Characterization, Imprinting Status and Tissue Distribution of Porcine GTL2 Gene

Agricultural Sciences in China

February 2009

2009, 8(2): 216-222

Characterization, Imprinting Status and Tissue Distribution of Porcine GTL2 Gene JIANG Cao-de and YANG Zong-lin School of Life Science, Southwest University, Chongqing 400715, P.R.China

Abstract The callipyge (CLPG) phenotype, exhibiting polar overdominance (POD), is an inherited skeletal muscle hypertrophy described in sheep. The callipyge locus maps to the distal portion of ovine chromosome 18 within the DLK1-GTL2 region and corresponds to human chromosome 14 and mouse chromosome 12. The POD phenomenon is confirmed to the homologous region of swine chromosome 7. In order to clone and investigate the expression of porcine GTL2 gene, DNA and RNA samples from 60-day-old F1 animals, generated with reciprocal crosses between Large White and Meishan breeds and their parents, were used. The authors showed that porcine GTL2 acted as a noncoding RNA. cDNA samples exhibited maternal expression of the gene in the heart, liver, spleen, lung, kidney, stomach, small intestine, skeletal muscle, and fat in pigs, and a unique tissue-specific expression different from that of humans and mice. These results indicated that the gene was conserved in the pig, human, mouse, and bovine. It will be of interest to further study the gene functions in muscle growth and fat deposition. Key words: imprinted gene, GTL2, tissue specific expression, pig

INTRODUCTION To date, more than 60 genes that exhibit parental imprinting effects are recognized in mice and humans. An intriguing feature of imprinted genes is that they are often clustered in domains, allowing concerted allelespecific regulation of neighboring imprinted genes. Imprinted genes play key roles in many aspects of development including fetal and placental growth, cell proliferation, adult behavior, human diseases, plant breeding, and apomixis in crops. Callipyge sheep have been of interest to geneticists because the phenotype exhibits hypertrophy of fasttwitching muscles and reduced adiposity without a net affect on animal growth. The callipyge phenotype is inherited in a non-Mendelian mode termed polar overdominance (POD), where only heterozygous individuReceived 12 March, 2008

als receiving the callipyge (CLPG) mutation from their sire, exhibit muscular hypertrophy (Cockett et al. 1996). Although the functional roles of the CLPG mutation are largely unknown, it has been suggested that the parentof-origin of the CLPG mutation affects the expression levels of imprinted genes in that region and that a trans interaction between these reciprocally imprinted genes, maternally expressed repressors, and paternally expressed growth-promoting targets, causes the observed muscular hypertrophy (Georges et al. 2003). A cluster of imprinted genes, delta-like homologe 1 (Dlk1), Dlk1-associated transcript (Dat), gene trap locus 2 (Gtl2/Meg3), retro-transposon like 1 (Rtl1), antiRtl1, and maternally expressed gene 8 (Meg8) is found in the CLPG region in the sheep chromosome 18, corresponding to human chromosome 14, and mouse chromosome 12 (Takada et al. 2000; Wylie et al. 2000; Charlier et al. 2001b). Of particular interest among the

Accepted 30 April, 2008

Correspondence JIANG Cao-de, Ph D, Associate Professor, Tel: +86-23-68252365, E-mail: [email protected]

© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.

Characterization, Imprinting Status and Tissue Distribution of Porcine GTL2 Gene

imprinted genes are the Dlk1 and Gtl2 genes. The Dlk1 gene encodes a transmembrane signaling molecule related to Notch-Delta family and can regulate the Notch receptor (Laborda et al. 1993; Bray et al. 2008). Dlk1 knockout mice display accelerated adiposity as well as symptoms shared with mUPD12 mice and mUPD14 humans: growth retardation, blepharophimosis, and skeletal abnormalities (Moon et al. 2002). Davis et al. (2004) demonstrated that overexpression of Dlk1 in mice leads to hypertrophy of fast-twitching muscles, further supporting the role of Dlk1 in the callipyge phenotype in sheep. The functional role of Gtl2 is unknown. Mice insertional mutation located upstream of Gtl2 results in paternally inherited partial lethality and dwarfism phenotype, and causes loss of imprinting and changes in expression of the Dlk1, Gtl2, and Meg8/Rian genes, suggesting that perturbation of Gtl2 is responsible for the growth and imprinting effects (Steshina et al. 2006). Examining the expression of DLK1 and GTL2 in the skeletal muscles of the 4 CLPG genotypes clearly indicates that elevated MEG3 expression in sheep with a maternally inherited callipyge mutation is concomitant with a reduction in DLK1. In contrast, a low level of GTL2 transcripts in postnatal + Mat/CLPGPat sheep correlates with the persistent elevation of DLK1 expression (Charlier et al. 2001a; Georges et al. 2003; Davis et al. 2004; Murphy et al. 2005). These studies make DLK1 and GTL2 the best candidate effectors and trans-acting repressor genes, respectively. The polar overdominance mode of inheritance is also present in the pig chromosomal region that is homologous to the CLPG locus in sheep (Kim et al. 2004). In order to provide important insights into the understanding of the molecular regulation of imprinted genes that are associated with human UPD14 and sheep callipyge phenotypes,

217

the imprinting status of GTL2 was investigated in this study using parental and F1 pigs from reciprocal crosses between Large White and Meishan breeds.

MATERIALS AND METHODS Molecular cloning of pig GTL2 gene A BLASTn search with the human MEG3 (AB032607), as a query against the pig dbEST database, was performed. The homologous sequences (match of > 100 bp and > 85% identity) were assembled into EST contigs. Primers that would amplify overlapping cDNA sequences were designed according to the assembled sequences (Table 1). All polymerase chain reactions were performed on a PTC-200 PCR machine (MJ Research Inc, MA, USA) using about 100 ng of cDNA, 10 pmol each oligonucleotide primer, 2.0 mM MgCl2, 200 —M of each dNTP, 2 U of Taq polymerase (TaKaRa, Dalian, China), and 1 × Taq polymerase buffer in a 25 —L volume. The thermal profile was as follows for all primer sets: 95°C 1 min; 94°C 30 s, 55-58°C 50 s (Table 1), 72°C 1 min, for 35 cycles; 72°C 10 min. The PCR products were separated by electrophoresis on a 1.5% agarose gel, purified with Agarose Gel DNA Purification (TaKaRa, Dalian, China), ligated to the pMD18-T vector (TaKaRa, Dalian, China), and sequenced commercially (Introvigen, Shanghai, China).

Analysis of heterozygous pigs for the GTL2 gene cDNA of skeletal muscle of Large White and Meishan pigs were amplified with primers GF5/R1 to search for

Table 1 Primer sequences and product size amplified in the porcine DLK1 and GTL2 genes Primer GF1 GR1 GF4 GR4 GF5 GR5 GF5 GR1 GF6 GR6 β-actinF β-actinR

Sequence (5´

3´)

CTGAGGACGCTGGGAACA CAAATCGAAGCCAAATTCATAC TGGGATGGAGCGCGCCTT GAGGCAAGTATCAGAGCAACAAGG CGTGTCTCACCGTCTCATTTATT TTTTTTTTTTTTTCCTAATCCCCAT CGTGTCTCACCGTCTCATTTATT CAAATCGAAGCCAAATTCATAC CGTGTCTCACCGTCTCATT ATGGCCTAAATGGGGATTAG TGCGGGACATCAAGGAGAAG AGTTGAAGGTGGTCTCGTGG

Size (bp)

Template

Annealing temperature (°C)

893

cDNA

57

298

cDNA

58

646

cDNA

55

242

cDNA and DNA

57

632

cDNA

56

216

cDNA and DNA

56

© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.

218

SNPs in the GTL2 gene. Sixteen F1 pigs of Large White and Meishan reciprocal crosses were examined for DNA heterozygous pigs.

Imprinting assays cDNA from tissues (heart, liver, spleen, lung, kidney, stomach, small intestine, skeletal muscle, and fat) of two-month-old heterozygous pigs were prepared according to the method described by Zhang et al. (2007). To eliminate the possibility of contamination by genomic DNA, cDNA was amplified using primer pair β-actinF/ R spanning exons 1 and 2 of pig β-actin gene (Fig.1). All imprinting assays were based on RT-PCR amplification with primers GF5/R1 followed by direct sequencing.

Quantitative detection tissue-specific expression of the GTL2 gene Relative RT-PCRs with primers GF5/R1 (Table 1) were performed to measure gene expression of porcine GTL2 gene. To ensure that no false positive PCR fragments would be generated from pseudogenes in contaminating genomic DNA, all PCR primer combinations were tested using porcine genomic DNA as a negative control. The product of reverse transcription was subjected to 33 PCR cycles, the products of which were verified as linear ranges. Pig β-actin was used to normalize GTL2 gene product. After agarose electrophoresis and staining with ethidium bromide, the quantity of the PCR products was analyzed by Band Leader software (BioRad, USA).

Bioinformatics, sequence analysis, and statistical analysis Homology analysis was performed using BLAST at NCBI (http://www.ncbi.nlm.nih.gov/). The open reading frames (ORF) and amino acid sequence were analyzed by ORF Finder software also available at NCBI. Sequence alignments and the cladogram tree were generated by the ClustalW program (http://www.ebi.ac. uk/clustalw/). One-way ANOVA followed by Tukey’s multiple comparison tests were performed on the data

JIANG Cao-de et al.

represented in Table 2.

RESULTS Identification and characterization of porcine GTL2 gene Using BLAST analysis of the NCBI GenBank database with human MEG3 gene (AB032607) as a query, the authors assembled the significant homologous pig ESTs and obtained a 1 391 bp sequence. The assembled sequence was confirmed by PCR amplification with primers GF1/R1, GF4/R4, and GF5/R5 (Fig.1) and sequencing, and a 1 383 bp sequence was submitted to GenBank under the accession number EF468461. Putative ORFs, predicated by six frames at NCBI, for the sequence revealed that there were no more than 282 nucleotides (74 amino acid residues) and no Kozak consensus sequence in the initial ATG region (Fig.2). Sequence analysis showed that porcine GTL2 gene had

Fig. 1 PCR amplification of porcine GTL2 gene. M, DNA marker DL2000; 1, GF1/R1 product (893 bp); 2, GF5/R5 product (646 bp); 3, GF4/R4 product (302 bp); 4 and 5, β-actinF/R amplification with cDNA and DNA as template, respectively (216, 313 bp). Table 2 Different expressions of GTL2 in pig tissues Tissue Brain Lung Tongue Spleen Stomach Fat Kidney Liver Skeletal muscle Heart Small intestine

Replicates

Mean ± SE

3 3 3 3 3 3 3 3 3 3 3

1.3826 ± 0.0208 A 1.1651 ± 0.0313 AB 0.9976 ± 0.0897 Bc 0.8922 ± 0.0740 Bcd 0.8611 ± 0.0418 Bcd 0.8029 ± 0.0001 cd 0.7589 ± 0.0001 cd 0.7294 ± 0.1243 cd 0.7094 ± 0.0682 cd 0.6800 ± 0.0502 d 0.5707 ± 0.0638

The values in the third column were calculated as the ratio of GTL2 to β -actin. Different letters in the third column differ significantly with upper case at 0.01 significance (P < 0.01) and lower case letter at 0.05 significance (P < 0.05).

© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.

Characterization, Imprinting Status and Tissue Distribution of Porcine GTL2 Gene

78, 80, and 81% homology to humans (AY314975), sheep (AY017220), and mice (AJ320506), respectively. Two clusters were constructed between mammalian species and other species (Fig.3). Alignment with published human BAC sequence AL117190 revealed the presence of ten exons in the mRNA sequence.

219

lelic expression of the gene was further detected in the heart, liver, spleen, lung, kidney, stomach, small intestine, and fat (data not shown). Therefore, it was concluded that GTL2 was actually imprinted and maternally expressed during development in the pig.

Imprinting analysis of porcine GTL2 gene

Quantitative analysis of tissue-specific expression of porcine GTL2 gene

To test whether GTL2 was imprinted in the pig, the authors identified a single base pair substitution (T/A) at base position 925 in the GTL2 sequence (GenBank accession no. EF468461). The primer pair GF5/R1 was thus used to amplify genomic DNA from Large White, Meishan, and F1 pigs. From direct sequencing analysis, Large White and Meishan pigs were T and A homozygotes, respectively. Three F1 progeny were found to be T/A heterozygous for the polymorphism. Allelic expression of GTL2 in tissues from the three F1 pigs was analyzed. Only the maternal allele was detected in the skeletal muscle (Fig.4). The maternal al-

GTL2 expression was measured in tissues of twomonth-old animals using relative PCR with β-actin as a control (Fig.5). The expression of β-actin was not significantly different across the tissues (P = 0.51), indicating that equivalent amount of RNA was used for cDNA synthesis and relative RT-PCR. The expression of GTL2, however, was significantly different (P < 0.001). The brain and lung had the highest GTL2 transcript abundance (P < 0.01), followed by the tongue and spleen, which had significantly greater transcript abundance than the small intestine (P < 0.01 and 0.05, respectively).

Fig. 2 Putative open reading frames (ORFs) of pig GTL2 gene predicated by six frames at NCBI. ORFs are represented by black boxes. Frame+1: 1-192, 271-510, and 1 114-1 382 nucleotide; Frame+2: 5-262, 305-565, and 686-883; Frame+3: 507-626, 639815; Frame-1: 364-468, 715-846, and 1 138-1 275; Frame-3: 1196, 470-667, 752-877, and 911-1 192. The number is based on the GTL2 gene sequence (EF468461).

Fig. 3 Cladogram tree of the GTL2 mRNA sequences of several species.

Fig. 4 Analysis of GTL2 imprinting in the skeletal muscle tissue of two-month-old offspring from a cross between Large White boar (A allele) × Meishan sow (T allele) (LM) and a cross between Meishan boar × Large White sow (ML).

© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.

220

JIANG Cao-de et al.

GTL2

β -actin

Fig. 5 Quantitative RT-PCR analysis of GTL2 expression in tissues. 1, small intestine; 2, heart; 3, tongue; 4, lung; 5, brain; 6, spleen; 7, skeletal muscle; 8, stomach; 9, fat; 10, kidney; 11, liver. GTL2 was amplified with GF5/R1 (242 bp).

DISCUSSION In this report, the authors cloned and analyzed the imprinting status of porcine GTL2 gene, which constitutes a novel imprinted locus in the pig. The similarity comparison showed that porcine GTL2 gene has high homology to other mammals, especially to humans and sheep, which is consistent with the cladogram tree in Fig.3, confirming that the GTL2 gene is highly conserved across species, and indicating that it may have a similar biological function in pigs, humans, and sheep. In humans, mice, and sheep, Gtl2 together with Dlk1 constitues an imprinted domain, which is mapped to the sheep chromosome 18, corresponding to human chromosome 14, and mouse chromosome 12 (Takada et al. 2000; Wylie et al. 2000; Kobayashi et al. 2000; Charlier et al. 2001a, b). Kim et al. (2004) mapped DLK1 to the telomeric region of pig chromosome 7. This result was consistent with a comparative map between pig chromosome 7 and human chromosome 14 (Goureau et al. 2000). Although further study needs to be performed, the authors can conclude that porcine GTL2 is located near the DLK1 gene on chromosome 7. These results show that Dlk1-Gtl2 region is conserved across mammals. The Gtl2 gene was first identified as an imprinted gene in humans and mice (Miyoshi et al. 2000), and then proved to be maternally expressed in sheep (Charlier et al. 2001b) and bovines (Dindot et al. 2004). To investigate the expression pattern of porcine GTL2 gene, the authors identified a single nucleotide polymorphism (T/A substitution) between Large White and Meishan pigs. This polymorphic site was used to determine the parental origin of the transcripts in reciprocal crosses between Large White and Meishan pigs. The authors detected the maternal expression without loss of im-

printing of GTL2 in different tissues (Fig.4). Therefore, it was concluded that the imprinting status of this gene is conserved across mammalian species, and could provide useful information in further investigation of its function in the pig. The callipyge phenotype is an inherited skeletal muscle hypertrophy described in sheep. The POD phenomenon is confirmed to the homologous region of pig chromosome 7 (Kim et al. 2004). The role of the DLK1 protein in inhibiting adipose cell development and differentiation (Sul et al. 2000) makes it the best candidate growth-promoting effector (Charlier et al. 2001a; Georges et al. 2003; Davis et al. 2004; Murphy et al. 2005). In this study, the authors noted that porcine GTL2 contained multiple small ORFs. However, none of the ATG codons of these ORFs is in the context of a strong Kozak consensus sequence for initiation of translation (Fig.3), suggesting that GTL2 has no significant ORF. This result is consistent with the study by Schuster-Gossler et al. (1998), supporting the concept that GTL2 functions as a non-coding RNA and is the trans-acting repressor gene. Despite these data, many essential regulatory mechanisms for the DLK1 and GTL2 genes remain unidentified. Recently, Zhou et al. (2007) found that MEG3 stimulates expression of the growth differentiation factor 15 (GDF15) by enhancing p53 binding to the GDF15 gene promoter, regulates the specificity of p53 transcriptional activation, and suppresses the mouse double minute 2 homolog (MDM2). This finding indicates that GTL2 might repress DLK1 not directly but through other pathways. The distribution of Gtl2 expression has been widely investigated. In humans, MEG3 is highly expressed in the pituitary and cerebellum, as well as other areas of the brain. It is also expressed in the placenta, adrenal gland, pancreas, and ovary, suggesting an endocrinerelated function. However, almost no expression is found in other tissues, such as the heart, kidney, spleen, liver, and colon (Zhang et al. 2003). In mice, Gtl2 was highly expressed in the inner ear, brain, and eye (Manji et al. 2006; McLaughlin et al. 2006). In embryonic mouse head sections, Gtl2 RNA expression was observed in the otocyst, brain, eye, cartilage, connective tissue, and muscle, but is not expressed in cell types within the lung, liver, and placenta (da Rocha et al. 2007). In accordance with the findings in humans and

© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.

Characterization, Imprinting Status and Tissue Distribution of Porcine GTL2 Gene

mice, pig GTL2 is highly expressed in the brain. However, porcine GTL2 expression is also detected in the liver, heart, spleen, fat, kidney, and skeletal muscle, though the expression is different by the tissues. These findings indicate that GTL2 has different expression patterns among mammalians, and suggest that the gene has independent tissue-specific functions.

CONCLUSION The authors report here the pig GTL2 sequence and imprinting status, and show that the gene is conserved in the pig, human, mouse, and bovine. The authors show that GTL2 is maternally expressed in several tissues examined in two-month-old pigs, and has a unique tissue-specific expression different from that of humans and mice. It will be of interest to further study the gene functions in muscle growth and fat deposition.

Acknowledgements The authors would like to thank Wang Xingxing, Southwest University, China, for the help in clone and imprinting analysis. This work was supported by the National Natural Science Foundation of China (30571331).

References Bray S J, Takada S, Harrison E, Shen S C, Ferguson-Smith A C. 2008. The atypical mammalian ligand Delta-like homologue 1 (Dlk1) can regulate Notch signalling in Drosophila. BMC Developmental Biology, 8, 11. Charlier C, Segers K, KarimL, Shay T, Gyapay G, Cockett N, Georges M. 2001a. The callipyge mutation enhances the expression of coregulated imprinted genes in cis without affecting their imprinting status. Nature Genetics, 27, 376369. Charlier C, Segers K, Wagenaar D, Karim L, Berghmans S, Jaillon O, Shay T, Weissenbach J, Cockett N, Gyapay G, Georges M. 2001b. Human-ovine comparative sequencing of a 250kb imprinted domain encompassing the callipyge (clpg) locus and identification of six imprinted transcripts: DLK1, DAT, GTL2, PEG11, antiPEG11, and MEG8. Genome Reseach, 11, 850-862. Cockett N E, Jackson S P, Shay T L, Farnir F, Berghmans S, Snowder G D, Nielsen D M, Georges M. 1996. Polar overdominance at the ovine callipyge locus. Science, 273, 236-238.

221

Davis E, Jensen C H, Schroder H D, Farnir F, Shay-Hadfield T, Kliem A, Cockett N, Georges M, Charlier C. 2004. Ectopic expression of DLK1 protein in skeletal muscle of padumnal heterozygotes causes the callipyge phenotype. Current Biology, 14, 1858-1862. Dindot S V, Kent K C, Evers B, Loskutoff N, Womack J, Piedrahita J A. 2004. Conservation of genomic imprinting at the XIST, IGF2, and GTL2 loci in the bovine. Mammalian Genome, 15, 966-974. Georges M, Charlier C, Cockett N. 2003. The callipyge locus: evidence for the trans interaction of reciprocally imprinted genes. Trends in Genetics, 19, 248-252. Goureau A, Vignoles M, Pinton P, Gellin J, Yerle M. 2000. Improvement of comparative map between porcine chromosomes 1 and 7 and human chromosomes 6, 14, and 15 by using human YACs. Mammalian Genome, 11, 796-799. Kim K S, Kim J J, Dekkers J C M, Rothschild M F. 2004. Polar overdominant inheritance of a DLK1 polymorphism is associated with growth and fatness in pigs. Mammalian Genome, 15, 552-559. Kobayashi S, Wagatsuma H, Ono R, Ichikawa H, Yamazaki M, Tashiro H, Aisaka K, Miyoshi N, Kohda T, Ogura A, Ohki M, Kaneko-Ishino T, Ishino F. 2000. Mouse Peg9/Dlk1 and human PEG9/DLK1 are paternally expressed imprinted genes closely located to the maternally expressed imprinted genes: mouse Meg3/Gtl2 and human MEG3. Genes to Cells, 5, 10291037. Laborda J, Sausville E A, Hoffman T, Notario V. 1993. dlk, a putative mammalian homeotic gene differentially expressed in small cell lung carcinoma and neuroendocrine tumor cell line. The Journal of Biological Chemistry, 268, 3817-3820 Manji S S, Sørensen B S, Klockars T, Lam T, Hutchison W, Dahl H H. 2006. Molecular characterization and expression of maternally expressed gene 3 (Meg3/Gtl2) RNA in the mouse inner ear. Journal of Neuroscience Research, 83, 181-190. McLaughlin D, Vidaki M, Renieri E, Karagogeos D. 2006. Expression pattern of the maternally imprinted gene Gtl2 in the forebrain during embryonic development and adulthood. Gene Expression Patterns, 6, 394-399. Miyoshi N, Wagatsuma H, Wakana S, Shiroishi T, Nomura1M, Aisaka K, Kohda T, Surani M A, Kaneko-Ishino T, Ishino F. 2000. Identification of an imprinted gene, Meg3/Gtl2 and its human homologue MEG3, first mapped on mouse distal chromosome 12 and human chromosome 14q. Genes to Cells, 5, 211-220. Moon Y S, Smas C M, Lee K, Villena J A, Kim K H, Yun J E, Sul H S. 2002. Mice lacking paternally expressed Pref-1/Dlk1 display growth retardation and accelerated adiposity. Molecular and Cell Biology, 22, 5585-5592. Murphy S K, Freking B A, Smith T P, Leymaster K , Nolan

© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.

222

JIANG Cao-de et al.

C M, Wylie A A, Evans H K, Randy J L. 2005. Abnormal postnatal maintenance of elevated DLK1 transcript levels in

Freeman T, Johnson M H, Paulsen M, Ferguson-Smith A C. 2000. Delta-like and Gtl2 are reciprocally expressed,

callipyge sheep. Mammalian Genome, 16, 171-183. da Rocha S T, Tevendale M, Knowles E, Takada S, Watkins M,

differentially methylated linked imprinted genes on mouse chromosome 12. Current Biology, 10, 1135-1138.

Ferguson-Smith A C. 2007. Restricted co-expression of Dlk1 and the reciprocally imprinted non-coding RNA, Gtl2:

Wylie A A, Murphy S K, Orton T C, Jirtle R L. 2000. Novel imprinted DLK1/GTL2 domain on human chromosome 14

implications for cis-acting control. Developmental Biology, 306, 810-823.

contains motifs that mimic those implicated in IGF2/H19 regulation. Genome Research, 10, 1711-1718.

Schuster-Gossler K, Bilinski P, Sado T, Ferguson-Smith A, Gossler A. 1998. The mouse Gtl2 gene is differentially

Zhang F W, Cheng H C, Jiang C D, Deng C Y, Xiong Y Z, Li F E, Lei M G. 2007. Imprinted status of pleomorphic adenoma

expressed during embryonic development, encodes multiple alternatively spliced transcripts, and may act as an RNA.

gene-like I and paternal expression gene 10 genes in pigs. Journal of Animal Science, 85, 886-890.

Developmental Dynamics, 212, 214-228. Steshina E Y, Carr M S, Glick E A, Yevtodiyenko A, Appelbe O

Zhang X, Zhou Y L, Mehta K R, Danila D C, Scolavino S, Johnson S R, Klibanski A. 2003. A pituitary-derived MEG3

K, Schmidt J V. 2006. Loss of imprinting at the Dlk1-Gtl2 locus caused by insertional mutagenesis in the Gtl2 5´ region.

isoform functions as a growth suppressor in tumor cells. The Journal of Clinical Endocrinology & Metabolism, 88, 5119-

BMC Genetics, 7, 44-64. Sul H S, Smas C, Mei B, Zhou L. 2000. Function of pref-1 as an

5126. Zhou Y L, Zhong Y, Wang Y Y, Zhang X, Batista D L, Gejman R,

inhibitor of adipocyte differentiation. International Journal of Obesity, 24, S15-S19.

Ansell P J, Zhao J, Weng C, Klibanski A. 2007. Activation of p53 by MEG3 non-coding RNA. Journal of Biology

Takada S, Tevendale M, Baker J, Georgiades P, Campbell E,

Chemistry, 282, 24731-24742. (Edited by ZHANG Juan)

© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.