- Email: [email protected]
Comparative expression and regulation of duplicated fibroblast growth factor 1 genes in grass carp (Ctenopharyngodon idella)
General and Comparative Endocrinology 240 (2017) 61–68
Contents lists available at ScienceDirect
General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen
Research paper
Comparative expression and regulation of duplicated fibroblast growth factor 1 genes in grass carp (Ctenopharyngodon idella) Dan-Dan Guo, Wen-Zhi Guan, Yi-Wen Sun, Jie Chen, Xia-Yun Jiang ⇑, Shu-Ming Zou ⇑ Key Laboratory of Freshwater Aquatic Genetic Resources, Shanghai Ocean University, Huchenghuan Road 999, Shanghai 201306, China
a r t i c l e
i n f o
Article history: Received 11 April 2016 Revised 18 September 2016 Accepted 23 September 2016 Available online 24 September 2016 Keywords: Ctenopharyngodon idella Fibroblast growth factor 1 Gene duplication Expression Nutritional status
a b s t r a c t Fibroblast growth factor 1 (Fgf1) is known as a mitogenic factor involved in the regulation of cell growth, proliferation, and differentiation in vertebrates. Here, we report the isolation and characterization of two fgf1 genes in grass carp (Ctenopharyngodon idella). Grass carp fgf1a and fgf1b cDNAs are highly divergent, sharing a relatively low amino acid sequence identity of 50%, probably due to fish-specific gene duplication. fgf1a and fgf1b mRNAs were detected in the zygote and expressed throughout embryogenesis. Both fgf1a and fgf1b mRNAs were primarily detectable in the notochord at 12 hpf. At 24 hpf, fgf1a mRNA was mainly expressed in the gut and somites, while fgf1b transcript persisted in the notochord and was detected in the tailbud. At 36 hpf, both fgf1a and fgf1b transcripts were detected in the brain, somites, and tailbud. In addition, the fgf1a mRNA was detected at the base of the yolk sac, whereas the fgf1b mRNA was expressed in the pectoral fin. In adult fish, duplicated fgf1a and fgf1b mRNAs were distributed in most tissues. After 2–6 days of starvation, both fgf1a and fgf1b mRNAs were upregulated in the muscle and liver. In the brain, fgf1a mRNA was upregulated, while fgf1b mRNA was significantly downregulated at 6 days. Furthermore, both fgf1a and fgf1b mRNA levels were significantly decreased in the brain and muscle after administration of 10 or 50 lg of the human growth hormone (hGH),while their mRNA levels were no significant difference in the liver. These results suggest that duplicated fgf1s may play important but divergent roles in the grass carp development. Ó 2016 Elsevier Inc. All rights reserved.
1. Introduction Fibroblast growth factors (FGFs), including 23 related polypeptides that combine with fibroblast growth factor receptors (FGFRs) (Haugsten et al., 2005; Partanen et al., 1992), are mitogenic factors involved in regulating cell growth, proliferation, and differentiation (Billottet et al., 2008; Ornitz and Itoh, 2001; Philippe et al., 1996). FGFs are composed of 150–200 peptides, and they have 50–70% amino acid identity with respect to their FGF domains (Han et al., 2009). Binding of FGFs to FGFRs is stabilized by heparan sulfate proteoglycans (HSPGs) and results in a dimer receptor– ligand complex that activates the intracellular tyrosine kinase domain by autophosphorylation, which triggers complex signal transduction in mammalian cells, such as the protein kinase C pathway, PI3K pathway, and Ras/ERK pathway (Dorey and Amaya, 2010). FGF1/FGFR1 signaling is involved in multiple signal regulation, including energy metabolism and growth in mammals (Kim ⇑ Corresponding authors. E-mail addresses: [email protected] (X.-Y. Jiang), [email protected] (S.-M. Zou). http://dx.doi.org/10.1016/j.ygcen.2016.09.014 0016-6480/Ó 2016 Elsevier Inc. All rights reserved.
et al., 2002; Lim et al., 2006). FGF1 is expressed in adipose tissues under the control of PPARc, and it plays an essential physiological role in maintaining adipose tissue plasticity during feeding–fasting cycles (Fernandes-Freitas and Owen, 2015). Additionally, FGF1 plays critical roles in metabolic homeostasis, which restores blood glucose levels and insulin sensitivity in mice (Jonker et al., 2012). During fasting, enhanced expression of FGF21 inhibited growth hormone (GH) signaling and impacted chondrocyte functions (Inagaki et al., 2008). These functions of FGF21 in mice tissue were governed by FGF1 receptor signaling (Adams et al., 2012). However, there is limited information on whether starvation regulates FGF1 and has an effect on growth in teleost fish. Mammals and Xenopus have single copies of the fgf1 gene; however, teleosts may have duplicate fgf1 genes, which is believed to be due to an additional genome-wide duplication event (Taylor et al., 2003). Two fgf1 genes have been identified in the zebrafish genome, with fgf1a on chromosome 14 and fgf1b on chromosome 21. During embryogenesis, fgf1a expression in zebrafish is the strongest in somites at 28 hpf, and fgf1a is required for normal differentiation of erythrocytes during primitive hematopoiesis (Songhet et al., 2007). In common carp, in situ hybridization was used to show that fgf1a was expressed specifically in developing
62
D.-D. Guo et al. / General and Comparative Endocrinology 240 (2017) 61–68
scale tissues, and it was also observed in the tissues of the tail and dorsal or ventral fins (Ma et al., 2014). These findings reveal the vital roles of fgf1a in earlier fish embryo development. However, to the best of our knowledge, there is no information on functions and expression patterns of duplicate fgf1 genes in teleosts. The grass carp, Ctenopharyngodon idellus, is an important species for freshwater aquaculture in China, with the highest output in fish farming worldwide; its production accounts for 15.6% of global freshwater aquaculture (FAO, 2011). In 2013, total production of grass carp was reportedly around 5 million tons (FBMA, 2013). Fish growth is an integrated process that depends, for the most part, on nutrient availability as well as GH (Cao et al., 2014; MacDonald and Webber, 1995). Fasted fish reduce energy storage and display a decrease in the growth rate (Cao et al., 2014). In this study, duplicated fgf1 cDNAs were cloned from the grass carp, and their expression patterns were examined in adult tissues and different embryo stages during embryogenesis. In addition, effects of fasting and human growth hormone (hGH) treatments on the mRNA expressions of fgf1a and fgf1b were investigated in juvenile grass carp.
2. Materials and methods 2.1. Experimental fish All experimental materials, including embryos and adult grass carp, were obtained from the Qingpu Fish Breeding Experiment Station, Shanghai, China. Embryos were obtained using artificial insemination. Fertilized eggs (200) were plated in petri dishes (10 cm in diameter). Embryo development occurred at room temperature (22 °C). Every 4 h after fertilization (0–40 hpf), the embryos were stored by immersion in RNA Store (Tiangen, Shanghai, China) and maintained at 4 °C overnight and then at 80 °C until use. Water in the petri dishes was replaced every 2–3 h with well-aerated water to maintain normal dissolved oxygen (DO) levels during embryogenesis. Embryos at different developmental stages were collected and fixed as reported previously for in situ hybridization (Jiang et al., 2012). Tissues from adult grass carp, namely, brain, muscle, liver, eyes, heart, gill, spleen, kidney, intestine, and skin, were rapidly dissected, frozen in liquid nitrogen, and stored at 80 °C until use. All experiments were conducted according to the guidelines approved by the Shanghai Ocean University Committee on the Use and Care of Animals. 2.2. Fasting and hGH treatments For the fasting treatment, 36 juvenile grass carp (20 g each) were cultured in two 150-L indoor tanks within a continuous flow system. After 1 week of acclimation, a total of 6 fish (3 per tank) were collected on day 0, 2, 4, and 6 during fasting treatment and on day 3 and 6 during re-feeding treatment. Six fish in a feeding control tank were collected simultaneously with the fasted or re-fed group at every sampling time. hGH treatment was performed according to a published method (Yuan et al., 2011). Nine juveniles were cultured in three 150-L indoor tanks. After 3 days without feeding, 3 fish from each tank were anesthetized using MS222 and administered an intraperitoneal injection of phosphate-buffered saline (PBS, control) or 10 or 50 lg of recombinant hGH (Shanghai United Cell Biotechnology Company, China) per gram body weight at a volume of 100 lL. Each experiment was performed in triplicate. After 12 h, a total of 9 fish were sampled for each experimental treatment. Brain, liver, and muscle were immediately excised, frozen in liquid nitrogen, and stored at 80 °C until use.
2.3. Molecular cloning of grass carp fgf1a and fgf1b cDNAs Total RNA was isolated from grass carp embryos at 40 hpf by using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and subsequently treated with DNase (Promega, Madison, WI, USA) to remove contaminant genomic DNA. First-strand cDNA was reverse-transcribed from the total RNA by using reverse transcriptase M-MLV (TaKaRa, Japan), according to the manufacturer’s instructions. PCR was performed to amplify partial cDNA fragments of fgf1a and fgf1b. The primer pairs were fgf1a-PS-F/-R and fgf1b-PS-F/-R (Table 1), designed using conserved regions of known sequences of zebrafish (GenBank Accession No. NP_957054.1 for fgf1a and NP_001098748.1 for fgf1b) and common carp (BAQ36072.1 for fgf1a and BAQ36073.1 for fgf1b). PCR fragments (185 bp for fgf1a and 306 bp for fgf1b) were cloned, sequenced, and used to design nested gene-specific primers for 30 RACE analysis (fgf1a-3RACE-O and fgf1a-3RACE-I; fgf1b-3RACE-O and fgf1b-3RACE-I) and 50 RACE analysis (fgf1a-5RACE-O and fgf1a-5RACE-I; fgf1b-5RACE-O and fgf1b-5RACE-I) (Table 1). The 50 and 30 ends of fgf1a and fgf1b mRNAs were amplified using the SMART RACE cDNA amplification kit (Clontech, CA, USA), according to the manufacturer’s protocol. PCR products were gel-purified, ligated into the T/A cloning vector pMD-19T (TaKaRa, Dalian, China), and transformed into Escherichia coli DH5a competent cells. Positive clones were examined using PCR and direct sequencing.
2.4. Sequence and phylogenetic analyses Nucleotide sequences of fgf1a and fgf1b were analyzed using BioEdit 7.0.0.1 (Jeon et al., 2014). Sequences of Fgf1a and Fgf1b proteins from different species were compared using the National Center for Biotechnology Information BLASTP search program. Alignment of putative amino acid sequences of the Fgf1a and Fgf1b proteins was performed with the Clustal X 1.83 program (Thompson et al., 1997). Phylogenetic analysis was performed using coding sequences with the neighbor-joining method in MEGA 5.05 (Tamura et al., 2011). Gap sites in the alignment were used for the phylogenetic reconstruction, and reliability of the estimated tree was evaluated using the bootstrap method with 1000 pseudo-replications.
Table 1 Primer sequences used in this study. Primer name
Primer sequence (50 –30 )
fgf1a-PS-F fgf1a-PS-R fgf1b-PS-F fgf1b-PS-R fgf1a-5RACE-O fgf1a-5RACE-I fgf1a-3RACE-O fgf1a-3RACE-I fgf1b-5RACE-O fgf1b-5RACE-I fgf1b-3RACE-O fgf1b-3RACE-I fgf1a-qRT-F fgf1a-qRT-R fgf1b-qRT-F fgf1b-qRT-R b-actin-qRT-F b-actin-qRT-R fgf1a-P-F fgf1a-P-R fgf1b-P-F fgf1b-P-R
AATGGAGGATTTCACCTTCAGA TCCATCTTCTCCAGGAAATAAC CAACCTAACGGGACTGTGGA GCCCTTGTGTGTTTTGGAGC TCTGTTCCTTCAATGACCACCA ATGCGCAGTATGCTGTAGATGTTC TGGTGGTCATTGAAGGAACAGA CGTCAGCATTAGTAACGGATGATAGT CCACATTTATCCATTGCCAGG ACCTTCAAAAGAGTGTAAACGTCG ACCTGGCAATGGATAAATGTGG CACATCCCGTTCACAGAGGTATC TTTCAAACAGCTCAGAATAGAT GGTAAAGTCCTGCCTCTGTTCC TTCACAGGGGTGTTCACGC ACAGTCCCGTTGGGTTGG TGCCATGTATGTGGCCATCC TCTTTCGGCTGTGGTGGTGA GCAGTGAAATTCAACCCGCC TCACACCATGTCATAGAAGCGTTTT TTCACACTGCTACCGACGAC AAAAAAGTTCTTTACATTCACCTG
D.-D. Guo et al. / General and Comparative Endocrinology 240 (2017) 61–68
2.5. Quantitative real-time (qRT)-PCR Total RNA was isolated from the brain, liver, and muscle of juvenile grass carp by using TRIzol reagent (Invitrogen, USA). After DNase treatment, 500 ng of total RNA was reverse-transcribed to single-strand cDNA by using the Prime Script RT reagent kit (TaKaRa, Japan), according to the manufacturer’s instructions. The stable housekeeping gene b-actin was used as the control. qRT-PCR was performed using the CFX96 TouchTM real-time PCR Detection System (BioRad, USA) and SYBR Green Premix Ex Taq (TaKaRa, Japan). The program for qRT-PCR was 95 °C for 30 s and 40 cycles of amplification at 95 °C for 5 s, 59.5 °C for 20 s, and 72 °C for 15 s. Each experiment was performed in triplicate. Primer pairs were fgf1a-qRT-F/-R, fgf1b-qRT-F/-R, and b-actin-qRT-F/-R (Table 1). The amplification efficiency (E) of each primer pair was calculated based on the slope of a linear regression from a dilution series of cDNA. Relative expression analyses were used the comparative threshold cycle (CT) method and employing the formula 2DDCT with DCT = CT (target gene)-CT (reference gene) with DDCT = DCT(treated gene)-DCT (control) using b-actin as reference genes (Livak and Schmittgen, 2001). The results of qRT-PCR were expressed as the normalized fold expression ± the standard error value. Statistical significance for expression of each gene in different tissues/embryo at different stage was analyzed using one-way analysis of variance (ANOVA) followed by Fisher’s post-hoc tests, and t-test was analyzed for gene expressions during nutritional treatment/GH treatment.
63
(DIG)-labeled RNA riboprobes was performed as reported previously, with modifications (Thisse and Thisse, 2008; Zou et al., 2009). Embryos were photographed using a Nikon SMZ1500 fluorescence microscope (Tokyo, Japan). 3. Results 3.1. Identification of fgf1a and fgf1b cDNAs in grass carp Two full-length cDNAs of fgf1a and fgf1b were identified in grass carp by performing 30 and 50 RACE. fgf1a (GenBank Accession No. KU863004) is 709 bp in length and has a 63-bp 50 -untranslated region (50 -UTR), a 444-bp open reading frame (ORF) that encodes 147 amino acids (Fig. 1), and a 202-bp 30 -UTR with a poly-A signal sequence. fgf1b (GenBank Accession No. KU863005) is 987 bp in length, and consists of a 92-bp 50 -UTR, a 477-bp ORF that encodes 158 amino acids (Fig. 1), and a 418-bp 30 -UTR with a poly-A signal sequence. Both putative Fgf1a and Fgf1b proteins lack a classic signal peptide. Similar to their human orthologs, grass carp Fgf1a and Fgf1b peptides contain a 121-amino acid and 124-amino acid FGF domain, respectively (Fig. 1). Grass carp Fgf1a shares 89% and 81% identity with zebrafish orthologs, while the identity between grass carp Fgf1a and Fgf1b peptides is 50% (Fig. 1). Moreover, phylogenetic analysis demonstrated that both fgf1a and fgf1b in grass carp clustered well with their orthologs in other teleost species (Fig. 2). 3.2. Expressions of grass carp fgf1a and fgf1b mRNAs
2.6. Whole-mount in situ hybridization A 540-bp PCR fragment of grass carp fgf1a was amplified by primers fgf1a-P-F/-R (Table 1), and a 629-bp PCR fragment of fgf1b was amplified by primers fgf1b-P-F/-R (Table 1). Fixed embryos of grass carp were washed briefly in PBS containing 0.1% Tween-20, transferred to 100% methanol, and stored at 20 °C for a minimum of 24 h. Whole-mount in situ hybridization using digoxigenin
Grass carp fgf1a and fgf1b mRNAs were detected during embryogenesis (Fig. 3A). Both fgf1a and fgf1b were detected in the zygote, and their mRNA levels decreased to the lowest levels at 8 hpf. Then, embryonic fgf1a and fgf1b mRNAs were expressed at 12 hpf, and both mRNA levels were significantly (p < 0.05) increased to reach the highest level at 28 hpf (Fig. 3A). After 32 hpf, both fgf1a and fgf1b mRNA levels showed fluctuations
Fig. 1. Alignment of deduced grass carp Fgf1a andFgf1b amino acid sequences with zebrafish and human homologs. Amino acids are designated using single-letter codes. The FGF domain is indicated by a solid red line.
64
D.-D. Guo et al. / General and Comparative Endocrinology 240 (2017) 61–68
Fig. 2. Phylogenetic analysis of Fgf1a and Fgf1b sequences in vertebrates. Accession numbers of sequences retrieved from GenBank are shown. Amino acid sequences of fulllength Fgf1s were analyzed using the neighbor-joining method in MEGA 5.05. Gaps were removed from the alignment. Bootstrap values derived from 1000 replications are shown.
(Fig. 3A). Whole-mount in situ hybridization demonstrated that both fgf1a and fgf1b expressions were primarily detectable in the notochord at 12 hpf when compared with the control (Fig. 4A, D, G). At 24 hpf, fgf1a mRNA was mainly expressed in the gut and somites (Fig. 4E), while fgf1b mRNA persisted in the notochord and was detected in the tailbud (Fig. 4H). At 36 hpf, both fgf1a and fgf1b mRNAs were found in the brain, somites, and tailbud (Fig. 4F, I). In addition, the fgf1a transcript was observed and expressed with clear signals in the base of the yolk sac at 36 hpf (Fig. 4F), whereas fgf1b was expressed in the pectoral fin (Fig. 4I). At the adult stage, duplicated grass carp fgf1a and fgf1b mRNAs were detected in all tissues. High expression of fgf1a mRNA was detected in the brain, gill, skin, kidney, and muscle, but low expression was observed in the heart, eyes, spleen, intestine, and liver (Fig. 3B). fgf1b mRNA showed high expression in the skin, muscle, gill, brain, kidney, heart, spleen, eyes, and intestine, but low expression in the liver (Fig. 3B). 3.3. Transcription of fgf1a and fgf1b by hGH treatment in grass carp To determine whether the duplicated fgf1 genes have divergent expression patterns in response to GH, different doses of recombinant hGH were intraperitoneally injected into juvenile grass carp. mRNA levels of duplicated fgf1s in the brain, muscle, and liver were examined using qRT-PCR. We found that the responsive degrees of duplicated fgf1 mRNAs to hGH varied with the different doses (Fig. 5). Compared to the controls, fgf1a mRNA was significantly downregulated in the brain and muscle after treatment with 50 lg of hGH per gram body weight (Fig. 5A, B), but no significant difference was found in the liver (Fig. 5C). The fgf1b mRNA was significantly downregulated in the brain and muscle after
treatment with 10 lg or 50 lg of hGH (Fig. 5A, B), respectively; no significant difference was found in the liver (Fig. 5C). 3.4. Nutritional status regulates fgf1a and fgf1b mRNA levels in grass carp Fasting treatment was conducted to determine the response of duplicated fgf1 genes to nutrient conditions. qRT-PCR was used to evaluate mRNA levels of fgf1a and fgf1b in the brain, muscle, and liver. In the brain, fgf1a was upregulated significantly (p < 0.05) after 6 days of starvation and then reached control levels after 3 and 6 days of re-feeding (Fig. 6A),whereas fgf1b mRNA level was significantly (p < 0.05) upregulated after 2 days and reduced after 6 days starvation and recovered after 6 days of re-feeding (Fig. 6D). In the muscle, fgf1a mRNA level was significantly (p < 0.05) increased after 2 and 4 days of starvation (Fig. 6B), while fgf1b was significantly upregulated after 4 days and 6 days of starvation (Fig. 6E); both their transcripts were restored to the control levels after 3 and 6 days of re-feeding. In the liver, fgf1a mRNA level was increased at 4 days of starvation, and the transcription level was gradually reduced and maintained at the control level after 6 days of re-feeding (Fig. 6C). In contrast, fgf1b was significantly upregulated at 4 days and 6 days of fasting and reduced to the control level after 6 days of re-feeding (Fig. 6F). 4. Discussion In this study, we successfully isolated duplicated fgf1 genes in grass carp. In the NCBI database, 2 fgf1 genes can be found for zebrafish and common carp. However, other teleost species only have 1 copy of fgf1. Both mature Fgf1a and Fgf1b peptides contain a
D.-D. Guo et al. / General and Comparative Endocrinology 240 (2017) 61–68
65
Fig. 3. Quantitative real-time PCR analysis of duplicated fgf1 mRNAs in adult grass carp tissues and during embryogenesis. The relative amount of a particular gene was calculated using the comparative threshold cycle (CT) method and employing the formula 2DDCT using b-actin as reference genes. Results are expressed as mean ± SE for separate fish (n = 5). ANOVA followed by post hoc test was used for comparison fgf1a and fgf1b expression separately in different tissues/embryo at different stage of expression. Columns marked with different letters are significantly different (p < 0.05). Zg, zygote; hpf, hours post-fertilization.
conserved FGF domain, such as that in human FGF1 and common carp Fgf1a (Ma et al., 2014); this indicates that the 2 genes are conserved among vertebrates during evolution. Both Fgf1a and Fgf1b share a low sequence identity of 50%, but they share higher homology with zebrafish orthologs. Additionally, the 2 teleost Fgf1s cluster well with their orthologs in other teleost species, suggesting that they are encoded by homologous genes. These results confirm that fgf1a and fgf1b are derived from fish-specific genome duplication (Van de Peer et al., 2003). As reported in previous studies (Abraham et al., 1986; Jaye et al., 1986), most FGFs (FGF3–8, 10, 15, 17–19, and 21–23) have a typical signal peptide at their N-terminal, while FGF1, FGF2, FGF16, FGF19, and FGF20 do not have a clear signal sequence; however, they were able to efficiently secrete extracellular signals through different mechanisms from the typical endoplasmic reticulum–Golgi pathway (Sato and Rifkin, 1988). This implies that duplicated grass carp Fgf1s with no classic signal peptide should not be secreted by the classical
secretion pathway to act as an autocrine or paracrine signal in grass carp. Duplicated fgf1 mRNAs are found in the zygote. The deposited mRNAs can be translated to Fgf1 peptides for early embryonic development. After 12 hpf, the embryo itself begins to synthesize fgf1a and fgf1b mRNAs. Whole-mount in situ hybridization showed that both fgf1a and fgf1b expressions were primarily detectable in the notochord at 12 hpf. At 24 hpf, fgf1a mRNA was mainly expressed in the gut and somites, while fgf1b mRNA persisted in the notochord and the tailbud. In the brain, somites, and tailbud, fgf1a signals were also found at the base of the yolk sac, while fgf1b was expressed in the pectoral fin at 36 hpf. Zebrafish fgf1a is also highly expressed in the somites at 28 hpf, and its expression decreases and is hardly detectable at 32 or 48 hpf (Songhet et al., 2007). In contrast, fgf1a mRNA, but not fgf1b mRNA, was detected during the earlier development of fins in the common carp (Ma et al., 2014); this finding is not consistent with our results. In adult
66
D.-D. Guo et al. / General and Comparative Endocrinology 240 (2017) 61–68
Fig. 4. Whole-mount in situ hybridization analysis of grass carp fgf1a and fgf1b mRNAs at different embryonic stages. Embryos at 12 hpf (A, D, G), 24 hpf (B, E, H), and 36 hpf (C, F, I) were analyzed using fgf1a antisense probe (D–F) fgf1b antisense probe (G–I), and fgf1a or fgf1b sense probe (A–C). All embryos are viewed laterally with the head to the left. NC, notochord; G, gut; PF, pectoral fin; B, brain; S, somites; TB, tailbud; YS, yolk sac. Scale bar = 600 lm.
Fig. 5. Regulation of duplicated fgf1 mRNA levels in the tissues of juvenile grass carp by hGH treatment. Fish were injected with 10 or 50 lg of recombinant hGH per gram body weight or with PBS as the control. After 12 h, total RNA was extracted, and fgf1 mRNA levels were measured using quantitative real-time (qRT)-PCR. fgf1 copy numbers were normalized to the amount of b-actin mRNA. qRT-PCR data are presented as mean ± SE; *p < 0.05; **p < 0.01.
grass carp, fgf1a mRNA was abundantly detected in the brain, gill, kidney, muscle, and skin, while low expression was observed in the eyes, spleen, intestine, heart, and liver. Similarly, mirror carp fgf1a mRNA also showed expression in the kidney, gill, muscle, liver, and skin; the highest expression was detected in the skin and the lowest, in the heart and kidney (Ma et al., 2014). Additionally, a previous study has shown that the heart, brain, liver, and kidney of chicken contain different levels of fgf1 mRNA (Philippe et al., 1996). In contrast to fgf1a mRNA, fgf1b mRNA showed higher expression in the tissues, except liver. These results illustrate that duplicated grass carp fgf1s would play conserved but divergent roles during early embryonic development and in adult tissues. Previous studies in mice have indicated that increased expression of FGF signaling during starvation can also cause growth attenuation by antagonizing the stimulatory effects of GH (Wu et al., 2013, 2012). In teleost fish, fasting treatment can also induce the levels of hepatic Fgf1 receptors, but hGH reduces their expression in blunt snout bream (Zhang et al., 2015). Moreover, grass carp igf1 and igf2 mRNA levels were found to be upregulated in the liver after re-feeding and hGH treatment and decreased after fasting
treatment (Yuan et al., 2011). In fact, fish are sometimes challenged to survive by reducing body growth under nutrition deficiency conditions. In the present study, GH treatment and starvation have differential effects (stimulatory & inhibitory) on transcript levels for the two forms of Fgf1 expressed in different tissues. The differential effects of GH and starvation in different tissues suggest that their functional roles on Fgf1 expressions are tissue dependent and may vary between different Fgf1 isoforms. Additional experiments will be needed to substantiate the hypothesis on body growth, interactions with GH-IGF axis and the idea of protection against nutrition deficiency in teleost fish. In summary, we isolated duplicated fgf1 genes from grass carp and characterized 2 distinct fgf1 genes. Peptide structures and different expression patterns of fgf1s in adult grass carp and during embryogenesis suggest that the duplicated genes have different biological activities and functions. GH treatment and starvation have differential effects on their mRNA expressions in different tissues. These results suggest that duplicated fgf1s may play important but divergent roles in regulating the development of grass carp.
D.-D. Guo et al. / General and Comparative Endocrinology 240 (2017) 61–68
67
Fig. 6. qRT-PCR results of fgf1a and fgf1b in juvenile grass carp in response to different nutritional status. Fish were sampled at 0, 2, 4, and 6 days after the onset of fasting and following re-feeding for 3 or 6 days. Six fish from another feeding control tank were collected simultaneously with the fasted or re-fed group at each sampling time. The fgf1 copy numbers were normalized to the amount of b-actin mRNA. qRT-PCR data are presented as mean ± SE; *p < 0.05; **p < 0.01.
Acknowledgments This work was supported by grants from the Key Technologies Research and Development Program of China (2012BAD26B02), the National High Technology Research and Development Program of China (863 Program) (2011AA100403), the National Natural Science Foundation of China (31272633; 31201760; 31572220), and the Shanghai University Knowledge Service Platform (ZF1206). References Abraham, J.A., Whang, J.L., Tumolo, A., Mergia, A., Fiddes, J.C., 1986. Human basic fibroblast growth factor: nucleotide sequence, genomic organization, and expression in mammalian cells. Cold Spring Harb. Symp. Quant. Biol. 51 (Pt 1), 657–668. Adams, A.C., Yang, C., Coskun, T., Cheng, C.C., Gimeno, R.E., Luo, Y., Kharitonenkov, A., 2012. The breadth of FGF21’s metabolic actions are governed by FGFR1 in adipose tissue. Mol. Metab. 2, 31–37. Billottet, C., Tuefferd, M., Gentien, D., Rapinat, A., Thiery, J.P., Broet, P., Jouanneau, J., 2008. Modulation of several waves of gene expression during FGF-1 induced epithelial-mesenchymal transition of carcinoma cells. J. Cell. Biochem. 104, 826–839. Cao, M., Chen, J., Peng, W., Wang, Y., Liao, L., Li, Y., Trudeau, V.L., Zhu, Z., Hu, W., 2014. Effects of growth hormone over-expression on reproduction in the common carp Cyprinus carpio L. Gen. Comp. Endocrinol. 195, 47–57. Dorey, K., Amaya, E., 2010. FGF signalling: diverse roles during early vertebrate embryogenesis. Development 137, 3731–3742. FAO, 2011. FAO Yearbook of Fishery and Aquaculture Statistics 2011. FBMA, 2013. Chinese Fisheries Year Book. China Agriculture Press, China, Beijing. Fernandes-Freitas, I., Owen, B.M., 2015. Metabolic roles of endocrine fibroblast growth factors. Curr. Opin. Pharmacol. 25, 30–35. Han, S., Gao, A., Li, J., Zhang, Y., Mei, B., 2009. Review on fibroblast growth factor (FGF). J. Anhui Agric. Sci. 37, 3008–3010. Haugsten, E.M., Sorensen, V., Brech, A., Olsnes, S., Wesche, J., 2005. Different intracellular trafficking of FGF1 endocytosed by the four homologous FGF receptors. J. Cell Sci. 118, 3869–3881. Inagaki, T., Lin, V.Y., Goetz, R., Mohammadi, M., Mangelsdorf, D.J., Kliewer, S.A., 2008. Inhibition of growth hormone signaling by the fasting-induced hormone FGF21. Cell Metab. 8, 77–83. Jaye, M., Howk, R., Burgess, W., Ricca, G.A., Chiu, I.M., Ravera, M.W., O’Brien, S.J., Modi, W.S., Maciag, T., Drohan, W.N., 1986. Human endothelial cell growth
factor: cloning, nucleotide sequence, and chromosome localization. Science 233, 541–545. Jeon, Y.S., Lee, K., Park, S.C., Kim, B.S., Cho, Y.J., Ha, S.M., Chun, J., 2014. EzEditor: a versatile sequence alignment editor for both rRNA- and protein-coding genes. Int. J. Syst. Evol. Microbiol. 64, 689–691. Jiang, X.Y., Du, X.D., Tian, Y.M., Shen, R.J., Sun, C.F., Zou, S.M., 2012. Goldfish transposase Tgf2 presumably from recent horizontal transfer is active. FASEB J. 26, 2743–2752. Jonker, J.W., Suh, J.M., Atkins, A.R., Ahmadian, M., Li, P., Whyte, J., He, M., Juguilon, H., Yin, Y.Q., Phillips, C.T., Yu, R.T., Olefsky, J.M., Henry, R.R., Downes, M., Evans, R.M., 2012. A PPARgamma-FGF1 axis is required for adaptive adipose remodelling and metabolic homeostasis. Nature 485, 391–394. Kim, S.O., Loesch, K., Wang, X., Jiang, J., Mei, L., Cunnick, J.M., Wu, J., Frank, S.J., 2002. A role for Grb2-associated binder-1 in growth hormone signaling. Endocrinology 143, 4856–4867. Lim, J.Y., Kim, H., Jeun, S.S., Kang, S.G., Lee, K.J., 2006. Merlin inhibits growth hormone-regulated Raf-ERKs pathways by binding to Grb2 protein. Biochem. Biophys. Res. Commun. 340, 1151–1157. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408. Ma, L., Jiang, L., Wang, Y.Y., Cheng, A.D., Qiao, Z.G., Li, H.D., 2014. Effect of FGF1a (fibroblast frowth factor 1a) Gene on mirror carp scale development. Genomics Appl. Biol. 33, 82–87. MacDonald, I.A., Webber, J., 1995. Feeding, fasting and starvation: factors affecting fuel utilization. Proc. Nutr. Soc. 54, 267–274. Ornitz, D.M., Itoh, N., 2001. Fibroblast growth factors. Genome Biol. 2. REVIEWS 3005. Partanen, J., Armstrong, E., Makela, T.P., Korhonen, J., Sandberg, M., Renkonen, R., Knuutila, S., Huebner, K., Alitalo, K., 1992. A novel endothelial cell surface receptor tyrosine kinase with extracellular epidermal growth factor homology domains. Mol. Cell. Biol. 12, 1698–1707. Philippe, J.M., Renaud, F., Courtois, Y., Laurent, M., 1996. Cloning of multiple chicken FGF1 mRNAs and their differential expression during development of whole embryo and of the lens. DNA Cell Biol. 15, 703–715. Sato, Y., Rifkin, D.B., 1988. Autocrine activities of basic fibroblast growth factor: regulation of endothelial cell movement, plasminogen activator synthesis, and DNA synthesis. J. Cell Biol. 107, 1199–1205. Songhet, P., Adzic, D., Reibe, S., Rohr, K.B., 2007. Fgf1 is required for normal differentiation of erythrocytes in zebrafish primitive hematopoiesis. Dev. Dyn. 236, 633–643. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739.
68
D.-D. Guo et al. / General and Comparative Endocrinology 240 (2017) 61–68
Taylor, J.S., Braasch, I., Frickey, T., Meyer, A., Van de Peer, Y., 2003. Genome duplication, a trait shared by 22000 species of ray-finned fish. Genome Res. 13, 382–390. Thisse, C., Thisse, B., 2008. High-resolution in situ hybridization to whole-mount zebrafish embryos. Nat. Protoc. 3, 59–69. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882. Van de Peer, Y., Taylor, J.S., Meyer, A., 2003. Are all fishes ancient polyploids? J. Struct. Funct. Genomics 3, 65–73. Wu, S., Grunwald, T., Kharitonenkov, A., Dam, J., Jockers, R., De Luca, F., 2013. Increased expression of fibroblast growth factor 21 (FGF21) during chronic undernutrition causes growth hormone insensitivity in chondrocytes by inducing leptin receptor overlapping transcript (LEPROT) and leptin receptor overlapping transcript-like 1 (LEPROTL1) expression. J. Biol. Chem. 288, 27375– 27383.
Wu, S., Levenson, A., Kharitonenkov, A., De Luca, F., 2012. Fibroblast growth factor 21 (FGF21) inhibits chondrocyte function and growth hormone action directly at the growth plate. J. Biol. Chem. 287, 26060–26067. Yuan, X.N., Jiang, X.Y., Pu, J.W., Li, Z.R., Zou, S.M., 2011. Functional conservation and divergence of duplicated insulin-like growth factor 2 genes in grass carp (Ctenopharyngodon idellus). Gene 470, 46–52. Zhang, Q.Q., Li, F.G., Qin, B., Chen, J., Jiang, X.Y., Zou, S.M., 2015. Functional conservation and divergence of duplicated fibroblast growth factor receptor 1 (fgfr1) genes in blunt snout bream (Megalobrama amblycephala). Gene 573, 225–232. Zou, S., Kamei, H., Modi, Z., Duan, C., 2009. Zebrafish IGF genes: gene duplication, conservation and divergence, and novel roles in midline and notochord development. PLoS One 4, e7026.
Contents lists available at ScienceDirect
General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen
Research paper
Comparative expression and regulation of duplicated fibroblast growth factor 1 genes in grass carp (Ctenopharyngodon idella) Dan-Dan Guo, Wen-Zhi Guan, Yi-Wen Sun, Jie Chen, Xia-Yun Jiang ⇑, Shu-Ming Zou ⇑ Key Laboratory of Freshwater Aquatic Genetic Resources, Shanghai Ocean University, Huchenghuan Road 999, Shanghai 201306, China
a r t i c l e
i n f o
Article history: Received 11 April 2016 Revised 18 September 2016 Accepted 23 September 2016 Available online 24 September 2016 Keywords: Ctenopharyngodon idella Fibroblast growth factor 1 Gene duplication Expression Nutritional status
a b s t r a c t Fibroblast growth factor 1 (Fgf1) is known as a mitogenic factor involved in the regulation of cell growth, proliferation, and differentiation in vertebrates. Here, we report the isolation and characterization of two fgf1 genes in grass carp (Ctenopharyngodon idella). Grass carp fgf1a and fgf1b cDNAs are highly divergent, sharing a relatively low amino acid sequence identity of 50%, probably due to fish-specific gene duplication. fgf1a and fgf1b mRNAs were detected in the zygote and expressed throughout embryogenesis. Both fgf1a and fgf1b mRNAs were primarily detectable in the notochord at 12 hpf. At 24 hpf, fgf1a mRNA was mainly expressed in the gut and somites, while fgf1b transcript persisted in the notochord and was detected in the tailbud. At 36 hpf, both fgf1a and fgf1b transcripts were detected in the brain, somites, and tailbud. In addition, the fgf1a mRNA was detected at the base of the yolk sac, whereas the fgf1b mRNA was expressed in the pectoral fin. In adult fish, duplicated fgf1a and fgf1b mRNAs were distributed in most tissues. After 2–6 days of starvation, both fgf1a and fgf1b mRNAs were upregulated in the muscle and liver. In the brain, fgf1a mRNA was upregulated, while fgf1b mRNA was significantly downregulated at 6 days. Furthermore, both fgf1a and fgf1b mRNA levels were significantly decreased in the brain and muscle after administration of 10 or 50 lg of the human growth hormone (hGH),while their mRNA levels were no significant difference in the liver. These results suggest that duplicated fgf1s may play important but divergent roles in the grass carp development. Ó 2016 Elsevier Inc. All rights reserved.
1. Introduction Fibroblast growth factors (FGFs), including 23 related polypeptides that combine with fibroblast growth factor receptors (FGFRs) (Haugsten et al., 2005; Partanen et al., 1992), are mitogenic factors involved in regulating cell growth, proliferation, and differentiation (Billottet et al., 2008; Ornitz and Itoh, 2001; Philippe et al., 1996). FGFs are composed of 150–200 peptides, and they have 50–70% amino acid identity with respect to their FGF domains (Han et al., 2009). Binding of FGFs to FGFRs is stabilized by heparan sulfate proteoglycans (HSPGs) and results in a dimer receptor– ligand complex that activates the intracellular tyrosine kinase domain by autophosphorylation, which triggers complex signal transduction in mammalian cells, such as the protein kinase C pathway, PI3K pathway, and Ras/ERK pathway (Dorey and Amaya, 2010). FGF1/FGFR1 signaling is involved in multiple signal regulation, including energy metabolism and growth in mammals (Kim ⇑ Corresponding authors. E-mail addresses: [email protected] (X.-Y. Jiang), [email protected] (S.-M. Zou). http://dx.doi.org/10.1016/j.ygcen.2016.09.014 0016-6480/Ó 2016 Elsevier Inc. All rights reserved.
et al., 2002; Lim et al., 2006). FGF1 is expressed in adipose tissues under the control of PPARc, and it plays an essential physiological role in maintaining adipose tissue plasticity during feeding–fasting cycles (Fernandes-Freitas and Owen, 2015). Additionally, FGF1 plays critical roles in metabolic homeostasis, which restores blood glucose levels and insulin sensitivity in mice (Jonker et al., 2012). During fasting, enhanced expression of FGF21 inhibited growth hormone (GH) signaling and impacted chondrocyte functions (Inagaki et al., 2008). These functions of FGF21 in mice tissue were governed by FGF1 receptor signaling (Adams et al., 2012). However, there is limited information on whether starvation regulates FGF1 and has an effect on growth in teleost fish. Mammals and Xenopus have single copies of the fgf1 gene; however, teleosts may have duplicate fgf1 genes, which is believed to be due to an additional genome-wide duplication event (Taylor et al., 2003). Two fgf1 genes have been identified in the zebrafish genome, with fgf1a on chromosome 14 and fgf1b on chromosome 21. During embryogenesis, fgf1a expression in zebrafish is the strongest in somites at 28 hpf, and fgf1a is required for normal differentiation of erythrocytes during primitive hematopoiesis (Songhet et al., 2007). In common carp, in situ hybridization was used to show that fgf1a was expressed specifically in developing
62
D.-D. Guo et al. / General and Comparative Endocrinology 240 (2017) 61–68
scale tissues, and it was also observed in the tissues of the tail and dorsal or ventral fins (Ma et al., 2014). These findings reveal the vital roles of fgf1a in earlier fish embryo development. However, to the best of our knowledge, there is no information on functions and expression patterns of duplicate fgf1 genes in teleosts. The grass carp, Ctenopharyngodon idellus, is an important species for freshwater aquaculture in China, with the highest output in fish farming worldwide; its production accounts for 15.6% of global freshwater aquaculture (FAO, 2011). In 2013, total production of grass carp was reportedly around 5 million tons (FBMA, 2013). Fish growth is an integrated process that depends, for the most part, on nutrient availability as well as GH (Cao et al., 2014; MacDonald and Webber, 1995). Fasted fish reduce energy storage and display a decrease in the growth rate (Cao et al., 2014). In this study, duplicated fgf1 cDNAs were cloned from the grass carp, and their expression patterns were examined in adult tissues and different embryo stages during embryogenesis. In addition, effects of fasting and human growth hormone (hGH) treatments on the mRNA expressions of fgf1a and fgf1b were investigated in juvenile grass carp.
2. Materials and methods 2.1. Experimental fish All experimental materials, including embryos and adult grass carp, were obtained from the Qingpu Fish Breeding Experiment Station, Shanghai, China. Embryos were obtained using artificial insemination. Fertilized eggs (200) were plated in petri dishes (10 cm in diameter). Embryo development occurred at room temperature (22 °C). Every 4 h after fertilization (0–40 hpf), the embryos were stored by immersion in RNA Store (Tiangen, Shanghai, China) and maintained at 4 °C overnight and then at 80 °C until use. Water in the petri dishes was replaced every 2–3 h with well-aerated water to maintain normal dissolved oxygen (DO) levels during embryogenesis. Embryos at different developmental stages were collected and fixed as reported previously for in situ hybridization (Jiang et al., 2012). Tissues from adult grass carp, namely, brain, muscle, liver, eyes, heart, gill, spleen, kidney, intestine, and skin, were rapidly dissected, frozen in liquid nitrogen, and stored at 80 °C until use. All experiments were conducted according to the guidelines approved by the Shanghai Ocean University Committee on the Use and Care of Animals. 2.2. Fasting and hGH treatments For the fasting treatment, 36 juvenile grass carp (20 g each) were cultured in two 150-L indoor tanks within a continuous flow system. After 1 week of acclimation, a total of 6 fish (3 per tank) were collected on day 0, 2, 4, and 6 during fasting treatment and on day 3 and 6 during re-feeding treatment. Six fish in a feeding control tank were collected simultaneously with the fasted or re-fed group at every sampling time. hGH treatment was performed according to a published method (Yuan et al., 2011). Nine juveniles were cultured in three 150-L indoor tanks. After 3 days without feeding, 3 fish from each tank were anesthetized using MS222 and administered an intraperitoneal injection of phosphate-buffered saline (PBS, control) or 10 or 50 lg of recombinant hGH (Shanghai United Cell Biotechnology Company, China) per gram body weight at a volume of 100 lL. Each experiment was performed in triplicate. After 12 h, a total of 9 fish were sampled for each experimental treatment. Brain, liver, and muscle were immediately excised, frozen in liquid nitrogen, and stored at 80 °C until use.
2.3. Molecular cloning of grass carp fgf1a and fgf1b cDNAs Total RNA was isolated from grass carp embryos at 40 hpf by using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and subsequently treated with DNase (Promega, Madison, WI, USA) to remove contaminant genomic DNA. First-strand cDNA was reverse-transcribed from the total RNA by using reverse transcriptase M-MLV (TaKaRa, Japan), according to the manufacturer’s instructions. PCR was performed to amplify partial cDNA fragments of fgf1a and fgf1b. The primer pairs were fgf1a-PS-F/-R and fgf1b-PS-F/-R (Table 1), designed using conserved regions of known sequences of zebrafish (GenBank Accession No. NP_957054.1 for fgf1a and NP_001098748.1 for fgf1b) and common carp (BAQ36072.1 for fgf1a and BAQ36073.1 for fgf1b). PCR fragments (185 bp for fgf1a and 306 bp for fgf1b) were cloned, sequenced, and used to design nested gene-specific primers for 30 RACE analysis (fgf1a-3RACE-O and fgf1a-3RACE-I; fgf1b-3RACE-O and fgf1b-3RACE-I) and 50 RACE analysis (fgf1a-5RACE-O and fgf1a-5RACE-I; fgf1b-5RACE-O and fgf1b-5RACE-I) (Table 1). The 50 and 30 ends of fgf1a and fgf1b mRNAs were amplified using the SMART RACE cDNA amplification kit (Clontech, CA, USA), according to the manufacturer’s protocol. PCR products were gel-purified, ligated into the T/A cloning vector pMD-19T (TaKaRa, Dalian, China), and transformed into Escherichia coli DH5a competent cells. Positive clones were examined using PCR and direct sequencing.
2.4. Sequence and phylogenetic analyses Nucleotide sequences of fgf1a and fgf1b were analyzed using BioEdit 7.0.0.1 (Jeon et al., 2014). Sequences of Fgf1a and Fgf1b proteins from different species were compared using the National Center for Biotechnology Information BLASTP search program. Alignment of putative amino acid sequences of the Fgf1a and Fgf1b proteins was performed with the Clustal X 1.83 program (Thompson et al., 1997). Phylogenetic analysis was performed using coding sequences with the neighbor-joining method in MEGA 5.05 (Tamura et al., 2011). Gap sites in the alignment were used for the phylogenetic reconstruction, and reliability of the estimated tree was evaluated using the bootstrap method with 1000 pseudo-replications.
Table 1 Primer sequences used in this study. Primer name
Primer sequence (50 –30 )
fgf1a-PS-F fgf1a-PS-R fgf1b-PS-F fgf1b-PS-R fgf1a-5RACE-O fgf1a-5RACE-I fgf1a-3RACE-O fgf1a-3RACE-I fgf1b-5RACE-O fgf1b-5RACE-I fgf1b-3RACE-O fgf1b-3RACE-I fgf1a-qRT-F fgf1a-qRT-R fgf1b-qRT-F fgf1b-qRT-R b-actin-qRT-F b-actin-qRT-R fgf1a-P-F fgf1a-P-R fgf1b-P-F fgf1b-P-R
AATGGAGGATTTCACCTTCAGA TCCATCTTCTCCAGGAAATAAC CAACCTAACGGGACTGTGGA GCCCTTGTGTGTTTTGGAGC TCTGTTCCTTCAATGACCACCA ATGCGCAGTATGCTGTAGATGTTC TGGTGGTCATTGAAGGAACAGA CGTCAGCATTAGTAACGGATGATAGT CCACATTTATCCATTGCCAGG ACCTTCAAAAGAGTGTAAACGTCG ACCTGGCAATGGATAAATGTGG CACATCCCGTTCACAGAGGTATC TTTCAAACAGCTCAGAATAGAT GGTAAAGTCCTGCCTCTGTTCC TTCACAGGGGTGTTCACGC ACAGTCCCGTTGGGTTGG TGCCATGTATGTGGCCATCC TCTTTCGGCTGTGGTGGTGA GCAGTGAAATTCAACCCGCC TCACACCATGTCATAGAAGCGTTTT TTCACACTGCTACCGACGAC AAAAAAGTTCTTTACATTCACCTG
D.-D. Guo et al. / General and Comparative Endocrinology 240 (2017) 61–68
2.5. Quantitative real-time (qRT)-PCR Total RNA was isolated from the brain, liver, and muscle of juvenile grass carp by using TRIzol reagent (Invitrogen, USA). After DNase treatment, 500 ng of total RNA was reverse-transcribed to single-strand cDNA by using the Prime Script RT reagent kit (TaKaRa, Japan), according to the manufacturer’s instructions. The stable housekeeping gene b-actin was used as the control. qRT-PCR was performed using the CFX96 TouchTM real-time PCR Detection System (BioRad, USA) and SYBR Green Premix Ex Taq (TaKaRa, Japan). The program for qRT-PCR was 95 °C for 30 s and 40 cycles of amplification at 95 °C for 5 s, 59.5 °C for 20 s, and 72 °C for 15 s. Each experiment was performed in triplicate. Primer pairs were fgf1a-qRT-F/-R, fgf1b-qRT-F/-R, and b-actin-qRT-F/-R (Table 1). The amplification efficiency (E) of each primer pair was calculated based on the slope of a linear regression from a dilution series of cDNA. Relative expression analyses were used the comparative threshold cycle (CT) method and employing the formula 2DDCT with DCT = CT (target gene)-CT (reference gene) with DDCT = DCT(treated gene)-DCT (control) using b-actin as reference genes (Livak and Schmittgen, 2001). The results of qRT-PCR were expressed as the normalized fold expression ± the standard error value. Statistical significance for expression of each gene in different tissues/embryo at different stage was analyzed using one-way analysis of variance (ANOVA) followed by Fisher’s post-hoc tests, and t-test was analyzed for gene expressions during nutritional treatment/GH treatment.
63
(DIG)-labeled RNA riboprobes was performed as reported previously, with modifications (Thisse and Thisse, 2008; Zou et al., 2009). Embryos were photographed using a Nikon SMZ1500 fluorescence microscope (Tokyo, Japan). 3. Results 3.1. Identification of fgf1a and fgf1b cDNAs in grass carp Two full-length cDNAs of fgf1a and fgf1b were identified in grass carp by performing 30 and 50 RACE. fgf1a (GenBank Accession No. KU863004) is 709 bp in length and has a 63-bp 50 -untranslated region (50 -UTR), a 444-bp open reading frame (ORF) that encodes 147 amino acids (Fig. 1), and a 202-bp 30 -UTR with a poly-A signal sequence. fgf1b (GenBank Accession No. KU863005) is 987 bp in length, and consists of a 92-bp 50 -UTR, a 477-bp ORF that encodes 158 amino acids (Fig. 1), and a 418-bp 30 -UTR with a poly-A signal sequence. Both putative Fgf1a and Fgf1b proteins lack a classic signal peptide. Similar to their human orthologs, grass carp Fgf1a and Fgf1b peptides contain a 121-amino acid and 124-amino acid FGF domain, respectively (Fig. 1). Grass carp Fgf1a shares 89% and 81% identity with zebrafish orthologs, while the identity between grass carp Fgf1a and Fgf1b peptides is 50% (Fig. 1). Moreover, phylogenetic analysis demonstrated that both fgf1a and fgf1b in grass carp clustered well with their orthologs in other teleost species (Fig. 2). 3.2. Expressions of grass carp fgf1a and fgf1b mRNAs
2.6. Whole-mount in situ hybridization A 540-bp PCR fragment of grass carp fgf1a was amplified by primers fgf1a-P-F/-R (Table 1), and a 629-bp PCR fragment of fgf1b was amplified by primers fgf1b-P-F/-R (Table 1). Fixed embryos of grass carp were washed briefly in PBS containing 0.1% Tween-20, transferred to 100% methanol, and stored at 20 °C for a minimum of 24 h. Whole-mount in situ hybridization using digoxigenin
Grass carp fgf1a and fgf1b mRNAs were detected during embryogenesis (Fig. 3A). Both fgf1a and fgf1b were detected in the zygote, and their mRNA levels decreased to the lowest levels at 8 hpf. Then, embryonic fgf1a and fgf1b mRNAs were expressed at 12 hpf, and both mRNA levels were significantly (p < 0.05) increased to reach the highest level at 28 hpf (Fig. 3A). After 32 hpf, both fgf1a and fgf1b mRNA levels showed fluctuations
Fig. 1. Alignment of deduced grass carp Fgf1a andFgf1b amino acid sequences with zebrafish and human homologs. Amino acids are designated using single-letter codes. The FGF domain is indicated by a solid red line.
64
D.-D. Guo et al. / General and Comparative Endocrinology 240 (2017) 61–68
Fig. 2. Phylogenetic analysis of Fgf1a and Fgf1b sequences in vertebrates. Accession numbers of sequences retrieved from GenBank are shown. Amino acid sequences of fulllength Fgf1s were analyzed using the neighbor-joining method in MEGA 5.05. Gaps were removed from the alignment. Bootstrap values derived from 1000 replications are shown.
(Fig. 3A). Whole-mount in situ hybridization demonstrated that both fgf1a and fgf1b expressions were primarily detectable in the notochord at 12 hpf when compared with the control (Fig. 4A, D, G). At 24 hpf, fgf1a mRNA was mainly expressed in the gut and somites (Fig. 4E), while fgf1b mRNA persisted in the notochord and was detected in the tailbud (Fig. 4H). At 36 hpf, both fgf1a and fgf1b mRNAs were found in the brain, somites, and tailbud (Fig. 4F, I). In addition, the fgf1a transcript was observed and expressed with clear signals in the base of the yolk sac at 36 hpf (Fig. 4F), whereas fgf1b was expressed in the pectoral fin (Fig. 4I). At the adult stage, duplicated grass carp fgf1a and fgf1b mRNAs were detected in all tissues. High expression of fgf1a mRNA was detected in the brain, gill, skin, kidney, and muscle, but low expression was observed in the heart, eyes, spleen, intestine, and liver (Fig. 3B). fgf1b mRNA showed high expression in the skin, muscle, gill, brain, kidney, heart, spleen, eyes, and intestine, but low expression in the liver (Fig. 3B). 3.3. Transcription of fgf1a and fgf1b by hGH treatment in grass carp To determine whether the duplicated fgf1 genes have divergent expression patterns in response to GH, different doses of recombinant hGH were intraperitoneally injected into juvenile grass carp. mRNA levels of duplicated fgf1s in the brain, muscle, and liver were examined using qRT-PCR. We found that the responsive degrees of duplicated fgf1 mRNAs to hGH varied with the different doses (Fig. 5). Compared to the controls, fgf1a mRNA was significantly downregulated in the brain and muscle after treatment with 50 lg of hGH per gram body weight (Fig. 5A, B), but no significant difference was found in the liver (Fig. 5C). The fgf1b mRNA was significantly downregulated in the brain and muscle after
treatment with 10 lg or 50 lg of hGH (Fig. 5A, B), respectively; no significant difference was found in the liver (Fig. 5C). 3.4. Nutritional status regulates fgf1a and fgf1b mRNA levels in grass carp Fasting treatment was conducted to determine the response of duplicated fgf1 genes to nutrient conditions. qRT-PCR was used to evaluate mRNA levels of fgf1a and fgf1b in the brain, muscle, and liver. In the brain, fgf1a was upregulated significantly (p < 0.05) after 6 days of starvation and then reached control levels after 3 and 6 days of re-feeding (Fig. 6A),whereas fgf1b mRNA level was significantly (p < 0.05) upregulated after 2 days and reduced after 6 days starvation and recovered after 6 days of re-feeding (Fig. 6D). In the muscle, fgf1a mRNA level was significantly (p < 0.05) increased after 2 and 4 days of starvation (Fig. 6B), while fgf1b was significantly upregulated after 4 days and 6 days of starvation (Fig. 6E); both their transcripts were restored to the control levels after 3 and 6 days of re-feeding. In the liver, fgf1a mRNA level was increased at 4 days of starvation, and the transcription level was gradually reduced and maintained at the control level after 6 days of re-feeding (Fig. 6C). In contrast, fgf1b was significantly upregulated at 4 days and 6 days of fasting and reduced to the control level after 6 days of re-feeding (Fig. 6F). 4. Discussion In this study, we successfully isolated duplicated fgf1 genes in grass carp. In the NCBI database, 2 fgf1 genes can be found for zebrafish and common carp. However, other teleost species only have 1 copy of fgf1. Both mature Fgf1a and Fgf1b peptides contain a
D.-D. Guo et al. / General and Comparative Endocrinology 240 (2017) 61–68
65
Fig. 3. Quantitative real-time PCR analysis of duplicated fgf1 mRNAs in adult grass carp tissues and during embryogenesis. The relative amount of a particular gene was calculated using the comparative threshold cycle (CT) method and employing the formula 2DDCT using b-actin as reference genes. Results are expressed as mean ± SE for separate fish (n = 5). ANOVA followed by post hoc test was used for comparison fgf1a and fgf1b expression separately in different tissues/embryo at different stage of expression. Columns marked with different letters are significantly different (p < 0.05). Zg, zygote; hpf, hours post-fertilization.
conserved FGF domain, such as that in human FGF1 and common carp Fgf1a (Ma et al., 2014); this indicates that the 2 genes are conserved among vertebrates during evolution. Both Fgf1a and Fgf1b share a low sequence identity of 50%, but they share higher homology with zebrafish orthologs. Additionally, the 2 teleost Fgf1s cluster well with their orthologs in other teleost species, suggesting that they are encoded by homologous genes. These results confirm that fgf1a and fgf1b are derived from fish-specific genome duplication (Van de Peer et al., 2003). As reported in previous studies (Abraham et al., 1986; Jaye et al., 1986), most FGFs (FGF3–8, 10, 15, 17–19, and 21–23) have a typical signal peptide at their N-terminal, while FGF1, FGF2, FGF16, FGF19, and FGF20 do not have a clear signal sequence; however, they were able to efficiently secrete extracellular signals through different mechanisms from the typical endoplasmic reticulum–Golgi pathway (Sato and Rifkin, 1988). This implies that duplicated grass carp Fgf1s with no classic signal peptide should not be secreted by the classical
secretion pathway to act as an autocrine or paracrine signal in grass carp. Duplicated fgf1 mRNAs are found in the zygote. The deposited mRNAs can be translated to Fgf1 peptides for early embryonic development. After 12 hpf, the embryo itself begins to synthesize fgf1a and fgf1b mRNAs. Whole-mount in situ hybridization showed that both fgf1a and fgf1b expressions were primarily detectable in the notochord at 12 hpf. At 24 hpf, fgf1a mRNA was mainly expressed in the gut and somites, while fgf1b mRNA persisted in the notochord and the tailbud. In the brain, somites, and tailbud, fgf1a signals were also found at the base of the yolk sac, while fgf1b was expressed in the pectoral fin at 36 hpf. Zebrafish fgf1a is also highly expressed in the somites at 28 hpf, and its expression decreases and is hardly detectable at 32 or 48 hpf (Songhet et al., 2007). In contrast, fgf1a mRNA, but not fgf1b mRNA, was detected during the earlier development of fins in the common carp (Ma et al., 2014); this finding is not consistent with our results. In adult
66
D.-D. Guo et al. / General and Comparative Endocrinology 240 (2017) 61–68
Fig. 4. Whole-mount in situ hybridization analysis of grass carp fgf1a and fgf1b mRNAs at different embryonic stages. Embryos at 12 hpf (A, D, G), 24 hpf (B, E, H), and 36 hpf (C, F, I) were analyzed using fgf1a antisense probe (D–F) fgf1b antisense probe (G–I), and fgf1a or fgf1b sense probe (A–C). All embryos are viewed laterally with the head to the left. NC, notochord; G, gut; PF, pectoral fin; B, brain; S, somites; TB, tailbud; YS, yolk sac. Scale bar = 600 lm.
Fig. 5. Regulation of duplicated fgf1 mRNA levels in the tissues of juvenile grass carp by hGH treatment. Fish were injected with 10 or 50 lg of recombinant hGH per gram body weight or with PBS as the control. After 12 h, total RNA was extracted, and fgf1 mRNA levels were measured using quantitative real-time (qRT)-PCR. fgf1 copy numbers were normalized to the amount of b-actin mRNA. qRT-PCR data are presented as mean ± SE; *p < 0.05; **p < 0.01.
grass carp, fgf1a mRNA was abundantly detected in the brain, gill, kidney, muscle, and skin, while low expression was observed in the eyes, spleen, intestine, heart, and liver. Similarly, mirror carp fgf1a mRNA also showed expression in the kidney, gill, muscle, liver, and skin; the highest expression was detected in the skin and the lowest, in the heart and kidney (Ma et al., 2014). Additionally, a previous study has shown that the heart, brain, liver, and kidney of chicken contain different levels of fgf1 mRNA (Philippe et al., 1996). In contrast to fgf1a mRNA, fgf1b mRNA showed higher expression in the tissues, except liver. These results illustrate that duplicated grass carp fgf1s would play conserved but divergent roles during early embryonic development and in adult tissues. Previous studies in mice have indicated that increased expression of FGF signaling during starvation can also cause growth attenuation by antagonizing the stimulatory effects of GH (Wu et al., 2013, 2012). In teleost fish, fasting treatment can also induce the levels of hepatic Fgf1 receptors, but hGH reduces their expression in blunt snout bream (Zhang et al., 2015). Moreover, grass carp igf1 and igf2 mRNA levels were found to be upregulated in the liver after re-feeding and hGH treatment and decreased after fasting
treatment (Yuan et al., 2011). In fact, fish are sometimes challenged to survive by reducing body growth under nutrition deficiency conditions. In the present study, GH treatment and starvation have differential effects (stimulatory & inhibitory) on transcript levels for the two forms of Fgf1 expressed in different tissues. The differential effects of GH and starvation in different tissues suggest that their functional roles on Fgf1 expressions are tissue dependent and may vary between different Fgf1 isoforms. Additional experiments will be needed to substantiate the hypothesis on body growth, interactions with GH-IGF axis and the idea of protection against nutrition deficiency in teleost fish. In summary, we isolated duplicated fgf1 genes from grass carp and characterized 2 distinct fgf1 genes. Peptide structures and different expression patterns of fgf1s in adult grass carp and during embryogenesis suggest that the duplicated genes have different biological activities and functions. GH treatment and starvation have differential effects on their mRNA expressions in different tissues. These results suggest that duplicated fgf1s may play important but divergent roles in regulating the development of grass carp.
D.-D. Guo et al. / General and Comparative Endocrinology 240 (2017) 61–68
67
Fig. 6. qRT-PCR results of fgf1a and fgf1b in juvenile grass carp in response to different nutritional status. Fish were sampled at 0, 2, 4, and 6 days after the onset of fasting and following re-feeding for 3 or 6 days. Six fish from another feeding control tank were collected simultaneously with the fasted or re-fed group at each sampling time. The fgf1 copy numbers were normalized to the amount of b-actin mRNA. qRT-PCR data are presented as mean ± SE; *p < 0.05; **p < 0.01.
Acknowledgments This work was supported by grants from the Key Technologies Research and Development Program of China (2012BAD26B02), the National High Technology Research and Development Program of China (863 Program) (2011AA100403), the National Natural Science Foundation of China (31272633; 31201760; 31572220), and the Shanghai University Knowledge Service Platform (ZF1206). References Abraham, J.A., Whang, J.L., Tumolo, A., Mergia, A., Fiddes, J.C., 1986. Human basic fibroblast growth factor: nucleotide sequence, genomic organization, and expression in mammalian cells. Cold Spring Harb. Symp. Quant. Biol. 51 (Pt 1), 657–668. Adams, A.C., Yang, C., Coskun, T., Cheng, C.C., Gimeno, R.E., Luo, Y., Kharitonenkov, A., 2012. The breadth of FGF21’s metabolic actions are governed by FGFR1 in adipose tissue. Mol. Metab. 2, 31–37. Billottet, C., Tuefferd, M., Gentien, D., Rapinat, A., Thiery, J.P., Broet, P., Jouanneau, J., 2008. Modulation of several waves of gene expression during FGF-1 induced epithelial-mesenchymal transition of carcinoma cells. J. Cell. Biochem. 104, 826–839. Cao, M., Chen, J., Peng, W., Wang, Y., Liao, L., Li, Y., Trudeau, V.L., Zhu, Z., Hu, W., 2014. Effects of growth hormone over-expression on reproduction in the common carp Cyprinus carpio L. Gen. Comp. Endocrinol. 195, 47–57. Dorey, K., Amaya, E., 2010. FGF signalling: diverse roles during early vertebrate embryogenesis. Development 137, 3731–3742. FAO, 2011. FAO Yearbook of Fishery and Aquaculture Statistics 2011. FBMA, 2013. Chinese Fisheries Year Book. China Agriculture Press, China, Beijing. Fernandes-Freitas, I., Owen, B.M., 2015. Metabolic roles of endocrine fibroblast growth factors. Curr. Opin. Pharmacol. 25, 30–35. Han, S., Gao, A., Li, J., Zhang, Y., Mei, B., 2009. Review on fibroblast growth factor (FGF). J. Anhui Agric. Sci. 37, 3008–3010. Haugsten, E.M., Sorensen, V., Brech, A., Olsnes, S., Wesche, J., 2005. Different intracellular trafficking of FGF1 endocytosed by the four homologous FGF receptors. J. Cell Sci. 118, 3869–3881. Inagaki, T., Lin, V.Y., Goetz, R., Mohammadi, M., Mangelsdorf, D.J., Kliewer, S.A., 2008. Inhibition of growth hormone signaling by the fasting-induced hormone FGF21. Cell Metab. 8, 77–83. Jaye, M., Howk, R., Burgess, W., Ricca, G.A., Chiu, I.M., Ravera, M.W., O’Brien, S.J., Modi, W.S., Maciag, T., Drohan, W.N., 1986. Human endothelial cell growth
factor: cloning, nucleotide sequence, and chromosome localization. Science 233, 541–545. Jeon, Y.S., Lee, K., Park, S.C., Kim, B.S., Cho, Y.J., Ha, S.M., Chun, J., 2014. EzEditor: a versatile sequence alignment editor for both rRNA- and protein-coding genes. Int. J. Syst. Evol. Microbiol. 64, 689–691. Jiang, X.Y., Du, X.D., Tian, Y.M., Shen, R.J., Sun, C.F., Zou, S.M., 2012. Goldfish transposase Tgf2 presumably from recent horizontal transfer is active. FASEB J. 26, 2743–2752. Jonker, J.W., Suh, J.M., Atkins, A.R., Ahmadian, M., Li, P., Whyte, J., He, M., Juguilon, H., Yin, Y.Q., Phillips, C.T., Yu, R.T., Olefsky, J.M., Henry, R.R., Downes, M., Evans, R.M., 2012. A PPARgamma-FGF1 axis is required for adaptive adipose remodelling and metabolic homeostasis. Nature 485, 391–394. Kim, S.O., Loesch, K., Wang, X., Jiang, J., Mei, L., Cunnick, J.M., Wu, J., Frank, S.J., 2002. A role for Grb2-associated binder-1 in growth hormone signaling. Endocrinology 143, 4856–4867. Lim, J.Y., Kim, H., Jeun, S.S., Kang, S.G., Lee, K.J., 2006. Merlin inhibits growth hormone-regulated Raf-ERKs pathways by binding to Grb2 protein. Biochem. Biophys. Res. Commun. 340, 1151–1157. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408. Ma, L., Jiang, L., Wang, Y.Y., Cheng, A.D., Qiao, Z.G., Li, H.D., 2014. Effect of FGF1a (fibroblast frowth factor 1a) Gene on mirror carp scale development. Genomics Appl. Biol. 33, 82–87. MacDonald, I.A., Webber, J., 1995. Feeding, fasting and starvation: factors affecting fuel utilization. Proc. Nutr. Soc. 54, 267–274. Ornitz, D.M., Itoh, N., 2001. Fibroblast growth factors. Genome Biol. 2. REVIEWS 3005. Partanen, J., Armstrong, E., Makela, T.P., Korhonen, J., Sandberg, M., Renkonen, R., Knuutila, S., Huebner, K., Alitalo, K., 1992. A novel endothelial cell surface receptor tyrosine kinase with extracellular epidermal growth factor homology domains. Mol. Cell. Biol. 12, 1698–1707. Philippe, J.M., Renaud, F., Courtois, Y., Laurent, M., 1996. Cloning of multiple chicken FGF1 mRNAs and their differential expression during development of whole embryo and of the lens. DNA Cell Biol. 15, 703–715. Sato, Y., Rifkin, D.B., 1988. Autocrine activities of basic fibroblast growth factor: regulation of endothelial cell movement, plasminogen activator synthesis, and DNA synthesis. J. Cell Biol. 107, 1199–1205. Songhet, P., Adzic, D., Reibe, S., Rohr, K.B., 2007. Fgf1 is required for normal differentiation of erythrocytes in zebrafish primitive hematopoiesis. Dev. Dyn. 236, 633–643. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739.
68
D.-D. Guo et al. / General and Comparative Endocrinology 240 (2017) 61–68
Taylor, J.S., Braasch, I., Frickey, T., Meyer, A., Van de Peer, Y., 2003. Genome duplication, a trait shared by 22000 species of ray-finned fish. Genome Res. 13, 382–390. Thisse, C., Thisse, B., 2008. High-resolution in situ hybridization to whole-mount zebrafish embryos. Nat. Protoc. 3, 59–69. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882. Van de Peer, Y., Taylor, J.S., Meyer, A., 2003. Are all fishes ancient polyploids? J. Struct. Funct. Genomics 3, 65–73. Wu, S., Grunwald, T., Kharitonenkov, A., Dam, J., Jockers, R., De Luca, F., 2013. Increased expression of fibroblast growth factor 21 (FGF21) during chronic undernutrition causes growth hormone insensitivity in chondrocytes by inducing leptin receptor overlapping transcript (LEPROT) and leptin receptor overlapping transcript-like 1 (LEPROTL1) expression. J. Biol. Chem. 288, 27375– 27383.
Wu, S., Levenson, A., Kharitonenkov, A., De Luca, F., 2012. Fibroblast growth factor 21 (FGF21) inhibits chondrocyte function and growth hormone action directly at the growth plate. J. Biol. Chem. 287, 26060–26067. Yuan, X.N., Jiang, X.Y., Pu, J.W., Li, Z.R., Zou, S.M., 2011. Functional conservation and divergence of duplicated insulin-like growth factor 2 genes in grass carp (Ctenopharyngodon idellus). Gene 470, 46–52. Zhang, Q.Q., Li, F.G., Qin, B., Chen, J., Jiang, X.Y., Zou, S.M., 2015. Functional conservation and divergence of duplicated fibroblast growth factor receptor 1 (fgfr1) genes in blunt snout bream (Megalobrama amblycephala). Gene 573, 225–232. Zou, S., Kamei, H., Modi, Z., Duan, C., 2009. Zebrafish IGF genes: gene duplication, conservation and divergence, and novel roles in midline and notochord development. PLoS One 4, e7026.