- Email: [email protected]
Characterization and expression of galectin-3 in grass carp (Ctenopharyngodon idella)
Developmental and Comparative Immunology 104 (2020) 103567
Contents lists available at ScienceDirect
Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/devcompimm
Characterization and expression of galectin-3 in grass carp (Ctenopharyngodon idella)
T
Denghui Zhua,b, Rong Huanga, Pengfei Chua,b, Liangming Chena,b, Yangyu Lia,b, Libo Hea,∗∗, Yongming Lia, Lanjie Liaoa, Zuoyan Zhua, Yaping Wanga,c,∗ a
State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, 430072, China University of Chinese Academy of Sciences, Beijing, 100049, China c Innovative Academy of Seed Design, Chinese Academy of Sciences, Beijing, 100101, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Galectin-3 Grass carp reovirus Immune response Subcellular localization mRNA expression
Galectins are members of evolutionary conserved lectin family and play important roles in the innate and adaptive immunity of both vertebrates and invertebrates. Galectin-3 is the only chimera galectin with one Cterminal carbohydrate recognition domain (CRD) connected to the N-terminal end. Here, a galectin-3 (named CiGal3) from grass carp was identified and characterized, which encodes polypeptides 362 amino acids with a predicted molecular mass of 36.45 kDa and theoretical isoelectric point of 4.91. The sugar binding motifs involved in carbohydrate binding activity (H–N-R, V–N and W–E-R) were detected in CRD. In comparison to other species, CiGal3 showed the highest similarity and identity to Cyprinus carpio (95.3% sequence similarity and 92.5% sequence identity). The subcellular localization of CiGal3 was distributed in the cytoplasm and nucleus of transfected cells. The CiGal3 transcripts were ubiquitously expressed in all checked tissues and highly expressed in immune tissues. In addition, the expression of CiGal3 in liver and spleen was induced post grass carp reovirus (GCRV), lipopolysaccharide (LPS), and polyinosinic:polycytidylic acid (poly I:C) challenge. These results suggest that CiGal3 plays a vital role in the immune system.
1. Introduction The immune system of grass carp has both innate and adaptive components. The innate immune response is the first line of defense against invading pathogens in both invertebrates and vertebrates, playing a crucial role in early recognition and subsequent triggering of proinflammatory responses against invading pathogens (Medzhitov and Janeway, 2000b). During a bacterial infection, the host innate immune system recognizes the pathogen-associated molecular patterns (PAMPs) on the cell surface of potentially pathogenic bacteria using host pattern recognition receptors (PRRs) (Medzhitov and Janeway, 2000a), include Toll-like receptors (TLRs), C-type lectin receptors (CLRs), cytoplasmic proteins Retinoic acid inducible gene (RIG)-1-like receptors, NOD-like receptors (NLRs) (Takeuchi and Akira, 2010), and galectins (Vasta, 2012). Galectins are a family of carbohydrate-binding soluble lectins characterized by a conserved carbohydrate recognition domain (CRD) that specifically recognizes β-galactosides (a carbohydrate structure)
and are nonclassical secretory proteins (Liu et al., 2013). The 15 mammalian galectins identified thus far are subdivided into three groups based on their molecular structure: the prototype containing one CRD (galectin-1, -2, -5, -7, -10, −11, −13, −14, and −15), the tandem-repeat type containing two non-identical CRDs linked by a short peptide (galectin-4, -6, -8, -9, and -12), and the chimera type consisting of an N-terminal Pro- and Gly-rich domain fused to the Cterminal CRD (galectin-3) (Cooper and Barondes, 1999; Hirabayashi and Kasai, 1993). Non-mammalian members of the galectin family are found in birds, amphibians, fish, plants, nematodes, sponges, and fungi (Matsumoto et al., 1998; Zhu et al., 2019a). Similar to other galectin types, galectin-3 also lacks a signal sequence required for secretion, but galectin-3 protein could be released into the extracellular space (Yang et al., 2008). In mammals, galectin-3 has been revealed to be widely expressed in immune cells (activated T cells, B cells, and inflammatory macrophages) (Blaser et al., 1998; Joo et al., 2001) and played important roles in T-cell apoptosis (Fukumori et al., 2003a; Xue et al., 2017a; Yoshii et al., 2002), inflammation (Bertocchi et al., 2008;
∗
Corresponding author. State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, China. ∗∗ Corresponding author. Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, 430072, China. E-mail addresses: [email protected] (L. He), [email protected] (Y. Wang). https://doi.org/10.1016/j.dci.2019.103567 Received 29 September 2019; Received in revised form 6 December 2019; Accepted 6 December 2019 Available online 09 December 2019 0145-305X/ © 2019 Elsevier Ltd. All rights reserved.
Developmental and Comparative Immunology 104 (2020) 103567
D. Zhu, et al.
2.3. Sequence analysis
Kikuchi et al., 2004), and tumor (Fortuna-Costa et al., 2014). In galectin-3 knock-out mice, the number of immune cells was significantly reduced following the infection (Hsu et al., 2000). Most studies on galectin-3 were performed in mammals, whereas the characterization of galectin-3 in teleost was still limited in a few species. Grass carp, the largest consumed freshwater fish in China, has important economic value. However, grass carp is susceptible to grass carp reovirus (GCRV), which causes severe hemorrhagic disease with approximately 85% mortality of fingerling and yearling grass carp in China (Chu et al., 2018, 2019c; Rao and Su, 2015). Therefore, it is necessary to investigate innate immunity defense mechanisms in deeply in order to provide information for long-term development of aquaculture. In the study, a full-length galectin cDNA from grass carp was cloned and characterized. Its expression in normal and conditioned fish was analyzed. Our results will provide the basis and inspiration for further functional research of galectins in grass carp.
The full-length cDNA sequences of CiGal3 were blasted for homology using the Basic Local Alignment Search Tool at the National Center for Biotechnology Information (NCBI) (http://blast.ncbi.nlm. nih.gov/Blast). The nucleotide and predicted amino acid sequences of CiGal3 were analyzed using the Sequence Manipulation Suite (SMS) (http://www.bio-soft.net/sms/). Functional domains of the deduced amino acid sequence were predicted using on line SMART (http:// smart.emblheidelberg.de/) (Letunic et al., 2015). The conserved residues were predicted by InterProScan (http://www.ebi.ac.uk/ interpro/search/sequence-search). Online SignaIP 4.0 Server (http:// www.cbs.dtu.dk/services/SignalP/) was used to predict the signal peptide. The molecular weight (MW) and isoelectric point (pI) of the deduced amino acid sequence were calculated by ExPASy (http://web. expasy.org/compute_pi/). Identity and similarity of CiGal3 with its counterparts from other animals were analyzed by MatGAT (Campanella et al., 2003). The ClustalW 2 (http://www.ebi.ac.uk/ Tools/msa/clustalw2/) tool was involved in performing the multiple sequences alignment. The phylogenetic position of CiGal3 was assessed by reconstructing a phylogenetic tree using MEGA 5.0 program based on neighbor-joining (NJ) method with 1000 bootstraps (Tamura et al., 2011).
2. Materials and methods 2.1. Experimental animals Grass carp (3-month-old; weight, 10 ± 2 g; length, 7 ± 3 cm) were collected at the GuanQiao Experimental Station, Institute of Hydrobiology, Chinese Academic of Sciences, and acclimatized in aerated freshwater at 28 °C for one week. The fishes were fed with a commercial feed (Tong Wei, Chengdu, China) to adapt to the environment until 24 h before the experiments under the same conditions. In the tissue distribution experiment, ten tissue types, including liver, muscle, spleen, gill, intestine (foregut), skin, head kidney, middle kidney, heart, and brain, were collected from 5 random untreated grass carp.
2.4. Immune challenge experiment The GCRV challenge experiment was performed as described previously (Chu et al., 2019a) with some modifications. Briefly, 5 healthy grass carp were intraperitoneally injected with 200 μl PBS (pH 7.4) as the control group while fish of challenging group were injected with an equal volume of GCRV (GD108 strain). The titer of virus was detected by Quantitative real-time PCR (RT-qPCR) and it was 3.12 × 103 copy/ μl (the special primers in Table 1). These injected fish were kept under the same conditions as above mentioned. Five individuals were collected at the indicated times post-infection, including 1, 2, 3, 4, 5, and 6 days post injection (dpi), respectively. The spleen and liver were harvested into TRIzol reagent (Invitrogen) and stored at −80 °C until RNA extraction. The PAMPs challenge experiments were performed as described previously (Zhu et al., 2019d). Grass carp (n = 150) were randomly divided into three groups: control group, LPS, and poly I:C challenge groups. 50 individuals of control group were intraperitoneally injected with 200 μl PBS (pH 7.4) while 50 individuals of each challenge groups were also intraperitoneally injected with an equal volume of LPS (L2880, Sigma, St. Louis, MO, USA, from Escherichia coli 055: B5, 0.5 mg/ml) or 200 μl poly I:C (27472901, GE, 1 mg/ml) dissolved in PBS. These injected fish were kept under the same conditions as above mentioned. At 3, 6, 12, 24, and 48 h post-injection (hpi), 5 individuals from each group were anaesthetized in eugenol anesthesia (final concentration: 100 mg/L). The spleen and liver were harvested into TRIzol
2.2. Full-length cDNA cloning Total RNAs were extracted using TRIzol reagent according to the manufacturer's protocol (Invitrogen, Carlsbad, CA, USA). RNA samples were incubated in RNase-free DNase I (Promega, Wisconsin, USA) to eliminate any contaminating genomic DNA. First-strand cDNA synthesis was performed based on ReverTra Ace kit (Toyobo, Osaka, Japan) using oligo (dT)-adaptor as primer. The reaction was performed at 42 °C for 1 h, and terminated by heating at 95 °C for 5 min. Specific fragments with the coverage of ORF region of were obtained by blasting the galectin-3a sequence of zebrafish (Accession no. XM_699180.9) with the C. idella transcriptional database (Wang et al., 2015). Following, the ORF sequence was amplified using one pair of primers (Table 1), and then specific and adaptor primers (Table 1) were designed to clone the 5ʹ and 3ʹ UTRs using rapid-amplification of cDNA ends (RACE) kit according to the method described previously in our laboratory (Zhu et al., 2019c). Table 1 Primers used in this study. Primers
Sequences (5′—3′)
Purpose
Gal3-5′Rout Gal3-5′Rin Gal3-3′Rout Gal3-3′Rin Gal3-F Gal3-R qGal3-F qGal3-R qβ-actin-F qβ-actin-R pEGFP-Gal3-F pEGFP-Gal3-R
AACCAGGCCATCCAGGATTAGTG AGCTGATGGATTGGTGTGCCTAG ACGGGGTTCATCTGCTGGA GATGTCACTCGTCTGCACATAGAGG ATGGCAGACTTTTCGCTTGC TCAGATCATGCTGGGAGCTGC ACCGGGCGTACCTGGACAGT CCCAGGTGGGCAAGGGAACT TCGGTATGGGACAGAAGGAC GACCAGAGGCATACAGGGAC CTAGCGCTACCGGACTCAGATCTCGAGGTATGGCAGACTTTTCGCTTGC GCTCACCATGGTGGCGATGGATCCGATCATGCTGGGAGCTGC
5′ RACE
2
3′ RACE ORF cloning RT-qPCR
Subcellular localization
Developmental and Comparative Immunology 104 (2020) 103567
D. Zhu, et al.
reagent (Invitrogen) and stored at −80 °C until RNA extraction.
terminal (231–360) CRD and a N-terminal end (https://www. sciencedirect.com/science/article/pii/S1050464818308428?via %3Dihub Fig. 1B), which were also very conserved in other examined vertebrates through the multiple sequence alignment (Fig. 2). Sugar binding motifs (H–N-R, V–N and W–E-R) involved in carbohydrate binding activity were detected in CRD (Fig. 1A; 2). A comparison of homology revealed that the deduced CiGal3 shares 43.4%–95.3% sequence similarity and 33.3%–92.5% sequence identity with galectin-3 of other species, with it being the most similar to that of the Cyprinus carpio (95.3% sequence similarity and 92.5% sequence identity), followed by the Danio rerio (92.7% sequence similarity and 87.1% sequence identity) (Fig. 3). In order to evaluate the evolutionary relationship of CiGal3, a phylogenetic tree was constructed based on amino acid sequences of galectin-3 from different species using the neighbor-joining method with 1000 replications tests (Fig. 4). Phylogenetic analysis showed that CiGal3 was clustered with fish galectin-3s. Moreover, CiGal3 firstly clustered with its counterpart of C. carpio, then grouped together with D. rerio. And all branching nodes were supported by high bootstrap values (Fig. 4).
2.5. Expression analysis of CiGal3 by RT-qPCR RNA extraction and cDNA synthesis were performed as described previously (Chu et al., 2019b). All the samples of RNA were extracted from TRIzol reagent. 2 μg total RNA was used as the template for synthesizing first-strand cDNAs and oligo (dT) primers was used in 20 μl reaction solution. In order to understand the expression profiles of CiGal3 in different tissues and transcriptional regulation of immune challenged animals, RT-qPCR was carried out using iQ™ SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) on a CFX96™ Real Time Detection System (BioRad). A pair of gene-specific primers (Table 1) was used to amplify the CiGal3 fragment. The β-actin (Accession No. M25013.1) was selected as internal control and amplified with its specific primers (Table 1). The RT-qPCR cycling conditions were as follows: 95 °C for 2 min, 40 cycles of 95 °C for 10 s, annealing at 62 °C for 20 s, and 72 °C for 30 s, followed by a Melt Curve was constructed. The relative expression levels were measured using the 2−ΔΔCt method with β-actin as an internal reference (Livak and Schmittgen, 2001).
3.2. The distribution of CiGal3 mRNA in different tissues The RT-qPCR technique was employed to detect the distribution of CiGal3 mRNA transcripts in 10 different tissues with β-actin gene as internal control (Fig. 5). The expression level of CiGal3 in middle kidney was set as 1. CiGal3 mRNA expressions in other tissues were expressed as fold changes relative to expression in the middle kidney. CiGal3 transcripts were detected in all tissues examined, but the relative level of expression varied in different tissues (Fig. 5). The mRNA expression was extremely high in the liver (13.66-fold) followed by the muscle (12.48-fold) and moderate in the heart (5.82-fold), skin (4.65fold), and spleen (4.01-fold). Comparatively, a low level of expression was detected in the head kidney, and middle kidney.
2.6. Subcellular localization Human embryonic kidney 293T (HEK 293T) cells were cultured at High glucose Dulbecco's modified Eagle's medium (DMEM; Hyclone, Logan, UT, USA), with 10% fetal bovine serum (FBS), 100 IU/ml penicillin (Sigma) and 100 mg/ml streptomycin (Sigma) under a humidified condition with 5% CO2 at 37 °C. To study the subcellular localization of CiGal3, the complete ORF sequence of CiGal3 was cloned into pEGFP-N3 vectors (Clontech, Palo Alto, California, USA) using ClonExpress II One Step Cloning Kit (Vazyme Biotech Co., Ltd., Nanjing, China) and produced GFP-tagged expression plasmid (named CiGal3-pEGFP). Sequence of the resulting plasmid was verified by DNA sequencing. HEK 293T cells were seeded into 6-well plates with 1 × 106 cells per well and cultured 24 h. After that, 5 μg of plasmid constructs of CiGal3-pEGFP and pEGFP-N3 (vector control) were respectively transfected into the cells using Lipo 6000™ Transfection Reagent (Beyotime, Shanghai, China). At 24 h posttransfection, the cells were fixed with 4% (v/v) paraformaldehyde, permeabilized with 0.2% Triton X-100, and stained with Hoechst 33342 (Beyotime) (Zhu et al., 2019b). The cells were observed using the UltraVIEW VOX confocal system (PerkinElmer, Fremont, CA, USA) and a 63× oil immersion objective lens.
3.3. CiGal3 expression after GCRV challenge To observe the effect of viral infection on CiGal3 expression in innate immune organs, the CiGal3 transcripts in liver and spleen were detected. As shown in Fig. 6, CiGal3 was significantly up-regulated in liver and spleen after GCRV challenge (P < 0.05) compared to the non-challenge control. In the spleen, CiGal3 transcripts were increased on 1 dpi, then dropped to the basal level on 2 dpi. Afterwards, the expression levels were up-regulated from 3 to 6 dpi and the peak on 4 dpi (Fig. 6A). In the liver, the levels of CiGal3 mRNA were dramatically up-regulated from 2 to 5 dpi and then reached the basal level on 6 dpi (Fig. 6B).
2.7. Statistical analysis
3.4. Changes of CiGal3 transcripts upon PAMPs challenges
All the data were analyzed using the SPSS 16.0 (IBM Corporation, Armonk, NY, USA) and assessed by one-way analysis of variance (ANOVA). All the experiments were repeated at least three times. The significance level was set at p ≤ 0.05 and the extreme significance level was set at p ≤ 0.01.
The temporal expression patterns of CiGal3 in spleen and liver with LPS and poly I:C injection were qualified by RT-qPCR. When grass carp individuals were treated with LPS and poly I:C, the transcript level of CiGal3 in different tissues varied considerably, and the mRNA levels varied with the kind of infectious agent (Fig. 7). In the spleen, the expression patterns of CiGal3 mRNA were very similar after LPS and poly I:C injection, that is, CiGal3 transcripts were increased sharply and reached the peak at 3 hpi, and then declined and dropped to the lowest level at 48 hpi (Fig. 7A). In the liver, CiGal3 transcripts after poly I:C injection exhibited significant up-regulation at 12 hpi, and had no significantly differences at other time points. However, CiGal3 transcripts after LPS injection had no significantly difference with the control group throughout the test period (Fig. 7B).
3. Results 3.1. The molecular features, sequence alignment and phylogeny relationship of CiGal3 The full-length cDNA of the CiGal3 sequence was 2152 bp, containing a 5′-UTR of 242 bp, a 3′-UTR of 821 bp with the putative polyadenylation consensus signal (AATAAA), an ORF of 1089 bp encoding polypeptides of 362 amino acids with a predicted molecular mass of 36.45 kDa and theoretical isoelectric point of 4.91 (https:// www.sciencedirect.com/science/article/pii/S1050464818308428?via %3Dihub Fig. 1A). No signal peptides was found in the sequence of CiGal3. Using online SMART program prediction, CiGal3 contained a C-
3.5. Subcellular localization of CiGal3 To determine the subcellular localization of CiGal3, the eukaryotic 3
Developmental and Comparative Immunology 104 (2020) 103567
D. Zhu, et al.
Fig. 1. (A) Nucleotide and deduced amino acid sequences of CiGal3 are given in the bottom and top lines, respectively. The number indicates the position of the nucleotides and amino acids. Start codon (ATG) and the stop codon (TAA) were boxed. The GLECT/Gal-bind_lectin domain was in dark green. The conserved residues involved in carbohydrate binding activity were boxed. The polyadenylation signal sequence is underlined. (B) The protein domain predicted by SMART program using CiGal3 amino acid sequence. The two pink bands represent low complexity region. The diamond represents Gal-bind_lectin domain. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
to the extracellular space via an endoplasmic reticulum (ER)/Golgi independent pathway (Cha et al., 2015; Hou et al., 2015; Shi et al., 2014)]. Galectin-3 is the only chimera galectin with one CRD connected to the N-terminal end, and the CRD was conserved in vertebrates (Fig. 2). These two functional domains were typical domains in galectin-3 family (Barondes et al., 1994b; Brinchmann et al., 2018; Ho and Springer, 1982; Liu et al., 1985; Rabinovich and Gruppi, 2005). The N-terminal end and the CRD coordinate to induce signaling pathways and involvement in biological processes including T-cell apoptosis (Fukumori et al., 2003b), caspase-9 activation (Xue et al., 2017b). From the multiple sequence alignment with different species, CiGal3 was similar to other galectin-3s, especially the CRD domain. Highly conserved sugar binding pockets (H–N-R, V–N, and W-E-R) located in the concave sheets of CRD (Marchler-Bauer et al., 2015), were responsible for holding carbohydrates (Cooper, 2002a). Moreover, CiGal3 clusters more closely with galectin-3s from fish than mammals, according with their high identities and traditional taxonomy. Based on the structure and evolutional features of CiGal3, we confirm that CiGal3 is a member of galectin subfamily. To provide insight into functions of galectin-3 gene, expression profiles of CiGal3 were determined in healthy grass carp tissues. In this
expression vector of CiGal3-pEGFP was constructed transfected into HEK 293T cells. Meanwhile, empty pEGFP-N3 plasmids were also transfected as the negative control. The subcellular localization of CiGal3-GFP was distributed in the cytoplasm and nucleus, similar to the results of the control group (Fig. 8). 4. Discussion The primary feature of lectin is that it has a specific carbohydraterecognition domain (Gauto et al., 2011; Wang et al., 2012; Zhu et al., 2008)]. Animal lectins are classified according to the peptide sequence of their CRDs, as C-type (Gabius, 1997), S-type (also referred to as galectin) (Jung et al., 2003), I-type (Tateno et al., 2002), P-type (Dahms and Hancock, 2002) and F-type (Anju et al., 2013), amongst others (Ma et al., 2011). Galectins are members of evolutionary conserved lectin family and play important roles in the innate and adaptive immunity of both vertebrates and invertebrates (Barondes et al., 1994a; Cooper, 2002b; Vasta, 2009; Vasta et al., 2004). In the present research, the fulllength cDNA of galectin was cloned from grass carp (named CiGal3). Similar to other identified vertebrates galectins, no classical signal peptides were found in CiGal3 (Fig. 1), indicating it might be secreted 4
Developmental and Comparative Immunology 104 (2020) 103567
D. Zhu, et al.
Fig. 2. Multiple sequences alignment among the galectin-3 of several species containing mammals and fish. The red triangle indicates the critical conserved residues for carbohydrate binding (as H–N-R, V–N and W–E-R). GenBank accession numbers for the protein sequences are as follows. Cyprinus carpio (XP 018946665.1); Salmo salar (XP 014038550.1); Danio rerio (XP 704272.2); Takifugu r ubripe (XP 011613179.1); Oncorhynchus mykiss (XP 021441115.1); Larimichthys crocea (XP 010751985.3); Cynoglossus semilaevis (XP 016891389.1); Sinocyclocheilus anshuiensis (XP 016334677.1); Sinocyclocheilus Rhinocerous (XP 016403382.1); Labeo Rohita (RXN05027.1); Xenopus tropicalis (NP 988986.1); Gallus gallus (NP 001289729.1); Mus musculus (NP 001139425.1); Bos taurus (NP 001095811.1); Homo sapiens (BAA22164.1); Carassius auratus (XP 026133872.1). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
the kidney, and gills (Kong et al., 2012). Larimichthys crocea galectin-9 was most abundant in liver, moderately expressed in spleen, gill, kidney, head-kidney and intestine (Zhang et al., 2016). However, in Oreochromis niloticus, the higher expression levels of galectin-3 were observed in the kidney, spleen, gill, and skin, and lower transcription in other tissues (Zhu et al., 2019e). Turbot (Scophthalmus maximus L.) galectin-3 was highly expressed in brain, followed by intestine, headkidney and blood (Tian et al., 2018). In mammals, the mucosal
study, CiGal3 was constitutively expressed in different tissues examined, with the highest expression level in liver. The broad tissue expression pattern was also detected in other teleost fish, and most were expressed mainly in the immune-related tissues. In some studies also revealed that galectins highly expressed in liver. In channel catfish, galectin-3a was highly expressed in liver, gill and skin (Zhou et al., 2016). In Korean rose bitterling (Rhodeus uyekii), galectin-9 mRNA was highly expressed in the spleen, intestine, and liver, and moderately in 5
Developmental and Comparative Immunology 104 (2020) 103567
D. Zhu, et al.
Fig. 3. Identity and similarity of CiGal3 with its counterparts from other animals by MatGAT. The percents of identity and similarity are showed in upper and lower triangles, respectively. Fig. 4. Phylogenetic analysis of galectin-3 using neighbor-joining (NJ) method. The confidence in each node was assessed by 1000 bootstraps. GenBank accession numbers for the protein sequences are as follows. Cyprinus carpio (XP 018946665.1); Salmo salar (XP 014038550.1); Danio rerio (XP 704272.2); Takifugu rubripe (XP 011613179.1); Oncorhynchus mykiss (XP 021441115.1); Larimichthys crocea (XP 010751985.3); Cynoglossus semilaevis (XP 016891389.1); Xenopus tropicalis (NP 988986.1); Gallus gallus (NP 001289729.1); Mus musculus (NP 001139425.1); Bos taurus (NP 001095811.1); Homo sapiens (BAA22164.1).
an important role for immune responses in various fish species. As we all known, liver and spleen were important immune organs (Protzer et al., 2012; Rauta et al., 2012; Raz, 2007). To determine whether CiGal3 participates in the immune response to pathogenic microbes, the expression profiles of CiGal3 gene were analyzed in the two tissues following the injection of GCRV, poly I:C and LPS. Notably, the results revealed that CiGal3 was significantly induced by GCRV, LPS and poly I:C injection in the tested tissues. Interestingly, two peaks upregulation of CiGal3 (1 dpi and 3–6 dpi) were found in spleen following the GCRV infection. Galectin-3 has been revealed to be played important roles in cell apoptosis (Fukumori et al., 2003a; Xue et al., 2017a; Yoshii et al., 2002). At the early stage of infection, viruses target key regulatory proteins to escape from apoptosis and this process contributes to viral replication and propagation (Liang et al., 2015). So this could explain why CiGal3 expression in spleen down-regulated once. Similarly, galectin-3 was significantly up-regulated in catfish skin following Flavobacterium columnare, and Aeromonas hydrophila infection (Li et al., 2013; Zhou et al., 2016). The Oreochromis niloticus galectin-3 transcription was up-regulated by Streptococcus agalactiae and A. hydrophila infection in immune-related tissues. In contrast, Scophthalmus maximus L. galectin-3 was significantly down-regulated in intestine following both Gram-negative bacteria Vibrio anguillarum, and Grampositive bacteria Streptococcus iniae immersion challenge (Tian et al., 2018). In addition, in zebrafish, extracellular galectin-3 could reduce the adhesion of infectious hematopoietic necrosis virus by direct interaction with virus envelop on the epithelial cell surface in a carbohydrate-dependent manner (Nita-Lazar et al., 2016). In gastric
Fig. 5. Tissue distribution of CiGal3 in healthy grass carp by RT-qPCR. The G: gill; S: spleen; L: liver; M: muscle; SK: skin; B: brain; I: intestine H: heart; MK: middle kidney and HK: head kidney were harvested from healthy grass carp to extract total RNA for a tissue distribution analysis (n = 5). The β-actin was used as an internal control. The expression level of CiGal3 in middle kidney was set as 1. All data were given in terms of relative mRNA expression as the mean ± SD. Asterisks (*) representative of significant difference (* = p ≤ 0.05, ** = p ≤ 0.01).
epithelium has a high expression of galectin-3 (Lippert et al., 2007). Although there are different in the expression of genes in different species, these highly expressed tissues are considered to be important immune tissues. The extensive distribution of CiGal3 shows that it plays 6
Developmental and Comparative Immunology 104 (2020) 103567
D. Zhu, et al.
Fig. 6. Temporal expression of CiGal3 in spleen (A) and liver (B) after GCRV infection. Expression levels on day 0 was set to 1.0. The β-actin was used as an internal control. All data were given in terms of relative mRNA expression as means ± SD (n = 5). Asterisks (*) representative of significant difference (* = p ≤ 0.05, ** = p ≤ 0.01).
Fig. 7. Expression analysis of CiGal3 in liver (A) and spleen (B) at 3 h, 6 h, 12 h, 24 h, 48 h postinjection with PBS, LPS and poly I:C, respectively. All data were given in terms of relative mRNA expression as the mean ± SD (n = 5). The β-actin was used as an internal control. Asterisks (*) representative of significant difference (* = p ≤ 0.05, ** = p ≤ 0.01).
COOH-terminal end (the last 28 amino acids) of the Gal3 polypeptide is important for nuclear localization (Haudek et al., 2010). The protein shuttles between the cytoplasm and nucleus on the basis of targeting signals that are recognized by importin(s) for nuclear localization and exportin-1 (CRM1) for nuclear export. Indeed, a number of ligands have been reported for Gal3 in the cytoplasm and in the nucleus. In the cytoplasm, for example, Gal3 interacts with the apoptosis repressor Bcl-2 and this interaction may be involved in Gal3's anti-apoptotic activity (Yang et al., 1996). In the nucleus, Gal3 is a required pre-mRNA splicing factor; the protein is incorporated into spliceosomes via its association with the U1 small nuclear ribonucleoprotein (snRNP) complex (Haudek et al., 2009). Thus, Gal3 play important roles in both the cytoplasm and the nucleus. Taken together, a galectin-3 (named CiGal3) from grass carp was identified and characterized. The fluorescence of CiGal3-GFP was distributed in the cytoplasm and nucleus. The CiGal3 transcripts were ubiquitously expressed in all checked tissues and highly expressed in immune tissues. In addition, the expression of CiGal3 in liver and spleen was induced post GCRV, LPS, and poly I:C challenge. All these implied its vital role in immune the system.
Fig. 8. (A) Subcellular localization of CiGal3 proteins in HEK 293T cells. HEK 293T cells were plated in 6-well plates. At 24 h post-transfection, cells were fixed with 4% (v/v) paraformaldehyde, permeabilized with 0.2% Triton X-100. Green fluorescence shows the distribution of GFP or GFP-tagged proteins and blue fluorescence shows the nucleus that was stained by Hoechst 33342 under a 63 × oil immersion objective lens (scale bar, 20 μm). All samples were visualized using a confocal microscope. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Acknowledgments This study was supported by the National Natural Science Foundation of China (grant numbers 31721005 and 31572614). Appendix A. Supplementary data
epithelial cells, galectin-3 was up-regulated following Helicobacter pylori infection (Subhash and Ho, 2016). Galectin-3 null mice demonstrated reduced T cell and macrophage responses to Citrobacter rodentium infection in the gut (Curciarello et al., 2014). These results collectively indicate that CiGal3 is involved in the response of pathogenic microbes. From the results of subcellular localization, CiGal3-GFP was distributed in the cytoplasm and nucleus. A large number of observations on the nuclear versus cytoplasmic distribution of Gal3 have been reported (Askew et al., 1993; Dumic et al., 2000; Joo et al., 2001). More experiments have provided at least some general agreement that the
Supplementary data to this article can be found online at https:// doi.org/10.1016/j.dci.2019.103567. References Anju, A., Jeswin, J., Thomas, P.C., Vijayan, K.K., 2013. Molecular cloning, characterization and expression analysis of F-type lectin from pearl oyster Pinctada fucata. Fish Shellfish Immunol. 35, 170–174. Askew, D., Burger, C.J., Elgert, K.D., 1993. Tumor growth and adherence change the
7
Developmental and Comparative Immunology 104 (2020) 103567
D. Zhu, et al.
Kikuchi, Y., Kobayashi, S., Hemmi, N., Ikee, R., Hyodo, N., Saigusa, T., Namikoshi, T., Yamada, M., Suzuki, S., Miura, S., 2004. Galectin-3-positive cell infiltration in human diabetic nephropathy. Nephrol. Dial. Transplant. 19, 602–607. Kong, H.J., Kim, W.-J., Kim, H.S., Lee, Y.J., Kim, C.H., Nam, B.-H., Kim, Y.-O., Kim, D.-G., Lee, S.-J., Lim, S.-G., Kim, B.-S., 2012. Molecular characterization of a tandem-repeat galectin-9 (RuGlec9) from Korean rose bitterling (Rhodeus uyekii). Fish Shellfish Immunol. 32, 939–944. Letunic, I., Doerks, T., Bork, P., 2015. SMART: recent updates, new developments and status in 2015. Nucleic Acids Res. 43, D257–D260. Li, C., Wang, R., Su, B., Luo, Y., Terhune, J., Beck, B., Peatman, E., 2013. Evasion of mucosal defenses during Aeromonas hydrophila infection of channel catfish (Ictalurus punctatus) skin. Dev. Comp. Immunol. 39, 447–455. Liang, C., Oh, B.H., Jung, J.U., 2015. Novel functions of viral anti-apoptotic factors. Nat. Rev. Microbiol. 13, 7–12. Lippert, E., Falk, W., Bataille, F., Kaehne, T., Naumann, M., Goeke, M., Herfarth, H., Schoelmerich, J., Rogler, G., 2007. Soluble galectin-3 is a strong, colonic epithelialcell-derived, lamina propria fibroblast-stimulating factor. Gut 56, 43–51. Liu, F.T., Albrandt, K., Mendel, E., Kulczycki, A., Orida, N.K., 1985. Identification of an ige-binding protein by molecular-cloning. Proc. Natl. Acad. Sci. U.S.A. 82, 4100–4104. Liu, L.H., He, H.J., Lv, Z.Y., Wei, J., Zeng, X., Liang, J.Y., Zheng, H.Q., Yu, X.B., Sun, X., Wu, Z.D., 2013. The mRNA level of the galectin-10 of Angiostrongylus cantonensis induced by reactive oxygen stress. Parasitol. Res. 112, 933–943. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25, 402–408. Ma, Y.J., Doni, A., Skjoedt, M.O., Honore, C., Arendrup, M., Mantovani, A., Garred, P., 2011. Heterocomplexes of mannose-binding lectin and the pentraxins PTX3 or serum amyloid P component trigger cross-activation of the complement system. J. Biol. Chem. 286, 3405–3417. Marchler-Bauer, A., Derbyshire, M.K., Gonzales, N.R., Lu, S.N., Chitsaz, F., Geer, L.Y., Geer, R.C., He, J., Gwadz, M., Hurwitz, D.I., Lanczycki, C.J., Lu, F., Marchler, G.H., Song, J.S., Thanki, N., Wang, Z.X., Yamashita, R.A., Zhang, D.C., Zheng, C.J., Bryant, S.H., 2015. CDD: NCBI's conserved domain database. Nucleic Acids Res. 43, D222–D226. Matsumoto, R., Matsumoto, H., Seki, M., Hata, M., Asano, Y., Kanegasaki, S., Stevens, R.L., Hirashima, M., 1998. Human ecalectin, a variant of human galectin-9, is a novel eosinophil chemoattractant produced by T lymphocytes. J. Biol. Chem. 273, 16976–16984. Medzhitov, R., Janeway, C., 2000a. Innate immune recognition: mechanisms and pathways. Immunol. Rev. 173, 89–97. Medzhitov, R., Janeway, C.J., 2000b. Advances in immunology: innate immunity. N. Engl. J. Med. 343, 338–344. Nita-Lazar, M., Mancini, J., Feng, C.G., Gonzalez-Montalban, N., Ravindran, C., Jackson, S., de las Heras-Sanchez, A., Giomarelli, B., Ahmed, H., Haslam, S.M., Wu, G., Dell, A., Ammayappan, A., Vakharia, V.N., Vasta, G.R., 2016. The zebrafish galectins Drgal1-L2 and Drgal3-L1 bind in vitro to the infectious hematopoietic necrosis virus (IHNV) glycoprotein and reduce viral adhesion to fish epithelial cells. Dev. Comp. Immunol. 55, 241–252. Protzer, U., Maini, M.K., Knolle, P.A., 2012. Living in the liver: hepatic infections. Nat. Rev. Immunol. 12, 201–213. Rabinovich, G.A., Gruppi, A., 2005. Galectins as immunoregulators during infectious processes: from microbial invasion to the resolution of the disease. Parasite Immunol. 27, 103–114. Rao, Y., Su, J., 2015. Insights into the antiviral immunity against grass carp (Ctenopharyngodon idella) reovirus (GCRV) in grass carp. Journal of immunology research 2015 670437. Rauta, P.R., Nayak, B., Das, S., 2012. Immune system and immune responses in fish and their role in comparative immunity study: a model for higher organisms. Immunol. Lett. 148, 23–33. Raz, E., 2007. Organ-specific regulation of innate immunity. Nat. Immunol. 8, 3–4. Shi, X.Z., Wang, L., Xu, S., Zhang, X.W., Zhao, X.F., Vasta, G.R., Wang, J.X., 2014. A galectin from the kuruma shrimp (Marsupenaeus japonicus) functions as an opsonin and promotes bacterial clearance from hemolymph. PLoS One 9. Subhash, V.V., Ho, B., 2016. Galectin 3 acts as an enhancer of survival responses in Hpylori-infected gastric cancer cells. Cell Biol. Toxicol. 32, 23–35. Takeuchi, O., Akira, S., 2010. Pattern recognition receptors and inflammation. Cell 140, 805–820. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Tateno, H., Yamaguchi, T., Ogawa, T., Muramoto, K., Watanabe, T., Kamiya, H., Saneyoshi, M., 2002. Immunohistochemical localization of rhamnose-binding lectins in the steelhead trout (Oncorhynchus mykiss). Dev. Comp. Immunol. 26, 543–550. Tian, M., Yang, N., Zhang, L., Fu, Q., Tan, F., Li, C., 2018. Expression profiling and functional characterization of galectin-3 of turbot (Scophthalmus maximus L.) in host mucosal immunity. Fish Shellfish Immunol. 84, 333–340. Vasta, G.R., 2009. Roles of galectins in infection. Nat. Rev. Microbiol. 7, 424–438. Vasta, G.R., 2012. Galectins as pattern recognition receptors: structure, function, and evolution. Adv. Exp. Med. Biol. 946, 21–36. Vasta, G.R., Ahmed, H., Odom, E.W., 2004. Structural and functional diversity of lectin repertoires in invertebrates, protochordates and ectothermic vertebrates. Curr. Opin. Struct. Biol. 14, 617–630. Wang, L., Wang, L., Yang, J., Zhang, H., Huang, M., Kong, P., Zhou, Z., Song, L., 2012. A multi-CRD C-type lectin with broad recognition spectrum and cellular adhesion from Argopectenirradians. Dev. Comp. Immunol. 36, 591–601. Wang, Y., Lu, Y., Zhang, Y., Ning, Z., Li, Y., Zhao, Q., Lu, H., Huang, R., Xia, X., Feng, Q.,
expression of macrophage Mac-2. Cancer Lett. 69, 67–74. Barondes, S.H., Castronovo, V., Cooper, D.N.W., Cummings, R.D., Drickamer, K., Felzi, T., Gitt, M.A., Hirabayashi, J., Hughes, C., Kasai, K.-i., Leffler, H., Liu, F.-T., Lotan, R., Mercurio, A.M., Monsigny, M., Pillai, S., Poirer, F., Raz, A., Rigby, P.W.J., Rini, J.M., Wang, J.L., 1994a. Galectins: a family of animal β-galactoside-binding lectins. Cell 76, 597–598. Barondes, S.H., Cooper, D.N.W., Gitt, M.A., Leffler, H., 1994b. Galectins - structure and function of a large family of animal lectins. J. Biol. Chem. 269, 20807–20810. Bertocchi, A.P.F., Campanhole, G., Wang, P.H.M., Goncalves, G.M., Damiao, M.J., Cenedeze, M.A., Beraldo, F.C., Teixeira, V.D.A., dos Reis, M.A., Mazzali, M., PachecoSilva, A., Camara, N.O.S., 2008. A Role for galectin-3 in renal tissue damage triggered by ischemia and reperfusion injury. Transpl. Int. 21, 999–1007. Blaser, C., Kaufmann, M., Muller, C., Zimmermann, C., Wells, V., Mallucci, L., Pircher, H., 1998. Beta-galactoside-binding protein secreted by activated T cells inhibits antigeninduced proliferation of T cells. Eur. J. Immunol. 28, 2311–2319. Brinchmann, M.F., Patel, D.M., Iversen, M.H., 2018. The role of galectins as modulators of metabolism and inflammation. Mediat. Inflamm. 2018 9186940-9186940. Campanella, J.J., Bitincka, L., Smalley, J., 2003. MatGAT: an application that generates similarity/identity matrices using protein or DNA sequences. BMC Bioinf. 4. Cha, G.H., Liu, Y., Peng, T., Huang, M.Z., Xie, C.Y., Xiao, Y.C., Wang, W.N., 2015. Molecular cloning, expression of a galectin gene in Pacific white shrimp Litopenaeus vannamei and the antibacterial activity of its recombinant protein. Mol. Immunol. 67, 325–340. Chu, P., He, L., Li, Y., Huang, R., Liao, L., Li, Y., Zhu, Z., Wang, Y., 2018. Molecular cloning and functional characterisation of NLRX1 in grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 81, 276–283. Chu, P., He, L., Yang, C., Zeng, W., Huang, R., Liao, L., Li, Y., Zhu, Z., Wang, Y., 2019a. Grass carp ATG5 and ATG12 promote autophagy but down-regulate the transcriptional expression levels of IFN-I signaling pathway. Fish Shellfish Immunol. 92, 600–611. Chu, P., He, L., Zhu, D., Huang, R., Liao, L., Li, Y., Zhu, Z., Wang, Y., 2019b. Identification, expression and functional characterisation of CYP1A in grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 95, 35–43. Chu, P.F., He, L.B., Yang, C., Li, Y.Y., Huang, R., Liao, L.J., Li, Y.M., Zhu, Z.Y., Wang, Y.P., 2019c. Characterisation and function of TRIM23 in grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 88, 627–635. Cooper, D.N., 2002a. Galectinomics: finding themes in complexity. Biochim. Biophys. Acta 1572, 209–231. Cooper, D.N.W., 2002b. Galectinomics: finding themes in complexity. Bba-Gen Subjects 1572, 209–231. Cooper, D.N.W., Barondes, S.H., 1999. God must love galectins; He made so many of them. Glycobiology 9, 979–984. Curciarello, R., Steele, A., Cooper, D., MacDonald, T.T., Kruidenier, L., Kudo, T., 2014. The role of galectin-1 and galectin-3 in the mucosal immune response to Citrobacter rodentium infection. PLoS One 9. Dahms, N., Hancock, M.K., 2002. P-type lectins. Biochim. Biophys. Acta 1572, 317–340. Dumic, J., Lauc, G., Hadzija, M., Flogel, M., 2000. Transfer to in vitro conditions influences expression and intracellular distribution of galectin-3 in murine peritoneal macrophages. Zeitschrift fur Naturforschung. C, Journal of biosciences 55, 261–266. Fortuna-Costa, A., Gomes, A.M., Kozlowski, E.O., Stelling, M.P., Pavao, M.S., 2014. Extracellular galectin-3 in tumor progression and metastasis. Frontiers in oncology 4, 138. Fukumori, T., Takenaka, Y., Yoshii, T., Kim, H.R., Hogan, V., Inohara, H., Kagawa, S., Raz, A., 2003a. CD29 and CD7 mediate galectin-3-induced type II T-cell apoptosis. Cancer Res. 63, 8302–8311. Fukumori, T., Takenaka, Y., Yoshii, T., Kim, H.R.C., Hogan, V., Inohara, H., Kagawa, S., Raz, A., 2003b. CD29 and CD7 mediate galectin-3-induced type II T-cell apoptosis. Cancer Res. 63, 8302–8311. Gabius, H.J., 1997. Animal lectins. Eur. J. Biochem. 243, 543–576. Gauto, D.F., Di Lella, S., Estrin, D.A., Monaco, H.L., Marti, M.A., 2011. Structural basis for ligand recognition in a mushroom lectin: solvent structure as specificity predictor. Carbohydr. Res. 346, 939–948. Haudek, K.C., Spronk, K.J., Voss, P.G., Patterson, R.J., Wang, J.L., Arnoys, E.J., 2010. Dynamics of galectin-3 in the nucleus and cytoplasm. Biochim. Biophys. Acta 1800, 181–189. Haudek, K.C., Voss, P.G., Locascio, L.E., Wang, J.L., Patterson, R.J., 2009. A mechanism for incorporation of galectin-3 into the spliceosome through its association with U1 snRNP. Biochemistry 48, 7705–7712. Hirabayashi, J., Kasai, K., 1993. The family of metazoan metal-independent beta-galactoside-binding lectins: structure, function and molecular evolution. Glycobiology 3, 297–304. Ho, M.K., Springer, T.A., 1982. Mac-2, a novel 32,000 Mr mouse macrophage subpopulation-specific antigen defined by monoclonal-antibodies. J. Immunol. 128, 1221–1228. Hou, F.J., Liu, Y.J., He, S.L., Wang, X.Z., Mao, A.T., Liu, Z.G., Sun, C.B., Liu, X.L., 2015. A galectin from shrimp Litopenaeus vannamei is involved in immune recognition and bacteria phagocytosis. Fish Shellfish Immunol. 44, 584–591. Hsu, D.K., Yang, R.Y., Pan, Z., Yu, L., Salomon, D.R., Fung-Leung, W.P., Liu, F.T., 2000. Targeted disruption of the galectin-3 gene results in attenuated peritoneal inflammatory responses. Am. J. Pathol. 156, 1073–1083. Joo, H.G., Goedegebuure, P.S., Sadanaga, N., Nagoshi, M., von Bernstorff, W., Eberlein, T.J., 2001. Expression and function of galectin-3, a beta-galactoside-binding protein in activated T lymphocytes. J. Leukoc. Biol. 69, 555–564. Jung, W.K., Park, P.J., Kim, S.K., 2003. Purification and characterization of a new lectin from the hard roe of skipjack tuna, Katsuwonus pelamis. Int. J. Biochem. Cell Biol. 35, 255–265.
8
Developmental and Comparative Immunology 104 (2020) 103567
D. Zhu, et al.
Galectins in channel catfish, Ictalurus punctatus: characterization and expression profiling in mucosal tissues. Fish Shellfish Immunol. 49, 324–335. Zhu, D., Fu, P., Huang, R., Xiong, L., Wang, Y., He, L., Liao, L., Li, Y., Zhu, Z., Wang, Y., 2019a. Molecular characterization, tissue distribution and functional analysis of galectin 1-like 2 in grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 94, 455–463. Zhu, D., Huang, R., Fu, P., Chen, L., Luo, L., Chu, P., He, L., Li, Y., Liao, L., Zhu, Z., Wang, Y., 2019b. Investigating the role of BATF3 in grass carp (Ctenopharyngodon idella) immune modulation: a fundamental functional analysis. Int. J. Mol. Sci. 20, 1687. Zhu, D., Huang, R., Yang, C., Fu, P., Chen, L., Jiang, Y., He, L., Li, Y., Liao, L., Zhu, Z., Wang, Y., 2019c. Identification and Molecular Characterization of Peroxiredoxin 2 in Grass Carp (Ctenopharyngodon Idella). Fish & shellfish immunology. Zhu, D., Li, Y., Huang, R., Luo, L., Chen, L., Fu, P., He, L., Li, Y., Liao, L., Zhu, Z., Wang, Y., 2019d. Molecular Characterization and Functional Activity of Prx 1 in Grass Carp (Ctenopharyngodon Idella). Fish & shellfish immunology. Zhu, J., Wei, M., wang, Q., Ao, Q., Tan, Y., Luo, Y., Wang, H., Jiang, H., Hu, Q., 2019e. Characterization and expression of galectin-3 after Streptococcus agalactiae and Aeromonas hydrophila challenge in GIFT strain Nile tilapia (Oreochromis niloticus). Fish Shellfish Immunol. 86, 974–980. Zhu, L., Song, L.S., Xu, W., Qian, P.Y., 2008. Molecular cloning and immune responsive expression of a novel C-type lectin gene from bay scallop Argopecten irradians. Fish Shellfish Immunol. 25, 231–238.
Liang, X., Liu, K., Zhang, L., Lu, T., Huang, T., Fan, D., Weng, Q., Zhu, C., Lu, Y., Li, W., Wen, Z., Zhou, C., Tian, Q., Kang, X., Shi, M., Zhang, W., Jang, S., Du, F., He, S., Liao, L., Li, Y., Gui, B., He, H., Ning, Z., Yang, C., He, L., Luo, L., Yang, R., Luo, Q., Liu, X., Li, S., Huang, W., Xiao, L., Lin, H., Han, B., Zhu, Z., 2015. The draft genome of the grass carp (Ctenopharyngodon idellus) provides insights into its evolution and vegetarian adaptation. Nat. Genet. 47, 625–631. Xue, H., Liu, L., Zhao, Z., Zhang, Z., Guan, Y., Cheng, H., Zhou, Y., Tai, G., 2017a. The Nterminal tail coordinates with carbohydrate recognition domain to mediate galectin-3 induced apoptosis in T cells. Oncotarget 8, 49824–49838. Xue, H.T., Liu, L., Zhao, Z.H., Zhang, Z.Y., Guan, Y., Cheng, H.R., Zhou, Y.F., Tai, G.H., 2017b. The N-terminal tail coordinates with carbohydrate recognition domain to mediate galectin-3 induced apoptosis in T cells. Oncotarget 8, 49824–49838. Yang, R.Y., Hsu, D.K., Liu, F.T., 1996. Expression of galectin-3 modulates T-cell growth and apoptosis. Proc. Natl. Acad. Sci. U.S.A. 93, 6737–6742. Yang, R.Y., Rabinovich, G.A., Liu, F.T., 2008. Galectins: structure, function and therapeutic potential. Expert Rev. Mol. Med. 10, e17. Yoshii, T., Fukumori, T., Honjo, Y., Inohara, H., Kim, H.R.C., Raz, A., 2002. Galectin-3 phosphorylation is required for its anti-apoptotic function and cell cycle arrest. J. Biol. Chem. 277, 6852–6857. Zhang, D.L., Lv, C.H., Yu, D.H., Wang, Z.Y., 2016. Characterization and functional analysis of a tandem-repeat galectin-9 in large yellow croaker Larimichthys crocea. Fish Shellfish Immunol. 52, 167–178. Zhou, S., Zhao, H., Thongda, W., Zhang, D., Su, B., Yu, D., Peatman, E., Li, C., 2016.
9
Contents lists available at ScienceDirect
Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/devcompimm
Characterization and expression of galectin-3 in grass carp (Ctenopharyngodon idella)
T
Denghui Zhua,b, Rong Huanga, Pengfei Chua,b, Liangming Chena,b, Yangyu Lia,b, Libo Hea,∗∗, Yongming Lia, Lanjie Liaoa, Zuoyan Zhua, Yaping Wanga,c,∗ a
State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, 430072, China University of Chinese Academy of Sciences, Beijing, 100049, China c Innovative Academy of Seed Design, Chinese Academy of Sciences, Beijing, 100101, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Galectin-3 Grass carp reovirus Immune response Subcellular localization mRNA expression
Galectins are members of evolutionary conserved lectin family and play important roles in the innate and adaptive immunity of both vertebrates and invertebrates. Galectin-3 is the only chimera galectin with one Cterminal carbohydrate recognition domain (CRD) connected to the N-terminal end. Here, a galectin-3 (named CiGal3) from grass carp was identified and characterized, which encodes polypeptides 362 amino acids with a predicted molecular mass of 36.45 kDa and theoretical isoelectric point of 4.91. The sugar binding motifs involved in carbohydrate binding activity (H–N-R, V–N and W–E-R) were detected in CRD. In comparison to other species, CiGal3 showed the highest similarity and identity to Cyprinus carpio (95.3% sequence similarity and 92.5% sequence identity). The subcellular localization of CiGal3 was distributed in the cytoplasm and nucleus of transfected cells. The CiGal3 transcripts were ubiquitously expressed in all checked tissues and highly expressed in immune tissues. In addition, the expression of CiGal3 in liver and spleen was induced post grass carp reovirus (GCRV), lipopolysaccharide (LPS), and polyinosinic:polycytidylic acid (poly I:C) challenge. These results suggest that CiGal3 plays a vital role in the immune system.
1. Introduction The immune system of grass carp has both innate and adaptive components. The innate immune response is the first line of defense against invading pathogens in both invertebrates and vertebrates, playing a crucial role in early recognition and subsequent triggering of proinflammatory responses against invading pathogens (Medzhitov and Janeway, 2000b). During a bacterial infection, the host innate immune system recognizes the pathogen-associated molecular patterns (PAMPs) on the cell surface of potentially pathogenic bacteria using host pattern recognition receptors (PRRs) (Medzhitov and Janeway, 2000a), include Toll-like receptors (TLRs), C-type lectin receptors (CLRs), cytoplasmic proteins Retinoic acid inducible gene (RIG)-1-like receptors, NOD-like receptors (NLRs) (Takeuchi and Akira, 2010), and galectins (Vasta, 2012). Galectins are a family of carbohydrate-binding soluble lectins characterized by a conserved carbohydrate recognition domain (CRD) that specifically recognizes β-galactosides (a carbohydrate structure)
and are nonclassical secretory proteins (Liu et al., 2013). The 15 mammalian galectins identified thus far are subdivided into three groups based on their molecular structure: the prototype containing one CRD (galectin-1, -2, -5, -7, -10, −11, −13, −14, and −15), the tandem-repeat type containing two non-identical CRDs linked by a short peptide (galectin-4, -6, -8, -9, and -12), and the chimera type consisting of an N-terminal Pro- and Gly-rich domain fused to the Cterminal CRD (galectin-3) (Cooper and Barondes, 1999; Hirabayashi and Kasai, 1993). Non-mammalian members of the galectin family are found in birds, amphibians, fish, plants, nematodes, sponges, and fungi (Matsumoto et al., 1998; Zhu et al., 2019a). Similar to other galectin types, galectin-3 also lacks a signal sequence required for secretion, but galectin-3 protein could be released into the extracellular space (Yang et al., 2008). In mammals, galectin-3 has been revealed to be widely expressed in immune cells (activated T cells, B cells, and inflammatory macrophages) (Blaser et al., 1998; Joo et al., 2001) and played important roles in T-cell apoptosis (Fukumori et al., 2003a; Xue et al., 2017a; Yoshii et al., 2002), inflammation (Bertocchi et al., 2008;
∗
Corresponding author. State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, China. ∗∗ Corresponding author. Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, 430072, China. E-mail addresses: [email protected] (L. He), [email protected] (Y. Wang). https://doi.org/10.1016/j.dci.2019.103567 Received 29 September 2019; Received in revised form 6 December 2019; Accepted 6 December 2019 Available online 09 December 2019 0145-305X/ © 2019 Elsevier Ltd. All rights reserved.
Developmental and Comparative Immunology 104 (2020) 103567
D. Zhu, et al.
2.3. Sequence analysis
Kikuchi et al., 2004), and tumor (Fortuna-Costa et al., 2014). In galectin-3 knock-out mice, the number of immune cells was significantly reduced following the infection (Hsu et al., 2000). Most studies on galectin-3 were performed in mammals, whereas the characterization of galectin-3 in teleost was still limited in a few species. Grass carp, the largest consumed freshwater fish in China, has important economic value. However, grass carp is susceptible to grass carp reovirus (GCRV), which causes severe hemorrhagic disease with approximately 85% mortality of fingerling and yearling grass carp in China (Chu et al., 2018, 2019c; Rao and Su, 2015). Therefore, it is necessary to investigate innate immunity defense mechanisms in deeply in order to provide information for long-term development of aquaculture. In the study, a full-length galectin cDNA from grass carp was cloned and characterized. Its expression in normal and conditioned fish was analyzed. Our results will provide the basis and inspiration for further functional research of galectins in grass carp.
The full-length cDNA sequences of CiGal3 were blasted for homology using the Basic Local Alignment Search Tool at the National Center for Biotechnology Information (NCBI) (http://blast.ncbi.nlm. nih.gov/Blast). The nucleotide and predicted amino acid sequences of CiGal3 were analyzed using the Sequence Manipulation Suite (SMS) (http://www.bio-soft.net/sms/). Functional domains of the deduced amino acid sequence were predicted using on line SMART (http:// smart.emblheidelberg.de/) (Letunic et al., 2015). The conserved residues were predicted by InterProScan (http://www.ebi.ac.uk/ interpro/search/sequence-search). Online SignaIP 4.0 Server (http:// www.cbs.dtu.dk/services/SignalP/) was used to predict the signal peptide. The molecular weight (MW) and isoelectric point (pI) of the deduced amino acid sequence were calculated by ExPASy (http://web. expasy.org/compute_pi/). Identity and similarity of CiGal3 with its counterparts from other animals were analyzed by MatGAT (Campanella et al., 2003). The ClustalW 2 (http://www.ebi.ac.uk/ Tools/msa/clustalw2/) tool was involved in performing the multiple sequences alignment. The phylogenetic position of CiGal3 was assessed by reconstructing a phylogenetic tree using MEGA 5.0 program based on neighbor-joining (NJ) method with 1000 bootstraps (Tamura et al., 2011).
2. Materials and methods 2.1. Experimental animals Grass carp (3-month-old; weight, 10 ± 2 g; length, 7 ± 3 cm) were collected at the GuanQiao Experimental Station, Institute of Hydrobiology, Chinese Academic of Sciences, and acclimatized in aerated freshwater at 28 °C for one week. The fishes were fed with a commercial feed (Tong Wei, Chengdu, China) to adapt to the environment until 24 h before the experiments under the same conditions. In the tissue distribution experiment, ten tissue types, including liver, muscle, spleen, gill, intestine (foregut), skin, head kidney, middle kidney, heart, and brain, were collected from 5 random untreated grass carp.
2.4. Immune challenge experiment The GCRV challenge experiment was performed as described previously (Chu et al., 2019a) with some modifications. Briefly, 5 healthy grass carp were intraperitoneally injected with 200 μl PBS (pH 7.4) as the control group while fish of challenging group were injected with an equal volume of GCRV (GD108 strain). The titer of virus was detected by Quantitative real-time PCR (RT-qPCR) and it was 3.12 × 103 copy/ μl (the special primers in Table 1). These injected fish were kept under the same conditions as above mentioned. Five individuals were collected at the indicated times post-infection, including 1, 2, 3, 4, 5, and 6 days post injection (dpi), respectively. The spleen and liver were harvested into TRIzol reagent (Invitrogen) and stored at −80 °C until RNA extraction. The PAMPs challenge experiments were performed as described previously (Zhu et al., 2019d). Grass carp (n = 150) were randomly divided into three groups: control group, LPS, and poly I:C challenge groups. 50 individuals of control group were intraperitoneally injected with 200 μl PBS (pH 7.4) while 50 individuals of each challenge groups were also intraperitoneally injected with an equal volume of LPS (L2880, Sigma, St. Louis, MO, USA, from Escherichia coli 055: B5, 0.5 mg/ml) or 200 μl poly I:C (27472901, GE, 1 mg/ml) dissolved in PBS. These injected fish were kept under the same conditions as above mentioned. At 3, 6, 12, 24, and 48 h post-injection (hpi), 5 individuals from each group were anaesthetized in eugenol anesthesia (final concentration: 100 mg/L). The spleen and liver were harvested into TRIzol
2.2. Full-length cDNA cloning Total RNAs were extracted using TRIzol reagent according to the manufacturer's protocol (Invitrogen, Carlsbad, CA, USA). RNA samples were incubated in RNase-free DNase I (Promega, Wisconsin, USA) to eliminate any contaminating genomic DNA. First-strand cDNA synthesis was performed based on ReverTra Ace kit (Toyobo, Osaka, Japan) using oligo (dT)-adaptor as primer. The reaction was performed at 42 °C for 1 h, and terminated by heating at 95 °C for 5 min. Specific fragments with the coverage of ORF region of were obtained by blasting the galectin-3a sequence of zebrafish (Accession no. XM_699180.9) with the C. idella transcriptional database (Wang et al., 2015). Following, the ORF sequence was amplified using one pair of primers (Table 1), and then specific and adaptor primers (Table 1) were designed to clone the 5ʹ and 3ʹ UTRs using rapid-amplification of cDNA ends (RACE) kit according to the method described previously in our laboratory (Zhu et al., 2019c). Table 1 Primers used in this study. Primers
Sequences (5′—3′)
Purpose
Gal3-5′Rout Gal3-5′Rin Gal3-3′Rout Gal3-3′Rin Gal3-F Gal3-R qGal3-F qGal3-R qβ-actin-F qβ-actin-R pEGFP-Gal3-F pEGFP-Gal3-R
AACCAGGCCATCCAGGATTAGTG AGCTGATGGATTGGTGTGCCTAG ACGGGGTTCATCTGCTGGA GATGTCACTCGTCTGCACATAGAGG ATGGCAGACTTTTCGCTTGC TCAGATCATGCTGGGAGCTGC ACCGGGCGTACCTGGACAGT CCCAGGTGGGCAAGGGAACT TCGGTATGGGACAGAAGGAC GACCAGAGGCATACAGGGAC CTAGCGCTACCGGACTCAGATCTCGAGGTATGGCAGACTTTTCGCTTGC GCTCACCATGGTGGCGATGGATCCGATCATGCTGGGAGCTGC
5′ RACE
2
3′ RACE ORF cloning RT-qPCR
Subcellular localization
Developmental and Comparative Immunology 104 (2020) 103567
D. Zhu, et al.
reagent (Invitrogen) and stored at −80 °C until RNA extraction.
terminal (231–360) CRD and a N-terminal end (https://www. sciencedirect.com/science/article/pii/S1050464818308428?via %3Dihub Fig. 1B), which were also very conserved in other examined vertebrates through the multiple sequence alignment (Fig. 2). Sugar binding motifs (H–N-R, V–N and W–E-R) involved in carbohydrate binding activity were detected in CRD (Fig. 1A; 2). A comparison of homology revealed that the deduced CiGal3 shares 43.4%–95.3% sequence similarity and 33.3%–92.5% sequence identity with galectin-3 of other species, with it being the most similar to that of the Cyprinus carpio (95.3% sequence similarity and 92.5% sequence identity), followed by the Danio rerio (92.7% sequence similarity and 87.1% sequence identity) (Fig. 3). In order to evaluate the evolutionary relationship of CiGal3, a phylogenetic tree was constructed based on amino acid sequences of galectin-3 from different species using the neighbor-joining method with 1000 replications tests (Fig. 4). Phylogenetic analysis showed that CiGal3 was clustered with fish galectin-3s. Moreover, CiGal3 firstly clustered with its counterpart of C. carpio, then grouped together with D. rerio. And all branching nodes were supported by high bootstrap values (Fig. 4).
2.5. Expression analysis of CiGal3 by RT-qPCR RNA extraction and cDNA synthesis were performed as described previously (Chu et al., 2019b). All the samples of RNA were extracted from TRIzol reagent. 2 μg total RNA was used as the template for synthesizing first-strand cDNAs and oligo (dT) primers was used in 20 μl reaction solution. In order to understand the expression profiles of CiGal3 in different tissues and transcriptional regulation of immune challenged animals, RT-qPCR was carried out using iQ™ SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) on a CFX96™ Real Time Detection System (BioRad). A pair of gene-specific primers (Table 1) was used to amplify the CiGal3 fragment. The β-actin (Accession No. M25013.1) was selected as internal control and amplified with its specific primers (Table 1). The RT-qPCR cycling conditions were as follows: 95 °C for 2 min, 40 cycles of 95 °C for 10 s, annealing at 62 °C for 20 s, and 72 °C for 30 s, followed by a Melt Curve was constructed. The relative expression levels were measured using the 2−ΔΔCt method with β-actin as an internal reference (Livak and Schmittgen, 2001).
3.2. The distribution of CiGal3 mRNA in different tissues The RT-qPCR technique was employed to detect the distribution of CiGal3 mRNA transcripts in 10 different tissues with β-actin gene as internal control (Fig. 5). The expression level of CiGal3 in middle kidney was set as 1. CiGal3 mRNA expressions in other tissues were expressed as fold changes relative to expression in the middle kidney. CiGal3 transcripts were detected in all tissues examined, but the relative level of expression varied in different tissues (Fig. 5). The mRNA expression was extremely high in the liver (13.66-fold) followed by the muscle (12.48-fold) and moderate in the heart (5.82-fold), skin (4.65fold), and spleen (4.01-fold). Comparatively, a low level of expression was detected in the head kidney, and middle kidney.
2.6. Subcellular localization Human embryonic kidney 293T (HEK 293T) cells were cultured at High glucose Dulbecco's modified Eagle's medium (DMEM; Hyclone, Logan, UT, USA), with 10% fetal bovine serum (FBS), 100 IU/ml penicillin (Sigma) and 100 mg/ml streptomycin (Sigma) under a humidified condition with 5% CO2 at 37 °C. To study the subcellular localization of CiGal3, the complete ORF sequence of CiGal3 was cloned into pEGFP-N3 vectors (Clontech, Palo Alto, California, USA) using ClonExpress II One Step Cloning Kit (Vazyme Biotech Co., Ltd., Nanjing, China) and produced GFP-tagged expression plasmid (named CiGal3-pEGFP). Sequence of the resulting plasmid was verified by DNA sequencing. HEK 293T cells were seeded into 6-well plates with 1 × 106 cells per well and cultured 24 h. After that, 5 μg of plasmid constructs of CiGal3-pEGFP and pEGFP-N3 (vector control) were respectively transfected into the cells using Lipo 6000™ Transfection Reagent (Beyotime, Shanghai, China). At 24 h posttransfection, the cells were fixed with 4% (v/v) paraformaldehyde, permeabilized with 0.2% Triton X-100, and stained with Hoechst 33342 (Beyotime) (Zhu et al., 2019b). The cells were observed using the UltraVIEW VOX confocal system (PerkinElmer, Fremont, CA, USA) and a 63× oil immersion objective lens.
3.3. CiGal3 expression after GCRV challenge To observe the effect of viral infection on CiGal3 expression in innate immune organs, the CiGal3 transcripts in liver and spleen were detected. As shown in Fig. 6, CiGal3 was significantly up-regulated in liver and spleen after GCRV challenge (P < 0.05) compared to the non-challenge control. In the spleen, CiGal3 transcripts were increased on 1 dpi, then dropped to the basal level on 2 dpi. Afterwards, the expression levels were up-regulated from 3 to 6 dpi and the peak on 4 dpi (Fig. 6A). In the liver, the levels of CiGal3 mRNA were dramatically up-regulated from 2 to 5 dpi and then reached the basal level on 6 dpi (Fig. 6B).
2.7. Statistical analysis
3.4. Changes of CiGal3 transcripts upon PAMPs challenges
All the data were analyzed using the SPSS 16.0 (IBM Corporation, Armonk, NY, USA) and assessed by one-way analysis of variance (ANOVA). All the experiments were repeated at least three times. The significance level was set at p ≤ 0.05 and the extreme significance level was set at p ≤ 0.01.
The temporal expression patterns of CiGal3 in spleen and liver with LPS and poly I:C injection were qualified by RT-qPCR. When grass carp individuals were treated with LPS and poly I:C, the transcript level of CiGal3 in different tissues varied considerably, and the mRNA levels varied with the kind of infectious agent (Fig. 7). In the spleen, the expression patterns of CiGal3 mRNA were very similar after LPS and poly I:C injection, that is, CiGal3 transcripts were increased sharply and reached the peak at 3 hpi, and then declined and dropped to the lowest level at 48 hpi (Fig. 7A). In the liver, CiGal3 transcripts after poly I:C injection exhibited significant up-regulation at 12 hpi, and had no significantly differences at other time points. However, CiGal3 transcripts after LPS injection had no significantly difference with the control group throughout the test period (Fig. 7B).
3. Results 3.1. The molecular features, sequence alignment and phylogeny relationship of CiGal3 The full-length cDNA of the CiGal3 sequence was 2152 bp, containing a 5′-UTR of 242 bp, a 3′-UTR of 821 bp with the putative polyadenylation consensus signal (AATAAA), an ORF of 1089 bp encoding polypeptides of 362 amino acids with a predicted molecular mass of 36.45 kDa and theoretical isoelectric point of 4.91 (https:// www.sciencedirect.com/science/article/pii/S1050464818308428?via %3Dihub Fig. 1A). No signal peptides was found in the sequence of CiGal3. Using online SMART program prediction, CiGal3 contained a C-
3.5. Subcellular localization of CiGal3 To determine the subcellular localization of CiGal3, the eukaryotic 3
Developmental and Comparative Immunology 104 (2020) 103567
D. Zhu, et al.
Fig. 1. (A) Nucleotide and deduced amino acid sequences of CiGal3 are given in the bottom and top lines, respectively. The number indicates the position of the nucleotides and amino acids. Start codon (ATG) and the stop codon (TAA) were boxed. The GLECT/Gal-bind_lectin domain was in dark green. The conserved residues involved in carbohydrate binding activity were boxed. The polyadenylation signal sequence is underlined. (B) The protein domain predicted by SMART program using CiGal3 amino acid sequence. The two pink bands represent low complexity region. The diamond represents Gal-bind_lectin domain. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
to the extracellular space via an endoplasmic reticulum (ER)/Golgi independent pathway (Cha et al., 2015; Hou et al., 2015; Shi et al., 2014)]. Galectin-3 is the only chimera galectin with one CRD connected to the N-terminal end, and the CRD was conserved in vertebrates (Fig. 2). These two functional domains were typical domains in galectin-3 family (Barondes et al., 1994b; Brinchmann et al., 2018; Ho and Springer, 1982; Liu et al., 1985; Rabinovich and Gruppi, 2005). The N-terminal end and the CRD coordinate to induce signaling pathways and involvement in biological processes including T-cell apoptosis (Fukumori et al., 2003b), caspase-9 activation (Xue et al., 2017b). From the multiple sequence alignment with different species, CiGal3 was similar to other galectin-3s, especially the CRD domain. Highly conserved sugar binding pockets (H–N-R, V–N, and W-E-R) located in the concave sheets of CRD (Marchler-Bauer et al., 2015), were responsible for holding carbohydrates (Cooper, 2002a). Moreover, CiGal3 clusters more closely with galectin-3s from fish than mammals, according with their high identities and traditional taxonomy. Based on the structure and evolutional features of CiGal3, we confirm that CiGal3 is a member of galectin subfamily. To provide insight into functions of galectin-3 gene, expression profiles of CiGal3 were determined in healthy grass carp tissues. In this
expression vector of CiGal3-pEGFP was constructed transfected into HEK 293T cells. Meanwhile, empty pEGFP-N3 plasmids were also transfected as the negative control. The subcellular localization of CiGal3-GFP was distributed in the cytoplasm and nucleus, similar to the results of the control group (Fig. 8). 4. Discussion The primary feature of lectin is that it has a specific carbohydraterecognition domain (Gauto et al., 2011; Wang et al., 2012; Zhu et al., 2008)]. Animal lectins are classified according to the peptide sequence of their CRDs, as C-type (Gabius, 1997), S-type (also referred to as galectin) (Jung et al., 2003), I-type (Tateno et al., 2002), P-type (Dahms and Hancock, 2002) and F-type (Anju et al., 2013), amongst others (Ma et al., 2011). Galectins are members of evolutionary conserved lectin family and play important roles in the innate and adaptive immunity of both vertebrates and invertebrates (Barondes et al., 1994a; Cooper, 2002b; Vasta, 2009; Vasta et al., 2004). In the present research, the fulllength cDNA of galectin was cloned from grass carp (named CiGal3). Similar to other identified vertebrates galectins, no classical signal peptides were found in CiGal3 (Fig. 1), indicating it might be secreted 4
Developmental and Comparative Immunology 104 (2020) 103567
D. Zhu, et al.
Fig. 2. Multiple sequences alignment among the galectin-3 of several species containing mammals and fish. The red triangle indicates the critical conserved residues for carbohydrate binding (as H–N-R, V–N and W–E-R). GenBank accession numbers for the protein sequences are as follows. Cyprinus carpio (XP 018946665.1); Salmo salar (XP 014038550.1); Danio rerio (XP 704272.2); Takifugu r ubripe (XP 011613179.1); Oncorhynchus mykiss (XP 021441115.1); Larimichthys crocea (XP 010751985.3); Cynoglossus semilaevis (XP 016891389.1); Sinocyclocheilus anshuiensis (XP 016334677.1); Sinocyclocheilus Rhinocerous (XP 016403382.1); Labeo Rohita (RXN05027.1); Xenopus tropicalis (NP 988986.1); Gallus gallus (NP 001289729.1); Mus musculus (NP 001139425.1); Bos taurus (NP 001095811.1); Homo sapiens (BAA22164.1); Carassius auratus (XP 026133872.1). (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
the kidney, and gills (Kong et al., 2012). Larimichthys crocea galectin-9 was most abundant in liver, moderately expressed in spleen, gill, kidney, head-kidney and intestine (Zhang et al., 2016). However, in Oreochromis niloticus, the higher expression levels of galectin-3 were observed in the kidney, spleen, gill, and skin, and lower transcription in other tissues (Zhu et al., 2019e). Turbot (Scophthalmus maximus L.) galectin-3 was highly expressed in brain, followed by intestine, headkidney and blood (Tian et al., 2018). In mammals, the mucosal
study, CiGal3 was constitutively expressed in different tissues examined, with the highest expression level in liver. The broad tissue expression pattern was also detected in other teleost fish, and most were expressed mainly in the immune-related tissues. In some studies also revealed that galectins highly expressed in liver. In channel catfish, galectin-3a was highly expressed in liver, gill and skin (Zhou et al., 2016). In Korean rose bitterling (Rhodeus uyekii), galectin-9 mRNA was highly expressed in the spleen, intestine, and liver, and moderately in 5
Developmental and Comparative Immunology 104 (2020) 103567
D. Zhu, et al.
Fig. 3. Identity and similarity of CiGal3 with its counterparts from other animals by MatGAT. The percents of identity and similarity are showed in upper and lower triangles, respectively. Fig. 4. Phylogenetic analysis of galectin-3 using neighbor-joining (NJ) method. The confidence in each node was assessed by 1000 bootstraps. GenBank accession numbers for the protein sequences are as follows. Cyprinus carpio (XP 018946665.1); Salmo salar (XP 014038550.1); Danio rerio (XP 704272.2); Takifugu rubripe (XP 011613179.1); Oncorhynchus mykiss (XP 021441115.1); Larimichthys crocea (XP 010751985.3); Cynoglossus semilaevis (XP 016891389.1); Xenopus tropicalis (NP 988986.1); Gallus gallus (NP 001289729.1); Mus musculus (NP 001139425.1); Bos taurus (NP 001095811.1); Homo sapiens (BAA22164.1).
an important role for immune responses in various fish species. As we all known, liver and spleen were important immune organs (Protzer et al., 2012; Rauta et al., 2012; Raz, 2007). To determine whether CiGal3 participates in the immune response to pathogenic microbes, the expression profiles of CiGal3 gene were analyzed in the two tissues following the injection of GCRV, poly I:C and LPS. Notably, the results revealed that CiGal3 was significantly induced by GCRV, LPS and poly I:C injection in the tested tissues. Interestingly, two peaks upregulation of CiGal3 (1 dpi and 3–6 dpi) were found in spleen following the GCRV infection. Galectin-3 has been revealed to be played important roles in cell apoptosis (Fukumori et al., 2003a; Xue et al., 2017a; Yoshii et al., 2002). At the early stage of infection, viruses target key regulatory proteins to escape from apoptosis and this process contributes to viral replication and propagation (Liang et al., 2015). So this could explain why CiGal3 expression in spleen down-regulated once. Similarly, galectin-3 was significantly up-regulated in catfish skin following Flavobacterium columnare, and Aeromonas hydrophila infection (Li et al., 2013; Zhou et al., 2016). The Oreochromis niloticus galectin-3 transcription was up-regulated by Streptococcus agalactiae and A. hydrophila infection in immune-related tissues. In contrast, Scophthalmus maximus L. galectin-3 was significantly down-regulated in intestine following both Gram-negative bacteria Vibrio anguillarum, and Grampositive bacteria Streptococcus iniae immersion challenge (Tian et al., 2018). In addition, in zebrafish, extracellular galectin-3 could reduce the adhesion of infectious hematopoietic necrosis virus by direct interaction with virus envelop on the epithelial cell surface in a carbohydrate-dependent manner (Nita-Lazar et al., 2016). In gastric
Fig. 5. Tissue distribution of CiGal3 in healthy grass carp by RT-qPCR. The G: gill; S: spleen; L: liver; M: muscle; SK: skin; B: brain; I: intestine H: heart; MK: middle kidney and HK: head kidney were harvested from healthy grass carp to extract total RNA for a tissue distribution analysis (n = 5). The β-actin was used as an internal control. The expression level of CiGal3 in middle kidney was set as 1. All data were given in terms of relative mRNA expression as the mean ± SD. Asterisks (*) representative of significant difference (* = p ≤ 0.05, ** = p ≤ 0.01).
epithelium has a high expression of galectin-3 (Lippert et al., 2007). Although there are different in the expression of genes in different species, these highly expressed tissues are considered to be important immune tissues. The extensive distribution of CiGal3 shows that it plays 6
Developmental and Comparative Immunology 104 (2020) 103567
D. Zhu, et al.
Fig. 6. Temporal expression of CiGal3 in spleen (A) and liver (B) after GCRV infection. Expression levels on day 0 was set to 1.0. The β-actin was used as an internal control. All data were given in terms of relative mRNA expression as means ± SD (n = 5). Asterisks (*) representative of significant difference (* = p ≤ 0.05, ** = p ≤ 0.01).
Fig. 7. Expression analysis of CiGal3 in liver (A) and spleen (B) at 3 h, 6 h, 12 h, 24 h, 48 h postinjection with PBS, LPS and poly I:C, respectively. All data were given in terms of relative mRNA expression as the mean ± SD (n = 5). The β-actin was used as an internal control. Asterisks (*) representative of significant difference (* = p ≤ 0.05, ** = p ≤ 0.01).
COOH-terminal end (the last 28 amino acids) of the Gal3 polypeptide is important for nuclear localization (Haudek et al., 2010). The protein shuttles between the cytoplasm and nucleus on the basis of targeting signals that are recognized by importin(s) for nuclear localization and exportin-1 (CRM1) for nuclear export. Indeed, a number of ligands have been reported for Gal3 in the cytoplasm and in the nucleus. In the cytoplasm, for example, Gal3 interacts with the apoptosis repressor Bcl-2 and this interaction may be involved in Gal3's anti-apoptotic activity (Yang et al., 1996). In the nucleus, Gal3 is a required pre-mRNA splicing factor; the protein is incorporated into spliceosomes via its association with the U1 small nuclear ribonucleoprotein (snRNP) complex (Haudek et al., 2009). Thus, Gal3 play important roles in both the cytoplasm and the nucleus. Taken together, a galectin-3 (named CiGal3) from grass carp was identified and characterized. The fluorescence of CiGal3-GFP was distributed in the cytoplasm and nucleus. The CiGal3 transcripts were ubiquitously expressed in all checked tissues and highly expressed in immune tissues. In addition, the expression of CiGal3 in liver and spleen was induced post GCRV, LPS, and poly I:C challenge. All these implied its vital role in immune the system.
Fig. 8. (A) Subcellular localization of CiGal3 proteins in HEK 293T cells. HEK 293T cells were plated in 6-well plates. At 24 h post-transfection, cells were fixed with 4% (v/v) paraformaldehyde, permeabilized with 0.2% Triton X-100. Green fluorescence shows the distribution of GFP or GFP-tagged proteins and blue fluorescence shows the nucleus that was stained by Hoechst 33342 under a 63 × oil immersion objective lens (scale bar, 20 μm). All samples were visualized using a confocal microscope. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Acknowledgments This study was supported by the National Natural Science Foundation of China (grant numbers 31721005 and 31572614). Appendix A. Supplementary data
epithelial cells, galectin-3 was up-regulated following Helicobacter pylori infection (Subhash and Ho, 2016). Galectin-3 null mice demonstrated reduced T cell and macrophage responses to Citrobacter rodentium infection in the gut (Curciarello et al., 2014). These results collectively indicate that CiGal3 is involved in the response of pathogenic microbes. From the results of subcellular localization, CiGal3-GFP was distributed in the cytoplasm and nucleus. A large number of observations on the nuclear versus cytoplasmic distribution of Gal3 have been reported (Askew et al., 1993; Dumic et al., 2000; Joo et al., 2001). More experiments have provided at least some general agreement that the
Supplementary data to this article can be found online at https:// doi.org/10.1016/j.dci.2019.103567. References Anju, A., Jeswin, J., Thomas, P.C., Vijayan, K.K., 2013. Molecular cloning, characterization and expression analysis of F-type lectin from pearl oyster Pinctada fucata. Fish Shellfish Immunol. 35, 170–174. Askew, D., Burger, C.J., Elgert, K.D., 1993. Tumor growth and adherence change the
7
Developmental and Comparative Immunology 104 (2020) 103567
D. Zhu, et al.
Kikuchi, Y., Kobayashi, S., Hemmi, N., Ikee, R., Hyodo, N., Saigusa, T., Namikoshi, T., Yamada, M., Suzuki, S., Miura, S., 2004. Galectin-3-positive cell infiltration in human diabetic nephropathy. Nephrol. Dial. Transplant. 19, 602–607. Kong, H.J., Kim, W.-J., Kim, H.S., Lee, Y.J., Kim, C.H., Nam, B.-H., Kim, Y.-O., Kim, D.-G., Lee, S.-J., Lim, S.-G., Kim, B.-S., 2012. Molecular characterization of a tandem-repeat galectin-9 (RuGlec9) from Korean rose bitterling (Rhodeus uyekii). Fish Shellfish Immunol. 32, 939–944. Letunic, I., Doerks, T., Bork, P., 2015. SMART: recent updates, new developments and status in 2015. Nucleic Acids Res. 43, D257–D260. Li, C., Wang, R., Su, B., Luo, Y., Terhune, J., Beck, B., Peatman, E., 2013. Evasion of mucosal defenses during Aeromonas hydrophila infection of channel catfish (Ictalurus punctatus) skin. Dev. Comp. Immunol. 39, 447–455. Liang, C., Oh, B.H., Jung, J.U., 2015. Novel functions of viral anti-apoptotic factors. Nat. Rev. Microbiol. 13, 7–12. Lippert, E., Falk, W., Bataille, F., Kaehne, T., Naumann, M., Goeke, M., Herfarth, H., Schoelmerich, J., Rogler, G., 2007. Soluble galectin-3 is a strong, colonic epithelialcell-derived, lamina propria fibroblast-stimulating factor. Gut 56, 43–51. Liu, F.T., Albrandt, K., Mendel, E., Kulczycki, A., Orida, N.K., 1985. Identification of an ige-binding protein by molecular-cloning. Proc. Natl. Acad. Sci. U.S.A. 82, 4100–4104. Liu, L.H., He, H.J., Lv, Z.Y., Wei, J., Zeng, X., Liang, J.Y., Zheng, H.Q., Yu, X.B., Sun, X., Wu, Z.D., 2013. The mRNA level of the galectin-10 of Angiostrongylus cantonensis induced by reactive oxygen stress. Parasitol. Res. 112, 933–943. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25, 402–408. Ma, Y.J., Doni, A., Skjoedt, M.O., Honore, C., Arendrup, M., Mantovani, A., Garred, P., 2011. Heterocomplexes of mannose-binding lectin and the pentraxins PTX3 or serum amyloid P component trigger cross-activation of the complement system. J. Biol. Chem. 286, 3405–3417. Marchler-Bauer, A., Derbyshire, M.K., Gonzales, N.R., Lu, S.N., Chitsaz, F., Geer, L.Y., Geer, R.C., He, J., Gwadz, M., Hurwitz, D.I., Lanczycki, C.J., Lu, F., Marchler, G.H., Song, J.S., Thanki, N., Wang, Z.X., Yamashita, R.A., Zhang, D.C., Zheng, C.J., Bryant, S.H., 2015. CDD: NCBI's conserved domain database. Nucleic Acids Res. 43, D222–D226. Matsumoto, R., Matsumoto, H., Seki, M., Hata, M., Asano, Y., Kanegasaki, S., Stevens, R.L., Hirashima, M., 1998. Human ecalectin, a variant of human galectin-9, is a novel eosinophil chemoattractant produced by T lymphocytes. J. Biol. Chem. 273, 16976–16984. Medzhitov, R., Janeway, C., 2000a. Innate immune recognition: mechanisms and pathways. Immunol. Rev. 173, 89–97. Medzhitov, R., Janeway, C.J., 2000b. Advances in immunology: innate immunity. N. Engl. J. Med. 343, 338–344. Nita-Lazar, M., Mancini, J., Feng, C.G., Gonzalez-Montalban, N., Ravindran, C., Jackson, S., de las Heras-Sanchez, A., Giomarelli, B., Ahmed, H., Haslam, S.M., Wu, G., Dell, A., Ammayappan, A., Vakharia, V.N., Vasta, G.R., 2016. The zebrafish galectins Drgal1-L2 and Drgal3-L1 bind in vitro to the infectious hematopoietic necrosis virus (IHNV) glycoprotein and reduce viral adhesion to fish epithelial cells. Dev. Comp. Immunol. 55, 241–252. Protzer, U., Maini, M.K., Knolle, P.A., 2012. Living in the liver: hepatic infections. Nat. Rev. Immunol. 12, 201–213. Rabinovich, G.A., Gruppi, A., 2005. Galectins as immunoregulators during infectious processes: from microbial invasion to the resolution of the disease. Parasite Immunol. 27, 103–114. Rao, Y., Su, J., 2015. Insights into the antiviral immunity against grass carp (Ctenopharyngodon idella) reovirus (GCRV) in grass carp. Journal of immunology research 2015 670437. Rauta, P.R., Nayak, B., Das, S., 2012. Immune system and immune responses in fish and their role in comparative immunity study: a model for higher organisms. Immunol. Lett. 148, 23–33. Raz, E., 2007. Organ-specific regulation of innate immunity. Nat. Immunol. 8, 3–4. Shi, X.Z., Wang, L., Xu, S., Zhang, X.W., Zhao, X.F., Vasta, G.R., Wang, J.X., 2014. A galectin from the kuruma shrimp (Marsupenaeus japonicus) functions as an opsonin and promotes bacterial clearance from hemolymph. PLoS One 9. Subhash, V.V., Ho, B., 2016. Galectin 3 acts as an enhancer of survival responses in Hpylori-infected gastric cancer cells. Cell Biol. Toxicol. 32, 23–35. Takeuchi, O., Akira, S., 2010. Pattern recognition receptors and inflammation. Cell 140, 805–820. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Tateno, H., Yamaguchi, T., Ogawa, T., Muramoto, K., Watanabe, T., Kamiya, H., Saneyoshi, M., 2002. Immunohistochemical localization of rhamnose-binding lectins in the steelhead trout (Oncorhynchus mykiss). Dev. Comp. Immunol. 26, 543–550. Tian, M., Yang, N., Zhang, L., Fu, Q., Tan, F., Li, C., 2018. Expression profiling and functional characterization of galectin-3 of turbot (Scophthalmus maximus L.) in host mucosal immunity. Fish Shellfish Immunol. 84, 333–340. Vasta, G.R., 2009. Roles of galectins in infection. Nat. Rev. Microbiol. 7, 424–438. Vasta, G.R., 2012. Galectins as pattern recognition receptors: structure, function, and evolution. Adv. Exp. Med. Biol. 946, 21–36. Vasta, G.R., Ahmed, H., Odom, E.W., 2004. Structural and functional diversity of lectin repertoires in invertebrates, protochordates and ectothermic vertebrates. Curr. Opin. Struct. Biol. 14, 617–630. Wang, L., Wang, L., Yang, J., Zhang, H., Huang, M., Kong, P., Zhou, Z., Song, L., 2012. A multi-CRD C-type lectin with broad recognition spectrum and cellular adhesion from Argopectenirradians. Dev. Comp. Immunol. 36, 591–601. Wang, Y., Lu, Y., Zhang, Y., Ning, Z., Li, Y., Zhao, Q., Lu, H., Huang, R., Xia, X., Feng, Q.,
expression of macrophage Mac-2. Cancer Lett. 69, 67–74. Barondes, S.H., Castronovo, V., Cooper, D.N.W., Cummings, R.D., Drickamer, K., Felzi, T., Gitt, M.A., Hirabayashi, J., Hughes, C., Kasai, K.-i., Leffler, H., Liu, F.-T., Lotan, R., Mercurio, A.M., Monsigny, M., Pillai, S., Poirer, F., Raz, A., Rigby, P.W.J., Rini, J.M., Wang, J.L., 1994a. Galectins: a family of animal β-galactoside-binding lectins. Cell 76, 597–598. Barondes, S.H., Cooper, D.N.W., Gitt, M.A., Leffler, H., 1994b. Galectins - structure and function of a large family of animal lectins. J. Biol. Chem. 269, 20807–20810. Bertocchi, A.P.F., Campanhole, G., Wang, P.H.M., Goncalves, G.M., Damiao, M.J., Cenedeze, M.A., Beraldo, F.C., Teixeira, V.D.A., dos Reis, M.A., Mazzali, M., PachecoSilva, A., Camara, N.O.S., 2008. A Role for galectin-3 in renal tissue damage triggered by ischemia and reperfusion injury. Transpl. Int. 21, 999–1007. Blaser, C., Kaufmann, M., Muller, C., Zimmermann, C., Wells, V., Mallucci, L., Pircher, H., 1998. Beta-galactoside-binding protein secreted by activated T cells inhibits antigeninduced proliferation of T cells. Eur. J. Immunol. 28, 2311–2319. Brinchmann, M.F., Patel, D.M., Iversen, M.H., 2018. The role of galectins as modulators of metabolism and inflammation. Mediat. Inflamm. 2018 9186940-9186940. Campanella, J.J., Bitincka, L., Smalley, J., 2003. MatGAT: an application that generates similarity/identity matrices using protein or DNA sequences. BMC Bioinf. 4. Cha, G.H., Liu, Y., Peng, T., Huang, M.Z., Xie, C.Y., Xiao, Y.C., Wang, W.N., 2015. Molecular cloning, expression of a galectin gene in Pacific white shrimp Litopenaeus vannamei and the antibacterial activity of its recombinant protein. Mol. Immunol. 67, 325–340. Chu, P., He, L., Li, Y., Huang, R., Liao, L., Li, Y., Zhu, Z., Wang, Y., 2018. Molecular cloning and functional characterisation of NLRX1 in grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 81, 276–283. Chu, P., He, L., Yang, C., Zeng, W., Huang, R., Liao, L., Li, Y., Zhu, Z., Wang, Y., 2019a. Grass carp ATG5 and ATG12 promote autophagy but down-regulate the transcriptional expression levels of IFN-I signaling pathway. Fish Shellfish Immunol. 92, 600–611. Chu, P., He, L., Zhu, D., Huang, R., Liao, L., Li, Y., Zhu, Z., Wang, Y., 2019b. Identification, expression and functional characterisation of CYP1A in grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 95, 35–43. Chu, P.F., He, L.B., Yang, C., Li, Y.Y., Huang, R., Liao, L.J., Li, Y.M., Zhu, Z.Y., Wang, Y.P., 2019c. Characterisation and function of TRIM23 in grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 88, 627–635. Cooper, D.N., 2002a. Galectinomics: finding themes in complexity. Biochim. Biophys. Acta 1572, 209–231. Cooper, D.N.W., 2002b. Galectinomics: finding themes in complexity. Bba-Gen Subjects 1572, 209–231. Cooper, D.N.W., Barondes, S.H., 1999. God must love galectins; He made so many of them. Glycobiology 9, 979–984. Curciarello, R., Steele, A., Cooper, D., MacDonald, T.T., Kruidenier, L., Kudo, T., 2014. The role of galectin-1 and galectin-3 in the mucosal immune response to Citrobacter rodentium infection. PLoS One 9. Dahms, N., Hancock, M.K., 2002. P-type lectins. Biochim. Biophys. Acta 1572, 317–340. Dumic, J., Lauc, G., Hadzija, M., Flogel, M., 2000. Transfer to in vitro conditions influences expression and intracellular distribution of galectin-3 in murine peritoneal macrophages. Zeitschrift fur Naturforschung. C, Journal of biosciences 55, 261–266. Fortuna-Costa, A., Gomes, A.M., Kozlowski, E.O., Stelling, M.P., Pavao, M.S., 2014. Extracellular galectin-3 in tumor progression and metastasis. Frontiers in oncology 4, 138. Fukumori, T., Takenaka, Y., Yoshii, T., Kim, H.R., Hogan, V., Inohara, H., Kagawa, S., Raz, A., 2003a. CD29 and CD7 mediate galectin-3-induced type II T-cell apoptosis. Cancer Res. 63, 8302–8311. Fukumori, T., Takenaka, Y., Yoshii, T., Kim, H.R.C., Hogan, V., Inohara, H., Kagawa, S., Raz, A., 2003b. CD29 and CD7 mediate galectin-3-induced type II T-cell apoptosis. Cancer Res. 63, 8302–8311. Gabius, H.J., 1997. Animal lectins. Eur. J. Biochem. 243, 543–576. Gauto, D.F., Di Lella, S., Estrin, D.A., Monaco, H.L., Marti, M.A., 2011. Structural basis for ligand recognition in a mushroom lectin: solvent structure as specificity predictor. Carbohydr. Res. 346, 939–948. Haudek, K.C., Spronk, K.J., Voss, P.G., Patterson, R.J., Wang, J.L., Arnoys, E.J., 2010. Dynamics of galectin-3 in the nucleus and cytoplasm. Biochim. Biophys. Acta 1800, 181–189. Haudek, K.C., Voss, P.G., Locascio, L.E., Wang, J.L., Patterson, R.J., 2009. A mechanism for incorporation of galectin-3 into the spliceosome through its association with U1 snRNP. Biochemistry 48, 7705–7712. Hirabayashi, J., Kasai, K., 1993. The family of metazoan metal-independent beta-galactoside-binding lectins: structure, function and molecular evolution. Glycobiology 3, 297–304. Ho, M.K., Springer, T.A., 1982. Mac-2, a novel 32,000 Mr mouse macrophage subpopulation-specific antigen defined by monoclonal-antibodies. J. Immunol. 128, 1221–1228. Hou, F.J., Liu, Y.J., He, S.L., Wang, X.Z., Mao, A.T., Liu, Z.G., Sun, C.B., Liu, X.L., 2015. A galectin from shrimp Litopenaeus vannamei is involved in immune recognition and bacteria phagocytosis. Fish Shellfish Immunol. 44, 584–591. Hsu, D.K., Yang, R.Y., Pan, Z., Yu, L., Salomon, D.R., Fung-Leung, W.P., Liu, F.T., 2000. Targeted disruption of the galectin-3 gene results in attenuated peritoneal inflammatory responses. Am. J. Pathol. 156, 1073–1083. Joo, H.G., Goedegebuure, P.S., Sadanaga, N., Nagoshi, M., von Bernstorff, W., Eberlein, T.J., 2001. Expression and function of galectin-3, a beta-galactoside-binding protein in activated T lymphocytes. J. Leukoc. Biol. 69, 555–564. Jung, W.K., Park, P.J., Kim, S.K., 2003. Purification and characterization of a new lectin from the hard roe of skipjack tuna, Katsuwonus pelamis. Int. J. Biochem. Cell Biol. 35, 255–265.
8
Developmental and Comparative Immunology 104 (2020) 103567
D. Zhu, et al.
Galectins in channel catfish, Ictalurus punctatus: characterization and expression profiling in mucosal tissues. Fish Shellfish Immunol. 49, 324–335. Zhu, D., Fu, P., Huang, R., Xiong, L., Wang, Y., He, L., Liao, L., Li, Y., Zhu, Z., Wang, Y., 2019a. Molecular characterization, tissue distribution and functional analysis of galectin 1-like 2 in grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 94, 455–463. Zhu, D., Huang, R., Fu, P., Chen, L., Luo, L., Chu, P., He, L., Li, Y., Liao, L., Zhu, Z., Wang, Y., 2019b. Investigating the role of BATF3 in grass carp (Ctenopharyngodon idella) immune modulation: a fundamental functional analysis. Int. J. Mol. Sci. 20, 1687. Zhu, D., Huang, R., Yang, C., Fu, P., Chen, L., Jiang, Y., He, L., Li, Y., Liao, L., Zhu, Z., Wang, Y., 2019c. Identification and Molecular Characterization of Peroxiredoxin 2 in Grass Carp (Ctenopharyngodon Idella). Fish & shellfish immunology. Zhu, D., Li, Y., Huang, R., Luo, L., Chen, L., Fu, P., He, L., Li, Y., Liao, L., Zhu, Z., Wang, Y., 2019d. Molecular Characterization and Functional Activity of Prx 1 in Grass Carp (Ctenopharyngodon Idella). Fish & shellfish immunology. Zhu, J., Wei, M., wang, Q., Ao, Q., Tan, Y., Luo, Y., Wang, H., Jiang, H., Hu, Q., 2019e. Characterization and expression of galectin-3 after Streptococcus agalactiae and Aeromonas hydrophila challenge in GIFT strain Nile tilapia (Oreochromis niloticus). Fish Shellfish Immunol. 86, 974–980. Zhu, L., Song, L.S., Xu, W., Qian, P.Y., 2008. Molecular cloning and immune responsive expression of a novel C-type lectin gene from bay scallop Argopecten irradians. Fish Shellfish Immunol. 25, 231–238.
Liang, X., Liu, K., Zhang, L., Lu, T., Huang, T., Fan, D., Weng, Q., Zhu, C., Lu, Y., Li, W., Wen, Z., Zhou, C., Tian, Q., Kang, X., Shi, M., Zhang, W., Jang, S., Du, F., He, S., Liao, L., Li, Y., Gui, B., He, H., Ning, Z., Yang, C., He, L., Luo, L., Yang, R., Luo, Q., Liu, X., Li, S., Huang, W., Xiao, L., Lin, H., Han, B., Zhu, Z., 2015. The draft genome of the grass carp (Ctenopharyngodon idellus) provides insights into its evolution and vegetarian adaptation. Nat. Genet. 47, 625–631. Xue, H., Liu, L., Zhao, Z., Zhang, Z., Guan, Y., Cheng, H., Zhou, Y., Tai, G., 2017a. The Nterminal tail coordinates with carbohydrate recognition domain to mediate galectin-3 induced apoptosis in T cells. Oncotarget 8, 49824–49838. Xue, H.T., Liu, L., Zhao, Z.H., Zhang, Z.Y., Guan, Y., Cheng, H.R., Zhou, Y.F., Tai, G.H., 2017b. The N-terminal tail coordinates with carbohydrate recognition domain to mediate galectin-3 induced apoptosis in T cells. Oncotarget 8, 49824–49838. Yang, R.Y., Hsu, D.K., Liu, F.T., 1996. Expression of galectin-3 modulates T-cell growth and apoptosis. Proc. Natl. Acad. Sci. U.S.A. 93, 6737–6742. Yang, R.Y., Rabinovich, G.A., Liu, F.T., 2008. Galectins: structure, function and therapeutic potential. Expert Rev. Mol. Med. 10, e17. Yoshii, T., Fukumori, T., Honjo, Y., Inohara, H., Kim, H.R.C., Raz, A., 2002. Galectin-3 phosphorylation is required for its anti-apoptotic function and cell cycle arrest. J. Biol. Chem. 277, 6852–6857. Zhang, D.L., Lv, C.H., Yu, D.H., Wang, Z.Y., 2016. Characterization and functional analysis of a tandem-repeat galectin-9 in large yellow croaker Larimichthys crocea. Fish Shellfish Immunol. 52, 167–178. Zhou, S., Zhao, H., Thongda, W., Zhang, D., Su, B., Yu, D., Peatman, E., Li, C., 2016.
9