- Email: [email protected]
Expression and methylation status of imprinted genes in placentas of deceased and live cloned transgenic calves
Available online at www.sciencedirect.com
Theriogenology 75 (2011) 1346 –1359 www.theriojournal.com
Expression and methylation status of imprinted genes in placentas of deceased and live cloned transgenic calves Jian-min Su, Bo Yang, Yong-sheng Wang, Yan-yan Li, Xian-rong Xiong, Li-jun Wang, Ze-kun Guo, Yong Zhang* College of Veterinary Medicine, Northwest A&F University, Key Laboratory of Animal Reproductive Physiology & Embryo Technology, Ministry of Agriculture, Yangling, Shaanxi 712100, PR China Received 1 July 2010; received in revised form 30 November 2010; accepted 30 November 2010
Abstract Placental deficiencies are linked with developmental abnormalities in cattle produced by somatic cell nuclear transfer (SCNT). To investigate whether the aberrant expression of imprinted genes in placenta was responsible for fetal overgrowth and placental hypertrophy, quantitative expression analysis of six imprinted genes (H19, XIST, IGF2R, SNRPN, PEG3, and IGF2) was conducted in placentas of: 1) deceased (died during perinatal period) transgenic calves (D group, n ⫽ 4); 2) live transgenic calves (L group, n ⫽ 15); and 3) conventionally produced (control) female calves (N group, n ⫽ 4). In this study, XIST, PEG3 and IGF2 were significantly over-expressed in the D group, whereas expression of H19 and IGF2R was significantly reduced in the D group compared to controls. The DNA methylation patterns in the differentially methylated region (DMR) from H19, XIST, and IGF2R were compared using Bisulfite Sequencing PCR (BSP) and Combined Bisulfite Restriction Analysis (COBRA). In the D group, H19 DMR was significantly hypermethylated, but XIST DMR and IGF2R ICR were significantly hypomethylated compared to controls. In contrast, there were no noticeable differences in the expression and DNA methylation status of imprinted genes (except DNA methylation level of XIST DMR) in the L group compared to controls. In conclusion, altered DNA methylation levels in the DMRs of imprinted genes in placentas of deceased transgenic calves, presumably due to aberrant epigenetic nuclear reprogramming during SCNT, may have been associated with abnormal expression of these genes; perhaps this caused developmental insufficiencies and ultimately death in cloned transgenic calves. © 2011 Elsevier Inc. All rights reserved. Keywords: DNA methylation; Imprinted gene; SCNT; Cloned transgenic cow
1. Introduction Although generation of transgenic livestock by somatic cell nuclear transfer (SCNT) has great potential for producing valuable recombinant proteins and breeding disease-resistant livestock, there is a high incidence
* Corresponding author: Tel.: ⫹86 29 87080085; fax: ⫹86 29 87080085. E-mail address: [email protected] (Y. Zhang); sujianmin@ gmail.com (J.M. Su). 0093-691X/$ – see front matter © 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.theriogenology.2010.11.045
of abnormalities in SCNT clones. Developmental abnormalities of cloned animals usually involve the placenta in several species [1], including cattle [2– 4], mice [5,6], pigs [7], and sheep [8]. Most cloned animals die in utero, due to placental deficiency [9]. The placenta may be more prone to aberrancies than the fetus in SCNT animals: several genes were abnormally expressed in the placenta, but not in the fetus, of cloned mice [10], pigs [11], and cattle [12]. Therefore, it has been proposed that the placental abnormality may be the main cause of cloned fetal death.
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359
It is generally believed that the principal cause of developmental abnormalities of fetus and placenta in cloned animals is aberrant epigenetic nuclear reprogramming of the donor somatic cell, which involves various epigenetic modifications. Methylation of DNA is a major epigenetic modification of the genome, with a crucial role in nuclear reprogramming during SCNT. Vertebrate DNA methylation preferentially occurs at the 5’ position of cytosine in CpG dinucleotides, which are mostly found in clusters termed CpG islands [13]. Generally, DNA methylation in differentially methylated regions (DMRs), which predominantly occurs in the promoter or the first exon of a gene [14], represses gene transcription [15]. Imprinted genes are expressed from only one of the two chromosome homologues in a parent-of-origindependent manner, regulated primarily by DNA methylation in imprinting control regions (ICRs). Most imprinted genes have roles in regulating fetal and placental growth; therefore, aberrant imprinting leads to developmental anomalies. Since many developmental defects in cloned cattle were similar to experimentally produced imprinting disruptions in mice, as well as naturally occurring imprinting diseases in humans, it has been proposed that imprinting disruptions in the nuclear reprogramming process may be related to defects in clones [12]. There are reports regarding aberrant DNA methylation and expression of imprinted genes in cloned embryos [16 –21] and fetuses [22–26], but fewer studies have examined DNA methylation and expression of imprinted genes in the placenta. The expression of several imprinted genes was abnormally reduced in cloned mice placentas [10], but not fetuses. The imprinted gene IGF2R was also found aberrantly allelic expressed in placenta, whereas there were no differences in organs of cloned calves [12]. In a recent study, there were aberrant mRNA and DNA methylation levels of several imprinted genes in placentas of dead cloned piglets [11]. Therefore, DNA methylation and expression of imprinted genes in placenta were closely associated with development of cloned animals. We recently produced 21 transgenic Human -defensin-3 (hBD-3) calves by SCNT, including 17 live transgenic clones and four dead transgenic clones (unpublished). In the present study, the mRNA level was determined (quantitative real-time PCR) for six imprinted genes (H19, XIST, IGF2R, SNRPN, PEG3, and IGF2) in placentas of live and dead transgenic clones. In addition, DNA methylation status of H19 DMR, XIST DMR, and IGF2R ICR was determined by Bisulfite Sequencing PCR (BSP) and Combined Bisulfite Restriction Analysis (COBRA).
1347
2. Materials and methods 2.1. Production of transgenic calves and collection of samples Construction of the human -defensin-3 gene vector and the preparation of competent hBD-3 transgenic donor cells were conducted as described [27,28]. Oocyte collection and in vitro maturation (IVM), SCNT, activation of reconstructed embryos, culture of cloned embryos, embryo transfer, and pregnancy diagnosis were performed as described [29,30]. Briefly, oocytes were recovered from abbatoir-derived ovaries, and matured in vitro in tissue culture medium 199 (TCM-199; Gibco, BRL, Grand Island, NY, USA), supplemented with 10% (v/v) FBS, 1 g/mL 17 -estradiol, and 0.075 IU/mL Human Menopausal Gonadotropin (HMG) for 20 h. Oocytes with an extruded first polar body were selected and stained with 10 g/mL Hoechst 33342 for 10 min prior to enucleation. The first polar body and the small amount of surrounding cytoplasm was removed from oocytes with a glass pipette (inner diameter, 20 m) in PBS microdrops supplemented with 7.5 g/mL cytochalasin B (CB) and 10% FBS. The expelled cytoplasm was examined under ultraviolet radiation to confirm removal of nuclear material. Disaggregated transgenic donor cells were transferred to the previtelline space of enucleated oocytes. The oocyte-cell couplet was sandwiched with a pair of platinum electrodes connected to the micromanipulator in microdrops of Zimmermann’s fusion medium, and a double electrical pulse of 35 V for 10 s was applied for oocyte-cell fusion. Reconstructed embryos were kept in SOFaa containing 5 g/mL cytochalasin B for 2 h until activation. Cloned embryos were activated in 5 M Ionomycin for 4 min, followed by 4 h exposure to 1.9 mM dimethynopyridine in SOFaa. Activated embryos were then cultured in SOFaa with 8 mg/mL BSA in a humidified atmosphere of 5% CO2 in air at 38.5 °C. Fresh Day 7 blastocysts were nonsurgically transferred (one embryo per recipient) to the uterine horn ipsilateral to the CL of 200 Red Angus recipients, 7 d after standing estrus. Of the 21 cloned trangenic calves that were born, 17 were born alive (designated GT09001 to GT09017), whereas four died during the perinatal period (named D1, D2, D3, D4) as a result of LOS. Clones, as well as normal control calves (described below) were delivered by Cesarean section. Afterwards, recipients were slaughtered, the uterine horns opened, and all placentomes dissected. Calf weight, placenta weight, placentome number, and placentome weight were determined. Transgenic calves were identified by PCR screening, Southern blotting, and FISH mapping (unpublished data).
1348
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359
Table 1 Primers for quantitative real-time PCR for characterization of bovine placentas. Genes H19 XIST IGF2R SNRPN PEG3 IGF2 GAPDH
Primer sequences (5’-3’) F†: AGAGATGGTGCTACCCAGCTCA Ra: TGTAGTGGTTCCAAAATGCAGC F: AACCTCACGCCATTCCTCTG R: GGGTAGGTGTTCCTCTTGAG F: CTACGACCTGACCGAGTG R: TGACAGCCTCCCAGTTG F: GGGACCGTTTACACTTGAGAC R: GGAAATCCACCACAGGTACT F: CGCCAAAGTCAGGGAGAG R: CTTAACTGCCAGGACACC F: GCATCGTGGAAGAGTGTTGCTT R: TCGTAGAGGCAGACACATCCCT F: CGACTTCAACAGCGACACTCAC R: CCCTGTTGCTGTAGCCAAATTC
Tann* (°C)
Product size (bp)
Reference
AY849926
Accession no.
60
101
[23]
AF104906
56
226
[32]
NM_174352
60
95
[31]
NM_174463
60
153
[31]
AY427787
60
150
[31]
NM_174087
60
102
[23]
NM_001034034
60
118
[23]
* Annealing temperature. † Forward primer. a Reverse primer.
In the present study, placentas were divided into three groups: N, D, and L. The N group was normal controls, which were placentas of four female Holstein calves (N1, N2, N3, and N4), produced by normal sexual reproduction. The D group was placentas of four deceased transgenic calves with LOS (D1, D2, D3, and D4), whereas the L group were 15 placentas of all live transgenic calves, except GT09001 and GT09013 (placentas were missing). Clones GT09012 and GT09013 were from a twin pregnancy. The semen sample was collected from a normal adult male bull. All experimental procedures were approved by the Animal Care Commission of the College of Veterinary Medicine, Northwest A&F University. 2.2. Quantitative real-time PCR Placental total RNA was extracted with TRIZOL reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. The quality and quantity of the extracted RNA were determined using an Epoch MultiVolume Spectrophotometer System (BioTek, Winooski, VT, USA), then the total RNA samples were treated with RNA-free Dnase I (Invitrogen) to digest genomic DNA in the RNA samples, and stored at -80 °C. Synthesis of cDNA was done using PrimeScriptTM RT Reagent Kit (TaKaRa, Tokyo, Japan) with a total volume of 20 L (4 L 5⫻RT buffer, 1 L RT enzyme Mix, 1 L Oligo dT Primer, 1 L Random 6 mers, 1 g RNA, and up to 20 L RNase-free dH2O). The expression levels of the six imprinted genes were quantified on a CFX96 real-time PCR detection system (Bio-Rad, Hercules, CA, USA) using SYBR Premix Ex Taq™ (TaKaRa). The primers for
quantitative PCR were synthesized (Table 1) according to previous reports [23,31,32]. Reactions were performed in Low Tube Strips (Bio-Rad). Each reaction mixture (20 L) contained 2 L (⬃100 ng) cDNA template, 10 L SYBR® Premix Ex Taq ™ ll (2⫻), 0.8 L of both PCR forward and reverse primers (10 M), and 6.4 L dH2O. Thermal cycling conditions were 95 °C for 1 min, followed by 40 PCR cycles of 5 s at 95 °C for DNA denaturation, and 30 s at 60 °C (56 °C for XIST) for primer annealing and extension. The melting protocol was 65 to 95 °C (in increments of 0.5 °C/5 s). Transcripts of six imprinted genes (H19, XIST, IGF2R, SNRPN, PEG3, and IGF2) were quantified in three replicates and calculated relative to the transcription in every sample of the housekeeping gene, GAPDH (endogenous control). The specificity of the PCR reaction was confirmed by gel electrophoresis on a 2.5% agarose gel and by a single peak in the melt curve. As a negative control, dH2O replaced cDNA in real-time reaction tubes. The results of RT-PCR are presented as CT value (mean ⫾ SD), where CT was defined as the threshold cycle number of PCRs at which the amplified product was first detected. The 2–⌬⌬CT method [33] was used to quantify the relative mRNA levels using the following formula: ⌬CT ⫽ CT共target
gene兲
⫺ CT共GADPH兲, and
⌬⌬CT ⫽ ⌬CT共sample兲 ⫺ ⌬CT共control兲. The relative levels of mRNA was calculated as
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359
1349
Table 2 Primers for BS PCR of bovine placenta. Genes H19 XIST IGF2R
Primer sequences (5’-3’) F†: AAGGGAGGTTAGGGTATAGGTAGG Ra: TAACCAAAAACATCAAAAAAACAAC F: TTTTGTTGTAGGGATAATATGGTTGA R: CCACCCTTTCTAATTAAATAAAACAC F: AGTTGGGTAGGGGGTTTTTTT R:CTCAACACCTTACTCAAAACCTACC
Accession no.
Tann* (°C)
Product size (bp)
AY849926
55.5
193
AF104906
57.8
222
DQ835615.1
56.3
163
* Annealing temperature. † Forward primer. a Reverse primer. Table 3 Fetal weight, placental weight, placentome number and weigh among normally reproduced (N group), deceased transgenic cloned (D group), and live transgenic cloned (L group) calves*. Parameter Fetal weight (kg) Placental weight (kg) No. of placentomes Placentome weight (Mean g)
N group (n ⫽ 4)
D group (n ⫽ 4)
L group (n ⫽ 15)
43.23 ⫾ 1.06 7.78 ⫾ 0.40 101 ⫾ 7 71.50 ⫾ 22.29
58.38 ⫾ 9.45a 8.13 ⫾ 0.79† 74 ⫾ 1† 135.00 ⫾ 33.80†
50.41 ⫾ 3.04a 7.85 ⫾ 0.68 91 ⫾ 16 76.67 ⫾ 40.14
* Values are presented as the mean ⫾ SD. † (P ⬍ 0.05). a (P ⬍ 0.01) denote differences between D group and N group, L group and N group, respectively.
2–⌬⌬CT. For ease of comparison, the average expression level of each gene from the control group was set as 1. 2.3. Bisulfite Sequencing PCR analysis Genomic DNA was extracted from placenta and sperm using a TIANamp Genomic DNA Kit (Tiangen, Beijing, China) and subjected to sodium bisulfite treatment, using an EZ DNA Methylation-GoldTM Kit (Zymo Research, Orange, CA, USA), in accordance with the instruction manual, with minor modifications. Briefly, 130 L CT Conversion Reagent was added to a 20 L DNA sample (500 to 900 ng) in a PCR tube. If the DNA sample volume was ⬍ 20 L, dH2O was added to bring the sample to volume. Sample tubes were placed in the DNA engine (MJ Research, Waltham, MA, USA) with 10 min at 95 °C for DNA denaturation, and 2.5 h at 64 °C for C-T conversion. Modified DNA was then desalted, purified, and eluted with 15 L elution buffer. Subsequently, Bisulfite Sequencing PCR (BS-PCR) was immediately carried out using 2 L of modified DNA per PCR run, or stored at -80 °C avoiding freeze thawing. Three separate bisulfite modification treatments were performed for each DNA sample. The CpG islands were predicted using MethPrimer software [34]. Amplified regions were chosen based on the result of predicted CpG islands and previous reports [22–24]. The DMR of H19 and XIST that were chosen
are in exon 1. The IGF2R is regulated by ICR (located in intron 2 of IGF2R). Therefore, the DMR within the ICR was chosen as the analyzed region. Specific primers for BS-PCR amplification were designed (Table 2) using MethPrimer [34] and Methyl Primer Express® Software v1.0 (Applied Biosystems Inc., Foster City, CA, USA). Primers for bisulfite-treated DNA were optimized to amplify 150 to 400 bp fragments at an annealing temperature of 50 to 60 °C, with no CpG dinucleotides present in the primer sequence. Although nested PCRs are usually conducted for BS-PCR, in the present study, one round was enough when using the special Hot Start DNA polymerase (the Zymo TaqTM premix, Zymo Research). Each reaction mixture (50 L) contained 25 L Zymo TaqTM premix, 2 L modified DNA, 21 L dH2O, and 1 L of both forward and reverse primers. The PCRs were performed with a DNA engine (MJ Research) using the following programs: 94 °C for 5 min, followed by 45 cycles of denaturation at 94 °C for 30 s, annealing at 55.5 °C (H19), 57.8 °C (XIST) or 56.3 °C (IGF2R) for 40 s, extension at 72 °C for 30 s, and a final extension at 72 °C for 7 min. The PCR products were resolved on 2.5% agarose gels to confirm the specific amplification of the product by size and then gel-purified using the TIANgel Midi Purification Kit (Tiangen, Beijing, China). Purified fragments were subcloned into pMD18-T vectors (TaKaRa). The clones confirmed by PCR were selected
1350
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359
Fig. 1. Relative mRNA levels of six imprinted genes in bovine placentas which were analyzed by quantitative real-time PCR. Relative mRNA levels of (A) H19, (B) XIST, (C) IGF2R, (D) SNRPN, (E) PEG3 and (F) IGF2 in the placentas of normal control calves (open bar), deceased transgenic cloned calves (gray bars) and live transgenic cloned calves (black bar) were analyzed by quantitative real-time PCR. Each bar represents an individual sample, which were N1, N2, N3, N4, D1, D2, D3, D4, GT09002, GT09003, GT09004, GT09005, GT09006, GT09007, GT09008, GT09009, GT09010, GT09011, GT09012, GT09014, GT09015, GT09016, and GT09017 from left to right. Each sample was analyzed in triplicate (n ⫽ 3), and the standard deviations were presented as error bars. The dotted lines (set as 1) represent the average of expression levels of each gene from controls. *(P ⬍ 0.05), **(P ⬍ 0.01) denote differences between D group and N group, L group and N group.
for DNA sequencing (BGI, Beijing, China). Three independent amplification experiments were performed for each gene in each sample. We sequenced four or
five clones from each independent set of amplification and cloning; therefore, there were a total 12 to 15 clones for each gene in each sample. The BSP data and
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359
C-T conversion rate were analyzed with BIQ Analyzer software [35]. To ensure high data quality, sequences with a C-T conversion rate ⬍ 95% were excluded. Methylation data were analyzed by computing the percentage of clones which were ⬎ 50% methylated. 2.4. Combined bisulfite restriction analysis (COBRA) Half of all gel-purified PCR products used for BSP analysis from the three replicates were pooled and digested with restriction enzymes Taqa I (NEB) for H19 and BstU I (NEB) for XIST and IGF2R. The digested fragments were subjected to electrophoresis on 2.5% agarose gels. During sodium bisulfite treatment, unmethylated cytosine residues were converted to thymine, whereas methylated cytosine residues were retained as cytosine. The restriction sites (“TCGA” for Taqa I, “CGCG” for BstU I) can be cleaved if CpG dinucleotides are methylated, otherwise, the site can not be cleaved if one or more CpG dinucleotides within its recognition sequence were unmethylated. Therefore, in the mixed population of resulting PCR fragments, the ratio of band intensity of digested fraction to the combined intensities of both digested and non-digested fractions reflected the levels of DNA methylation on the restriction sites. Band intensity was calculated using the image analyzer ChemiDoc and Quantity One software (Bio-Rad). 2.5. Statistical analysis Data were presented as mean ⫾ SD. The levels of gene expression and DNA methylation among the three groups were tested by one-way ANOVA and LSD tests, using SPSS 13.0 software (SPSS Inc., Chicago, IL, USA). Differences were considered significant at P ⬍ 0.05. 3. Results 3.1. Gross morphology Fetal weight (P ⬍ 0.01), placental weight (P ⬍ 0.05) and mean placentome weight (P ⬍ 0.05) were larger, but the number of placentomes was smaller, in the D group compared with the N group (Table 3). Deceased transgenic clone D1 (68.54 kg) and D3 (64.28 kg) were heavier than the average birth weight of live transgenic clones (L group), consistent with LOS. Deceased transgenic clone D2 had generalized edema and atelectasis, whereas D4 (stillborn) had under-developed lungs and atelectasis.
1351
3.2. Expression levels of six imprinted genes in cloned transgenic bovine placentas Relative mRNA levels of six imprinted genes were analyzed by quantitative real-time PCR (Fig. 1). The amplified products were identified by melting curve profile analysis and electrophoresis on 2.5% agarose gels. Based on quantitative real-time PCR analysis, paternally expressed genes, XIST (P ⬍ 0.05), PEG3 (P ⬍ 0.01) and IGF2 (P ⬍ 0.05) were over-expressed in placentas of deceased transgenic calves (D group) compared to normal controls (N group). There was no significant difference between the D and N groups in the expression of SNRPN, although transgenic clone D1 had approximately five times more SNRPN gene expression in its placenta than the N group. In contrast, the expression of maternally expressed genes of H19 (P ⬍ 0.05) and IGF2R (P ⬍ 0.01) was reduced in the D group compared to the N group. In contrast to the D group, the expression of the six imprinted genes in placentas of live transgenic calves (L group) was similar to normal controls. However, the level of gene expression was more variable in the L group compared to the N group. For example, GT09007 and GT09009 had four fold greater IGF2R gene expression in the placenta than the average expression levels of the controls, but its expression was significantly reduced in the placentas of GT09004, GT09008, GT09011, and GT09014. 3.3. DNA methylation status of H19 DMR, XIST DMR and IGF2R ICR analyzed by BPS Methylation level of H19 DMR (Fig. 2 and Table 4) was higher in the D group compared to the controls (91.13 ⫾ 3.06% vs 56.07 ⫾ 11.87%, P ⬍ 0.05). In contrast, there was no significant difference in the methylation of H19 DMR between the L group and the control (69.77 ⫾ 19.03% vs 56.07 ⫾ 11.87%). Furthermore, variation in the DNA methylation level of H19 DMR was greater within L group compared to the controls. For example, DNA methylation levels were significantly high in placentas of GT09004, GT09005, GT09007, GT09010, GT09012, and GT09015, but methylation levels were reduced in placentas of GT09008 and GT09014 compared to the controls. In contrast to H19, both XIST DMR (6.79 ⫾ 9.43% vs 48.39 ⫾ 16.88%, P ⬍ 0.01) and IGF2R ICR (23.17 ⫾ 17.24% vs 63.35 ⫾ 4.61%, P ⬍ 0.01) were significantly hypomethylated in the D group compared with N group (Figs. 3 and 4, and Table 4). In addition, XIST DMR in L group also had hypomethylation (23.59 ⫾ 16.08% vs 48.39 ⫾ 16.88%,
1352
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359
1353
Table 4 DNA methylation levels in placentas of normal produced (N group), deceased transgenic cloned (D group) and live transgenic cloned (L group) calves was analyzed by BSP*.
with the BSP sequencing results confirmed the reliability of the latter.
Genes
N group (mean ⫾ SD%)
D group (mean ⫾ SD%)
L group (mean ⫾ SD%)
4. Discussion
H19 XIST IGF2R
56.07 ⫾ 11.87 48.39 ⫾ 16.88 63.35 ⫾ 4.61
91.13 ⫾ 3.06† 6.79 ⫾ 9.43a 23.17 ⫾ 17.24a
69.77 ⫾ 19.03 23.59 ⫾ 16.08a 53.24 ⫾ 11.72
* Values are presented as the mean ⫾ SD. † (P ⬍ 0.05). a (P ⬍ 0.01) denote significant differences between D group and N group, L group and N group, respectively.
P ⬍ 0.01), whereas IGF2R ICR (53.24 ⫾ 11.72% vs 63.35 ⫾ 4.61%, P ⬎ 0.05) in the L group had normal differential methylation levels compared with N group (Figs. 3 and 4 and Table 4). All three imprinted genes in the normal control group exhibited nearly hemizygous methylation status. In sperm from a normal adult male bull, H19 DMR was exclusively methylated, as well as XIST DMR, which was completely unmethylated in all eight clones. Noticeably, the CpG 15 in H19 DMR, the CpG 3 and CpG 4 in XIST DMR, and the CpG 1 and CpG 16 in IGF2R ICR were almost all non-methylated, whereas CpG 1 and CpG 2 in XIST DMR were almost all methylated. 3.4. Overall DNA methylation profiles of H19 DMR, XIST DMR and IGF2R ICR analyzed by COBRA To confirm that the BSP sequencing data from a limited number of templates reflected the overall methylation status for these DMRs, COBRA analysis was performed using restriction enzymes Taqa I for H19 and BstU I for XIST and IGF2R. The BS-PCR amplified nucleotide sequences and Cleavage CpG sites of H19, XIST, and IGF2R are shown (Fig. 2A, 3A and 4A). The COBRA results of H19 DMR, XIST DMR, and IGF2R ICR are shown (Fig. 5). The methylation level of H19 DMR in D group was extremely high (Fig. 5A). In contrast, XIST DMR and IGF2R ICR were hypomethylated (Fig. 5B, 5C). That these results were consistent
Large offspring syndrome, which has frequently been described in cloned cattle [3,12,36 – 43], commonly involves the placenta. It is generally believed that placental abnormalities are the main causes of cloned fetal death and low SCNT efficiency [44]. In the present study, we examined the expression and DNA methylation levels of imprinted genes in placentas of deceased and live transgenic calves to determine whether epigenetic modification of imprinted genes was responsible for fetal overgrowth and placental hypertrophy. Relative expression levels of six imprinted genes in the placentas among three groups were examined by quantitative real-time PCR. Expression of five of six imprinted genes in placentas of deceased transgenic calves was abnormal, whereas the expression of those genes in the placentas of most live transgenic calves was similar to normal controls. The expression of the maternally expressed, but untranslated, imprinted gene H19 was significantly reduced in placentas of deceased transgenic calves, but not in placentas of live ones, compared to normal controls. This was consistent with findings in placentas of deceased cloned piglets [11] and ES cell cloned mice [6]. However, expression of H19 in organs of cloned animals was variable. For example, H19 was significantly over-expressed in the bladder, brain, heart, and lung, but not in the kidney, liver, spleen, and thymus of deceased cloned calves [12]. In cloned mice, expression levels of H19 were also highly variable and the findings were controversial: H19 was decreased in the fetuses and placentas [6] and in the livers of ES cloned mice [45], not changed in the placenta in somatic cell clones compared to controls [10], and silenced in placenta of ES clones [45]. These apparent discrepancies may reflect the fact that the expression of H19 is highly variable between individual clones and even in organs from same clone.
Fig. 2. DNA methylation status of H19 DMR was analyzed by BSP. A: Nucleotide sequences for a 193 bp H19 DMR fragment (upper strands) and its bisulfite-converted version (lower strands). Primer sequences are underlined. Each CpG is numbered and italicized. Cleavage CpG sites of TaqaI for COBRA analysis were indicated by arrows. B: Methylation profiles of H19 DMR in sperm and placentas of dead transgenic clones, live transgenic clones and normally produced Holstein calves. Unfilled (white) and filled (black) circles represent unmethylated and methylated CpGs, respectively. Horizontal lines of circles represent one separate clone that was sequenced. Lollipop diagrams were generated by BIQ Analyzer software [35]. For each sample, the methylation data were analyzed by computing the percentage of clones with ⬎50% methylated.
1354
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359
Fig. 3. DNA methylation status of XIST DMR was analyzed by BSP. A: Nucleotide sequences for a 222 bp XIST DMR fragment. Cleavage CpG sites of BstUI for COBRA analysis are indicated by arrows. B: Methylation profiles of XIST DMR in sperm and placentas. Details are described in the legend to Fig. 2.
Similar to H19, expression of IGF2R, another maternally expressed imprinted gene, which interferes with the mitogenic effect of IGF2, was also significantly lower in placentas of deceased transgenic calves compared to controls. Reduced expression of IGF2R has also been reported in various organs of IVF sheep with LOS [46], and in the placentas of SCNT mice [10]. Since IGF2R inhibits fetal growth, fetuses with reduced
IGF2R would have less growth suppression. Therefore, IGF2R may be associated with LOS. In contrast with H19, the paternally expressed imprinted gene IGF2 was notably over-expressed in placentas of deceased transgenic calves. Placental-specific IGF2 was a major modulator of placental and fetal growth [47]; this gene acted in the placenta to directly control the supply of maternal nutrients to the fetus.
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359
Furthermore, IGF2 was clustered with H19, with both genes regulated by an ICR located between the two genes [48 –51]. Expression of IGF2 and H19 was negatively correlated in naturally produced [52] and somatic cloned mice [45], which had relatively low expression of H19 and over-expression of IGF2. Similarly, in the present study, there was a negative association between H19 (low expression) and IGF2 (over-expression) expression in placentas of deceased transgenic calves with LOS. Furthermore, IGF2 was also over-expressed in cloned bovine embryos compared to IVF controls [18]. There was drastically higher expression of IGF2 in the bladder, brain, heart, and lung of cloned calves suffering from LOS compared to normal controls [12]. In humans, up-regulation of IGF2 was thought to be important in the pathogenesis of Beckwith-Wiedemann syndrome (BWS) [53–55], which is characterized by somatic overgrowth, similar to LOS in ruminants. Based on the present results, together with those from previous studies, we inferred that up-regulation of IGF2 promoted overall fetal growth and therefore could be related to LOS. In contrast, a recent study reported a significant reduction in the expression of IGF2 in placentas of dead cloned piglets compared to normal controls [11]. Perhaps there are differences between species in expression of this gene. The other imprinted gene, XIST was significantly over-expressed in placentas of deceased transgenic calves with LOS compared to controls. It was reported that XIST RNA played a crucial role in X-chromosome inactivation (XCI) [56]. Although a recent study provided evidence of XIST RNA-independent initiation of mouse imprinted X-chromosome inactivation [57], it is noteworthy that XIST is required to stabilize silencing along the paternal X chromosome (Xp) [57]. Cloned bovine blastocysts had increased XIST expression compared with IVF, in vivo-generated, and parthenogenetic embryos [58]. In addition, expression of XIST in the hearts of bovine clones was higher than that of controls [32]. Besides, the PEG3 gene had approximately 14.8 times more expression in placentas of deceased transgenic calves than the average level of the controls. In the present study, BSP and COBRA assays were used to investigate whether aberrant expression of the imprinted genes H19, XIST, and IGF2R was associated with abnormal methylation patterns of their DMRs. Unfortunately, it was not possible to specifically distinguish between the paternal and maternal alleles for the absence of single nucleotide polymorphisms (SNPs). However, that these imprinted genes were im-
1355
printed in cattle and that their DMRs were exclusively methylated (H19) or completely unmethylated (XIST) in sperm provided us with some useful information. Still, a previous study reported that IGF2R ICR in bovine sperm was also completely unmethylated [24]. Furthermore, the regions amplified in the three imprinted genes exhibited nearly hemizygous methylation status in the normal control group. In the present study, DNA methylation status of the three imprinted genes in placentas of deceased transgenic calves was abnormal, whereas DNA methylation levels of these genes (except XIST DMR) in most placentas of live transgenic calves were similar to normal controls. In this study, we found that there was aberrant hypermethylation of H19 DMR in placentas of deceased transgenic calves with LOS, but in the placentas of live transgenic calves, mean DNA methylation of the gene was similar to controls. This finding supported the results of the present study on gene expression analysis and supported the idea that the hypermethylated H19 DMR may cause repression of the gene, consistent with findings in cloned mice [6]. Curchoe et al [59] detected hypomethylation trends in the intergenic region of the imprinted IGF2 and H19 genes in the cloned cattle, the region like an imprinting control region (ICR). Imprinting control regions regulated the expression of both IGF2 and H19 in mammals [51]. In contrast, XIST DMR in placentas of deceased and live transgenic calves were seriously hypomethylated. Similarly, Xue et al [60] found that methylation patterns in the 5= region of bovine XIST had variable degrees of hypomethylation in the heart, liver, and spleen of deceased clones, based on methylation-sensitive PCR analysis. Furthermore, there was significant hypomethylation of XIST DMR in two aborted SCNT calves [22]. Based on all of these findings, we inferred that there were aberrant patterns of X chromosome inactivation in bovine clones. The maternally expressed imprinted gene IGF2R is regulated by differentially methylated ICR, which is located within the second intron of IGF2R. The ICR includes the promoter for IGF2R antisense (also known as Air) that silences expression of IGF2R [61]. In mice, the ICR is hypermethylated on the maternal chromosome, preventing transcription of Air and allowing IGF2R to be transcribed [61]. On the paternal chromosome the ICR is unmethylated, Air is expressed and IGF2R is repressed [51]. In cattle, IGF2R expression was also regulated by epigenetic modification of ICR [24], and in cloned calves, DNA methylation at the locus of gene imprinting was disrupted [24]. Conse-
1356
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359
1357
Fig. 5. Overall DNA methylation profiles of H19 (A), XIST (B) and IGF2R (C) in sperm and placentas were analyzed by COBRA. N, D and T denote the placenta of normal controls, deceased transgenic clones and live transgenic clones. The sizes of digested products are indicated at the top of each electrophoretogram. Cleavage CpG sites are shown in Figs. 2A, 3A, and 4A. The enzymes only cut the fragments when the specific CpG site was methylated. A 100 bp marker is indicated on the right.
quently DNA methylation of IGF2R ICR was assessed in the present study. That it was hypomethylated in placentas of deceased transgenic calves may have caused higher Air expression and lower IGF2R expression. In conclusion, expression and DNA methylation of imprinted genes in the placentas of live transgenic calves appeared to be more normal than in deceased transgenic calves. We inferred that abnormal expression of the imprinted genes in placentas of deceased transgenic calves could be associated with altered DNA methylation levels at the DMRs of these imprinted genes. These alterations could result from aberrant epigenetic nuclear reprogramming during SCNT and may disrupt normal developmental regulation of placenta and fetus, which may result in developmental insufficiencies and ultimately fetal or perinatal death in cloned transgenic calves.
Acknowledgments The authors greatly appreciate Dr. John P. Kastelic for carefully editing and correcting the paper. We thank Prof. Jeff Gale for his help during the writing. We are thankful to Dr. Xingjun Miao and Dr. Shuang Tang for their help with data analysis. We are also thankful to Prof. Jian-Er Long, Dr. Yan-chang Wei and Dr. Xingwei Liang for their generous technical assistance with the BSP and COBRA analyses. This work was supported by a grant from the National Key Project for Production of Transgenic Livestock, PR China (No.2008ZX08007-004).
References [1] Yang XZ, Smith SL, Tian XC, Lewin HA, Renard JP, Wakayama T. Nuclear reprogramming of cloned embryos and its
Fig. 4. DNA methylation status of IGF2R ICR analyzed by BSP. A: Nucleotide sequences for a 163 bp IGF2R ICR fragment. Cleavage CpG sites of BstUI for COBRA analysis are indicated by arrows. B: different nucleotide sequences (162 bp) we found, changed nucleotides compared the origin sequences were showed in grey. CpGs are underlined. CpG4, 8, 11, and 15 (in grey) were missing in this amplified region. C: Methylation profiles of IGF2R ICR. Unfilled (white) and filled (black) circles represent unmethylated and methylated CpGs, respectively. Small vertical lines without a circle correspond to non-CpG position where there is a CpG in the genomic sequence. Details are described in the legend to Fig. 2.
1358
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13] [14] [15] [16]
[17]
[18]
[19]
[20]
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359 implications for therapeutic cloning. Nat Genet 2007; 39:295–302. Chavatte-Palmer P, Heyman Y, Richard C, Monget P, LeBourhis D, Kann G, et al. Clinical, hormonal, and hematologic characteristics of bovine calves derived from nuclei from somatic cells. Biol Reprod 2002;66:1596 –1603. Constant F, Guillomot M, Heyman Y, Vignon X, Laigre P, Servely JL, et al. Large offspring or large placenta syndrome? Morphometric analysis of late gestation bovine placentomes from somatic nuclear transfer pregnancies complicated by hydrallantois. Biol Reprod 2006;75:122–30. Miglino MA, Pereira FTV, Visintin JA, Garcia JM, Meirelles FV, Rumpf R, et al. Placentation in cloned cattle: Structure and microvascular architecture. Theriogenology 2007;68:604 –17. Suemizu H, Aiba K, Yoshikawa T, Sharov AA, Shimozawa N, Tamaoki N, et al. Expression profiling of placentomegaly associated with nuclear transplantation of mouse ES cells. Dev Biol 2003;253:36 –53. Ogawa H, Ono Y, Shimozawa N, Sotomaru Y, Katsuzawa Y, Hiura H, et al. Disruption of imprinting in cloned mouse fetuses from embryonic stem cells. Reproduction 2003;126:549 –57. Bischoff SR, Tsai S, Hardison N, Motsinger-Reif AA, Freking BA, Nonneman D, et al. Characterization of Conserved and Nonconserved Imprinted Genes in Swine. Biol Reprod 2009; 81:906 –20. De Sousa PA, King T, Harkness L, Young LE, Walker SK, Wilmut I. Evaluation of gestational deficiencies in cloned sheep fetuses and placentae. Biol Reprod 2001;65:23–30. Arnold DR, Fortier AL, Lefebvre R, Miglino MA, Pfarrer C, Smith LC. Placental insufficiencies in cloned animals - a workshop report. Placenta 2008;29 Suppl A:S108 –110. Inoue K, Kohda T, Lee J, Ogonuki N, Mochida K, Noguchi Y, et al. Faithful expression of imprinted genes in cloned mice. Science 2002;295:297. Wei YC, Zhu J, Huan YJ, Liu ZF, Yang CR, Zhang XM, et al. Aberrant expression and methylation status of putatively imprinted genes in placenta of cloned piglets. Cell Reprogram 2010;12:213–22. Yang L, Chavatte-Palmer P, Kubota C, O’Neill M, Hoagland T, Renard JP, et al. Expression of imprinted genes is aberrant in deceased newborn cloned calves and relatively normal in surviving adult clones. Mol Reprod Dev 2005;71:431– 8. Gardiner-Garden M, Frommer M. CpG islands in vertebrate genomes. J Mol Biol 1987;196:261– 82. Larsen F, Gundersen G, Lopez R, Prydz H. Cpg islands as gene markers in the human genome. Genomics 1992;13:1095–107. Plass C, Soloway PD. DNA methylation, imprinting and cancer. Eur J Hum Genet 2002;10:6 –16. Chae JI, Lee KS, Kim DJ, Han YM, Lee DS, Lee KK, et al. Abnormal gene expression in extraembryonic tissue from cloned porcine embryos. Theriogenology 2009;71:323–33. Cui XS, Zhang DX, Ko YG, Kim NH. Aberrant epigenetic reprogramming of imprinted microRNA-127 and Rtl1 in cloned mouse embryos. Biochem Bioph Res Co 2009;379:390 – 4. Han DW, Song SJ, Uhum SJ, Do JT, Kim NH, Chung KS, et al. Expression of IGF2 and IGF receptor mRNA in bovine nuclear transferred embryos. Zygote 2003;11:245–52. Kang YK, Koo DB, Park JS, Choi YH, Chung AS, Lee KK, et al. Aberrant methylation of donor genome in cloned bovine embryos. Nat Genet 2001;28:173–77. Mann MRW, Chung YG, Nolen LD, Verona RI, Latham KE, Bartolomei MS. Disruption of imprinted gene methylation and
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32]
[33]
[34] [35]
[36]
[37]
[38]
expression in cloned preimplantation stage mouse embryos. Biol Reprod 2003;69:902–14. Smith SL, Everts RE, Tian XC, Du FL, Sung LY, RodriguezZas SL, et al. Global gene expression profiles reveal significant nuclear reprogramming by the blastocyst stage after cloning. P Natl Acad Sci USA 2005;102:17582–7. Liu JH, Yin S, Xiong B, Hou Y, Chen DY, Sun QY. Aberrant DNA methylation imprints in aborted bovine clones. Mol Reprod Dev 2008;75:598 – 607. Lin L, Li Q, Zhang L, Zhao DS, Dai YP, Li N. Aberrant epigenetic changes and gene expression in cloned cattle dying around birth. Bmc Dev Biol 2008;8:14. Long JE, Cai X. Igf-2r expression regulated by epigenetic modification and the locus of gene imprinting disrupted in cloned cattle. Gene 2007;388:125–34. Zhang L, Wang SH, Dai YP, Li N. Aberrant gene expression in deceased transgenic cloned calves. Anim Reprod Sci 2009;112: 182–9. Suteevun-Phermthai T, Curchoe CL, Evans AC, Boland E, Rizos D, Fair T, et al. Allelic switching of the imprinted IGF2R gene in cloned bovine fetuses and calves. Anim Reprod Sci 2009;116:19 –27. Ma JJ, Wang YS, He XN, Zheng YM, Zhang Y. Transfection of bovine fetal fibroblasts with -defensin (hBD3) gene and construction of transgenetic cloned embryos. J Agric Biotech 2010; 18:707–12. Peng W, Lan ZG, Ma JJ, Wang BL, Zhang Y. Construction of HBD-3 gene mammary-specific expression vector and eukaryotic expression. Chin J Biotech 2009;25:968 –74. Wang YS, Tang S, An ZX, Li WZ, Liu J, Quan FS, et al. Effect of mSOF and G1.1/G2.2 Media on the Developmental Competence of SCNT-Derived Bovine Embryos. Reprod Domest Anim 2010 (in press). Wang YS, Xiong XR, An ZX, Wang LJ, Liu J, Quan FS, et al. Production of cloned calves by combination treatment of both donor cells and early cloned embryos with 5-aza-2=-deoxycytidine and trichostatin A. Theriogenology 2010 (in press). Katz-Jaffe MG, McCallie BR, Preis KA, Filipovits J, Gardner DK. Transcriptome analysis of in vivo and in vitro matured bovine MII oocytes. Theriogenology 2009;71:939 – 46. Li SJ, Li YX, Du WH, Zhang L, Yu SY, Dai YP, et al. Aberrant gene expression in organs of bovine clones that die within two days after birth. Biol Reprod 2005;72:258 – 65. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 2001;25:402– 8. Li LC, Dahiya R. MethPrimer: designing primers for methylation PCRs. Bioinformatics 2002;18:1427–31. Bock C, Reither S, Mikeska T, Paulsen M, Walter J, Lengauer T. BiQ analyzer: visualization and quality control for DNA methylation data from bisulfite sequencing. Bioinformatics 2005;21:4067– 8. Kato Y, Tani T, Sotomaru Y, Kurokawa K, Kato J, Doguchi H, et al. Eight calves cloned from somatic cells of a single adult. Science 1998;282:2095– 8. Renard JP, Chastant S, Chesne P, Richard C, Marchal J, Cordonnier N, et al. Lymphoid hypoplasia and somatic cloning. Lancet 1999;353:1489 –91. Wells DN, Misica PM, Tervit HR. Production of cloned calves following nuclear transfer with cultured adult mural granulosa cells. Biol Reprod 1999;60:996 –1005.
Available online at www.sciencedirect.com
Theriogenology 75 (2011) 1346 –1359 www.theriojournal.com
Expression and methylation status of imprinted genes in placentas of deceased and live cloned transgenic calves Jian-min Su, Bo Yang, Yong-sheng Wang, Yan-yan Li, Xian-rong Xiong, Li-jun Wang, Ze-kun Guo, Yong Zhang* College of Veterinary Medicine, Northwest A&F University, Key Laboratory of Animal Reproductive Physiology & Embryo Technology, Ministry of Agriculture, Yangling, Shaanxi 712100, PR China Received 1 July 2010; received in revised form 30 November 2010; accepted 30 November 2010
Abstract Placental deficiencies are linked with developmental abnormalities in cattle produced by somatic cell nuclear transfer (SCNT). To investigate whether the aberrant expression of imprinted genes in placenta was responsible for fetal overgrowth and placental hypertrophy, quantitative expression analysis of six imprinted genes (H19, XIST, IGF2R, SNRPN, PEG3, and IGF2) was conducted in placentas of: 1) deceased (died during perinatal period) transgenic calves (D group, n ⫽ 4); 2) live transgenic calves (L group, n ⫽ 15); and 3) conventionally produced (control) female calves (N group, n ⫽ 4). In this study, XIST, PEG3 and IGF2 were significantly over-expressed in the D group, whereas expression of H19 and IGF2R was significantly reduced in the D group compared to controls. The DNA methylation patterns in the differentially methylated region (DMR) from H19, XIST, and IGF2R were compared using Bisulfite Sequencing PCR (BSP) and Combined Bisulfite Restriction Analysis (COBRA). In the D group, H19 DMR was significantly hypermethylated, but XIST DMR and IGF2R ICR were significantly hypomethylated compared to controls. In contrast, there were no noticeable differences in the expression and DNA methylation status of imprinted genes (except DNA methylation level of XIST DMR) in the L group compared to controls. In conclusion, altered DNA methylation levels in the DMRs of imprinted genes in placentas of deceased transgenic calves, presumably due to aberrant epigenetic nuclear reprogramming during SCNT, may have been associated with abnormal expression of these genes; perhaps this caused developmental insufficiencies and ultimately death in cloned transgenic calves. © 2011 Elsevier Inc. All rights reserved. Keywords: DNA methylation; Imprinted gene; SCNT; Cloned transgenic cow
1. Introduction Although generation of transgenic livestock by somatic cell nuclear transfer (SCNT) has great potential for producing valuable recombinant proteins and breeding disease-resistant livestock, there is a high incidence
* Corresponding author: Tel.: ⫹86 29 87080085; fax: ⫹86 29 87080085. E-mail address: [email protected] (Y. Zhang); sujianmin@ gmail.com (J.M. Su). 0093-691X/$ – see front matter © 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.theriogenology.2010.11.045
of abnormalities in SCNT clones. Developmental abnormalities of cloned animals usually involve the placenta in several species [1], including cattle [2– 4], mice [5,6], pigs [7], and sheep [8]. Most cloned animals die in utero, due to placental deficiency [9]. The placenta may be more prone to aberrancies than the fetus in SCNT animals: several genes were abnormally expressed in the placenta, but not in the fetus, of cloned mice [10], pigs [11], and cattle [12]. Therefore, it has been proposed that the placental abnormality may be the main cause of cloned fetal death.
Theriogenology 75 (2011) 1346 –1359 www.theriojournal.com
Expression and methylation status of imprinted genes in placentas of deceased and live cloned transgenic calves Jian-min Su, Bo Yang, Yong-sheng Wang, Yan-yan Li, Xian-rong Xiong, Li-jun Wang, Ze-kun Guo, Yong Zhang* College of Veterinary Medicine, Northwest A&F University, Key Laboratory of Animal Reproductive Physiology & Embryo Technology, Ministry of Agriculture, Yangling, Shaanxi 712100, PR China Received 1 July 2010; received in revised form 30 November 2010; accepted 30 November 2010
Abstract Placental deficiencies are linked with developmental abnormalities in cattle produced by somatic cell nuclear transfer (SCNT). To investigate whether the aberrant expression of imprinted genes in placenta was responsible for fetal overgrowth and placental hypertrophy, quantitative expression analysis of six imprinted genes (H19, XIST, IGF2R, SNRPN, PEG3, and IGF2) was conducted in placentas of: 1) deceased (died during perinatal period) transgenic calves (D group, n ⫽ 4); 2) live transgenic calves (L group, n ⫽ 15); and 3) conventionally produced (control) female calves (N group, n ⫽ 4). In this study, XIST, PEG3 and IGF2 were significantly over-expressed in the D group, whereas expression of H19 and IGF2R was significantly reduced in the D group compared to controls. The DNA methylation patterns in the differentially methylated region (DMR) from H19, XIST, and IGF2R were compared using Bisulfite Sequencing PCR (BSP) and Combined Bisulfite Restriction Analysis (COBRA). In the D group, H19 DMR was significantly hypermethylated, but XIST DMR and IGF2R ICR were significantly hypomethylated compared to controls. In contrast, there were no noticeable differences in the expression and DNA methylation status of imprinted genes (except DNA methylation level of XIST DMR) in the L group compared to controls. In conclusion, altered DNA methylation levels in the DMRs of imprinted genes in placentas of deceased transgenic calves, presumably due to aberrant epigenetic nuclear reprogramming during SCNT, may have been associated with abnormal expression of these genes; perhaps this caused developmental insufficiencies and ultimately death in cloned transgenic calves. © 2011 Elsevier Inc. All rights reserved. Keywords: DNA methylation; Imprinted gene; SCNT; Cloned transgenic cow
1. Introduction Although generation of transgenic livestock by somatic cell nuclear transfer (SCNT) has great potential for producing valuable recombinant proteins and breeding disease-resistant livestock, there is a high incidence
* Corresponding author: Tel.: ⫹86 29 87080085; fax: ⫹86 29 87080085. E-mail address: [email protected] (Y. Zhang); sujianmin@ gmail.com (J.M. Su). 0093-691X/$ – see front matter © 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.theriogenology.2010.11.045
of abnormalities in SCNT clones. Developmental abnormalities of cloned animals usually involve the placenta in several species [1], including cattle [2– 4], mice [5,6], pigs [7], and sheep [8]. Most cloned animals die in utero, due to placental deficiency [9]. The placenta may be more prone to aberrancies than the fetus in SCNT animals: several genes were abnormally expressed in the placenta, but not in the fetus, of cloned mice [10], pigs [11], and cattle [12]. Therefore, it has been proposed that the placental abnormality may be the main cause of cloned fetal death.
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359
It is generally believed that the principal cause of developmental abnormalities of fetus and placenta in cloned animals is aberrant epigenetic nuclear reprogramming of the donor somatic cell, which involves various epigenetic modifications. Methylation of DNA is a major epigenetic modification of the genome, with a crucial role in nuclear reprogramming during SCNT. Vertebrate DNA methylation preferentially occurs at the 5’ position of cytosine in CpG dinucleotides, which are mostly found in clusters termed CpG islands [13]. Generally, DNA methylation in differentially methylated regions (DMRs), which predominantly occurs in the promoter or the first exon of a gene [14], represses gene transcription [15]. Imprinted genes are expressed from only one of the two chromosome homologues in a parent-of-origindependent manner, regulated primarily by DNA methylation in imprinting control regions (ICRs). Most imprinted genes have roles in regulating fetal and placental growth; therefore, aberrant imprinting leads to developmental anomalies. Since many developmental defects in cloned cattle were similar to experimentally produced imprinting disruptions in mice, as well as naturally occurring imprinting diseases in humans, it has been proposed that imprinting disruptions in the nuclear reprogramming process may be related to defects in clones [12]. There are reports regarding aberrant DNA methylation and expression of imprinted genes in cloned embryos [16 –21] and fetuses [22–26], but fewer studies have examined DNA methylation and expression of imprinted genes in the placenta. The expression of several imprinted genes was abnormally reduced in cloned mice placentas [10], but not fetuses. The imprinted gene IGF2R was also found aberrantly allelic expressed in placenta, whereas there were no differences in organs of cloned calves [12]. In a recent study, there were aberrant mRNA and DNA methylation levels of several imprinted genes in placentas of dead cloned piglets [11]. Therefore, DNA methylation and expression of imprinted genes in placenta were closely associated with development of cloned animals. We recently produced 21 transgenic Human -defensin-3 (hBD-3) calves by SCNT, including 17 live transgenic clones and four dead transgenic clones (unpublished). In the present study, the mRNA level was determined (quantitative real-time PCR) for six imprinted genes (H19, XIST, IGF2R, SNRPN, PEG3, and IGF2) in placentas of live and dead transgenic clones. In addition, DNA methylation status of H19 DMR, XIST DMR, and IGF2R ICR was determined by Bisulfite Sequencing PCR (BSP) and Combined Bisulfite Restriction Analysis (COBRA).
1347
2. Materials and methods 2.1. Production of transgenic calves and collection of samples Construction of the human -defensin-3 gene vector and the preparation of competent hBD-3 transgenic donor cells were conducted as described [27,28]. Oocyte collection and in vitro maturation (IVM), SCNT, activation of reconstructed embryos, culture of cloned embryos, embryo transfer, and pregnancy diagnosis were performed as described [29,30]. Briefly, oocytes were recovered from abbatoir-derived ovaries, and matured in vitro in tissue culture medium 199 (TCM-199; Gibco, BRL, Grand Island, NY, USA), supplemented with 10% (v/v) FBS, 1 g/mL 17 -estradiol, and 0.075 IU/mL Human Menopausal Gonadotropin (HMG) for 20 h. Oocytes with an extruded first polar body were selected and stained with 10 g/mL Hoechst 33342 for 10 min prior to enucleation. The first polar body and the small amount of surrounding cytoplasm was removed from oocytes with a glass pipette (inner diameter, 20 m) in PBS microdrops supplemented with 7.5 g/mL cytochalasin B (CB) and 10% FBS. The expelled cytoplasm was examined under ultraviolet radiation to confirm removal of nuclear material. Disaggregated transgenic donor cells were transferred to the previtelline space of enucleated oocytes. The oocyte-cell couplet was sandwiched with a pair of platinum electrodes connected to the micromanipulator in microdrops of Zimmermann’s fusion medium, and a double electrical pulse of 35 V for 10 s was applied for oocyte-cell fusion. Reconstructed embryos were kept in SOFaa containing 5 g/mL cytochalasin B for 2 h until activation. Cloned embryos were activated in 5 M Ionomycin for 4 min, followed by 4 h exposure to 1.9 mM dimethynopyridine in SOFaa. Activated embryos were then cultured in SOFaa with 8 mg/mL BSA in a humidified atmosphere of 5% CO2 in air at 38.5 °C. Fresh Day 7 blastocysts were nonsurgically transferred (one embryo per recipient) to the uterine horn ipsilateral to the CL of 200 Red Angus recipients, 7 d after standing estrus. Of the 21 cloned trangenic calves that were born, 17 were born alive (designated GT09001 to GT09017), whereas four died during the perinatal period (named D1, D2, D3, D4) as a result of LOS. Clones, as well as normal control calves (described below) were delivered by Cesarean section. Afterwards, recipients were slaughtered, the uterine horns opened, and all placentomes dissected. Calf weight, placenta weight, placentome number, and placentome weight were determined. Transgenic calves were identified by PCR screening, Southern blotting, and FISH mapping (unpublished data).
1348
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359
Table 1 Primers for quantitative real-time PCR for characterization of bovine placentas. Genes H19 XIST IGF2R SNRPN PEG3 IGF2 GAPDH
Primer sequences (5’-3’) F†: AGAGATGGTGCTACCCAGCTCA Ra: TGTAGTGGTTCCAAAATGCAGC F: AACCTCACGCCATTCCTCTG R: GGGTAGGTGTTCCTCTTGAG F: CTACGACCTGACCGAGTG R: TGACAGCCTCCCAGTTG F: GGGACCGTTTACACTTGAGAC R: GGAAATCCACCACAGGTACT F: CGCCAAAGTCAGGGAGAG R: CTTAACTGCCAGGACACC F: GCATCGTGGAAGAGTGTTGCTT R: TCGTAGAGGCAGACACATCCCT F: CGACTTCAACAGCGACACTCAC R: CCCTGTTGCTGTAGCCAAATTC
Tann* (°C)
Product size (bp)
Reference
AY849926
Accession no.
60
101
[23]
AF104906
56
226
[32]
NM_174352
60
95
[31]
NM_174463
60
153
[31]
AY427787
60
150
[31]
NM_174087
60
102
[23]
NM_001034034
60
118
[23]
* Annealing temperature. † Forward primer. a Reverse primer.
In the present study, placentas were divided into three groups: N, D, and L. The N group was normal controls, which were placentas of four female Holstein calves (N1, N2, N3, and N4), produced by normal sexual reproduction. The D group was placentas of four deceased transgenic calves with LOS (D1, D2, D3, and D4), whereas the L group were 15 placentas of all live transgenic calves, except GT09001 and GT09013 (placentas were missing). Clones GT09012 and GT09013 were from a twin pregnancy. The semen sample was collected from a normal adult male bull. All experimental procedures were approved by the Animal Care Commission of the College of Veterinary Medicine, Northwest A&F University. 2.2. Quantitative real-time PCR Placental total RNA was extracted with TRIZOL reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. The quality and quantity of the extracted RNA were determined using an Epoch MultiVolume Spectrophotometer System (BioTek, Winooski, VT, USA), then the total RNA samples were treated with RNA-free Dnase I (Invitrogen) to digest genomic DNA in the RNA samples, and stored at -80 °C. Synthesis of cDNA was done using PrimeScriptTM RT Reagent Kit (TaKaRa, Tokyo, Japan) with a total volume of 20 L (4 L 5⫻RT buffer, 1 L RT enzyme Mix, 1 L Oligo dT Primer, 1 L Random 6 mers, 1 g RNA, and up to 20 L RNase-free dH2O). The expression levels of the six imprinted genes were quantified on a CFX96 real-time PCR detection system (Bio-Rad, Hercules, CA, USA) using SYBR Premix Ex Taq™ (TaKaRa). The primers for
quantitative PCR were synthesized (Table 1) according to previous reports [23,31,32]. Reactions were performed in Low Tube Strips (Bio-Rad). Each reaction mixture (20 L) contained 2 L (⬃100 ng) cDNA template, 10 L SYBR® Premix Ex Taq ™ ll (2⫻), 0.8 L of both PCR forward and reverse primers (10 M), and 6.4 L dH2O. Thermal cycling conditions were 95 °C for 1 min, followed by 40 PCR cycles of 5 s at 95 °C for DNA denaturation, and 30 s at 60 °C (56 °C for XIST) for primer annealing and extension. The melting protocol was 65 to 95 °C (in increments of 0.5 °C/5 s). Transcripts of six imprinted genes (H19, XIST, IGF2R, SNRPN, PEG3, and IGF2) were quantified in three replicates and calculated relative to the transcription in every sample of the housekeeping gene, GAPDH (endogenous control). The specificity of the PCR reaction was confirmed by gel electrophoresis on a 2.5% agarose gel and by a single peak in the melt curve. As a negative control, dH2O replaced cDNA in real-time reaction tubes. The results of RT-PCR are presented as CT value (mean ⫾ SD), where CT was defined as the threshold cycle number of PCRs at which the amplified product was first detected. The 2–⌬⌬CT method [33] was used to quantify the relative mRNA levels using the following formula: ⌬CT ⫽ CT共target
gene兲
⫺ CT共GADPH兲, and
⌬⌬CT ⫽ ⌬CT共sample兲 ⫺ ⌬CT共control兲. The relative levels of mRNA was calculated as
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359
1349
Table 2 Primers for BS PCR of bovine placenta. Genes H19 XIST IGF2R
Primer sequences (5’-3’) F†: AAGGGAGGTTAGGGTATAGGTAGG Ra: TAACCAAAAACATCAAAAAAACAAC F: TTTTGTTGTAGGGATAATATGGTTGA R: CCACCCTTTCTAATTAAATAAAACAC F: AGTTGGGTAGGGGGTTTTTTT R:CTCAACACCTTACTCAAAACCTACC
Accession no.
Tann* (°C)
Product size (bp)
AY849926
55.5
193
AF104906
57.8
222
DQ835615.1
56.3
163
* Annealing temperature. † Forward primer. a Reverse primer. Table 3 Fetal weight, placental weight, placentome number and weigh among normally reproduced (N group), deceased transgenic cloned (D group), and live transgenic cloned (L group) calves*. Parameter Fetal weight (kg) Placental weight (kg) No. of placentomes Placentome weight (Mean g)
N group (n ⫽ 4)
D group (n ⫽ 4)
L group (n ⫽ 15)
43.23 ⫾ 1.06 7.78 ⫾ 0.40 101 ⫾ 7 71.50 ⫾ 22.29
58.38 ⫾ 9.45a 8.13 ⫾ 0.79† 74 ⫾ 1† 135.00 ⫾ 33.80†
50.41 ⫾ 3.04a 7.85 ⫾ 0.68 91 ⫾ 16 76.67 ⫾ 40.14
* Values are presented as the mean ⫾ SD. † (P ⬍ 0.05). a (P ⬍ 0.01) denote differences between D group and N group, L group and N group, respectively.
2–⌬⌬CT. For ease of comparison, the average expression level of each gene from the control group was set as 1. 2.3. Bisulfite Sequencing PCR analysis Genomic DNA was extracted from placenta and sperm using a TIANamp Genomic DNA Kit (Tiangen, Beijing, China) and subjected to sodium bisulfite treatment, using an EZ DNA Methylation-GoldTM Kit (Zymo Research, Orange, CA, USA), in accordance with the instruction manual, with minor modifications. Briefly, 130 L CT Conversion Reagent was added to a 20 L DNA sample (500 to 900 ng) in a PCR tube. If the DNA sample volume was ⬍ 20 L, dH2O was added to bring the sample to volume. Sample tubes were placed in the DNA engine (MJ Research, Waltham, MA, USA) with 10 min at 95 °C for DNA denaturation, and 2.5 h at 64 °C for C-T conversion. Modified DNA was then desalted, purified, and eluted with 15 L elution buffer. Subsequently, Bisulfite Sequencing PCR (BS-PCR) was immediately carried out using 2 L of modified DNA per PCR run, or stored at -80 °C avoiding freeze thawing. Three separate bisulfite modification treatments were performed for each DNA sample. The CpG islands were predicted using MethPrimer software [34]. Amplified regions were chosen based on the result of predicted CpG islands and previous reports [22–24]. The DMR of H19 and XIST that were chosen
are in exon 1. The IGF2R is regulated by ICR (located in intron 2 of IGF2R). Therefore, the DMR within the ICR was chosen as the analyzed region. Specific primers for BS-PCR amplification were designed (Table 2) using MethPrimer [34] and Methyl Primer Express® Software v1.0 (Applied Biosystems Inc., Foster City, CA, USA). Primers for bisulfite-treated DNA were optimized to amplify 150 to 400 bp fragments at an annealing temperature of 50 to 60 °C, with no CpG dinucleotides present in the primer sequence. Although nested PCRs are usually conducted for BS-PCR, in the present study, one round was enough when using the special Hot Start DNA polymerase (the Zymo TaqTM premix, Zymo Research). Each reaction mixture (50 L) contained 25 L Zymo TaqTM premix, 2 L modified DNA, 21 L dH2O, and 1 L of both forward and reverse primers. The PCRs were performed with a DNA engine (MJ Research) using the following programs: 94 °C for 5 min, followed by 45 cycles of denaturation at 94 °C for 30 s, annealing at 55.5 °C (H19), 57.8 °C (XIST) or 56.3 °C (IGF2R) for 40 s, extension at 72 °C for 30 s, and a final extension at 72 °C for 7 min. The PCR products were resolved on 2.5% agarose gels to confirm the specific amplification of the product by size and then gel-purified using the TIANgel Midi Purification Kit (Tiangen, Beijing, China). Purified fragments were subcloned into pMD18-T vectors (TaKaRa). The clones confirmed by PCR were selected
1350
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359
Fig. 1. Relative mRNA levels of six imprinted genes in bovine placentas which were analyzed by quantitative real-time PCR. Relative mRNA levels of (A) H19, (B) XIST, (C) IGF2R, (D) SNRPN, (E) PEG3 and (F) IGF2 in the placentas of normal control calves (open bar), deceased transgenic cloned calves (gray bars) and live transgenic cloned calves (black bar) were analyzed by quantitative real-time PCR. Each bar represents an individual sample, which were N1, N2, N3, N4, D1, D2, D3, D4, GT09002, GT09003, GT09004, GT09005, GT09006, GT09007, GT09008, GT09009, GT09010, GT09011, GT09012, GT09014, GT09015, GT09016, and GT09017 from left to right. Each sample was analyzed in triplicate (n ⫽ 3), and the standard deviations were presented as error bars. The dotted lines (set as 1) represent the average of expression levels of each gene from controls. *(P ⬍ 0.05), **(P ⬍ 0.01) denote differences between D group and N group, L group and N group.
for DNA sequencing (BGI, Beijing, China). Three independent amplification experiments were performed for each gene in each sample. We sequenced four or
five clones from each independent set of amplification and cloning; therefore, there were a total 12 to 15 clones for each gene in each sample. The BSP data and
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359
C-T conversion rate were analyzed with BIQ Analyzer software [35]. To ensure high data quality, sequences with a C-T conversion rate ⬍ 95% were excluded. Methylation data were analyzed by computing the percentage of clones which were ⬎ 50% methylated. 2.4. Combined bisulfite restriction analysis (COBRA) Half of all gel-purified PCR products used for BSP analysis from the three replicates were pooled and digested with restriction enzymes Taqa I (NEB) for H19 and BstU I (NEB) for XIST and IGF2R. The digested fragments were subjected to electrophoresis on 2.5% agarose gels. During sodium bisulfite treatment, unmethylated cytosine residues were converted to thymine, whereas methylated cytosine residues were retained as cytosine. The restriction sites (“TCGA” for Taqa I, “CGCG” for BstU I) can be cleaved if CpG dinucleotides are methylated, otherwise, the site can not be cleaved if one or more CpG dinucleotides within its recognition sequence were unmethylated. Therefore, in the mixed population of resulting PCR fragments, the ratio of band intensity of digested fraction to the combined intensities of both digested and non-digested fractions reflected the levels of DNA methylation on the restriction sites. Band intensity was calculated using the image analyzer ChemiDoc and Quantity One software (Bio-Rad). 2.5. Statistical analysis Data were presented as mean ⫾ SD. The levels of gene expression and DNA methylation among the three groups were tested by one-way ANOVA and LSD tests, using SPSS 13.0 software (SPSS Inc., Chicago, IL, USA). Differences were considered significant at P ⬍ 0.05. 3. Results 3.1. Gross morphology Fetal weight (P ⬍ 0.01), placental weight (P ⬍ 0.05) and mean placentome weight (P ⬍ 0.05) were larger, but the number of placentomes was smaller, in the D group compared with the N group (Table 3). Deceased transgenic clone D1 (68.54 kg) and D3 (64.28 kg) were heavier than the average birth weight of live transgenic clones (L group), consistent with LOS. Deceased transgenic clone D2 had generalized edema and atelectasis, whereas D4 (stillborn) had under-developed lungs and atelectasis.
1351
3.2. Expression levels of six imprinted genes in cloned transgenic bovine placentas Relative mRNA levels of six imprinted genes were analyzed by quantitative real-time PCR (Fig. 1). The amplified products were identified by melting curve profile analysis and electrophoresis on 2.5% agarose gels. Based on quantitative real-time PCR analysis, paternally expressed genes, XIST (P ⬍ 0.05), PEG3 (P ⬍ 0.01) and IGF2 (P ⬍ 0.05) were over-expressed in placentas of deceased transgenic calves (D group) compared to normal controls (N group). There was no significant difference between the D and N groups in the expression of SNRPN, although transgenic clone D1 had approximately five times more SNRPN gene expression in its placenta than the N group. In contrast, the expression of maternally expressed genes of H19 (P ⬍ 0.05) and IGF2R (P ⬍ 0.01) was reduced in the D group compared to the N group. In contrast to the D group, the expression of the six imprinted genes in placentas of live transgenic calves (L group) was similar to normal controls. However, the level of gene expression was more variable in the L group compared to the N group. For example, GT09007 and GT09009 had four fold greater IGF2R gene expression in the placenta than the average expression levels of the controls, but its expression was significantly reduced in the placentas of GT09004, GT09008, GT09011, and GT09014. 3.3. DNA methylation status of H19 DMR, XIST DMR and IGF2R ICR analyzed by BPS Methylation level of H19 DMR (Fig. 2 and Table 4) was higher in the D group compared to the controls (91.13 ⫾ 3.06% vs 56.07 ⫾ 11.87%, P ⬍ 0.05). In contrast, there was no significant difference in the methylation of H19 DMR between the L group and the control (69.77 ⫾ 19.03% vs 56.07 ⫾ 11.87%). Furthermore, variation in the DNA methylation level of H19 DMR was greater within L group compared to the controls. For example, DNA methylation levels were significantly high in placentas of GT09004, GT09005, GT09007, GT09010, GT09012, and GT09015, but methylation levels were reduced in placentas of GT09008 and GT09014 compared to the controls. In contrast to H19, both XIST DMR (6.79 ⫾ 9.43% vs 48.39 ⫾ 16.88%, P ⬍ 0.01) and IGF2R ICR (23.17 ⫾ 17.24% vs 63.35 ⫾ 4.61%, P ⬍ 0.01) were significantly hypomethylated in the D group compared with N group (Figs. 3 and 4, and Table 4). In addition, XIST DMR in L group also had hypomethylation (23.59 ⫾ 16.08% vs 48.39 ⫾ 16.88%,
1352
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359
1353
Table 4 DNA methylation levels in placentas of normal produced (N group), deceased transgenic cloned (D group) and live transgenic cloned (L group) calves was analyzed by BSP*.
with the BSP sequencing results confirmed the reliability of the latter.
Genes
N group (mean ⫾ SD%)
D group (mean ⫾ SD%)
L group (mean ⫾ SD%)
4. Discussion
H19 XIST IGF2R
56.07 ⫾ 11.87 48.39 ⫾ 16.88 63.35 ⫾ 4.61
91.13 ⫾ 3.06† 6.79 ⫾ 9.43a 23.17 ⫾ 17.24a
69.77 ⫾ 19.03 23.59 ⫾ 16.08a 53.24 ⫾ 11.72
* Values are presented as the mean ⫾ SD. † (P ⬍ 0.05). a (P ⬍ 0.01) denote significant differences between D group and N group, L group and N group, respectively.
P ⬍ 0.01), whereas IGF2R ICR (53.24 ⫾ 11.72% vs 63.35 ⫾ 4.61%, P ⬎ 0.05) in the L group had normal differential methylation levels compared with N group (Figs. 3 and 4 and Table 4). All three imprinted genes in the normal control group exhibited nearly hemizygous methylation status. In sperm from a normal adult male bull, H19 DMR was exclusively methylated, as well as XIST DMR, which was completely unmethylated in all eight clones. Noticeably, the CpG 15 in H19 DMR, the CpG 3 and CpG 4 in XIST DMR, and the CpG 1 and CpG 16 in IGF2R ICR were almost all non-methylated, whereas CpG 1 and CpG 2 in XIST DMR were almost all methylated. 3.4. Overall DNA methylation profiles of H19 DMR, XIST DMR and IGF2R ICR analyzed by COBRA To confirm that the BSP sequencing data from a limited number of templates reflected the overall methylation status for these DMRs, COBRA analysis was performed using restriction enzymes Taqa I for H19 and BstU I for XIST and IGF2R. The BS-PCR amplified nucleotide sequences and Cleavage CpG sites of H19, XIST, and IGF2R are shown (Fig. 2A, 3A and 4A). The COBRA results of H19 DMR, XIST DMR, and IGF2R ICR are shown (Fig. 5). The methylation level of H19 DMR in D group was extremely high (Fig. 5A). In contrast, XIST DMR and IGF2R ICR were hypomethylated (Fig. 5B, 5C). That these results were consistent
Large offspring syndrome, which has frequently been described in cloned cattle [3,12,36 – 43], commonly involves the placenta. It is generally believed that placental abnormalities are the main causes of cloned fetal death and low SCNT efficiency [44]. In the present study, we examined the expression and DNA methylation levels of imprinted genes in placentas of deceased and live transgenic calves to determine whether epigenetic modification of imprinted genes was responsible for fetal overgrowth and placental hypertrophy. Relative expression levels of six imprinted genes in the placentas among three groups were examined by quantitative real-time PCR. Expression of five of six imprinted genes in placentas of deceased transgenic calves was abnormal, whereas the expression of those genes in the placentas of most live transgenic calves was similar to normal controls. The expression of the maternally expressed, but untranslated, imprinted gene H19 was significantly reduced in placentas of deceased transgenic calves, but not in placentas of live ones, compared to normal controls. This was consistent with findings in placentas of deceased cloned piglets [11] and ES cell cloned mice [6]. However, expression of H19 in organs of cloned animals was variable. For example, H19 was significantly over-expressed in the bladder, brain, heart, and lung, but not in the kidney, liver, spleen, and thymus of deceased cloned calves [12]. In cloned mice, expression levels of H19 were also highly variable and the findings were controversial: H19 was decreased in the fetuses and placentas [6] and in the livers of ES cloned mice [45], not changed in the placenta in somatic cell clones compared to controls [10], and silenced in placenta of ES clones [45]. These apparent discrepancies may reflect the fact that the expression of H19 is highly variable between individual clones and even in organs from same clone.
Fig. 2. DNA methylation status of H19 DMR was analyzed by BSP. A: Nucleotide sequences for a 193 bp H19 DMR fragment (upper strands) and its bisulfite-converted version (lower strands). Primer sequences are underlined. Each CpG is numbered and italicized. Cleavage CpG sites of TaqaI for COBRA analysis were indicated by arrows. B: Methylation profiles of H19 DMR in sperm and placentas of dead transgenic clones, live transgenic clones and normally produced Holstein calves. Unfilled (white) and filled (black) circles represent unmethylated and methylated CpGs, respectively. Horizontal lines of circles represent one separate clone that was sequenced. Lollipop diagrams were generated by BIQ Analyzer software [35]. For each sample, the methylation data were analyzed by computing the percentage of clones with ⬎50% methylated.
1354
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359
Fig. 3. DNA methylation status of XIST DMR was analyzed by BSP. A: Nucleotide sequences for a 222 bp XIST DMR fragment. Cleavage CpG sites of BstUI for COBRA analysis are indicated by arrows. B: Methylation profiles of XIST DMR in sperm and placentas. Details are described in the legend to Fig. 2.
Similar to H19, expression of IGF2R, another maternally expressed imprinted gene, which interferes with the mitogenic effect of IGF2, was also significantly lower in placentas of deceased transgenic calves compared to controls. Reduced expression of IGF2R has also been reported in various organs of IVF sheep with LOS [46], and in the placentas of SCNT mice [10]. Since IGF2R inhibits fetal growth, fetuses with reduced
IGF2R would have less growth suppression. Therefore, IGF2R may be associated with LOS. In contrast with H19, the paternally expressed imprinted gene IGF2 was notably over-expressed in placentas of deceased transgenic calves. Placental-specific IGF2 was a major modulator of placental and fetal growth [47]; this gene acted in the placenta to directly control the supply of maternal nutrients to the fetus.
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359
Furthermore, IGF2 was clustered with H19, with both genes regulated by an ICR located between the two genes [48 –51]. Expression of IGF2 and H19 was negatively correlated in naturally produced [52] and somatic cloned mice [45], which had relatively low expression of H19 and over-expression of IGF2. Similarly, in the present study, there was a negative association between H19 (low expression) and IGF2 (over-expression) expression in placentas of deceased transgenic calves with LOS. Furthermore, IGF2 was also over-expressed in cloned bovine embryos compared to IVF controls [18]. There was drastically higher expression of IGF2 in the bladder, brain, heart, and lung of cloned calves suffering from LOS compared to normal controls [12]. In humans, up-regulation of IGF2 was thought to be important in the pathogenesis of Beckwith-Wiedemann syndrome (BWS) [53–55], which is characterized by somatic overgrowth, similar to LOS in ruminants. Based on the present results, together with those from previous studies, we inferred that up-regulation of IGF2 promoted overall fetal growth and therefore could be related to LOS. In contrast, a recent study reported a significant reduction in the expression of IGF2 in placentas of dead cloned piglets compared to normal controls [11]. Perhaps there are differences between species in expression of this gene. The other imprinted gene, XIST was significantly over-expressed in placentas of deceased transgenic calves with LOS compared to controls. It was reported that XIST RNA played a crucial role in X-chromosome inactivation (XCI) [56]. Although a recent study provided evidence of XIST RNA-independent initiation of mouse imprinted X-chromosome inactivation [57], it is noteworthy that XIST is required to stabilize silencing along the paternal X chromosome (Xp) [57]. Cloned bovine blastocysts had increased XIST expression compared with IVF, in vivo-generated, and parthenogenetic embryos [58]. In addition, expression of XIST in the hearts of bovine clones was higher than that of controls [32]. Besides, the PEG3 gene had approximately 14.8 times more expression in placentas of deceased transgenic calves than the average level of the controls. In the present study, BSP and COBRA assays were used to investigate whether aberrant expression of the imprinted genes H19, XIST, and IGF2R was associated with abnormal methylation patterns of their DMRs. Unfortunately, it was not possible to specifically distinguish between the paternal and maternal alleles for the absence of single nucleotide polymorphisms (SNPs). However, that these imprinted genes were im-
1355
printed in cattle and that their DMRs were exclusively methylated (H19) or completely unmethylated (XIST) in sperm provided us with some useful information. Still, a previous study reported that IGF2R ICR in bovine sperm was also completely unmethylated [24]. Furthermore, the regions amplified in the three imprinted genes exhibited nearly hemizygous methylation status in the normal control group. In the present study, DNA methylation status of the three imprinted genes in placentas of deceased transgenic calves was abnormal, whereas DNA methylation levels of these genes (except XIST DMR) in most placentas of live transgenic calves were similar to normal controls. In this study, we found that there was aberrant hypermethylation of H19 DMR in placentas of deceased transgenic calves with LOS, but in the placentas of live transgenic calves, mean DNA methylation of the gene was similar to controls. This finding supported the results of the present study on gene expression analysis and supported the idea that the hypermethylated H19 DMR may cause repression of the gene, consistent with findings in cloned mice [6]. Curchoe et al [59] detected hypomethylation trends in the intergenic region of the imprinted IGF2 and H19 genes in the cloned cattle, the region like an imprinting control region (ICR). Imprinting control regions regulated the expression of both IGF2 and H19 in mammals [51]. In contrast, XIST DMR in placentas of deceased and live transgenic calves were seriously hypomethylated. Similarly, Xue et al [60] found that methylation patterns in the 5= region of bovine XIST had variable degrees of hypomethylation in the heart, liver, and spleen of deceased clones, based on methylation-sensitive PCR analysis. Furthermore, there was significant hypomethylation of XIST DMR in two aborted SCNT calves [22]. Based on all of these findings, we inferred that there were aberrant patterns of X chromosome inactivation in bovine clones. The maternally expressed imprinted gene IGF2R is regulated by differentially methylated ICR, which is located within the second intron of IGF2R. The ICR includes the promoter for IGF2R antisense (also known as Air) that silences expression of IGF2R [61]. In mice, the ICR is hypermethylated on the maternal chromosome, preventing transcription of Air and allowing IGF2R to be transcribed [61]. On the paternal chromosome the ICR is unmethylated, Air is expressed and IGF2R is repressed [51]. In cattle, IGF2R expression was also regulated by epigenetic modification of ICR [24], and in cloned calves, DNA methylation at the locus of gene imprinting was disrupted [24]. Conse-
1356
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359
1357
Fig. 5. Overall DNA methylation profiles of H19 (A), XIST (B) and IGF2R (C) in sperm and placentas were analyzed by COBRA. N, D and T denote the placenta of normal controls, deceased transgenic clones and live transgenic clones. The sizes of digested products are indicated at the top of each electrophoretogram. Cleavage CpG sites are shown in Figs. 2A, 3A, and 4A. The enzymes only cut the fragments when the specific CpG site was methylated. A 100 bp marker is indicated on the right.
quently DNA methylation of IGF2R ICR was assessed in the present study. That it was hypomethylated in placentas of deceased transgenic calves may have caused higher Air expression and lower IGF2R expression. In conclusion, expression and DNA methylation of imprinted genes in the placentas of live transgenic calves appeared to be more normal than in deceased transgenic calves. We inferred that abnormal expression of the imprinted genes in placentas of deceased transgenic calves could be associated with altered DNA methylation levels at the DMRs of these imprinted genes. These alterations could result from aberrant epigenetic nuclear reprogramming during SCNT and may disrupt normal developmental regulation of placenta and fetus, which may result in developmental insufficiencies and ultimately fetal or perinatal death in cloned transgenic calves.
Acknowledgments The authors greatly appreciate Dr. John P. Kastelic for carefully editing and correcting the paper. We thank Prof. Jeff Gale for his help during the writing. We are thankful to Dr. Xingjun Miao and Dr. Shuang Tang for their help with data analysis. We are also thankful to Prof. Jian-Er Long, Dr. Yan-chang Wei and Dr. Xingwei Liang for their generous technical assistance with the BSP and COBRA analyses. This work was supported by a grant from the National Key Project for Production of Transgenic Livestock, PR China (No.2008ZX08007-004).
References [1] Yang XZ, Smith SL, Tian XC, Lewin HA, Renard JP, Wakayama T. Nuclear reprogramming of cloned embryos and its
Fig. 4. DNA methylation status of IGF2R ICR analyzed by BSP. A: Nucleotide sequences for a 163 bp IGF2R ICR fragment. Cleavage CpG sites of BstUI for COBRA analysis are indicated by arrows. B: different nucleotide sequences (162 bp) we found, changed nucleotides compared the origin sequences were showed in grey. CpGs are underlined. CpG4, 8, 11, and 15 (in grey) were missing in this amplified region. C: Methylation profiles of IGF2R ICR. Unfilled (white) and filled (black) circles represent unmethylated and methylated CpGs, respectively. Small vertical lines without a circle correspond to non-CpG position where there is a CpG in the genomic sequence. Details are described in the legend to Fig. 2.
1358
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13] [14] [15] [16]
[17]
[18]
[19]
[20]
J.M. Su et al. / Theriogenology 75 (2011) 1346 –1359 implications for therapeutic cloning. Nat Genet 2007; 39:295–302. Chavatte-Palmer P, Heyman Y, Richard C, Monget P, LeBourhis D, Kann G, et al. Clinical, hormonal, and hematologic characteristics of bovine calves derived from nuclei from somatic cells. Biol Reprod 2002;66:1596 –1603. Constant F, Guillomot M, Heyman Y, Vignon X, Laigre P, Servely JL, et al. Large offspring or large placenta syndrome? Morphometric analysis of late gestation bovine placentomes from somatic nuclear transfer pregnancies complicated by hydrallantois. Biol Reprod 2006;75:122–30. Miglino MA, Pereira FTV, Visintin JA, Garcia JM, Meirelles FV, Rumpf R, et al. Placentation in cloned cattle: Structure and microvascular architecture. Theriogenology 2007;68:604 –17. Suemizu H, Aiba K, Yoshikawa T, Sharov AA, Shimozawa N, Tamaoki N, et al. Expression profiling of placentomegaly associated with nuclear transplantation of mouse ES cells. Dev Biol 2003;253:36 –53. Ogawa H, Ono Y, Shimozawa N, Sotomaru Y, Katsuzawa Y, Hiura H, et al. Disruption of imprinting in cloned mouse fetuses from embryonic stem cells. Reproduction 2003;126:549 –57. Bischoff SR, Tsai S, Hardison N, Motsinger-Reif AA, Freking BA, Nonneman D, et al. Characterization of Conserved and Nonconserved Imprinted Genes in Swine. Biol Reprod 2009; 81:906 –20. De Sousa PA, King T, Harkness L, Young LE, Walker SK, Wilmut I. Evaluation of gestational deficiencies in cloned sheep fetuses and placentae. Biol Reprod 2001;65:23–30. Arnold DR, Fortier AL, Lefebvre R, Miglino MA, Pfarrer C, Smith LC. Placental insufficiencies in cloned animals - a workshop report. Placenta 2008;29 Suppl A:S108 –110. Inoue K, Kohda T, Lee J, Ogonuki N, Mochida K, Noguchi Y, et al. Faithful expression of imprinted genes in cloned mice. Science 2002;295:297. Wei YC, Zhu J, Huan YJ, Liu ZF, Yang CR, Zhang XM, et al. Aberrant expression and methylation status of putatively imprinted genes in placenta of cloned piglets. Cell Reprogram 2010;12:213–22. Yang L, Chavatte-Palmer P, Kubota C, O’Neill M, Hoagland T, Renard JP, et al. Expression of imprinted genes is aberrant in deceased newborn cloned calves and relatively normal in surviving adult clones. Mol Reprod Dev 2005;71:431– 8. Gardiner-Garden M, Frommer M. CpG islands in vertebrate genomes. J Mol Biol 1987;196:261– 82. Larsen F, Gundersen G, Lopez R, Prydz H. Cpg islands as gene markers in the human genome. Genomics 1992;13:1095–107. Plass C, Soloway PD. DNA methylation, imprinting and cancer. Eur J Hum Genet 2002;10:6 –16. Chae JI, Lee KS, Kim DJ, Han YM, Lee DS, Lee KK, et al. Abnormal gene expression in extraembryonic tissue from cloned porcine embryos. Theriogenology 2009;71:323–33. Cui XS, Zhang DX, Ko YG, Kim NH. Aberrant epigenetic reprogramming of imprinted microRNA-127 and Rtl1 in cloned mouse embryos. Biochem Bioph Res Co 2009;379:390 – 4. Han DW, Song SJ, Uhum SJ, Do JT, Kim NH, Chung KS, et al. Expression of IGF2 and IGF receptor mRNA in bovine nuclear transferred embryos. Zygote 2003;11:245–52. Kang YK, Koo DB, Park JS, Choi YH, Chung AS, Lee KK, et al. Aberrant methylation of donor genome in cloned bovine embryos. Nat Genet 2001;28:173–77. Mann MRW, Chung YG, Nolen LD, Verona RI, Latham KE, Bartolomei MS. Disruption of imprinted gene methylation and
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32]
[33]
[34] [35]
[36]
[37]
[38]
expression in cloned preimplantation stage mouse embryos. Biol Reprod 2003;69:902–14. Smith SL, Everts RE, Tian XC, Du FL, Sung LY, RodriguezZas SL, et al. Global gene expression profiles reveal significant nuclear reprogramming by the blastocyst stage after cloning. P Natl Acad Sci USA 2005;102:17582–7. Liu JH, Yin S, Xiong B, Hou Y, Chen DY, Sun QY. Aberrant DNA methylation imprints in aborted bovine clones. Mol Reprod Dev 2008;75:598 – 607. Lin L, Li Q, Zhang L, Zhao DS, Dai YP, Li N. Aberrant epigenetic changes and gene expression in cloned cattle dying around birth. Bmc Dev Biol 2008;8:14. Long JE, Cai X. Igf-2r expression regulated by epigenetic modification and the locus of gene imprinting disrupted in cloned cattle. Gene 2007;388:125–34. Zhang L, Wang SH, Dai YP, Li N. Aberrant gene expression in deceased transgenic cloned calves. Anim Reprod Sci 2009;112: 182–9. Suteevun-Phermthai T, Curchoe CL, Evans AC, Boland E, Rizos D, Fair T, et al. Allelic switching of the imprinted IGF2R gene in cloned bovine fetuses and calves. Anim Reprod Sci 2009;116:19 –27. Ma JJ, Wang YS, He XN, Zheng YM, Zhang Y. Transfection of bovine fetal fibroblasts with -defensin (hBD3) gene and construction of transgenetic cloned embryos. J Agric Biotech 2010; 18:707–12. Peng W, Lan ZG, Ma JJ, Wang BL, Zhang Y. Construction of HBD-3 gene mammary-specific expression vector and eukaryotic expression. Chin J Biotech 2009;25:968 –74. Wang YS, Tang S, An ZX, Li WZ, Liu J, Quan FS, et al. Effect of mSOF and G1.1/G2.2 Media on the Developmental Competence of SCNT-Derived Bovine Embryos. Reprod Domest Anim 2010 (in press). Wang YS, Xiong XR, An ZX, Wang LJ, Liu J, Quan FS, et al. Production of cloned calves by combination treatment of both donor cells and early cloned embryos with 5-aza-2=-deoxycytidine and trichostatin A. Theriogenology 2010 (in press). Katz-Jaffe MG, McCallie BR, Preis KA, Filipovits J, Gardner DK. Transcriptome analysis of in vivo and in vitro matured bovine MII oocytes. Theriogenology 2009;71:939 – 46. Li SJ, Li YX, Du WH, Zhang L, Yu SY, Dai YP, et al. Aberrant gene expression in organs of bovine clones that die within two days after birth. Biol Reprod 2005;72:258 – 65. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 2001;25:402– 8. Li LC, Dahiya R. MethPrimer: designing primers for methylation PCRs. Bioinformatics 2002;18:1427–31. Bock C, Reither S, Mikeska T, Paulsen M, Walter J, Lengauer T. BiQ analyzer: visualization and quality control for DNA methylation data from bisulfite sequencing. Bioinformatics 2005;21:4067– 8. Kato Y, Tani T, Sotomaru Y, Kurokawa K, Kato J, Doguchi H, et al. Eight calves cloned from somatic cells of a single adult. Science 1998;282:2095– 8. Renard JP, Chastant S, Chesne P, Richard C, Marchal J, Cordonnier N, et al. Lymphoid hypoplasia and somatic cloning. Lancet 1999;353:1489 –91. Wells DN, Misica PM, Tervit HR. Production of cloned calves following nuclear transfer with cultured adult mural granulosa cells. Biol Reprod 1999;60:996 –1005.
Available online at www.sciencedirect.com
Theriogenology 75 (2011) 1346 –1359 www.theriojournal.com
Expression and methylation status of imprinted genes in placentas of deceased and live cloned transgenic calves Jian-min Su, Bo Yang, Yong-sheng Wang, Yan-yan Li, Xian-rong Xiong, Li-jun Wang, Ze-kun Guo, Yong Zhang* College of Veterinary Medicine, Northwest A&F University, Key Laboratory of Animal Reproductive Physiology & Embryo Technology, Ministry of Agriculture, Yangling, Shaanxi 712100, PR China Received 1 July 2010; received in revised form 30 November 2010; accepted 30 November 2010
Abstract Placental deficiencies are linked with developmental abnormalities in cattle produced by somatic cell nuclear transfer (SCNT). To investigate whether the aberrant expression of imprinted genes in placenta was responsible for fetal overgrowth and placental hypertrophy, quantitative expression analysis of six imprinted genes (H19, XIST, IGF2R, SNRPN, PEG3, and IGF2) was conducted in placentas of: 1) deceased (died during perinatal period) transgenic calves (D group, n ⫽ 4); 2) live transgenic calves (L group, n ⫽ 15); and 3) conventionally produced (control) female calves (N group, n ⫽ 4). In this study, XIST, PEG3 and IGF2 were significantly over-expressed in the D group, whereas expression of H19 and IGF2R was significantly reduced in the D group compared to controls. The DNA methylation patterns in the differentially methylated region (DMR) from H19, XIST, and IGF2R were compared using Bisulfite Sequencing PCR (BSP) and Combined Bisulfite Restriction Analysis (COBRA). In the D group, H19 DMR was significantly hypermethylated, but XIST DMR and IGF2R ICR were significantly hypomethylated compared to controls. In contrast, there were no noticeable differences in the expression and DNA methylation status of imprinted genes (except DNA methylation level of XIST DMR) in the L group compared to controls. In conclusion, altered DNA methylation levels in the DMRs of imprinted genes in placentas of deceased transgenic calves, presumably due to aberrant epigenetic nuclear reprogramming during SCNT, may have been associated with abnormal expression of these genes; perhaps this caused developmental insufficiencies and ultimately death in cloned transgenic calves. © 2011 Elsevier Inc. All rights reserved. Keywords: DNA methylation; Imprinted gene; SCNT; Cloned transgenic cow
1. Introduction Although generation of transgenic livestock by somatic cell nuclear transfer (SCNT) has great potential for producing valuable recombinant proteins and breeding disease-resistant livestock, there is a high incidence
* Corresponding author: Tel.: ⫹86 29 87080085; fax: ⫹86 29 87080085. E-mail address: [email protected] (Y. Zhang); sujianmin@ gmail.com (J.M. Su). 0093-691X/$ – see front matter © 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.theriogenology.2010.11.045
of abnormalities in SCNT clones. Developmental abnormalities of cloned animals usually involve the placenta in several species [1], including cattle [2– 4], mice [5,6], pigs [7], and sheep [8]. Most cloned animals die in utero, due to placental deficiency [9]. The placenta may be more prone to aberrancies than the fetus in SCNT animals: several genes were abnormally expressed in the placenta, but not in the fetus, of cloned mice [10], pigs [11], and cattle [12]. Therefore, it has been proposed that the placental abnormality may be the main cause of cloned fetal death.