WT) VSE radiolabeled probes were incubated with the human (lanes 2–6) or rat (lanes 8–12) nuclear extracts and analysed by EMSA. For the competitive EMSA, 20× or 100× molar excess of human (lanes 3–4 and 11–12) or rat (lanes 5–6 and 9–10) unlabeled probes were pre-mixed with the radiolabeled probes (as shown) before incubating with the nuclear extracts. Probes without addition of proteins were analysed as control (lanes 1 and 7). Rat-specific protein–DNA complexes (A and B) are shown with arrows. (C) Rat WT or MT (mutant) VSE radiolabeled probes (sequences given in A and Table 1) were incubated with the rat nuclear extracts and analysed by EMSA. (D) Rat nuclear extracts incubated with radiolabeled WT-VSE (lane 1) alone or pre-mixed with 10× or 50× molar excess of unlabeled WT (lanes 2–3), MT1 (lanes 4–5) or MT2 (lanes 6–7) were analysed by EMSA.
human cells. This dramatic increase was dependent on the rat VSE as this activation was completely abolished in the rat promoter with a mutated VSE (Fig. 2B and C). In summary, the VSE of the wild type rat CYP24A1 promoter functions in human cells, but when the rat VSE element is substituted into the human promoter it is not functional. Therefore, although human cells possess transcription factors capable of binding and activating the VSE in the rat promoter context, the same VSE is non-functional in the human promoter context.
3.1.1. 1,25D-mediated induction of endogenous CYP24A1 in breast cell lines To further investigate CYP24A1 regulation, and to identify a breast cell line that exhibits a high 1,25-mediated CYP24A1 activation, we determined 1,25D-mediated activation of CYP24A1 in a panel of breast cell lines. Cells were treated with either 1,25D or vehicle (ethanol) for 16 h and assayed for mRNA level using qRTPCR (Fig. 3A) and protein levels by Western blot analysis (Fig. 3B). 1,25D induced a significant activation of CYP24A1 mRNA in MCF-
50
R. Kumar et al. / Molecular and Cellular Endocrinology 325 (2010) 46–53
Fig. 2. Only rat wild type CYP24A1 promoter is stimulated by 1,25D via a single VSE located between the two conserved VDREs. (A) Structure and nucleotide sequences of the VSE elements in the rat and human CYP24A1 promoter constructs. Nucleotide substitutions in the VSE to generate different mutant CYP24A1 promoters are underlined. Rat pCYP24A1(−298)-Luc (WT-VSE), rat pCYP24A1(−298)-Luc (MT-VSE), human pCYP24A1(−392)-Luc (WT-VSE), human pCYP24A1(−392)-Luc (with Rat WT-VSE) and human pCYP24A1(−392)-Luc (MT-VSE) reporter constructs were transfected into either HEK293T (B) or ROS 17/2.8 (C) cells, treated with either 1,25D or vehicle (ethanol) and assayed by dual-luciferase reporter assay system. Mean values ± standard error from three independent experiments each repeated in triplicates were plotted. *P < 0.001; **P < 0.05; n.s., not significant.
10A (210-fold), MCF-7 (140-fold) and ZR75-1 cells (150-fold). There was a relatively lower level of CYP24A1 transcriptional activation observed in SK-BR-3 cells (39-fold). The relative levels of 1,25D induced CYP24A1 protein in the cell lines differed somewhat from the relative levels of mRNA. A very high level of CYP24A1 induction was observed in MCF-10A, MCF-7 and SK-BR-3 cells, but there was a lower level of induction in ZR75-1 cells. 1,25D treatment had minimal effect on the relative levels of the mRNA, and undetectable effect on the protein, in BT-20 and MDA-MB-231 cells.
3.1.2. 1,25D activates human CYP24A1 via sequences located between nucleotides −470 to −392 In a previous study, deletion analysis of the human CYP24A1 promoter sequences localized a region of the promoter between nucleotides −496 to −294 with a role in 1,25D-mediated induction (Tashiro et al., 2007). It was proposed that this activity was the consequence of three Sp1 transcription factor binding sites within this region. We generated five reporter constructs carrying different lengths of the CYP24A1 promoter to determine activation elements
R. Kumar et al. / Molecular and Cellular Endocrinology 325 (2010) 46–53
Fig. 3. Differential induction of endogenous human CYP24A1 by 1,25D in breast cell lines. MCF-10A (spontaneously immortalized human breast epithelial), BT-20, MDA-MB-231, MCF-7, SK-BR-3 and ZR75-1 (breast cancer) cell lines treated with either 1,25D or vehicle. The CYP24A1 mRNA level was assayed by qRT-PCR (A) and CYP24A1 protein analysed by Western blotting (B) as described in material and methods. -Tubulin was used as a loading control. *P < 0.001.
between nucleotides −496 to −392 (Fig. 4). Note that the −392 reporter construct contains all three Sp1 binding sites. These five constructs were transfected into MCF-7 cells, since this cell line was observed to strongly induce the endogenous CYP24A1 (140fold) in the presence of 1,24D (see Fig. 3). Cells were treated with either 1,25D or vehicle (ethanol) and then assayed for promoter activity. Compared with the transcriptional activity of −392; −451 and −470 showed 2.7 and 4.6-fold higher activation, respectively, in the presence of 1,25D. No further increase in this activity was seen in −482 and −496 promoters (Fig. 4). These results suggest that 1,25D further stimulates CYP24A1 activity through sequences located between nucleotides −470 to −392. 4. Discussion Human cells contain the relevant transcription factor that is capable of binding to the rat VSE sequence 5 -TGTCGGTCA. This was shown both by a protein from human nuclear extract binding to the rat VSE DNA using EMSA (Nutchey et al., 2005) and from reporter assays where 1,25D induction via the rat VSE was functional in human cells (Fig. 2). The human CYP24A1 promoter did not contain a functional VSE (Fig. 1B) and this was consistent with the replacement of the three 5 bases of the rat VSE with CCC in the homologous human sequence. Unexpectedly, conversion of the human homologous VSE sequence to the rat consensus did not restore VSE function. It is suggested that, besides the VSE sequence, the context of the VSE is critical for its function and that adjacent DNA sequences that presumably bind additional transcription factors are present in the rat but are missing from the human CYP24A1 promoter. The promoters of the rat and human genes share 50% nucleotide homology and an examination of this homology identifies many regions with complete identity. Some are regions of established transcriptional activity, for example the VDREs (Nutchey et al.,
51
2005; Tashiro et al., 2007). However, the function of a number of conserved regions has yet to be established. We have identified a region of the human CYP24A1 promoter located between nucleotides −470 to −392 that is involved in stimulating the CYP24A1 activity. These results further define the region of the CYP24A1 promoter that is critical for 1,25D-mediated activation reported previously (Tashiro et al., 2007). This 79 bp region shows limited evolutionary conservation and prediction of transcription factor binding using TESS (Schug, 2008) identifies, with a high probability, location of a number of potential AP-2 binding sites that may be the basis for the stimulation of CYP24A1 transcription. The functional elements within the rat and human CYP24A1 promoters have evolved to meet their respective physiological homeostatic needs. Thus, although conservation of some functional promoter elements has been retained, it is apparent that sequence-dependent variations in the binding of transcription factors provide the species-specific functions. The VSE defined and functional in the rat CYP24A1 promoter is not functional in the human promoter even though the relevant binding transcription factors are present. 1,25D-mediated rat CYP24A1 activation through the rat VSE sequence is dependent on an intact nine nucleotide VSE sequence. However, the first three 5 TGT nucleotides are conserved in mouse but not in any other non-rodent mammals. In contrast, five of the remaining six nucleotides of the VSE are conserved in all mammalian species (Fig. 5). The presence of the VSE provides the murine species with the ability to generate particularly high levels of CYP24A1, and therefore, rapid inactivation of 1,25D, the active form of vitamin D. The breast cancer cell lines MCF-7, ZR75-1 and SK-BR-3 demonstrate inhibition of proliferation when exposed to 1,25D (Agadir et al., 1999). MCF-7 has been utilised in a number of studies since it is VDR positive (Cordes et al., 2006) and CYP24A1 is strongly induced by treatment with 1,25D (Sundaram et al., 2006). Fischer et al. (2009) report basal levels of CYP24A1 expression in MCF-10F and MCF-7. As the cells were not grown in serum-stripped media, presence of the levels of 1,25D in the culture media is not clear. In the absence of 1,25D, the six breast cell lines reported here all had very low to undetectable levels of CYP24A1 both by qRT-PCR and by western blot analysis (Fig. 3). A number of these breast cancer cell lines used to determine the induction of CYP24A1 by 1,25D have not been previously reported. CYP24A1 expression is strongly induced in the non-malignant immortalised breast cell line MCF-10A and in the breast tumour lines MCF-7 and ZR75-1. Interestingly, the CYP24A1 message is not highly induced in SK-BR-3 but the protein levels are similar to MCF-7, suggesting that the CYP24A1 protein is stabilised in this cell line. Both the breast cancer cell lines BT20 and MDA-MB-231 show very low levels of CYP24A1 induction by 1,25D. The lack of induction in MDA-MB-231 is consistent with the absence of the VDR (Cordes et al., 2006), and therefore, the absence of any vitamin D regulatory effects. This is further supported by the lack of sensitivity of MDA-MB-231 cells to inhibition of proliferation by 1,25D (Elstner et al., 1995). In the absence of CYP24A1 induction by 1,25D, it would be expected that cells would be highly sensitive to inhibition of proliferation by 1,25D. Since, BT-20 is reported to be somewhat resistant to growth inhibition by 1,25D (Chouvet et al., 1986), it is suggested that this cell line also has mutated VDR. In general, a robust induction of CYP24A1 would be expected in breast cancer cells as this will be associated with protection from anti-proliferative effects of 1,25D. However, it is apparent that other strategies could be utilised by cancer cells to achieve a similar endpoint and these may include inactivation of the CYP27B1 gene, preventing local synthesis of 1,25D, or lack of VDR, inhibiting any downstream gene activation through the VDRE.
52
R. Kumar et al. / Molecular and Cellular Endocrinology 325 (2010) 46–53
Fig. 4. Human CYP24A1 promoter is stimulated by 1,25D via sequences located within the −470/−392 region. (A) Structure of CYP24A1 promoter constructs used for a dual-luciferase reporter assay. Arrows depict Sp1 transcription factor binding sites. (B) Reporter constructs carrying CYP24A1 promoters of different lengths were transfected into MCF-7 cells, treated with either 1,25D or vehicle (ethanol) and assayed by dual-luciferase reporter assay system. Mean values ± standard error from three independent experiments each repeated in triplicates were plotted. Fold induction in the presence of 1,25D is also shown. *P < 0.001; n.s., not significant.
Fig. 5. Alignment of the VSE sequences located between the two VDREs within the CYP24A1 promoters of different mammals. Nucleotides similar among the five organisms are highlighted.
Acknowledgement Financial support from the Australian Research Council is gratefully acknowledged. References Agadir, A., Lazzaro, G., Zheng, Y., Zhang, X.K., Mehta, R., 1999. Resistance of HBL100 human breast epithelial cells to vitamin D action. Carcinogenesis 20, 577–582. Anderson, P.H., O’Loughlin, P.D., May, B.K., Morris, H.A., 2004. Determinants of circulating 1,25-dihydroxyvitamin D3 levels: the role of renal synthesis and catabolism of vitamin D. J. Steroid Biochem. Mol. Biol. 89–90, 111–113. Anderson, P.H., O’Loughlin, P.D., May, B.K., Morris, H.A., 2005. Modulation of CYP27B1 and CYP24 mRNA expression in bone is independent of circulating 1,25(OH)2D3 levels. Bone 36, 654–662. Andrews, N.C., Faller, D.V., 1991. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res. 19, 2499. Armbrecht, H.J., Boltz, M.A., Hodam, T.L., Kumar, V.B., 2001. Differential responsiveness of intestinal epithelial cells to 1,25-dihydroxyvitamin D3—role of protein kinase C. J. Endocrinol. 169, 145–151.
Chen, K.S., DeLuca, H.F., 1995. Cloning of the human 1 alpha,25-dihydroxyvitamin D3 24-hydroxylase gene promoter and identification of two vitamin D-responsive elements. Biochim. Biophys. Acta 1263, 1–9. Chouvet, C., Vicard, E., Devonec, M., Saez, S., 1986. 1,25-Dihydroxyvitamin D3 inhibitory effect on the growth of two human breast cancer cell lines (MCF-7, BT-20). J. Steroid Biochem. 24, 373–376. Cordes, T., Diesing, D., Becker, S., Diedrich, K., Reichrath, J., Friedrich, M., 2006. Modulation of MAPK ERK1 and ERK2 in VDR-positive and -negative breast cancer cell lines. Anticancer Res. 26, 2749–2753. Deeb, K.K., Trump, D.L., Johnson, C.S., 2007. Vitamin D signalling pathways in cancer: potential for anticancer therapeutics. Nat. Rev. Cancer 7, 684–700. Dhawan, P., Peng, X., Sutton, A.L., MacDonald, P.N., Croniger, C.M., Trautwein, C., Centrella, M., McCarthy, T.L., Christakos, S., 2005. Functional cooperation between CCAAT/enhancer-binding proteins and the vitamin D receptor in regulation of 25-hydroxyvitamin D3 24-hydroxylase. Mol. Cell Biol. 25, 472–487. Dwivedi, P.P., Muscat, G.E., Bailey, P.J., Omdahl, J.L., May, B.K., 1998. Repression of basal transcription by vitamin D receptor: evidence for interaction of unliganded vitamin D receptor with two receptor interaction domains in RIP13delta1. J. Mol. Endocrinol. 20, 327–335. Elstner, E., Linker-Israeli, M., Said, J., Umiel, T., de Vos, S., Shintaku, I.P., Heber, D., Binderup, L., Uskokovic, M., Koeffler, H.P., 1995. 20-Epi-vitamin D3 analogues: a novel class of potent inhibitors of proliferation and inducers of differentiation of human breast cancer cell lines. Cancer Res. 55, 2822–2830. Fischer, D., Becker, S., Cordes, T., Bucker, B., Diedrich, K., Friedrich, M., Salehin, D., Thill, M., 2009. Vitamin D-24-hydroxylase in benign and malignant breast tissue and cell lines. Anticancer Res. 29, 3641–3645. Jones, G., Strugnell, S.A., DeLuca, H.F., 1998. Current understanding of the molecular actions of vitamin D. Physiol. Rev. 78, 1193–1231. Kumar, R., Manning, J., Spendlove, H.E., Kremmidiotis, G., McKirdy, R., Lee, J., Millband, D.N., Cheney, K.M., Stampfer, M.R., Dwivedi, P.P., Morris, H.A., Callen, D.F., 2006. ZNF652, a novel zinc finger protein, interacts with the putative breast tumor suppressor CBFA2T3 to repress transcription. Mol. Cancer Res. 4, 655–665. Nutchey, B.K., Kaplan, J.S., Dwivedi, P.P., Omdahl, J.L., Ferrante, A., May, B.K., Hii, C.S., 2005. Molecular action of 1,25-dihydroxyvitamin D3 and phorbol ester on the activation of the rat cytochrome P450C24 (CYP24) promoter: role of MAP kinase activities and identification of an important transcription factor binding site. Biochem. J. 389, 753–762.
R. Kumar et al. / Molecular and Cellular Endocrinology 325 (2010) 46–53 Omdahl, J.L., Morris, H.A., May, B.K., 2002. Hydroxylase enzymes of the vitamin D pathway: expression, function, and regulation. Annu. Rev. Nutr. 22, 139–166. Schug, J., 2008. Using TESS to predict transcription factor binding sites in DNA sequence. Curr. Prot. Bioinformatics (chapter 2, unit 2.6). Sundaram, S., Beckman, M.J., Bajwa, A., Wei, J., Smith, K.M., Posner, G.H., Gewirtz, D.A., 2006. QW-1624F2-2, a synthetic analogue of 1,25-dihydroxyvitamin D3, enhances the response to other deltanoids and suppresses the invasiveness of human metastatic breast tumor cells. Mol. Cancer Ther. 5, 2806–2814. Tashiro, K., Ishii, C., Ryoji, M., 2007. Role of distal upstream sequence in vitamin D-induced expression of human CYP24 gene. Biochem. Biophys. Res. Commun. 358, 259–265.
53
Vaisanen, S., Dunlop, T.W., Sinkkonen, L., Frank, C., Carlberg, C., 2005. Spatiotemporal activation of chromatin on the human CYP24 gene promoter in the presence of 1alpha,25-dihydroxyvitamin D3. J. Mol. Biol. 350, 65–77. Wysocka, J., Reilly, P.T., Herr, W., 2001. Loss of HCF-1-chromatin association precedes temperature-induced growth arrest of tsBN67 cells. Mol. Cell Biol. 21, 3820–3829. Zierold, C., Darwish, H.M., DeLuca, H.F., 1995. Two vitamin D response elements function in the rat 1,25-dihydroxyvitamin D 24-hydroxylase promoter. J. Biol. Chem. 270, 1675–1678.
Contents lists available at ScienceDirect
Molecular and Cellular Endocrinology journal homepage: www.elsevier.com/locate/mce
Systematic characterisation of the rat and human CYP24A1 promoter R. Kumar a,∗ , D.N. Iachini a , P.M. Neilsen a , J. Kaplan b , J. Michalakas a , P.H. Anderson c , B.K. May d , H.A. Morris c,e , D.F. Callen a a
Breast Cancer Genetics Group, Discipline of Medicine, University of Adelaide and Hanson Institute, SA Pathology, Frome Road, Adelaide, SA 5000, Australia Department of Orthopedic Surgery, University of Pennsylvania, Philadelphia, USA c Endocrine Bone Research Laboratory, Hanson Institute, SA Pathology, Adelaide, SA, Australia d School of Molecular and Biomedical Sciences, University of Adelaide, Australia e School of Pharmacy and Medical Sciences, University of South Australia, Australia b
a r t i c l e
i n f o
Article history: Received 29 December 2009 Received in revised form 22 March 2010 Accepted 27 April 2010 Keywords: Promoter CYP24A1 Vitamin D VSE Stimulation
a b s t r a c t The biologically active form of vitamin D, 1,25-dihydroxyvitamin D (1,25D) ligands VDR (vitamin D receptor) and binds to the vitamin D response element (VDRE) located within target genes to regulate their transcription. Previously we showed that 1,25D-mediated rat CYP24A1 induction via the two critical VDREs is dependent on a short stretch of nucleotides called vitamin D stimulating element (VSE), located approximately 30 bp upstream of VDRE-1 in the rat CYP24A1 promoter. We have now undertaken systematic analysis of the human CYP24A1 and rat CYP24A1 promoters to determine if the VSE is present in the human promoter. Using electrophoretic mobility shift and dual-luciferase reporter assays, we show that the VSE is absent in the human CYP24A1 promoter. In addition, we show that 1,25D-mediated induction of human CYP24A1 is dependant upon a promoter region spanning nucleotides −470 to −392 of the human CYP24A1 promoter. Crown Copyright © 2010 Published by Elsevier Ireland Ltd. All rights reserved.
1. Introduction Vitamin D in mammals arises from ultraviolet B exposure of the skin, although it can be obtained from the diet (Deeb et al., 2007; Jones et al., 1998). Metabolism through sequential hydroxylations of vitamin D is essential for generating the hormonally-active form known as 1,25-dihydroxyvitamin D (calcitriol, 1,25D); first hydroxylation of vitamin D by the enzyme 25-hydroxylase (CYP27A1) results in the formation of 25-hydroxyvitamin D (25D), a circulating prohormone. A second hydroxylation by the enzyme 25-hydroxyvitamin D-1␣-hydroxylase (CYP27B1) generates 1,25D, the biologically active form of steroid hormone that directs transcriptional regulation of a large number of target genes (Deeb et al., 2007). 1,25D is subsequently inactivated by 25-hydroxyvitamin D 24-hydroxylase (CYP24A1) (Omdahl et al., 2002). The blood levels of 25D and 1,25D arise from metabolism in the liver and kidney, respectively, and blood levels of 1,25D are determined by the balance of the CYP27B1 and CYP24A1 enzyme activities in the kidney, the genetic expression of which are inversely related to each other (Anderson et al., 2004, 2005). The biological action of 1,25D is mediated through the vitamin D receptor (VDR) (Deeb et al., 2007). 1,25D binding activates VDR, and together with the retinoid-X recep-
∗ Corresponding author. Tel.: +61 8 8222 3450; fax: +61 8 8222 3217. E-mail address: [email protected] (R. Kumar).
tor (RXR), binds to vitamin D response elements (VDREs) located within promoters of the target genes to regulate their transcription. There is now strong evidence that this hormone acts in many tissues to modulate cell proliferation, apoptosis and the immune system (Deeb et al., 2007; Jones et al., 1998). In these tissues 1,25D is locally produced through metabolism of circulating levels of the prohormone 25D since these tissues also express CYP27B1. The levels of 1,25D in the tissue are critically dependent on the balance of localised activation of 25D by CYP27B1 and the subsequent catabolism by CYP24A1. In these tissues, unlike in the kidney, the genetic expression of CYP27B1 and CYP24A1 are positively related consistent with an autocrine signaling paradigm (Anderson et al., 2005). The levels of CYP24A1 expression are repressed through the action of the unliganded VDR (Dwivedi et al., 1998) but are rapidly and highly induced in the presence of 1,25D. Since high levels of 1,25D are toxic to cells, this provides a negative regulatory mechanism for initiating intracellular autocrine signaling, and minimises cell toxicity resulting from elevated levels of 1,25D. This rapid induction of CYP24A1 by 1,25D has led to an in depth analysis of the CYP24A1 promoter. Several groups independently showed that the rat promoter of CYP24A1 contained two VDREs which were critical for the 1,25D induction of CYP24A1 expression (Zierold et al., 1995). Similar results were described for the human CYP24A1 promoter with two classical VDREs located within 300 bp upstream of the
0303-7207/$ – see front matter. Crown Copyright © 2010 Published by Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.mce.2010.04.023
R. Kumar et al. / Molecular and Cellular Endocrinology 325 (2010) 46–53
transcriptional start site (Chen and DeLuca, 1995). Despite the demonstration of additional classical VDREs at nucleotide positions −2640 and −3950 (Vaisanen et al., 2005) those in the first 300 bp of the promoter have the highest binding efficiency to VDR/RXR and efficiently recruit co-activator proteins. Luciferase reporter assays have defined that the region of the human CYP24A1 promoter from −548 to −294 bp interacts synergistically with the two adjacent VDREs to achieve maximum induction of CYP24A1 (Tashiro et al., 2007). Further upstream regions to −1918 bp have no major influence on the induction of CYP24A1 by 1,25D. The rat CYP24A1 promoter has also been extensively investigated to identify enhancer elements through which 1,25D-VDRmediated expression is stimulated. 1,25D up-regulation of rat CYP24A1 is synergistically potentiated by the phorbol ester PMA via a protein kinase C (PKC) dependent mechanism (Armbrecht et al., 2001). Further studies defined an element termed the vitamin D stimulating element (VSE). Luciferase reporter assays utilising the rat CYP24A1 promoter showed mutation of the VSE drastically reduced both 1,25D-based stimulation of the promoter and the PMA-based synergistic induction (Nutchey et al., 2005). The VSE is a short 5 -TGTCGGTCA motif located approximately 30 bp upstream of VDRE-1 at nucleotides −171 to −163 within the rat CYP24A1 promoter (Nutchey et al., 2005). Electrophoretic mobility shift assay (EMSA) detected the presence of protein binding activity to the rat VSE in human and rat nuclear extracts although the identity of the transcription factor that binds the VSE is unknown. A number of published studies have investigated the transcriptional regulation of CYP24A1. Such studies have utilised both rat and human promoter constructs and reporter assays in rat and/or human cells. Since the rat and human CYP24A1 promoter homology is only approximately 50%, the transcription factor binding sites in the rat promoter are not necessarily relevant to the human pro-
47
moter. For example, the C/EPB binding site at −395 to −388 defined in the rat CYP24A1 promoter is not conserved in the homologous region of the human promoter (Dhawan et al., 2005). The present study determines if in humans CYP24A1 induction by 1,25D is also dependent on a sequence similar to the VSE motif present within the rat CYP24A1 promoter. The present study also defines a new region of the human CYP24A1 promoter that further potentiates the 1,25D induction of the VDRs. 2. Materials and methods 2.1. Cell lines HEK293T (adherent human embryonic kidney), MCF-10A (immortalized human breast epithelial), ROS 17/2.8 (adherent rat osteosarcoma) and MCF-7, MDA-MB231, BT-20, ZR75-1, SK-BR-3 (human breast cancer) cell lines were obtained from the American Type Culture Collection (ATCC, Manassa, VA, USA) and maintained as recommended by ATCC. 2.2. Reporter constructs The rat pCYP24A1(−298)-Luc (WT-VSE) and pCYP24A1(−298)-Luc (MT-VSE) reporter constructs were as previously reported (Nutchey et al., 2005). For the remaining constructs, promoter sequences were PCR amplified from MCF7 genomic DNA with the GC-RICH PCR System (Roche) using primers listed in Table 1 and cloned at KpnI-BglII sites of pGL3-Basic vector (Promega) to generate human pCYP24A1(−392)-Luc (WT-VSE), pCYP24A1(−392)-Luc (MTVSE), pCYP24A1(−392)-Luc (with Rat WT-VSE), pCYP24A1(−451)-Luc (WT-VSE), pCYP24A1(−470)-Luc (WT-VSE), pCYP24A1(−482)-Luc and pCYP24A1(−496)-Luc (WT-VSE). 2.3. EMSA For nuclear protein extractions, nuclei isolated by a published method (Wysocka et al., 2001) were resuspended in high salt buffer (Andrews and Faller, 1991), centrifuged and aliquots of the supernatants stored at −80 ◦ C until use. Annealed short double stranded oligonucleotides were end-filled ([␣32 P]-dCTP) with Klenow frag-
Table 1 List of oligonucleotides used in this study. Construct Human pCYP24A1(−392)-Luc (WT-VSE) Human pCYP24A1(−451)-Luc Human pCYP24A1(−482)-Luc Human pCYP24A1(−470)-Luc Human pCYP24A1(−496)-Luc Human pCYP24A1(−392)-Luc (with Rat WT-VSE) Human pCYP24A1(−392)-Luc (MT-VSE) EMSA oligonucleotides hCYP24A1-WT-VSE rCyp24a1-WT-VSE rCyp24a1-MT-VSE-1 rCyp24a1-MT-VSE-2 rCyp24a1-MT-VSE-3 rCyp24a1-MT-VSE-4 rCyp24a1-MT-VSE-5 qRT-PCR hCYP24A1 PPIG
Primers (5 → 3 ) hCYP24A1p-392-F hCYP24A1p-R hCYP24A1p-451-F hCYP24A1p-R hCYP24A1p-482-F hCYP24A1p -R hCYP24A1p-470-F hCYP24A1p-R hCYP24A1p-497-F hCYP24A1p-R hCyp24A1-R-to-h-VSE-F hCyp24A1-R-to-h-VSE-R hCyp24A1-MT-VSE-F hCyp24A1-MT-VSE-R
CACACACACAGGTACCTCGCCCGCCCGGCATCGCGATTGTGCAA CACACACACAAGATCTTGGAGCCACGGGGAGGTGTCAAGGAGGGTA CACACACACAGGTACCCGGGCTCCCCGGGGCCCTGGCAGACGCCGGCAGCTTTTC CACACACACAAGATCTTGGAGCCACGGGGAGGTGTCAAGGAGGGTA CACACACACAGGTACCGCTGGGGGTATCTGGCTCCCCGGGA CACACACACAAGATCTTGGAGCCACGGGGAGGTGTCAAGGAGGGTA CACACACACAGGTACCTGGCTCCCCGGGAGGCGCCCGGGCTCCCCGGGGCCCTGGCAGA CACACACACAAGATCTTGGAGCCACGGGGAGGTGTCAAGGAGGGTA CACACACACAGGTACCTCACTTCAGTCCAGGCTGGGGGTA CACACACACAAGATCTTGGAGCCACGGGGAGGTGTCAAGGAGGGTA AGCGAACAGCGTGTCGGTCACCGCAGGCCCGGACGCCCTCGCTCACCT TCCGGGCCTGCGGTGACCGACACGCTGTTCGCTGGGCGCGGGAGGT AGCGAACATAGCCCAAGCTTCCCCAGGCCCGGACGCCCTCGCTCACCT TCCGGGCCTGGGGAAGCTTGGGCTATGTTCGCTGGGCGCGGGAGGT
Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
GTAGCCCCGGTCACCC GGGGTGACCGGGGCTA GGCGTGTCGGTCACCG GCGGTGACCGACACGC GGCGATGCGGTCACCG GCGGTGACCGCATCGC GGCGTGTAAGCTTCCG GCGGAAGCTTACACGC GCACTGTCGGTCACCG GCGGTGACCGACAGTG GGCGTGTCGGTCATTA GTAATGACCGACACGC GGCGTGTCGGCTTCCG GCGGAAGCCGACACGC
Forward Reverse Forward Reverse
AGCTTCAACTGCATTTGGCT AAATACCACCATCTGAGGCG TGGACAAGTAATCTCTGGTCAA GTATCCGTACCTCCGCAAA
48
R. Kumar et al. / Molecular and Cellular Endocrinology 325 (2010) 46–53
ment, purified and used as probes (see Table 1 for oligonucleotide sequences). Binding reactions containing 5 g nuclear extract, 1× binding buffer (25 mM Tris–HCl pH 7.6, 100 mM KCl, 52.5 mM NaCl, 0.5 mM DTT, 5 mM MgCl2 , 0.5 mM EDTA, 10% glycerol, 30 g/ml dI-dC) and radiolabeled probe were incubated at room temperature for 15 min, and then resolved on 4% 0.5× TBE gel. For competitive EMSA, 10–100× molar excess of the unlabeled competitor probe was mixed with the [32 P]-labelled probe before adding to the nuclear extracts. 2.4. Dual-luciferase reporter (DLR) assay HEK293T, MCF-7 or ROS 17/2.8 at 2 × 105 cells/well were seeded into 24-well trays in appropriate culture media with 10% charcoal-stripped foetal calf serum. Next day, cells were transfected with 400 ng of reporter construct and 25 ng of pGL4.74-hRLuc (Rinella Luc driven by TK promoter) as an internal transfection control using lipofectamine 2000 transfection agent (Invitrogen). Eight hours after transfection, cells were supplemented with 10−7 M 1,25D (Wako Pure Chemical Industries, Osaka, Japan) or vehicle (ethanol). Sixteen hours later cells were harvested and assayed using dual-luciferase reporter assay system (Promega, Madison, USA). Firefly luciferase activity was normalised to the Rinella luciferase activity and expressed as relative luciferase units (RLU). Each experiment was repeated three times and values presented as mean of all experiments ± SE. 2.5. Induction and assay of endogenous CYP24A1 expression in breast cell lines MCF-10A, BT-20, MDA-MB-231, MCF-7, SK-BR-3 and ZR75-1 cells were seeded in 6 well plates in appropriate culture media with 10% charcoal-stripped foetal calf serum, and when 80% confluent, were supplemented with either 10−7 M 1,25D or vehicle (ethanol). Sixteen hours later cells were harvested and assayed for level of mRNA by qRT-PCR as reported previously (Kumar et al., 2006). The housekeeping gene peptidyl-prolyl isomerase G (PPIG) was used to normalise the CYP24A1 cDNA expression. CYP24A1 and PPIG primers used are listed in Table 1. Protein extraction, assay and Western blotting were performed as reported previously (Kumar et al., 2006). Ten micrograms protein of each sample was used. CYP24A1 was detected by mouse monoclonal anti-CYP24A1 clone 1F8 (Sigma) antibody and rabbit anti--tubulin antibody (abcam) was used to confirm equal loading among samples.
3. Results 3.1. Is there a VSE in the human CYP24A1 promoter? We aligned rat and human CYP24A1 promoter sequences and looked for the presence of a possible human VSE. Indeed, we identified a putative human VSE that is located between the two VDREs that is conserved between the rat and human CYP24A1 promoters (Fig. 1A). Homology between the human and rat sequences 5 to the VDRE1 and 3 to the VDRE2, and the location of the putative human VSE suggests that this is the correct human sequence. There are no other sequences in the human CYP24A1 promoter that are homologous to the rat VSE. We have previously shown that unknown rat and human proteins bind to the rat VSE. However, such binding studies on the human sequence homologous to the rat VSE are lacking. We performed experiments to characterise the putative human VSE. The human (HEK293T) nuclear extracts were shown to have protein binding activity to the rat VSE probe suggesting that the human cells possess the proteins that specifically bind this sequence (Nutchey et al., 2005). EMSA and competitive EMSA were performed to determine the presence of binding activity to the putative human VSE in the human nuclear extracts (Fig. 1B). EMSA of rat nuclear extracts incubated with the radiolabeled rat VSE probe, and competitive EMSA where rat VSE was competed with 20× or 100× molar excess of unlabeled human VSE probe were included (Fig. 1B, lanes 8–12). No specific human nuclear protein binding activity to the human putative VSE sequence was detected (Fig. 1B, lanes 2–6). There was some binding activity that was not reduced or abolished when competed with the unlabeled human or rat VSE probes confirming that this activity was due to non-specific human protein binding to the human VSE probe. A specific binding activity was observed when the rat VSE probe was incubated with the rat nuclear extracts (Fig. 1B, lane
8). That rat nuclear extract exhibits a rat VSE-specific activity was also supported by the observation showing loss of this signal in the presence of 20× or 100× molar excess of unlabeled rat VSE probe (Fig. 1B, lanes 9–10). As this binding was not competed by unlabeled human VSE probe (Fig. 1B, lanes 11–12), this further confirmed binding of specific rat derived protein/s to the rat VSE probe. An EMSA using various mutated versions (MT1-5) of the rat 5 GCGTGTCGGTCACCG sequence showed that all nine rat core VSE nucleotides are required for binding of the rat protein (Fig. 1C). Whereas MT1 (TGT mutated to ATG), although difficult to see in the gel, abolished formation of the complex A whilst enhancing complex B binding (Fig. 1C, lane 2), MT2 (CGGTCA mutated to AAGCTT; Fig. 1C, lane 3) or MT5 (CGGTCA mutated to CGGCTT; Fig. 1C, lane 6) abolished binding of both complexes A and B. Furthermore, MT3 and MT4 showed formation of complexes A and B, as mutations in these two probes were located outside the nine nucleotides VSE region (Fig. 1C, lanes 4–5). An additional EMSA was performed to show that complex A is specific and requires the presence of a full length rat VSE (Fig. 1D). As expected, the binding activity of rat nuclear proteins to the WT rat CYP24A1 VSE radiolabeled probe was completely abolished when this probe pre-mixed with 10× or 50× molar excess of unlabeled WT probe was used in a competitive EMSA (Fig. 1D, lanes 2–3). However, when competed with MT1 unlabeled probe (Fig. 1D, lanes 4–5), only complex A, and when competed with MT2 (Fig. 1D, lanes 6–7) both complexes A and B, remained unaffected. These results show that a full length rat VSE is required for binding of the rat protein to the WT CYP24A1 VSE. Furthermore, these results would explain the absence of binding of any human protein to the putative human VSE 5 -CCCCGGTCA. This is because substitution of 5 -TGT of the rat VSE by 5 -CCC in the human VSE results in loss of an intact rat-like VSE. The third band was considered to be non-specific as intensity of this band was significantly reduced in the presence of both rat and human unlabeled competitor VSE probes (Fig. 1B, lanes 9–12). Taken together, both rat and human cells contain a specific protein that binds to the rat VSE motif; however, the homologous human VSE motif does not bind any human proteins. This suggests that the 5 -TGT of the VSE located within the rat CYP24A1 promoter is critical to the function of the VSE, and its loss is sufficient to cause a complete inactivation of the VSE binding motif in the human CYP24A1 promoter. To confirm our EMSA results and further investigate the role of the rat and human VSEs in 1,25D-mediated CYP24A1 stimulation, we performed dual-luciferase reporter assays. Reporter constructs were generated with rat and human CYP24A1 promoters incorporating either wild type or mutated VSE sequences (see Table 1). We also generated a construct with a human CYP24A1 promoter where putative human VSE was replaced with the rat VSE sequence (Fig. 2A). Each construct was transfected into both rat (ROS 17/2.8) and human (HEK293T) cells pre-cultured in serum-free medium (see materials and methods), treated with either 1,25D or vehicle (ethanol) and assayed for promoter activity. pGL3-basic plasmid used as a control showed no basal or 1,25D induced activity (data not presented). The patterns of relative CYP24A1 transcriptional activity of all reporter constructs in both rat and human cells are presented in Fig. 2. The promoters with putative human WT-VSE, putative human VSE replaced with a rat WT-VSE and human mutant-VSE, in the presence of 1,25D, all showed moderate and comparable activation of reporter activity in human cells (Fig. 2B). Therefore, the human element that is homologous to the rat VSE is not functional. Since in human cells, substitution of putative human WT-VSE with the rat WT-VSE did not restore 1,25D-mediated activation to levels comparable to the rat CYP24A1 promoter (WT-VSE), this activation is independent of VSE sequences. In contrast, rat CYP24A1 promoter with wild type rat VSE showed a substantial increase in 1,25D-mediated activation in both rat and
R. Kumar et al. / Molecular and Cellular Endocrinology 325 (2010) 46–53
49
Fig. 1. Rat and human CYP24A1 promoters have regions with high homology and human nuclear extract does not exhibit binding activity for the putative human VSE sequence. (A) Structural elements of the rat and human CYP24A1 promoter. Conserved nucleotides within human and rat VDRE1, VDRE2 and VSE are shown with asterisks. Sequences of the rat and human CYP24A1 probes used in B–D are also shown. The mutated nucleotides in each MT probe sequence are underlined. (B) Human- or rat-specific wild type (WT) VSE radiolabeled probes were incubated with the human (lanes 2–6) or rat (lanes 8–12) nuclear extracts and analysed by EMSA. For the competitive EMSA, 20× or 100× molar excess of human (lanes 3–4 and 11–12) or rat (lanes 5–6 and 9–10) unlabeled probes were pre-mixed with the radiolabeled probes (as shown) before incubating with the nuclear extracts. Probes without addition of proteins were analysed as control (lanes 1 and 7). Rat-specific protein–DNA complexes (A and B) are shown with arrows. (C) Rat WT or MT (mutant) VSE radiolabeled probes (sequences given in A and Table 1) were incubated with the rat nuclear extracts and analysed by EMSA. (D) Rat nuclear extracts incubated with radiolabeled WT-VSE (lane 1) alone or pre-mixed with 10× or 50× molar excess of unlabeled WT (lanes 2–3), MT1 (lanes 4–5) or MT2 (lanes 6–7) were analysed by EMSA.
human cells. This dramatic increase was dependent on the rat VSE as this activation was completely abolished in the rat promoter with a mutated VSE (Fig. 2B and C). In summary, the VSE of the wild type rat CYP24A1 promoter functions in human cells, but when the rat VSE element is substituted into the human promoter it is not functional. Therefore, although human cells possess transcription factors capable of binding and activating the VSE in the rat promoter context, the same VSE is non-functional in the human promoter context.
3.1.1. 1,25D-mediated induction of endogenous CYP24A1 in breast cell lines To further investigate CYP24A1 regulation, and to identify a breast cell line that exhibits a high 1,25-mediated CYP24A1 activation, we determined 1,25D-mediated activation of CYP24A1 in a panel of breast cell lines. Cells were treated with either 1,25D or vehicle (ethanol) for 16 h and assayed for mRNA level using qRTPCR (Fig. 3A) and protein levels by Western blot analysis (Fig. 3B). 1,25D induced a significant activation of CYP24A1 mRNA in MCF-
50
R. Kumar et al. / Molecular and Cellular Endocrinology 325 (2010) 46–53
Fig. 2. Only rat wild type CYP24A1 promoter is stimulated by 1,25D via a single VSE located between the two conserved VDREs. (A) Structure and nucleotide sequences of the VSE elements in the rat and human CYP24A1 promoter constructs. Nucleotide substitutions in the VSE to generate different mutant CYP24A1 promoters are underlined. Rat pCYP24A1(−298)-Luc (WT-VSE), rat pCYP24A1(−298)-Luc (MT-VSE), human pCYP24A1(−392)-Luc (WT-VSE), human pCYP24A1(−392)-Luc (with Rat WT-VSE) and human pCYP24A1(−392)-Luc (MT-VSE) reporter constructs were transfected into either HEK293T (B) or ROS 17/2.8 (C) cells, treated with either 1,25D or vehicle (ethanol) and assayed by dual-luciferase reporter assay system. Mean values ± standard error from three independent experiments each repeated in triplicates were plotted. *P < 0.001; **P < 0.05; n.s., not significant.
10A (210-fold), MCF-7 (140-fold) and ZR75-1 cells (150-fold). There was a relatively lower level of CYP24A1 transcriptional activation observed in SK-BR-3 cells (39-fold). The relative levels of 1,25D induced CYP24A1 protein in the cell lines differed somewhat from the relative levels of mRNA. A very high level of CYP24A1 induction was observed in MCF-10A, MCF-7 and SK-BR-3 cells, but there was a lower level of induction in ZR75-1 cells. 1,25D treatment had minimal effect on the relative levels of the mRNA, and undetectable effect on the protein, in BT-20 and MDA-MB-231 cells.
3.1.2. 1,25D activates human CYP24A1 via sequences located between nucleotides −470 to −392 In a previous study, deletion analysis of the human CYP24A1 promoter sequences localized a region of the promoter between nucleotides −496 to −294 with a role in 1,25D-mediated induction (Tashiro et al., 2007). It was proposed that this activity was the consequence of three Sp1 transcription factor binding sites within this region. We generated five reporter constructs carrying different lengths of the CYP24A1 promoter to determine activation elements
R. Kumar et al. / Molecular and Cellular Endocrinology 325 (2010) 46–53
Fig. 3. Differential induction of endogenous human CYP24A1 by 1,25D in breast cell lines. MCF-10A (spontaneously immortalized human breast epithelial), BT-20, MDA-MB-231, MCF-7, SK-BR-3 and ZR75-1 (breast cancer) cell lines treated with either 1,25D or vehicle. The CYP24A1 mRNA level was assayed by qRT-PCR (A) and CYP24A1 protein analysed by Western blotting (B) as described in material and methods. -Tubulin was used as a loading control. *P < 0.001.
between nucleotides −496 to −392 (Fig. 4). Note that the −392 reporter construct contains all three Sp1 binding sites. These five constructs were transfected into MCF-7 cells, since this cell line was observed to strongly induce the endogenous CYP24A1 (140fold) in the presence of 1,24D (see Fig. 3). Cells were treated with either 1,25D or vehicle (ethanol) and then assayed for promoter activity. Compared with the transcriptional activity of −392; −451 and −470 showed 2.7 and 4.6-fold higher activation, respectively, in the presence of 1,25D. No further increase in this activity was seen in −482 and −496 promoters (Fig. 4). These results suggest that 1,25D further stimulates CYP24A1 activity through sequences located between nucleotides −470 to −392. 4. Discussion Human cells contain the relevant transcription factor that is capable of binding to the rat VSE sequence 5 -TGTCGGTCA. This was shown both by a protein from human nuclear extract binding to the rat VSE DNA using EMSA (Nutchey et al., 2005) and from reporter assays where 1,25D induction via the rat VSE was functional in human cells (Fig. 2). The human CYP24A1 promoter did not contain a functional VSE (Fig. 1B) and this was consistent with the replacement of the three 5 bases of the rat VSE with CCC in the homologous human sequence. Unexpectedly, conversion of the human homologous VSE sequence to the rat consensus did not restore VSE function. It is suggested that, besides the VSE sequence, the context of the VSE is critical for its function and that adjacent DNA sequences that presumably bind additional transcription factors are present in the rat but are missing from the human CYP24A1 promoter. The promoters of the rat and human genes share 50% nucleotide homology and an examination of this homology identifies many regions with complete identity. Some are regions of established transcriptional activity, for example the VDREs (Nutchey et al.,
51
2005; Tashiro et al., 2007). However, the function of a number of conserved regions has yet to be established. We have identified a region of the human CYP24A1 promoter located between nucleotides −470 to −392 that is involved in stimulating the CYP24A1 activity. These results further define the region of the CYP24A1 promoter that is critical for 1,25D-mediated activation reported previously (Tashiro et al., 2007). This 79 bp region shows limited evolutionary conservation and prediction of transcription factor binding using TESS (Schug, 2008) identifies, with a high probability, location of a number of potential AP-2 binding sites that may be the basis for the stimulation of CYP24A1 transcription. The functional elements within the rat and human CYP24A1 promoters have evolved to meet their respective physiological homeostatic needs. Thus, although conservation of some functional promoter elements has been retained, it is apparent that sequence-dependent variations in the binding of transcription factors provide the species-specific functions. The VSE defined and functional in the rat CYP24A1 promoter is not functional in the human promoter even though the relevant binding transcription factors are present. 1,25D-mediated rat CYP24A1 activation through the rat VSE sequence is dependent on an intact nine nucleotide VSE sequence. However, the first three 5 TGT nucleotides are conserved in mouse but not in any other non-rodent mammals. In contrast, five of the remaining six nucleotides of the VSE are conserved in all mammalian species (Fig. 5). The presence of the VSE provides the murine species with the ability to generate particularly high levels of CYP24A1, and therefore, rapid inactivation of 1,25D, the active form of vitamin D. The breast cancer cell lines MCF-7, ZR75-1 and SK-BR-3 demonstrate inhibition of proliferation when exposed to 1,25D (Agadir et al., 1999). MCF-7 has been utilised in a number of studies since it is VDR positive (Cordes et al., 2006) and CYP24A1 is strongly induced by treatment with 1,25D (Sundaram et al., 2006). Fischer et al. (2009) report basal levels of CYP24A1 expression in MCF-10F and MCF-7. As the cells were not grown in serum-stripped media, presence of the levels of 1,25D in the culture media is not clear. In the absence of 1,25D, the six breast cell lines reported here all had very low to undetectable levels of CYP24A1 both by qRT-PCR and by western blot analysis (Fig. 3). A number of these breast cancer cell lines used to determine the induction of CYP24A1 by 1,25D have not been previously reported. CYP24A1 expression is strongly induced in the non-malignant immortalised breast cell line MCF-10A and in the breast tumour lines MCF-7 and ZR75-1. Interestingly, the CYP24A1 message is not highly induced in SK-BR-3 but the protein levels are similar to MCF-7, suggesting that the CYP24A1 protein is stabilised in this cell line. Both the breast cancer cell lines BT20 and MDA-MB-231 show very low levels of CYP24A1 induction by 1,25D. The lack of induction in MDA-MB-231 is consistent with the absence of the VDR (Cordes et al., 2006), and therefore, the absence of any vitamin D regulatory effects. This is further supported by the lack of sensitivity of MDA-MB-231 cells to inhibition of proliferation by 1,25D (Elstner et al., 1995). In the absence of CYP24A1 induction by 1,25D, it would be expected that cells would be highly sensitive to inhibition of proliferation by 1,25D. Since, BT-20 is reported to be somewhat resistant to growth inhibition by 1,25D (Chouvet et al., 1986), it is suggested that this cell line also has mutated VDR. In general, a robust induction of CYP24A1 would be expected in breast cancer cells as this will be associated with protection from anti-proliferative effects of 1,25D. However, it is apparent that other strategies could be utilised by cancer cells to achieve a similar endpoint and these may include inactivation of the CYP27B1 gene, preventing local synthesis of 1,25D, or lack of VDR, inhibiting any downstream gene activation through the VDRE.
52
R. Kumar et al. / Molecular and Cellular Endocrinology 325 (2010) 46–53
Fig. 4. Human CYP24A1 promoter is stimulated by 1,25D via sequences located within the −470/−392 region. (A) Structure of CYP24A1 promoter constructs used for a dual-luciferase reporter assay. Arrows depict Sp1 transcription factor binding sites. (B) Reporter constructs carrying CYP24A1 promoters of different lengths were transfected into MCF-7 cells, treated with either 1,25D or vehicle (ethanol) and assayed by dual-luciferase reporter assay system. Mean values ± standard error from three independent experiments each repeated in triplicates were plotted. Fold induction in the presence of 1,25D is also shown. *P < 0.001; n.s., not significant.
Fig. 5. Alignment of the VSE sequences located between the two VDREs within the CYP24A1 promoters of different mammals. Nucleotides similar among the five organisms are highlighted.
Acknowledgement Financial support from the Australian Research Council is gratefully acknowledged. References Agadir, A., Lazzaro, G., Zheng, Y., Zhang, X.K., Mehta, R., 1999. Resistance of HBL100 human breast epithelial cells to vitamin D action. Carcinogenesis 20, 577–582. Anderson, P.H., O’Loughlin, P.D., May, B.K., Morris, H.A., 2004. Determinants of circulating 1,25-dihydroxyvitamin D3 levels: the role of renal synthesis and catabolism of vitamin D. J. Steroid Biochem. Mol. Biol. 89–90, 111–113. Anderson, P.H., O’Loughlin, P.D., May, B.K., Morris, H.A., 2005. Modulation of CYP27B1 and CYP24 mRNA expression in bone is independent of circulating 1,25(OH)2D3 levels. Bone 36, 654–662. Andrews, N.C., Faller, D.V., 1991. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res. 19, 2499. Armbrecht, H.J., Boltz, M.A., Hodam, T.L., Kumar, V.B., 2001. Differential responsiveness of intestinal epithelial cells to 1,25-dihydroxyvitamin D3—role of protein kinase C. J. Endocrinol. 169, 145–151.
Chen, K.S., DeLuca, H.F., 1995. Cloning of the human 1 alpha,25-dihydroxyvitamin D3 24-hydroxylase gene promoter and identification of two vitamin D-responsive elements. Biochim. Biophys. Acta 1263, 1–9. Chouvet, C., Vicard, E., Devonec, M., Saez, S., 1986. 1,25-Dihydroxyvitamin D3 inhibitory effect on the growth of two human breast cancer cell lines (MCF-7, BT-20). J. Steroid Biochem. 24, 373–376. Cordes, T., Diesing, D., Becker, S., Diedrich, K., Reichrath, J., Friedrich, M., 2006. Modulation of MAPK ERK1 and ERK2 in VDR-positive and -negative breast cancer cell lines. Anticancer Res. 26, 2749–2753. Deeb, K.K., Trump, D.L., Johnson, C.S., 2007. Vitamin D signalling pathways in cancer: potential for anticancer therapeutics. Nat. Rev. Cancer 7, 684–700. Dhawan, P., Peng, X., Sutton, A.L., MacDonald, P.N., Croniger, C.M., Trautwein, C., Centrella, M., McCarthy, T.L., Christakos, S., 2005. Functional cooperation between CCAAT/enhancer-binding proteins and the vitamin D receptor in regulation of 25-hydroxyvitamin D3 24-hydroxylase. Mol. Cell Biol. 25, 472–487. Dwivedi, P.P., Muscat, G.E., Bailey, P.J., Omdahl, J.L., May, B.K., 1998. Repression of basal transcription by vitamin D receptor: evidence for interaction of unliganded vitamin D receptor with two receptor interaction domains in RIP13delta1. J. Mol. Endocrinol. 20, 327–335. Elstner, E., Linker-Israeli, M., Said, J., Umiel, T., de Vos, S., Shintaku, I.P., Heber, D., Binderup, L., Uskokovic, M., Koeffler, H.P., 1995. 20-Epi-vitamin D3 analogues: a novel class of potent inhibitors of proliferation and inducers of differentiation of human breast cancer cell lines. Cancer Res. 55, 2822–2830. Fischer, D., Becker, S., Cordes, T., Bucker, B., Diedrich, K., Friedrich, M., Salehin, D., Thill, M., 2009. Vitamin D-24-hydroxylase in benign and malignant breast tissue and cell lines. Anticancer Res. 29, 3641–3645. Jones, G., Strugnell, S.A., DeLuca, H.F., 1998. Current understanding of the molecular actions of vitamin D. Physiol. Rev. 78, 1193–1231. Kumar, R., Manning, J., Spendlove, H.E., Kremmidiotis, G., McKirdy, R., Lee, J., Millband, D.N., Cheney, K.M., Stampfer, M.R., Dwivedi, P.P., Morris, H.A., Callen, D.F., 2006. ZNF652, a novel zinc finger protein, interacts with the putative breast tumor suppressor CBFA2T3 to repress transcription. Mol. Cancer Res. 4, 655–665. Nutchey, B.K., Kaplan, J.S., Dwivedi, P.P., Omdahl, J.L., Ferrante, A., May, B.K., Hii, C.S., 2005. Molecular action of 1,25-dihydroxyvitamin D3 and phorbol ester on the activation of the rat cytochrome P450C24 (CYP24) promoter: role of MAP kinase activities and identification of an important transcription factor binding site. Biochem. J. 389, 753–762.
R. Kumar et al. / Molecular and Cellular Endocrinology 325 (2010) 46–53 Omdahl, J.L., Morris, H.A., May, B.K., 2002. Hydroxylase enzymes of the vitamin D pathway: expression, function, and regulation. Annu. Rev. Nutr. 22, 139–166. Schug, J., 2008. Using TESS to predict transcription factor binding sites in DNA sequence. Curr. Prot. Bioinformatics (chapter 2, unit 2.6). Sundaram, S., Beckman, M.J., Bajwa, A., Wei, J., Smith, K.M., Posner, G.H., Gewirtz, D.A., 2006. QW-1624F2-2, a synthetic analogue of 1,25-dihydroxyvitamin D3, enhances the response to other deltanoids and suppresses the invasiveness of human metastatic breast tumor cells. Mol. Cancer Ther. 5, 2806–2814. Tashiro, K., Ishii, C., Ryoji, M., 2007. Role of distal upstream sequence in vitamin D-induced expression of human CYP24 gene. Biochem. Biophys. Res. Commun. 358, 259–265.
53
Vaisanen, S., Dunlop, T.W., Sinkkonen, L., Frank, C., Carlberg, C., 2005. Spatiotemporal activation of chromatin on the human CYP24 gene promoter in the presence of 1alpha,25-dihydroxyvitamin D3. J. Mol. Biol. 350, 65–77. Wysocka, J., Reilly, P.T., Herr, W., 2001. Loss of HCF-1-chromatin association precedes temperature-induced growth arrest of tsBN67 cells. Mol. Cell Biol. 21, 3820–3829. Zierold, C., Darwish, H.M., DeLuca, H.F., 1995. Two vitamin D response elements function in the rat 1,25-dihydroxyvitamin D 24-hydroxylase promoter. J. Biol. Chem. 270, 1675–1678.