Molecular structure of bovine Gtl2 gene and DNA methylation status of Dlk1-Gtl2 imprinted domain in cloned bovines

Animal Reproduction Science 127 (2011) 23–30

Contents lists available at ScienceDirect

Animal Reproduction Science journal homepage: www.elsevier.com/locate/anireprosci

Molecular structure of bovine Gtl2 gene and DNA methylation status of Dlk1-Gtl2 imprinted domain in cloned bovines Hong Su a , Dongjie Li b , Xiaohui Hou a , Beibei Tan a , Jiaqi Hu a , Cui Zhang a , Yunping Dai c , Ning Li c , Shijie Li a,∗ a b c

Department of Biochemistry and Molecular Biology, College of Life Science, Hebei Agriculture University, Baoding 071001, China College of Life Science and Life Engineering, Hebei Science and Technology University, Shijiazhuang 050018, China The State Key Laboratory for Agrobiotechnology in Livestock and Poultry, China Agricultural University, Beijing 100094, China

a r t i c l e

i n f o

Article history: Received 9 December 2010 Received in revised form 18 May 2011 Accepted 8 July 2011 Available online 19 July 2011 Key words: Somatic cell nuclear transfer Bovine Dlk1-Gtl2 Gtl2 DNA methylation Alternatively spliced transcripts

a b s t r a c t Somatic cell nuclear transfer (SCNT) is an inefficient process, which is due to incomplete reprogramming of the donor nucleus. DNA methylation of imprinted genes is essential to the reprogramming of the somatic cell nucleus in SCNT. Dlk1-Gtl2 imprinted domain has been widely studied in mouse and human. However, little is known in bovine, possibly because of limited appropriate sequences of bovine. In our study, we first isolated the cDNA sequence and found multiple transcript variants occurred in bovine Gtl2 gene, which was conserved among species. A probably 110-kb-long Dlk1-Gtl2 imprinted domain was detected on bovine chromosome 21. We identified the putative Gtl2 DMR and IG-DMR corresponding to the mouse and human DMRs and assessed the methylation status of the two DMRs and Dlk1 5 promoter in lungs of deceased SCNT bovines that died within 48 h after birth and the normal controls. In cloned bovines, Gtl2 DMR exhibited hypermethylation, which was similar to controls. However, the methylation status of IG-DMR and Dlk1 5 promoter in clones was significantly different from controls, with severe loss of methylation in IG-DMR and hypermethylation in the Dlk1 5 promoter region. Our data suggested that abnormal methylation patterns of IG-DMR may lead to the abnormal expression of Gtl2 and Dlk1 5 hypermethylated promoter is associated with the aberrant development of lungs of cloned bovines, which consequently may contribute to the low efficiency of SCNT. © 2011 Elsevier B.V. All rights reserved.

1. Introduction Somatic cell nuclear transfer (SCNT) has been successfully used in many animals (Campbell et al., 1996; Kato et al., 1998; Wakayama et al., 1998; Baguisi et al., 1999; Onishi et al., 2000; Chesné et al., 2002; Shin et al., 2002; Galli et al., 2003; Woods et al., 2003; Zhou et al., 2003; Lee et al., 2005; Li et al., 2006; Shi et al., 2007). However the low efficiency of SCNT limits its application in agriculture, medicine industry, and therapeutic cloning (Dinnyes

∗ Corresponding author. Tel.: +863127528251; fax: +863127528264. E-mail address: [email protected] (S. Li). 0378-4320/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.anireprosci.2011.07.002

et al., 2008). In the process of SCNT, the donor nucleus requires epigenetic reprogramming to a totipotent ground state (Humpherys et al., 2002) and the incomplete reprogramming of donor somatic cell nuclei has been implicated as a primary reason for the low efficiency (Dean et al., 2001). Genomic imprinting is an epigenetic phenomenon that results in an allele-specific expression, depending on its parental origin (Verona et al., 2003). DNA methylation is a common regulator of genomic imprinting and abnormal DNA methylation of imprinted genes in differential methylated regions (DMR) may result in their biallelic expression or silencing (Carr et al., 2007). Dlk1 (Delta-like 1) and Gtl2 (Gene-trap locus 2), two reciprocally imprinted genes, lie within an imprinted

24

H. Su et al. / Animal Reproduction Science 127 (2011) 23–30

domain on distal mouse chromosome 12 (Schmidt et al., 2000) and human chromosome 14 (Miyoshi et al., 2000). The altered dosage of imprinted genes in Dlk1-Gtl2 imprinted domain are involved in some defects in embryonic and placental growth (Georgiades et al., 2000; Kurosawa et al., 2002). Dlk1 encodes a transmembrane protein related to Delta/Notch, which is a growth regulator maintaining the proliferation of undifferentiated cells (Laborda et al., 1993). Gtl2 produces a non-coding RNA transcript whose function is unknown (Schuster-Gossler et al., 1998). DNA methylation is involved in maintaining the imprinting of Dlk1-Gtl2 region (Carr et al., 2007). In mouse and human, three DMRs have been determined in the Dlk1Gtl2 imprinted domain, the Dlk1 DMR, in the 3 region of Dlk1, the intergenic (IG) DMR located 70 kb downstream of Dlk1 and 15 kb upstream of Gtl2, and the Gtl2 DMR located across the Gtl2 promoter and the first exon (Fig. 2A). The IGDMR is associated with proper imprinting of linked genes on the maternal chromosome. The Gtl2 DMR may implicated in imprinting on both parental chromosomes (Takada et al., 2002; Carr et al., 2007). In somatic nuclear transfer, many cloned offspring die shortly after birth and often exhibit phenotypic abnormalities (Hill et al., 2000; Farin et al., 2004; Li et al., 2005). We previous observed Gtl2 gene was biallelic expression in brain, spleen, lung and kidney of SCNT bovines (Wang et al., 2008). In an effort to determine the DNA methylation reprogramming status of Dlk1-Gtl2 imprinted domain and the possible epigenetic causes of aberrant expression of Gtl2 in SCNT bovines, we firstly isolated the structure of Gtl2 and identified the sequences of Gtl2 DMR and IG-DMR, then investigated the methylation status of the two putative DMRs and Dlk1 5 promoter in lungs of SCNT bovines. 2. Materials and methods 2.1. Somatic cell nuclear transfer The Somatic cell nuclear transfer embryos were performed as described previously (Gong et al., 2004). The donor nuclei were obtained from skin fibroblast cells of an elite four-year-old female Holstein cow. 2.2. Tissue collection The SCNT bovines (9C3 and 9C5) died within 48 h after birth and were dissected immediately after death. Controls (Holstein cow, 9N3 and 9N4) produced by artificial insemination were also killed within 48 h after their birth. Samples of lungs from two cloned bovines and two controls were collected and frozen in liquid nitrogen until further analysis. The lung of 9C3 had atelectasis and thickened alveolar wall, and 9C5 lung had six lung lobes that did not connect and congest. 2.3. RNA extraction and reverse transcription PCR (RT-PCR) Total RNA was extracted from lung sample of one normal bovine using the Trizol RNA isolation kit (Invitrogen, China) and stored at −70 ◦ C. About 1 ␮g RNA was reverse

transcribed by Reverse Transcriptase M-MLV (TaKaRa, China). Primers Gtl2 F1 (5 -CACGCGAGAACCTCCCTA3 ) and Gtl2 R1 (5 -TCGGACCAACACTCACAACA-3 ) were designed according to Gtl2 conserved sequences in human (GenBank Accession no. NR 003530), mouse (GenBank Accession no. Y13832) and sheep (GenBank Accession no. AY017219, AY017220). Gtl2 cDNA was amplified using the following program: 94 ◦ C for 5 min, followed by 35 cycles of 94 ◦ C for 30 s, 60 ◦ C for 30 s, 72 ◦ C for 30 s, and a final extension at 72 ◦ C for 10 min. The PCR reaction mixture (25 ␮L) contained 0.5 ␮L primers (10 ␮M), 2 ␮L dNTPs (2.5 mM, Sangon, China), 1 ␮L cDNA, 2.5 ␮L 10 × PCR Buffer (TianGen, China), 18 ␮L ddH2 O and 0.5 ␮L Taq polymerase (2.5 U/␮L, TianGen, China). The PCR product was cloned into PMD18-T vectors (TaKaRa, China) and sequenced using DyeDeoxy terminators in an automated sequencer (ABI377; Applied Biosystems). 2.4. Rapid amplification of cDNA ends (3 RACE and 5 RACE) The 3 RACE and 5 RACE PCR were performed using the SMARTTM RACE cDNA Amplification Kit (Clontech, Japan). The 3 and 5 RACE first-strand cDNA was synthesized using 10 ng-1 ␮g of total RNA according to manufacturer’s protocols. RACE were performed by nested PCR. Primers were as follows: 3 GSP1 (5 -GTGTTGAAACCAGTGCCCTAGTG3 ) and 3 GSP2 (5 -GCACTGGCTAACCTCGGACTTTCG-3 ), 5 GSP1 (5 -AAGGTGAGGAAGGAAGACAGCGA-3 ) and 5 GSP2 (5 -GGGGTGGACTGAGAAAGACTGAC-3 ). In the first-round amplification, the PCR reactions contained 0.5 ␮L GSP1 (10 ␮M), 2.5 ␮L UPM (10 ␮M), 0.5 ␮L dNTPs (2.5 mM, Sangon, China), 1.25 ␮L first-strand cDNA, 2.5 ␮L 10 × PCR Buffer (TaKaRa, China), 17.25 ␮L ddH2 O and 0.5 ␮L LA Taq polymerase (TaKaRa, China). 2.5 ␮L of PCR product dilution (10×) was used as the template in the second amplifications. All the reactions contained 0.5 ␮L GSP2 (10 ␮M), 0.5 ␮L NUP (10 ␮M), 0.5 ␮L dNTPs (2.5 mM, Sangon, China), 2.5 ␮L cDNA, 2.5 ␮L 10 × PCR Buffer (TaKaRa, China), 18 ␮L ddH2 O and 0.5 ␮L LA Taq polymerase (TaKaRa, China). All the reactions were processed by touchdown PCR and the PCR conditions were as follows: predenaturation at 94 ◦ C for 5 min, 94 ◦ C for 30 s, 64 ◦ C for 30 s and 72 ◦ C for 2 min (2 cycles), 94 ◦ C for 30 s, 62 ◦ C for 30 sec and 72 ◦ C for 2 min (2 cycles), 94 ◦ C for 30 s, 60 ◦ C for 30 s and 72 ◦ C for 2 min (5 cycles), 94 ◦ C for 30 s, 58 ◦ C for 30 s and 72 ◦ C for 2 min (25 cycles), followed by 72 ◦ C for 10 min. The amplified products were cloned into PMD18-T vectors (TaKaRa, China) and sequenced as described above. 2.5. DNA extraction and bisulfite treatment Genomic DNA was extracted from lungs of two clones and two normal with the DNA Extraction kit (Sangon, China) according to the manufacturer’s instructions. The DNA samples were then stored at −20 ◦ C. Approximately 200 ng of genomic DNA was digested with EcoR I (TaKaRa, China). Then bisulfite treatment was carried out using the EZ DNA Methylation-GoldTM Kit (Zymo, USA) according to the manufacturer’s instructions. The bisulfite-converted

H. Su et al. / Animal Reproduction Science 127 (2011) 23–30

25

Table 1 Primers used for bisulfite sequencing. Region

Primers (5 –3 )

AT (◦ C)

Product size (bp)

No. of CpGs

Gtl2 DMR

Outside forward: TTTATTTTTTTGTTTTTAGTGGTGG Inside forward: TTTTTGTTTTTAGTGGTGGGTTTATA Inside reverse: CAAATTAAAAAAAACTCCCATACTCTT Outside reverse: CAAATTAAAAAAAACTCCCATACTCT

51/50

199

10

IG DMR

Outside forward: GGGGTTAGGGTAGTATGTAAGTTT Inside forward: GGGGTTAGGGTAGTATGTAAGTTT Inside reverse: CAAAAAAATACATCTAAACAAAAAA Outside reverse: CCCACCATAAATAAATAATCCC

50/48

191

9

Dlk1 Promoter

Outside forward: GTGTGAAAATTAGATGTATGAGA Inside forward: GTGTGAAAATTAGATGTATGAGA Inside reverse: TATAAAAACACATACAACAACCC Outside reverse: CACTTAAAAAAAACCTTAAAACACC

50/50

327

18

DNA was used for PCR reaction immediately or stored at −20 ◦ C for later use. 2.6. Primers design and amplification of bisulfite treated DNA We designed primers with Methprimer (http://www. urogene.org//methprimer/index1.html) and the software of Oligo 6.0 (no CpG sites within primers and 2 cytosines within primer sequence to select for converted sequences) (Lucifero et al., 2006). Bisulfited converted DNA was amplified using two rounds of hemi-nested PCR. The primers and AT (annealing temperature) were listed in Table 1. A hot start PCR was used for the first round PCR under the following conditions: an initial denaturation at 94 ◦ C for 10 min, 35 cycles of 94 ◦ C for 30 s, AT for 30 s, 72 ◦ C for 30 s, and extension at 72 ◦ C for 10 min. Each PCR reaction contained 0.5 ␮L primers (10 ␮M), 2 ␮L dNTPs (2.5 mM, Sangon, China), 2 ␮L bisulfited converted DNA, 2.5 ␮L 10 × PCR Buffer (TianGen, China), 17 ␮L ddH2 O and 0.5 ␮L DNA Taq polymerase (TianGen, China). 2 ␮L of PCR product dilution (10×) was used as the template in the second amplifications. The conditions for the second round PCR were the same as the first round PCR except the initial denaturation of 94 ◦ C for 10 min was omitted. 2.7. Cloning, DNA sequencing and statistical analysis The second round PCR products were purified and cloned into PMD18-T vectors (TaKaRa, China). Twenty clones per individual were sequenced as described in RTPCR. One clone with 50% of mCpG sites is considered “hypermethylated” (Imamura et al., 2005; Liu et al., 2008). The percentage of hypermethylated strands and the overall mCpGs in each individual were calculated. The differences of the methylation level between controls and clones were analyzed using SPSS 10.0 software. P < 0.05 indicated significantly differences between controls and clones. 3. Result 3.1. Cloning and structure analysis of the bovine Gtl2 gene The bovine Gtl2 cDNA sequences were determined by RT-PCR and RACE, and have been submitted to GenBank

(GenBank Accession no. HQ325845–HQ325851). Sequencing results of RACE indicated that two splice variants exist in 5 end and four in 3 end of bovine Gtl2 gene. The sequences of the six splice variants had high identity ranged from 72% to 94% when aligned with the ovis orthologue (GenBank Accession no. AY017217–AY017222). Comparison of bovine Gtl2 splice variants with pig Gtl2 cDNA sequence (GenBank Accession no. EF517525) indicated a range of 53–79% identity. The six splice variants had 55–75% identity to human orthologue (GenBank Accession no. NR 003530) and 48–57% identity to mouse orthologue (GenBank Accession no. Y13832). We obtained approximately 1730-bp full-length cDNA of bovine Gtl2 gene. The identity with the Gtl2 orthologue of pig, ovis, human and mouse was 83%, 75%, 57% and 48% in nucleotide sequence respectively. Alignment of cDNA sequence with published bovine chromosome 21 genomic sequence (GenBank Accession no. NW 001494068.2) revealed the presence of 8 exons in the Gtl2 gene (Fig. 1). The bovine Gtl2 molecular structure and six splice variants were shown in Fig. 1. 5 A splice variant lacks 27 nucleotides in exon 2 when aligned with 5 B splice variant. Comparison with the longest 3 C splice variant, 3 D splice variant lacks exon 4 and exon 5, 3 F splice variant lacks most of exon 3, exon 4, 5, 6 and part of exon 7. Interestingly, nearly 200-bplong intron turns to exon in 3 E splice. The bovine Gtl2 cDNA contains multiple small open reading frames (ORFs). However, none of the ATGs is consistent with Kozak consensus sequence. The longest open reading frame potentially is composed of 214 amino acids, which are encoded by part of exon 5, exon 6, 7 and most of exon 8. 3.2. Characterizations of putative DMRs in the bovine Dlk1-Gtl2 imprinted domain Comparison the Gtl2 cDNA sequences we have obtained (GenBank Accession no HQ325845–325851) and the Dlk1 cDNA sequence in NCBI (GenBank Accession no. NM 174037.2) with bovine genomic sequence, we detected that the Dlk1-Gtl2 imprinted domain spanned probably 110 kb on bovine chromosome 21. Aligning bovine Dlk1Gtl2 imprinted domain with mouse and human IG-DMR sequence, the region with high similarity was selected as putative bovine IG-DMR. The Gtl2 DMR is located around Gtl2 5 promoter and exon 1 in most species analyzed

26

H. Su et al. / Animal Reproduction Science 127 (2011) 23–30

Fig. 1. Gene structure, splice variants of the bovine Gtl2 gene. Exons are indicated by white boxes and straight lines between exons are introns. The alternative forms of exon 2, 3 and 7 are indicated by black and gray fillings. The length of each exon in the six splice variants are shown respectively. The dotted lines indicated the missed nucleotides in splice variants.

to date. We found it is conserved across human, mouse, and bovine, with 60% identity in bovine-mouse, 69% identity in bovine-human and 63% identity in human-mouse alignment. CpG Plot analysis (http://www.ebi.ac.uk/Tools/emboss/ cpgplot/) showed that the region surrounding Gtl2 5 promoter and exon 1 is marked by four CpG islands, and the first CpG island region was selected for bisulfite sequencing (position, nt 681704-nt 681902; GenBank Accession no. NW 001494068.2), which contains 10 CpG dinucleotides in a 199-bp fragment. While there are three CpG islands located in IG-DMR and the region containing the second CpG island was used for bisulfite sequencing (position, nt 672929-nt 673119; GenBank Accession no. NW 001494068.2) (Fig. 2), which was 191-bp containing 9 CpG dinucleotides. 3.3. Methylation analysis of Gtl2 DMR As shown in Fig. 3, there are various methylation patterns in controls and clones, with six in 9N4, eight types in

9N3, 9C3 and 9C5. The two controls showed 45.00% (9/20) of hypermethylated strands in 9N3 and 70.00% (14/20) in 9N4, and the average methylation level was 64.50 ± 40.25%. Each clones in 9N3 and 9N4 showed completely or nearly completely methylated or unmethylated, which demonstrated that Gtl2 DMR was differentially methylated. In the two cloned bovines, Gtl2 DMR exhibited hypermethylated, with 65.00% (13/20) in 9C3 and 85.00% (17/20) in 9C5 of hypermethylated strands. The percentage of methylated level for the two cloned bovines was 67.50 ± 38.21% (Table 2). Overall, the clones showed hypermethylation in the Gtl2 DMR, which was similar to the controls. 3.4. Methylation analysis of IG-DMR In the two controls, IG-DMR exhibited seriously hypermethylated, with 100% (20/20) of hypermethylated strands in both 9N3 and 9N4 (Fig. 4). Different from the methylation status of Gtl2 DMR, completely methylated clones of IGDMR were observed in the control fetuses. The percentage of methylation for the controls ranged from 66.67% to 100%

Fig. 2. Schematic representation of bovine Dlk1-Gtl2 imprinted domain. Gray and black boxes denote promoters and exons, respectively. The triangles show the regions used for methylation analysis.

H. Su et al. / Animal Reproduction Science 127 (2011) 23–30

27

Fig. 4. Methylation profiles of the IG-DMR in cloned bovines and controls. Opened and closed circles represent unmethylated and methylated CpGs. 9N3 and 9N4 are controls which were killed within 48 h after birth, 9C3 and 9C5 are clones which died within 48 h of birth. Fig. 3. Methylation profiles of the Gtl2 DMR in cloned bovines and controls. Opened and closed circles represent unmethylated and methylated CpGs. 9N3 and 9N4 are controls which were killed within 48 h after birth, 9C3 and 9C5 are clones which died within 48 h of birth.

and the average methylation level was 91.94 ± 10.06%. While the two cloned bovines displayed 45.00% (9/20) of hypermethylated strands in 9C3 and 75.00% (15/20) in 9C5. 9C3 and 9C5 had 67.78% and 80.56% methylation respectively, with the mean methylation level of 74.17 ± 29.28% (Table 2). Nine distinct methylation patterns were found in two controls and clones, respectively. Taken together as a group, the clones showed significantly lower methylation of IG-DMR than controls (P < 0.05). 3.5. Methylation analysis of Dlk1 5 promoter region A 327-bp sequence containing 18 CpGs in Dlk1 5 promoter region (position, nt 5193-nt 5519; GenBank Accession No. AB050725.1) was analyzed in the lungs of

cloned fetuses and controls (Fig. 2). In two controls, Dlk1 5 promoter region showed strongly heterogeneous methylation patterns, with 50.00% (10/20) in 9N3 and 45.00% (9/20) in 9N4 of hypermethylated strands (Fig. 5). Nineteen different methylation patterns of Dlk1 5 promoter in total were found in two controls. The percentages of methylated alleles for the controls ranged from 0 to 94.44%. On contrast, the clones exhibited seriously hypermethylated, with 100% (20/20) of hypermethylated strands in 9C3 and 90% (18/20) in 9C5 (Table 2). Interestingly, 9C3 showed only three methylation pattern of twenty clones and all the CpG sites in 9C3 displayed complete methylation. However, 9C5 showed strongly heterogeneous methylation of Dlk1 5 promoter, and 10 distinct methylaton patterns were found in 9C5. Results indicated that Dlk1 5 promoter region showed the mean methylation level of 87.92 ± 18.27% which seriously differ from the mean level of 41.53 ± 34.98% in controls (P < 0.05).

Table 2 Summary of DNA methylation in the bovine Dlk1-Gtl2 imprinted domain. Region

Sample

Gtl2 DMR

N C

IG-DMR

N C

Dlk1 promoter

N C

Number of clones analyzed

Percentage of strands with 50% mCpGs

Percentage of mCpGs overall

Mean methylation levels (mean ± strandard deviation%)

9N3 9N4 9C3 9C5

20 20 20 20

45.00 70.00 65.00 85.00

53.50 75.50 55.50 79.50

64.50 ± 40.25

9N3 9N4 9C3 9C5

20 20 20 20

100.00 100.00 45.00 75.00

92.22 91.67 67.78 80.56

91.94 ± 10.06

9N3 9N4 9C3 9C5

20 20 20 20

50.00 45.00 90.00 90.00

37.50 45.56 99.44 76.39

41.53 ± 34.98

N: normal control, C: clone group a Denote significant difference (P < 0.05).

67.50 ± 38.21

74.17 ± 29.28a

87.92 ± 18.27a

28

H. Su et al. / Animal Reproduction Science 127 (2011) 23–30

Fig. 5. Methylation profiles of Dlk1 5 promoter region in cloned bovines and controls. Opened and closed circles represent unmethylated and methylated CpGs. 9N3 and 9N4 are controls which were killed within 48 h after birth, 9C3 and 9C5 are clones which died within 48 h of birth.

4. Discussion The full-length cDNA of the bovine Gtl2 gene was obtained in present study. The aligned results indicated that the sequence of bovine Gtl2 shared a higher homology degree with that of sheep and pig than with human and mouse. There are 12 exons in the human and ovis Gtl2 orthologue, 10 exons in the mouse Gtl2 gene (Charlier et al., 2001). We found the bovine Gtl2 gene contains 8 exons. Gtl2/Meg3 gene is a single-copy gene, which generated multiple RNA isoforms by alternative splicing. Six splice variants of bovine Gtl2 cDNA have been identified in our study. In other mammalian species, different number isoforms of Gtl2 were revealed: 12 Meg3 cDNA isoforms were identified in human (Zhang et al., 2010), 7 transcripts of mouse Gtl2 gene were found in different cell types and at different stages of embryonic development (SchusterGossler et al., 1998), there were 5 Gtl2 cDNA isoforms in ovis (Bidwell et al., 2001) and 2 isoforms in pig (GenBank Accession no. EF517525, EF517526). Splice variants found in the bovine Gtl2 cDNA clones include fusions of exon 4 to exon 6, alternative usage of two splice donor sites in exon 2, 7 and three splice acceptor sites in exon 3. The variants contain multiple small open reading frames, but no Kozak consensus sequences for initiation of translation are found in the ATGs, suggesting that Gtl2 has no significant ORF. This result is consistent with the study in mouse (Schuster-Gossler et al., 1998), supporting that Gtl2 may function as a non-coding RNA. Additionally, the RNA encoded by Gtl2 is considered as a gene regulator by regulating single gene or influencing larger chromosomal regions in mouse (Schuster-Gossler et al., 1998). However, the function and the expression pattern of each bovine Gtl2 isform is unknown.

In this study, we identified the putative Gtl2 DMR and IG-DMR in bovine Dlk1-Gtl2 imprinted domain in order to investigate their methylation status in the lungs of SCNT bovines that died around birth and one had abnormal biallelic expression of Gtl2 (Wang et al., 2008). Despite the fact that many imprinted genes and their regulation mechanisms have been elucidated in mouse and human, little is known about the genomic imprinting in ruminants such as bovine. With many distinct advantages, bovine has become a widely used animal model (Niemann and Wrenzycki, 2000; Kues et al., 2008). In human and farm animals, the abnormality observed in pregnancies derived from assisted reproductive techniques is often found associated with the abnormal expression of imprinting genes (Suzuki et al., 2009). In SCNT, imprinting analysis is vital to define the epigenetic reprogramming degree of somatic donor cells. A better knowledge of bovine imprinting genes is essential to understand and improve in vitro culture conditions and the efficiency of SCNT. The Dlk1 and Gtl2 genes are closely associated imprinted genes, and they lie within Dlk1-Dio3 imprinted cluster, which contains at least ten imprinted genes (Cavaille et al., 2002; Hagan et al., 2009). Dlk1-Gtl2 imprinted domain has been extensively studied in mouse and human due to its relation with embryonic development and postnatal growth (Takada et al., 2000; Wylie et al., 2000; Takada et al., 2002). Furthermore, a large imprinted microRNA cluster and C/D snoRNA genes were found in the Dlk1-Gtl2 imprinted domain, which involved in imprinting control and gene regulation during development (Seitz et al., 2004). DNA methylation is one modification known to play a key role in the regulation of Dlk1-Gtl2 imprinted domain (Carr et al., 2007). In mice, the loss of methylation of Gtl2 DMR causes the altered imprinting and expression of Dlk1 and Gtl2. Deletion of the IG-DMR on the maternal chromosome causes bidirectional loss of imprinting of all genes in the imprinted cluster. However, the imprinting is unaltered after paternal transmission of the deleted IG-DMR (Lin et al., 2003; Steshina et al., 2006). Epigenetic alteration in the Dlk1-Gtl2 imprinted domain has been observed associated with tumorigenesis in human cancers (Astuti et al., 2005; Zhao et al., 2005). Dlk1-Gtl2 imprinted domain share a number of intriguing imprinting properties that well-characterized in Igf2-H19 domain, it has been proposed the imprinting in both regions may be regulated in the same way (Takada et al., 2002). Dlk1 and Igf2 are both paternally expressed, whereas Gtl2 and H19 are maternally expressed and appear to encode untranslated RNAs. Hypomethylation trends were observed in the intergenic Igf2-H19 DMR that involved in H19 allelic expression in cloned cattle (Zhang et al., 2004; Curchoe et al., 2009). Similarly, in our study, clones exhibited significantly lower methylation of IGDMR than controls, which may contributed to the abnormal expression of Gtl2 in SCNT bovines, resulting in abnormal development of fetus. In general, hypomethylation trend has been consistently observed in gene-specific regions in SCNT embryos or full term births (Curchoe et al., 2009). We previous observed H19 and Mash2 exhibit severely hypomethylation in lungs of SCNT bovines that died within 48 h after birth (Chen et al., 2008, 2010). In addition,

H. Su et al. / Animal Reproduction Science 127 (2011) 23–30

Suzuki et al. (2009), showed that day-17 embryos exhibited extensive loss of methylation in Snrpn DMR (Suzuki et al., 2009). On contrast, Dlk1 5 promoter region in cloned bovines showed hypermethylation (87.92%), which was about 46.00% more than that of controls (41.93%). As we know, Dlk1 was identified as a downstream target of the pleiotrophin/␤-catenin pathway, which regulate fetal lung development (Weng et al., 2009). So the severely differences of DNA methylation in Dlk1 between clones and controls may associated with the aberrant development of lungs of cloned bovines, which may lead to the low efficiency of SCNT. In conclusion, the different findings from DNA methylation studies in SCNT mammals are due to different species and tissues used, different genes or genomic regions examined (Kang et al., 2001; Ohgane et al., 2001; Couldrey and Lee, 2010) To our knowledge, this is the first study to identify putative DMRs and compare the methylation status of Dlk1-Gtl2 imprinted domain in SCNT bovines. The aberrant methylation of IG-DMR and Dlk1 5 promoter region in cloned bovines might account for the inefficiency of SCNT. More studies are needed to determine if other mechanisms such as histone acetylation, microRNA play an important role in the improper reprogramming and the low efficiency of SCNT. Acknowledgements This study was supported by the Natural Scientific Foundation of China (30972098) and National Transgene Major Program (2011ZX08009-002 and 2009ZX0801024B). References Astuti, D., Latif, F., Wagner, K., Gentle, D., Cooper, W.N., Catchpoole, D., Grundy, R., Ferguson-Smith, A.C., Maher, E.R., 2005. Epigenetic alteration at the Dlk1-Gtl2 imprinted domain in human neoplasia: analysis of neuroblastoma, phaeochromocytoma and Wilms’tumour. Br. J. Cancer. 92, 1574–1580. Baguisi, A., Behboodi, E., Melican, D.T., Pollock, J.S., Destrempes, M.M., Cammuso, C., Williams, J.L., Nims, S.D., Porter, C.A., Midura, P., Palacios, M.J., Ayres, S.L., Denniston, R.S., Hayes, M.L., Ziomek, C.A., Meade, H.M., Godke, R.A., Gavin, W.G., Overström, E.W., Echelard, Y., 1999. Production of goats by somatic cell nuclear transfer. Nat. Biotechnol. 17, 456–461. Bidwell, C.A., Shay, T.L., Georges, M., Beever, J.E., Berghmans, S., Cockett, N.E., 2001. Differential expression of the Gtl2 gene within the callipyge region of ovine chromosome 18. Anim. Genet. 32, 248–256. Campbell, K.H., McWhir, J., Ritchie, W.A., Wilmut, I., 1996. Sheep cloned by nuclear transfer from a cultured cell line. Nature 380, 64–66. Carr, M.S., Yevtodiyenko, A., Schmidt, C.L., Schmidt, J.V., 2007. Allelespecific histone modifications regulate expression of the Dlk1-Gtl2 imprinted domain. Genomics 89, 280–290. Cavaille, J., Seitz, H., Paulsen, M., Ferguson-Smith, A.C., Bachellerie, J.P., 2002. Identification of tandemly-repeated C/D snoRNA genes at the imprinted human 14q32 domain reminiscent of those at the PraderWilli/Angelman syndrome region. Hum. Mol. Genet. 11, 1527–1538. Charlier, C., Segers, K., Wagenaar, D., Karim, L., Berghmans, S., Jaillon, O., Shay, T., Weissenbach, J., Cockett, N., Gyapay, G., Georges, M., 2001. Human-ovine comparative sequencing of a 250-kb imprinted domain encompassing the Callipyge (clpg) locus and identification of six imprinted transcripts: DLK1, DAT, Gtl2, PEG11, antiPEG11, and MEG8. Genome Res. 11, 850–862. Chen, J., Li, D.J., Liu, Y.Q., Zhang, C., Dai, Y.P., Li, S.J., Li, N., 2008. DNA methylation status of H19 and Xist genes in lungs of somatic cell nuclear transfer bovines. Chin. Sci. Bull. 53, 1996–2001. Chen, J., Li, D.J., Zhang, C., Li, N., Li, S.J., 2010. DNA methylation status of mash2 in lungs of somatic cell cloning bovines. Prog. Biochem. Biophys. 37, 960–966.

29

Chesné, P., Adenot, P.G., Viglietta, C., Baratte, M., Boulanger, L., Renard, J.P., 2002. Cloned rabbits produced by nuclear transfer from adult somatic cells. Nat. Biotechnol. 20, 366–369. Couldrey, C., Lee, R.S., 2010. DNA methylation patterns in tissues from midgestation bovine foetuses produced by somatic cell nuclear transfer show subtle abnormalities in nuclear reprogramming. BMC Dev. Bio. 10, 27. Curchoe, C.L., Zhang, S., Yang, L., Page, R., Tian, X.C., 2009. Hypomethylation trends in the intergenic region of the imprinted Igf2 and H19 genes in cloned cattle. Anim. Reprod. Sci. 116, 213–225. Dean, W., Santos, F., Stojkovic, M., Zakhartchenko, V., Walter, J., Wolf, E., Reik, W., 2001. Conservation of methylation reprogramming in mammalian development: aberrant reprogramming in cloned embryos. Proc. Natl. Acad. Sci. U.S.A. 98, 13734–13738. Dinnyes, A., Tian, X.C., Yang, X., 2008. Epigenetic regulation of foetal development in nuclear transfer animal models. Reprod. Domest. Anim. 43, 302–309. Farin, C.E., Farin, P.W., Piedrahita, J.A., 2004. Development of fetuses from in vitro produced and cloned bovine embryos. J. Anim. Sci. 82, 53–62. Galli, C., Lagutina, I., Crotti, G., Colleoni, S., Turini, P., Ponderato, N., Duchi, R., Lazzari, G., 2003. Pregnancy: a cloned horse born to its dam twin. Nature 424, 635. Georgiades, P., Watkins, M., Surani, M.A., Ferguson-Smith, A.C., 2000. Parental origin-specific developmental defects in mice with uniparental disomy for chromosome 12. Development 127, 4719– 4728. Gong, G.C., Dai, Y.P., Zhu, H.B., Wang, H.P., Wang, L.L., Li, R., Wan, R., Liu, Y., Li, N., 2004. Production of transgenic blastocysts by nuclear transfer from different types of somatic cells in cattle. Sci. China C: Life Sci. 47, 183–189. Hagan, J.P., O’Neill, B.L., Stewart, C.L., Kozlov, S.V., Croce, C.M., 2009. At least ten genes define the imprinted Dlk1-Dio3 cluster on mouse chromosome 12qF1. PloS ONE 4, e4352. Hill, J.R., Burghardt, R.C., Jones, K., Long, C.R., Looney, C.R., Shin, T., Spencer, T.E., Thompson, J.A., Winger, Q.A., Westhusin, M.E., 2000. Evidence for placental abnormality as the major cause of mortality in first-trimester somatic cell cloned bovine fetuses. Biol. Reprod. 63, 1787–1794. Humpherys, D., Eggan, K., Akutsu, H., Friedman, A., Hochedlinger, K., Yanagimachi, R., Lander, E.S., Golub, T.R., Jaenisch, R., 2002. Abnormal gene expression in cloned mice derived from embryonic stem cell and cumulus cell nuclei. Proc. Natl. Acad. Sci. 99, 12889– 12894. Imamura, T., Kerjean, A., Heams, T., Kupiec, J.J., Thenevin, C., Paldi, A., 2005. Dynamic CpG and non-CpG methylation of the Peg1/Mest gene in the mouse oocyte and preimplantation embryo. J. Biol. Chem. 280, 20171–20175. Kang, Y.K., Koo, D.B., Park, J.S., Choi, Y.H., Kim, H.N., Chang, W.K., Lee, K.K., Han, Y.M., 2001. Typical demethylation events in cloned pig embryos. J. Biol. Chem. 276, 39980–39984. Kato, Y., Tani, T., Sotomaru, Y., Kurokawa, K., Kato, J., Doguchi, H., Yasue, H., Tsunoda, Y., 1998. Eight calves cloned from somatic cells of a single adult. Science 282, 2095–2098. Kues, W.A., Sudheer, S., Herrmann, D., Carnwath, J.W., Havlicek, V., Besenfelder, U., Lehrach, H., Adjaye, J., Niemann, H., 2008. Genome-wide expression profiling reveals distinct clusters of transcriptional regulation during bovine preimplantation development in vivo. Proc. Natl. Acad. Sci. U.S.A. 105, 19768–19773. Kurosawa, K., Sasaki, H., Sato, Y., Yamanaka, M., Shimizu, M., Ito, Y., Okuyama, T., Matsuo, M., Imaizumi, K., Kuroki, Y., Nishimura, G., 2002. Paternal UPD14 is responsible for a distinctive malformation complex. Am. J. Med. Genet. 10, 268–272. Laborda, J., Sausville, E.A., Hoffman, T., Notario, V., 1993. dlk, a putative mammalian homeotic gene differentially expressed in small cell lung carcinoma and neuroendocrine tumor cell line. J. Biol. Chem. 268, 3817–3820. Lee, B.C., Kim, M.K., Jang, G., Oh, H.J., Yuda, F., Kim, H.J., Hossein, M.S., Kim, J.J., Kang, S.K., Schatten, G., Hwang, W.S., 2005. Dogs cloned from adult somatic cells. Nature 436, 604. Li, S., Li, Y., Du, W., Zhang, L., Yu, S., Dai, Y., Zhao, C., Li, N., 2005. Aberrant gene expression in organs of bovine clones that die within two days after birth. Biol. Reprod. 72, 258–265. Lin, S.P., Youngson, N., Takada, S., Seitz, H., Reik, W., Paulsen, M., Cavaille, J., Ferguson-Smith, A.C., 2003. Asymmetric regulation of imprinting on the maternal and paternal chromosomes at the Dlk1-Gtl2 imprinted cluster on mouse chromosome 12. Nat. Genet. 35, 97–102. Liu, J.H., Yin, S., Xiong, B., Hou, Y., Chen, D.Y., Sun, Q.Y., 2008. Aberrant DNA methylation imprints in aborted bovine clones. Mol. Reprod. Dev. 75, 598–607.

30

H. Su et al. / Animal Reproduction Science 127 (2011) 23–30

Li, Z., Sun, X., Chen, J., Liu, X., Wisely, S.M., Zhou, Q., Renard, J.P., Leno, G.H., Engelhardt, J.F., 2006. Cloned ferrets produced by somatic cell nuclear transfer. Dev. Biol. 293, 439–448. Lucifero, D., Suzuki, J., Bordionon, V., Martel, J., Vigneault, C., Therrien, J., Filion, F., Smith, L.C., Trasler, J.M., 2006. Bovine SNRPN methylation imprint in oocytes and day 17 in vitro produced and somatic cell nuclear transfer embryos. Biol. Reprod. 75, 531–538. Miyoshi, N., Wagatsuma, H., Wakana, S., Shiroishi, T., Nomura, M., Aisaka, K., Kohda, T., Surani, M.A., Kaneko-Ishino, T., Ishino, F., 2000. Identification of an imprinted gene, Meg3/Gtl2 and its human homologue Meg3, first mapped on mouse distal chromosome 12 and human chromosome 14q. Genes. Cells. 5, 211–220. Niemann, H., Wrenzycki, C., 2000. Alterations of expression of developmentally importantgenes in preimplantation bovine embryos by in vitro culture conditions: implications for subsequent development. Theriogenology 53, 21–34. Ohgane, J., Wakayama, T., Kogo, Y., Senda, S., Hattori, N., Tanaka, S., Yanagimachi, R., Shiota, K., 2001. DNA methylation variation in cloned mice. Genesis 30, 45–50. Onishi, A., Iwamoto, M., Akita, T., Mikawa, S., Takeda, K., Awata, T., Hanada, H., Perry, A.C., 2000. Pig cloning by microinjection of fetal fibroblast nuclei. Science 289, 1188–1190. Schmidt, J.V., Matteson, P.G., Jones, B.K., Guan, X.J., Tilghman, S.M., 2000. The Dlk1 and Gtl2 genes are linked and reciprocally imprinted. Genes. Dev. 14, 1997–2002. Schuster-Gossler, K., Bilinski, P., Sado, T., Ferguson-Smith, A., Gossler, A., 1998. The mouse Gtl2 gene is differentially expressed during embryonic development, encodes multiple alternatively spliced transcripts, and may act as an RNA. Dev. Dyn. 212, 214–228. Seitz, H., Royo, H., Bortolin, M.L., Lin, S.P., Ferguson-Smith, A.C., Cavaille, J., 2004. A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain. Genome Res. 14, 1741–1748. Shin, T., Kraemer, D., Pryor, J., Liu, L., Rugila, J., Howe, L., Buck, S., Murphy, K., Lyons, L., Westhusin, M., 2002. A cat cloned by nuclear transplantation. Nature 415, 859. Shi, D., Lu, F., Wei, Y., Cui, K., Yang, S., Wei, J., Liu, Q., 2007. Buffalos (Bubalus bubalis) cloned by nuclear transfer of somatic cells. Biol. Reprod. 77, 285–291. Steshina, E.Y., Carr, M.S., Glick, E.A., Yevtodiyenko, A., Appelbe, O.K., Schmidt, J.V., 2006. Loss of imprinting at the Dlk1-Gtl2 locus caused by insertional mutagenesis in the Gtl2 5 region. BMC Genet. 7, 44. Suzuki Jr., J., Therrien, J., Filion, F., Lefebvre, R., Goff, A.K., Smith, L.C., 2009. In vitro culture and somatic cell nuclear transfer affect imprinting of SNRPN gene in pre-and post-implantation stages of development in cattle. BMC Dev. Biol. 9, 9.

Takada, S., Paulsen, M., Tevendale, M., Tsai, C.E., Kelsey, G., Cattanach, B.M., Ferguson-Smith, A.C., 2002. Epigenetic analysis of the Dlk1Gtl2 imprinted domain on mouse chromosome 12: implications for imprinting control from comparison with Igf2-H19. Hum. Mol. Genet. 11, 77–86. Takada, S., Tevendale, M., Baker, J., Georgiades, P., Campbell, E., Freeman, T., Johnson, M.H., Paulsen, M., Ferguson-Smith, A.C., 2000. Delta-like and Gtl2 are reciprocally expressed, differentially methylated linked imprinted genes on mouse chromosome 12. Curr. Biol. 10, 1135– 1138. Verona, R.I., Mann, M.R., Bartolomei, M.S., 2003. Genomic imprinting: intricacies of epigenetic regulation in clusters. Annu. Rev. Cell. Dev. Biol. 19, 237–259. Wakayama, T., Perry, A.C., Zuccotti, M., Johnson, K.R., Yanagimachi, R., 1998. Full-term development of mice from enucleated oocytes injected with cumulus cell nuclei. Nature 394, 369–374. Wang, J.C., Li, D.J., Du, W.H.F., Li, B.L., Li, N.S.J., 2008. Genomic imprinting of GTL2 in somatic cell nuclear transfer cattle. Prog. Biochem. Biophys. 35, 1183–1187. Weng, T., Gao, L., Bhaskaran, M., Guo, Y., Gou, D., Narayanaperumal, J., Chintagari, N.R., Zhang, K., Liu, L., 2009. Pleiotrophin regulates lung epithelial cell proliferation and differentiation during fetal lung development via beta-catenin and Dlk1. J. Biol. Chem. 284, 28021– 28032. Woods, G.L., White, K.L., Vanderwall, D.K., Li, G.P., Aston, K.I., Bunch, T.D., Meerdo, L.N., Pate, B.J., 2003. A mule cloned from fetal cells by nuclear transfer. Science 301, 1063. Wylie, A.A., Murphy, S.K., Orton, T.C., Jirtle, R.L., 2000. Novel imprinted Dlk1/Gtl2 domain on human chromosome 14 contains motifs that mimic those implicated in Igf2/H19 regulation. Genome Res. 10, 1711–1718. Zhang, S., Kubota, C., Yang, L., Zhang, Y., Page, R., O’Neill, M., Yang, X., Tian, X.C., 2004. Genomic imprinting of H19 in naturally reproduced and cloned cattle. Biol. Reprod. 71, 1540–1544. Zhang, X., Gejman, R., Mahta, A., Zhong, Y., Rice, K.A., Zhou, Y., Cheunsuchon, P., Louis, D., Klibanski, A., 2010. Maternally expressed gene 3, an imprinted noncoding RNA gene, is associated with meningioma pathogenesis and progression. Cancer Res. 70, 2350–2358. Zhao, J., Dahle, D., Zhou, Y., Zhang, X., Klibanski, A., 2005. Hypermethylation of the promoter region is associated with the loss of Meg3 gene expression in human pituitary tumors. J. Clin. Endocrinol. Metab. 90, 2179–2186. Zhou, Q., Renard, J.P., Le, Friec.G., Brochard, V., Beaujean, N., Cherifi, Y., Fraichard, A., Cozzi, J., 2003. Generation of fertile cloned rats by regulating oocyte activation. Science 302, 1179.