Characterization of bacterial symbionts in Frankliniella occidentalis (Pergande), Western flower thrips

Journal of Invertebrate Pathology 99 (2008) 318–325

Contents lists available at ScienceDirect

Journal of Invertebrate Pathology journal homepage: www.elsevier.com/locate/yjipa

Characterization of bacterial symbionts in Frankliniella occidentalis (Pergande), Western flower thrips Lisa Chanbusarakum *, Diane Ullman Department of Entomology, University of California-Davis, 1 Shields Avenue, Davis, CA 95616, USA

a r t i c l e

i n f o

Article history: Received 26 June 2008 Accepted 3 September 2008 Available online 9 September 2008 Keywords: Frankliniella occidentalis Bacteria Symbiosis 16S RNA Erwinia Escherichia Phylogenetic analysis

a b s t r a c t Many insects have associations with bacteria, although it is often difficult to determine the intricacies of the relationships. In one such case, facultative bacteria have been discovered in a major crop pest and virus vector, the Western flower thrips (WFT), Frankliniella occidentalis (Pergande) (Thysanoptera: Thripidae). Several bacterial isolates have been studied in Netherlands greenhouse thrips populations, with molecular data indicating that these bacteria were similar to Escherichia coli, although biochemical properties suggested these microbes might actually be most similar to plant pathogenic bacteria in the genus Erwinia. We focused on the bacterial flora of the Hawaiian Islands thrips population where these gut bacteria were first reported in 1989. We also analyzed a German population and a 1965 California population preserved in ethanol. Culture and culture-independent techniques revealed a consistent microflora that was similar to the Netherlands isolates studied. The similarity among thrips microbes from multiple populations and environments suggested these bacteria and their hosts share a widespread association. Molecular phylogeny based on the 16S rRNA gene and biochemical analysis of thrips bacteria suggested two distinctive groups of microbes are present in thrips. Phylogenetic analysis also revealed support for one thrips bacterial group having a shared ancestry with Erwinia, whereas the second group of thrips bacteria fell out with E. coli, but without support. Although species-specific relationships were indeterminable due to the conservative nature of 16S, there is strong indication that thrips symbionts belong to two different genera and originated from environmental microbes. Ó 2008 Elsevier Inc. All rights reserved.

1. Introduction Insects have had associations with microbes for millions of years (Ishikawa, 2003). Many of these microbes are bacteria residing inside the insect body, specifically extracellularly in the gut. Many such associations probably started as transient encounters or infectious parasitic relationships and evolved into more benign or beneficial relationships (Paracer and Ahmadjian, 2000; Ryan, 2002). Some associations evolved to the point where bacteria and host required one another for survival, making it difficult to study and characterize the bacterial symbiont on its own (Dillon and Dillon, 2004; Piel, 2004). Even insect gut bacteria that can survive independently of their insect host are often not well understood (Harada et al., 1997; Watanabe and Sato, 1998). Studying how these gut bacteria interact with their insect host provides the foundation for understanding how intimate relationships develop between two separate species. Furthermore, knowledge of insect– microbe relationships may reveal the roles gut bacteria play in the development and health of organisms of interest to humans. The Western flower thrips (WFT), Frankliniella occidentalis (Per* Corresponding author. Fax: +1 530 752 1537. E-mail address: [email protected] (L. Chanbusarakum). 0022-2011/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.jip.2008.09.001

gande) (Thysanoptera: Thripidae) is an important pest of food, fiber and ornamental crops with an extremely large host range. In addition to feeding and ovipositioning damage, thrips spread plant viruses in the genus Tospovirus [type member = Tomato spotted wilt virus (TSWV)]. Tospoviruses can kill plants or cause complete economic loss by destroying the portion of the plant that is harvested (Kumar et al., 1995; Whitfield et al., 2005). Many crops worldwide are impacted by these insects and the viruses they vector. While investigating the internal anatomy of WFT from the Hawaiian Islands, Ullman et al. (1989) discovered rod-shaped bacteria in the hindgut of all insects examined regardless of diet or age. An independent study of WFT collected in the Netherlands from greenhouse cucumber and chrysanthemum plants revealed there were potentially two types of WFT bacteria that formed a monophyletic group in phylogenetic analyses (de Vries et al., 2001a). These authors also found thrips bacteria were facultative symbionts (bacteria that could be cultured outside of their host), infected thrips at the larval stages, belonged in the bacterial family Enterobacteriaceae, formed a monophyletic group with Escherichia coli in phylogenetic analysis, and were associated with food uptake. Additional analyses suggested WFT bacteria parasitize thrips when thrips have a rich food source and aid WFT when the insect faces nutrient-deficient conditions (de Vries et al., 2004). Transmis-

L. Chanbusarakum, D. Ullman / Journal of Invertebrate Pathology 99 (2008) 318–325

sion studies showed these bacteria spread among unrelated WFT by the ingestion and excretion of bacteria on surfaces as well as between mother and offspring when egg surfaces and surrounding plant tissue were coated with bacteria during probing and ovipositioning (de Vries et al., 2001b). Despite the ability to survive without thrips, these bacteria appear to have a relationship with the Netherlands WFT studied that may be related to feeding habits and host adaptation (de Vries et al., 2001a). The classical definition of a symbiotic relationship is two separate species living in close association with one another (Sapp, 2004; Smith, 2001). Enterobacteriaceae were found in thrips colonies in Netherlands greenhouses, but this finding alone does not mean this association is universally symbiotic for all WFT and their bacteria. Some aphids in certain regions only possess certain species of bacteria (Tsuchida et al., 2002), but each microbe conveys its own cost and benefits (Koga et al., 2003; Montllor et al., 2002; Moran et al., 2005). Our goal was to test the hypothesis that there is indeed a close symbiotic association between specific bacteria and the major pests WFT independent of host location. We also hypothesize the genetic differences between the two thrips bacteria strains indicate two distinctive types of bacteria and these different symbionts likely evolved from unique ancestors. To test these hypotheses, we looked at the original WFT colony where bacteria were initially seen in the gut, a German lab population of thrips, and a sample of California thrips collected in 1965 and preserved in ethanol. We used phylogenetic analyses and biochemical tests to classify and characterize these thrips bacteria, compare them to other thrips microbes, and examine their ancestry.

2. Materials and methods 2.1. Investigating bacterial symbiosis in WFT 2.1.1. Thrips populations The WFT colony where thrips bacteria were first observed originated from a TSWV-infected field in the Hawaiian Islands in the early 1980’s. WFT collected from the field have been maintained as a lab colony on bleached green bean pods (Phaseolus vulgaris L.) after the methods of (Hunter and Ullman, 1992). Thrips from a German lab colony maintained over 10 years on chrysanthemum and bean plants were also examined (Gerald Moritz lab, Martin Luther University of Halle-Wittenberg, Halle, Germany). Specimens from a natural WFT population collected in 1965 off Ceanothus at the University of California-Davis arboretum and stored at room temperature in 95–100% ethanol were kindly provided by the Bohart Museum (Davis, CA). Hawaiian Islands WFT underwent both culture and culture-independent analysis (see below); the other two populations were analyzed via culture-independent methods only. 2.1.2. Culturing bacteria in thrips and extracting bacterial DNA Culturable bacteria were isolated from live individual adults and second instars by plating surface-sterilized WFT on LB agar plates following previous protocols (de Vries et al., 2001a). In total, 8 second instars and 13 adults were individually cultured for bacteria. One to 4 distinct bacterial colonies were randomly selected from each positive plate for further DNA and biochemical analysis. The QIAGEN DNeasy Tissue Kit (Qiagen Inc., Valencia, CA) was used to extract DNA from overnight bacterial cultures as per instructions. 2.1.3. Extracting bacterial DNA via culture-independent techniques Whole individuals were crushed with a sterilized pestle in an autoclaved microcentrifuge tube on dry ice and then subjugated to the QIAGEN DNeasy Tissue Kit. In total, 3 individual second in-

319

stars and 4 individual adults from the Hawaiian Islands lab colony, 3 groups of 5 adults from the German population, and a group of 3 thrips from the 1965 California collection were individually examined for bacteria via this culture-free method. 2.1.4. Amplification of cultured bacterial DNA The 16S gene, commonly used to identify bacteria, was amplified via polymerase chain reaction (PCR) from cultured bacteria using Taq Polymerase (Promega Corporation, Madison, WI) and universal primers 27f and 1525r designed to amplify the majority of eubacterial 16S genes (Table 1). A PTC 200 Peltier Thermal Cycler (MJ Research, Bio-Rad, San Francisco, CA) was used for PCR. The 25 lL PCR reactions consisted of 3 lL extracted DNA, 1 Taq buffer without MgCl2, 1 mM MgCl2, 1 U Taq Polymerase, 0.4 mM dNTPs, 0.4 lM forward and reverse primers, and autoclaved distilled water. The amplification program used was 95 °C for 3 min; 55 °C for 1 min; 72 °C for 15 s; 35 cycles of 95 °C for 1 min, 60 °C for 1 min, 72 °C for 1.5 min; 72 °C for 15 min and 4 °C until removal from the machine. Amplified 16S produced a 1.5 kb band on ethidium bromide stained gels. 2.1.5. Amplification of uncultured bacterial DNA 16S rDNA obtained via culture-independent techniques was amplified using high fidelity iProof polymerase (Invitrogen Corporation, Carlsbad, CA) and universal 16S primers: 27f and 1525r with restriction sites for ClaI and XhoI, respectively, at the 50 end. The 25 lL PCR reactions consisted of 3 lL extracted DNA, 1x iProof buffer, 0.5 U iProof polymerase, 0.2 mM dNTPs, and 0.4 lM forward and reverse primers. The sample was heated to 98 °C for 30 s; 98 °C for 30 s, 62 °C for 30 s, 72 °C for 1.5 min for 29 cycles; 72 °C for 30 min; 4 °C indefinitely. Resulting PCR products were purified using the Qiagen PCR purification kit and approximately 1 lg of DNA was digested with ClaI and XhoI. Digested product was gel purified and ligated into ClaI and XhoI digested pGADT7 vector using T4 DNA ligase (Invitrogen Corporation). The plasmid plus insert was transformed into competent E. coli DH1-a cells. Cells with insert were screened using ampicillan LB plates. Clones from successfully transformed cells were extracted using MO Bio Laboratories Miniprep Kit (MO Bio Laboratories, Inc.). Miniprepped products were diluted to one tenth their concentration and PCR amplified using iProof polymerase and M13 primers to detect inserted DNA. Conditions for the PCR reaction were as stated for iProof polymerase, except for applying 62 °C annealing temperature. 2.1.6. Sequencing bacterial DNA All PCR products from cultured bacteria and clones from DNA extracted from individual thrips were purified using the QIAquick PCR purification kit before being sent to the Division of Biological Sciences DNA Sequencing Facility (College of Biological Sciences, UC-Davis, Davis, CA) for sequencing with the primers: 27f, 514r, 357f, 530f, 874f and 1525r (Table 1). The resulting 16S rDNA

Table 1 Primers used for sequencing Primer name

Sequence (50 ? 30 )

27f 514r* 357f* 530f 874f* 1525r

AGAGTTTGATCMTGGCTCAG (M = A + C wobble) ATTACCGCGGCKGCTGGCAC (K = G + T wobble) CCAGACTCCTACGGGAGGCAGCAG GTGCCAGCMGCCGCGG (M = A + C wobble) GCTAACGCGTTAAGTCGACCGCC AAGGAGGTGWTCCARCC (R = G + A wobble)

* Denotes primers created based on the alignment published by Lane; primers otherwise from Lane (1991).

320

L. Chanbusarakum, D. Ullman / Journal of Invertebrate Pathology 99 (2008) 318–325

sequence was then assembled using Invitrogen Vector NTI Contig Express Software and manually verified. 2.2. Analysis of different bacteria strains 2.2.1. Analysis of gene sequences 16S sequences obtained from our study came from 33 cultured bacteria colonies taken from 6 adults and 6 second instars as well as 60 bacterial clones obtained from culture-independent techniques used on 3 second instars and 4 adults from the Hawaiian Islands, 30 clones from 3 groups of 5 German colony adults, and 10 clones from the group of 3 1965 California thrips. Sequences were aligned using the Invitrogen Vector NTI AlignX program. Our alignment revealed two unique sequences differing by 5% identity. For future computational ease, each unique sequence was represented and labeled with organism type (Bacterium), host species origination (Fo for Frankliniella occidentalis) and strain number (e.g. BFo1). 2.2.2. Phylogenetic analysis 16S WFT bacteria sequences were BLAST searched in GenBank (March, 2006). No standardized guidelines exist for defining a bacterial species based on 16S (Drancourt et al., 2000), although Stackebrandt and Goebel (1994) have suggested that less than 97% 16S identity definitively denotes separate species. A study comparing 16S genes of various Pseudomonas species showed that bacteria in the same genus had 93% or greater identity (Moore et al., 1996). Since we wanted to learn which genera and species were most similar to BFo, we selected bacteria for our comparisons that had greater than 94% similarity to BFo. We also required that bacteria used in our dataset must be submitted to GenBank with a peer-reviewed published journal entry, must have more than 90% of its 16S sequenced, and the bacteria must not be solely found in humans. We chose free-living Vibrio cholerae as our outgroup, as it has been used previously in studies examining relationships of bacteria in the family Enterobacteriaceae (Moran et al., 2005). The two unique Hawaiian Islands BFo strains were compared to 7 Netherlands thrips bacteria and 18 bacteria in the family Enterobacteriaceae (Table 2). Sequences were aligned and optimized using ClustalX. Nodal support was determined by calculating maximum parsimony bootstrapping support in PAUP* (Swofford, 2003) and Bayesian posterior probabilities in MrBayes (Huelsenbeck et al., 2001; Ronquist and Huelsenbeck, 2003). Nonparametric bootstraps were generated in PAUP* with 10,000 maximum parsimony replicates with 10 random addition sequences per bootstrap. No molecular clock was enforced. 100,000 trees were sampled in MrBayes under the GTR + G + I model with the first 25,000 trees discarded as burnin. A majority consensus tree was constructed to calculate posterior probabilities and determine phylogeny. 2.2.3. Testing BFo monophyly In addition to looking at the bootstrap and posterior probability calculations from the phylogenetic analysis, we tested various hypotheses about thrips bacterial origins determined earlier by de Vries et al. (2001a). Using the authors’ data as well as our own molecular data, we tested the null hypothesis that thrips bacteria were monophyletic. Heuristic searches of 100 constrained and 100 unconstrained topologies were constructed in PAUP* under the maximum likelihood criterion and compared using the Shimodaira–Hasegawa test [see (Buckley et al., 2001; Shimodaira and Hasegawa, 1999)]. 2.2.4. Phenology We examined biochemical properties of 27 colonies from all of the positive cultured adults and 5 of 6 positive second instars.

Table 2 Bacteria used in phylogenetic analysis Bacteria

GenBank Accession No.

BFo-1 (Hawaii Islands isolate) BFo-2 (Hawaii Islands isolate) Thrips 6.9 (Netherlands isolate) Thrips 6.4 (Netherlands isolate) Thrips 6.12 (Netherlands isolate) TACiii.94.1 (Netherlands isolate) TACi.94.1 (Netherlands isolate) TAC.xii.93.8 (Netherlands isolate) TACxii.93.2 (Netherlands isolate) Candidatus Erwinia dacicola Citrobacter freundii! Citrobacter rodentium! Enterobacter cloacae! Escherichia coli Erwinia amylovora Enterobacter sakazakii Erwinia persicinus Erwinia rhapontici Erwinia toletana Klebsiella oxytoca! Klebsiella pneumoniae! Morganella morganii Obesumbacterium proteus Pectobacterium carotovorum subsp atrosepticum Pectobacterium chrysanthemi Serratia liquefaciens Serratia fonticola Serratia grimesii Serratia proteamaculans Vibrio cholerae Xenorhabdus nematophila Yersinia pestis Yersinia pseudotuberculosis

EU029105 EU029106 AF024611 AF024610 AF024609 AF024608 AF024607 AF024612 AF024613 AJ586620 M59291 AB045737 EF551364 U00096 X83265 AY752937 EPJ001190 ERZ96087 AF130885 AB004754 X80684 AJ301681 AJ233422 AF373163 AF373202 AJ306725 AF286869 AJ233430 AJ233435 NC002505 AY521241 AJ414158 BX936398

Species used in phylogenetic analysis. ! denotes bacteria included only when examining biochemical genera suggestions.

Tools used to study bacterial phenology included gram staining, phase-contrast microscopy, API 20E Biochemical tests (bioMérieux, inc., Durham, NC), and various carbohydrate fermentation tests as outlined by Cowan and Steel (1974) and Edward and Ewing (1986). Results from API 20E tests were used with the Analytical Profile Index, 5th edition from bioMérieux to identify colonies. 2.3. Examining BFo origins 2.3.1. Phylogenetic analysis In addition to studying the phylogenetic tree derived from our data, we reviewed work by de Vries et al. (2001a) that suggested thrips bacteria formed a monophyletic group that was sister to E. coli with 62% bootstrap support. To test this hypothesis, we compared log likelihoods of unconstrained trees and trees in which BFo and E. coli were constrained to be monophyletic using the data from de Vries et al. and our own work, with topologies and comparisons done as stated before. 2.3.2. Examining biochemical genera suggestions According to the API 20E Biochemical tests, BFo-1 and BFo-2 were biochemically most similar to bacteria in Enterobacter and Klebsiella, and Citrobacter, respectively. These bacteria were not included in our phylogenetic analysis due to low 16S percentage match. To test the possibility of thrips bacteria being closely related to these bacteria, we selected type species and another well-known species from each genus and added them to our dataset and constrained trees for the specified associations (Table 2). Using the Shimodaira–Hasegawa test, we tested the hypotheses of BFo-1 and BFo-2 being monophyletic with their respective biochemically-similar bacteria.

321

L. Chanbusarakum, D. Ullman / Journal of Invertebrate Pathology 99 (2008) 318–325

strap support (53%), but some support from posterior probability (98%).

3. Results 3.1. Bacterial symbiosis in WFT

3.2.2. Testing BFo monophyly To test the monophyly of BFo-1 and BFo-2 as proposed by de Vries et al. (2001a), we compared likelihood ratio values using datasets from de Vries et al. and our own work. The constrained monophyletic tree from our dataset (ln L = 6037.85610) was not significantly better than the unconstrained tree (ln L = 6025.19349, p-value = 0.539). With the dataset from de Vries et al. the constrained (ln L = 7602.19406 and 7602.13859) versus unconstrained (ln L = 7602.19406 and 7602.13859) trees were also not significantly different (p-value = 0.689 or 1.00). We could therefore not disprove the hypothesis that BFo-1 and BFo-2 are monophyletic.

3.1.1. Hawaiian islands thrips Analysis of the 1500 basepair portion of the 16S showed that the bacteria colonizing thrips are predominant throughout the thrips population, independent of detection method, and that two distinct gene sequences were detected with both culture and culture-independent techniques (see Table 2 for GenBank Accession numbers). These strains, herein referred to as BFo-1 and BFo-2, were clearly distinct, sharing only 95% 16S identity and 50% of the biochemical properties tested (Table 3). Both culture and culture-independent techniques detected BFo-1 more frequently amongst tested thrips. Of the cultured thrips, 75% of second instars and 46% of adults had culturable bacteria. BFo-1 was the sole bacterium detected in 66% of infected adults and second instars. BFo-2 was exclusively found in the other 34% of adults and second instars. No cultured thrips appeared to possess both BFo-1 and BFo-2. Culture-independent techniques applied to thrips from the same Hawaiian Islands lab colony showed all insects examined were infected with at least one bacteria type. Nearly 30% of the culture-independently studied thrips possessed both BFo-1 and BFo-2, 60% possessed BFo-1 to the exclusion of BFo-2, and the remaining 10% had BFo-2 without BFo1. In one third of sampled thrips and less than 10% of all clones examined, 16S sequences were detected that did not closely match any entry into GenBank. The closest match to the mystery sequences were E. coli and Shigella sonnei.

3.2.3. Phenotypic analysis Of the 27 cultured bacteria colonies selected for biochemical analysis, 17 colonies identified by 16S sequences (cultured from 4 adults and 2 second instars) were BFo-1; the other 10 colonies were BFo-2 (cultured from 2 adults and 3 second instars). Bacterial colonies were morphologically indistinguishable, pale yellow, and mobile. Individual bacteria were flagellated. Although all Hawaiian Islands BFo shared certain characteristics, overall biochemical tests confirmed differences between BFo-1 and BFo-2. All BFo were gram-negative, rod-like and mobile. They tested positive for catalase, glucose and mannitol fermentation, beta-galactosidase, arginine dihydrolase; and negative for oxidase, lysine decarboxylase, orthinine decarboxylase, tryptophane deaminase, indole production, gelatinase and acetoin production. BFo-1 strains had greater variation in tests for fermentation or oxidation of various sugars and other metabolic capabilities, a stark contrast to the fairly uniform BFo-2 population (Table 3). Despite 16S congruency, sharing the same host, and undergoing identical culturing techniques, some BFo-1 colonies showed biochemical diversity (Table 4), indicating the 16S alone may be insufficient to detect differences amongst similar strains.

3.1.2. German colony and 1965 California thrips In contrast to our Hawaiian Islands colony, nearly all bacterial clones analyzed in the German thrips colony were BFo-1; only 1 of the 30 studied clones was BFo-2. No other bacteria were detected in the analysis. In the 1965 California WFT collection, 10% of the clones analyzed were BFo-2. The remaining clones were identical and shared 99% identity with various water or soil bacteria (i.e. see (Gihring et al., 2006; Iwasaki et al., 2007; Williams et al., 2004)) based on Blastn searches (May, 2007).

3.3. Origins of BFo 3.2. Two thrips bacterial isolates 3.3.1. Phylogenetic analysis Our analysis showed 78% bootstrap support and 98% Bayesian posterior probability supported BFo-1 and Netherlands Type 1 bacteria sharing origins with multiple plant pathogenic bacteria in Erwinia (Fig. 1). More detailed elucidation of the relationship between Erwinia and thrips bacteria and other Enterobacteriaceae was not possible due to poor resolution within the clade. Although BFo-2 and Netherlands Type 2 bacteria were sister to pathogens E. coli and Enterobacter sakazakii (Fig. 1) (Drudy et al., 2006; Rangel et al., 2005), there was no bootstrap or posterior probability support for this grouping. The contradicting phylogenies between our study and that of de Vries et al. (2001a) brought into question whether thrips bacteria and E. coli were monophyletic. When we used the data set reported by de Vries et al., we

3.2.1. Genetic analysis and phylogenetic analysis Comparisons between the originally discovered Hawaiian Islands thrips bacteria, German thrips bacteria, and 1965-collected California bacterial clones to thrips bacteria detected in the Netherlands showed that these bacterial strains were very similar to one another. Netherlands bacteria Type 1 and 2 were more similar to our reported BFo-1 and BFo-2 (98% and 97%), respectively, than they were to one another. This separation was again elucidated in our phylogenetic analysis, with each of our BFo strains forming a sister group with their respective Netherlands types (Fig. 1). Support for the BFo-2 and Netherlands Type 2 grouping was very high (99% bootstrap and 100% posterior probability) while the BFo-1 and Netherlands Type 1 clade had no boot-

Table 3 Non-uniform biochemical results of BFo

BFo-1 BFo-2 All BFo

CIT

H2S

URE

INO

SORB

RHA

SAC

MEL

AMY

ARAB

GLY

XYL

d d d

 + 

()  

d + (+)

d + (+)

d + (+)

d + (+)

d + d

d + d

d  d

 d ()

 d ()

+, 90–100% of strains were positive; (+), 76–89% of strains were positive; d, 26–75% strains were positive; (), 11–25% strains were positive; , 0–10% strains were positive. CIT, citrate utlization; H2S, H2S production; URE, urease, fermentation/oxidation tests: INO, inositol; SORB, sorbitol; RHA, rhamnose; SAC, sucrose; MEL, melibiose; AMY, amygdalin; ARAB, arabinose; GLY, glycerol; XYL, xylose. Notations follow Bergey’s manual of determinitive bacteriology (Holt et al., 1994).

322

L. Chanbusarakum, D. Ullman / Journal of Invertebrate Pathology 99 (2008) 318–325

Fig. 1. Bayesian phylogram of relationships among Enterobacteriaceae most similar to thrips bacteria. Numbers at the nodes indicate either parsimony bootstrap values (top) or posterior probabilities from Bayesian analyses (bottom). * denotes bootstrap values less than 50% when Bayesian values are greater than 50%. All other values less than 50% are excluded. Arrows indicate Hawaiian Islands thrips bacteria.

could not reject the hypothesis that E. coli and all thrips bacteria formed a monophyletic group (unconstrained ln L = 7602.19406 and 7602.13859, constrained ln L = 7607.95547, p-value = 0.144). Using our own data set, however, we were able to show that monophyletic BFo-E. coli trees (ln L = 6079.32203) had significantly worse likelihood values than the unconstrained trees we found (6025.19349) at the p < 0.05 level (p-value = 0.020). We therefore could reject the hypothesis that all thrips bacteria and E. coli form a monophyletic group. However, when we included E. sakazakii, which came out as a sister to E. coli, in the grouping, we could not reject the hypothesis of those taxa being monophyletic (ln

Table 4 Non-uniform API 20E biochemical results for bacterial colonies originating from the same cultured thrips BFo-1 colony source Second Second Second Second

instar instar instar instar

colony colony colony colony

1 2 3 4

Urease

Sucrose

  + +

+   +

Adult colony 1 Adult colony 2 Note. All colonies shared greater than 99.5% identity based on 16S.

Inositol  +

L = 6045.31464, p-value = 0.375). Further resolution of the more recent divergences is therefore not possible with only the 16S gene. 3.3.2. Examining biochemical genera suggestions Both thrips bacterial isolates could be identified to Enterobacteriaceae via biochemical traits, but species identification was not possible. BFo-1 was either unidentifiable or grouped into the genera Klebsiella or Enterobacter. BFo-2 coded to Citrobacter. When we tested the possibility of a relationship of BFo-1 to Klebsiella and Enterobacter based on 16S data (constrained ln L = 6655.62393, unconstrained = 6525.02072), we could reject the hypothesis that these bacteria might form their own clade at p < 0.05 level (p-value = 0.000). Also, there was sufficient evidence to reject BFo-2 and Citrobacter being monophyletic (constrained ln L = 6604.57106, unconstrained = 6525.02072, p-value = 0.000). A clear discrepancy exists between what the molecular data say and what the biochemical data suggest for this system. 4. Discussion 4.1. Bacterial symbiosis in WFT Our data strongly support a symbiosis between WFT and specific strains of bacteria. We have found specific bacteria repeatedly in thrips throughout the world. Our BFo-1 and BFo-2 show great 16S percent identity to respective Netherlands type 1 and 2

L. Chanbusarakum, D. Ullman / Journal of Invertebrate Pathology 99 (2008) 318–325

bacteria presented by de Vries et al. (98% and 97%, respectively) (de Vries et al., 2001a). This is further elucidated in the phylogenetic tree, with over 93% posterior probability for the monophyly of each bacteria type, and 99% bootstrap support for monophyly of the BFo-2 and Netherlands Type 2 (Fig. 1). The low bootstrap support for monophyly of BFo-1 and Netherlands Type 1 may simply be due to the need for more data to resolve the clade, while posterior probability (94%) provides support for BFo-1 and Erwinia to be monophyletic. In addition to pointing to a worldwide association, the data presented here also reveals a stable relationship between thrips and microbes that has lasted multiple decades. The presence of BFo in thrips raised on different plants and in different settings indicates the bacteria previously seen in electron microscopy images of thrips guts (Ullman et al., 1989) are most likely BFo-1, BFo-2, or both. This association is therefore, at minimum, 2 decades old. The detection of BFo-2 in a sample of WFT from 1965 reveals a nearly half-century relationship between thrips and BFo-2. Although we only found BFo-2 in our 1965 sample, we examined a limited number of clones (n = 10). A study of more numerous clones could reveal BFo-1 in the collection. The data we have collected here, combined with the data from de Vries et al. (2001a) show these bacteria and their insect host have been living together for decades regardless of location or host feeding habits. This is not a transient or geographically secluded relationship and fulfills the traditional definition of a symbiosis. Among the microbes we detected in the Western flower thrips, we believe the two strains, BFo-1 and BFo-2, were the only microbes serving as symbionts. We recognize there may be other symbionts we have not yet detected in our studies. The few instances of non-BFo found in the culture-independent Hawaiian Islands lab sample likely came from surface contamination of thrips or a transient encounter. Likewise, the predominant 1965 California WFT clones similar to water or soil bacteria probably came from the environment or from contamination introduced when collecting and preserving thrips. Culture-independent techniques involve DNA extraction of the entire insect, meaning bacteria on the insect cuticle or stored with the insect will contribute DNA to the sample. Since we used universal 16S primers, DNA from environmental bacteria were likely amplified along with BFo DNA. Indeed, the relatively low occurrence and inconsistency of these unidentified bacteria in processed thrips and their absence from cultured surface-sterilized thrips indicate these transient bacteria probably do not live in close association with thrips like BFo-1 or BFo-2. Survival in or on an insect is not the same as colonizing the gut or living closely and consistently with a host. We therefore do not feel that the few non-BFo microbes we detected should be considered symbionts of WFT. Although these two strains of bacteria have evolved a close association with their host, the symbiosis appears to be very recently developed. The coevolution often seen in other well-studied relationships has yet to occur, as indicated by the facultative nature of the bacteria and the lack of resolution at the distal clades in phylogenetic analyses. In fact, the inequality and inconsistency of BFo-1 and BFo-2 infection ratios indicate these two symbionts may be competing for space within the host. In our culture experiments, BFo-1 and BFo-2 were found exclusively in both adults and second instars, indicating host age does not affect which bacteria can colonize thrips. Our culture and culture-independent tests showed BFo-1 more successfully colonized WFT; however, it could not exclude BFo-2 in all instances. The means for successful exclusion (i.e. faster growth rate, antimicrobial compounds, or simply better adaptation to the host) has yet to be uncovered, although we noticed cultured BFo-1 tended to grow faster than BFo-2 colonies on LB plates. This growth advantage may explain why BFo-1 is the primary symbiont found in thrips. BFo-1 may also benefit the

323

host or be selected for by thrips. Certain species of fruit flies, mosquitoes, and stable flies have shown preferences for certain bacteria (Lauzon et al., 1998; Robacker et al., 2004; Romero et al., 2006; Sumba et al., 2004; Trexler et al., 2003). Since bacterial infection in thrips is feeding-dependent (de Vries et al., 2001b), the host may be drawn to specific bacteria present on leaf surfaces. The exact nature of this association is still unclear and warrants further study to understand the driving force behind this relationship. 4.2. Two separate symbionts Our phylogenetic and biochemical analyses indicate WFT has a symbiosis with two possibly different genera of bacteria. In WFT populations originating in Hawaii, we found bacteria possessing two unique molecular 16S strains sharing 95% identity. Previous studies showed 97% or greater 16S identity grouped bacteria in the same species (Moore et al., 1996). Thrips bacteria could therefore belong to two separate genera based on percent genetic identity. Biochemical tests comparing BFo-1 and BFo-2 also reveal significant differences in physiological properties. In fact, according to the Analytical Profile Index, enough biochemical differences exist between the two strains to warrant placing BFo-1 and -2 in separate genera. The phylogeny supports this conclusion, in that the bootstrap values indicate BFo-1 groups with Erwinia, while BFo-2 does not. Hypothesis testing for monophyly, however, prevented us from definitively declaring the two BFo strains to be unrelated. Using both de Vries et al. (2001a) and our data sets, we could not reject the proposition that both BFo types formed a monophyletic group based on 16S data. The inability to separate the two groups through likelihood hypothesis testing is most likely due to the nature of the 16S gene. 16S is useful for determining very old relationships [see (Ochman et al., 1999)]; however, these slow changes makes resolving species-level associations difficult in the Enterobacteriaceae (Hauben et al., 1998; Kwon et al., 1997; Prescott et al., 2004; Sproer et al., 1999). This problem has resulted in suggestions to use more genes in conjunction with the 16S (Wertz et al., 2003). As these new genes are sequenced, the resolution of Enterobacteriaceae species should improve and we will be able to more conclusively determine genera and species placement of these symbionts. Since we now have evidence that thrips bacteria are widespread in thrips populations, we propose renaming all studied thrips bacteria to BFo-1 or BFo-2. Previous naming techniques referenced location and food source for thrips bacteria (de Vries et al., 2001a). Since it appears that location and food are irrelevant in this symbiosis, and since more thrips bacteria could be detected in multiple thrips populations worldwide, using the previous naming technique is no longer appropriate. By using the naming system proposed here (organism type, genus and species of host, strain number), scientists can further explore thrips bacteria in WFT and other species of thrips and refer to them clearly. 4.3. Origins of BFo There is support for the hypothesis that BFo-1 and BFo-2 have unique ancestors. The phylogeny reveals BFo-1 alone shares origins with many plant pathogenic bacteria in Erwinia (Fig. 1). Specifically, 78% bootstrap support and 98% Bayesian posterior probability have been found at the node where Erwinia and all BFo-1 branch from the rest of the Enterobacteriaceae. Thrips share many hosts with the plant pathogenic Erwinia. There are a number of examples of plant pathogenic bacteria interacting with insects. Erwinia amylovora occasionally uses insects to disperse to new hosts (Thomson, 2000). Erwinia carotovora uses multiple genera of Drosophila to move around (Harrison et al., 1977). Pantoea ananatis, a close relative of Erwinia and a pathogen of onion plants,

324

L. Chanbusarakum, D. Ullman / Journal of Invertebrate Pathology 99 (2008) 318–325

can be vectored by the tobacco thrips Frankliniella fusca via feeding (Gitaitis et al., 2003). Given these kinds of opportunities for coevolution, we hypothesize that ancestors of BFo-1 may have been established in or on plant tissue, been ingested by WFT, and evolved to successfully reside in the insect gut. In contrast, our phylogenetic analyses place BFo-2 outside the Erwinia clade (Fig. 1). For BFo-2, additional genes will be needed to clearly determine ancestral relationships. It seems clear, however, that BFo-2 did not arise directly with BFo-1 as suggested by previous phylogenies (de Vries et al., 2001a). These bacteria therefore are likely different organisms with different evolutionary histories. Our molecular analysis allows us to reject the hypothesis that BFo-1 and BFo-2 comprise a monophyletic group with E. coli. At first glance, this seems to be a contradiction from initial reports by de Vries et al. (2001a); however, the different tree topologies are most likely due to the use of different taxa in the phylogenetic analyses: we selected bacteria that were similar to BFo based on 16S identity whereas de Vries et al. use a representative survey of bacteria in Enterobacteriaceae. In fact, although biochemical properties of Netherlands bacteria pointed to Erwinia, the molecular phylogeny only included two Erwinia taxa: Erwinia herbicola and Erwinia carotovora (de Vries et al., 2001a). A phylogenetic analysis focusing on Erwinia revealed three distinct clusters of Erwinia in Enterobacteriaceae. Both Erwinia species used by de Vries et al. fall out in clades separate from Erwinia most similar to BFo based on 16S (Kwon et al., 1997; Moran, 1996). This limited taxa selection likely hid the molecular-supported Erwinia-BFo link. We also chose V. cholerae as our outgroup instead of previously used Buchnera, since Buchnera is AT-rich (Moran, 1996) and BFo and other Enterobacteriaceae have more equal base pair frequencies than Buchnera. Using taxa with 16S most similar to BFo, we could reject the hypothesis that all BFo fall out as a sister group to only E. coli. A lack of further resolution again can be traced back to the conservative nature of 16S. 4.3.1. Examining biochemical genera suggestions The lack of molecular support for biochemical characterizations is not unusual (Carter et al., 1999; Drancourt et al., 2001). Genetic classification is now considered the primary way to categorize bacteria (Carter et al., 1999; Drancourt et al., 2001; Mergaert et al., 1999) and we thus adhere to 16S classifications. The analyses we have done here provide concrete evidence for a common symbiotic relationship between WFT and these bacteria. The facultative nature and paraphyletic phylogeny indicate this association is relatively new and this may explain why there appear to be two separate bacterial strains competing for the same host. The predominant BFo-1 in the population suggests this strain has more success establishing in thrips, but cannot yet exclude other bacteria from colonizing the host gut. We feel the symbiosis between WFT and their environmental bacteria suggests that the migration of WFT to other parts of the world may have an even greater impact on the environment and agriculture than what is now known. If bacteria previously accustomed to mammals or plants can develop the means necessary to associate with Western flower thrips, they may also be able to evolve to grow on new plant material when transported there by the thrips. Indeed, horizontal gene transfer among bacteria has resulted in the passage of antibiotic resistance, metabolic characteristics and virulence attributes (Ochman et al., 2000). Combined with BFo’s ability to be excreted from WFT and reside on the plant surface they are defecated on to (de Vries et al., 2001a), there is good opportunity for these bacteria to acquire the genes necessary to infect the plant they happen to encounter. BFo-1, most similar to other plant pathogens, may also be able to quickly cause disease in a new plant host. This symbiotic association as-is offers a great opportunity to understand how facultative symbionts can influ-

ence one another. This system also provides exciting chances to watch the evolution of gut bacteria and their host. Acknowledgments The authors thank Gerald Moritz and Lynn Kimsey for providing German thrips and California thrips, respectively. The authors also thank Penelope Gullan for comments on earlier versions of this manuscript. This work was partially supported by Jastro Shields Research Fellowships and UC-Davis and Humanities Research Scholarship. References Buckley, T.R., Simon, C., Shimodaira, H., Chambers, G.K., 2001. Evaluating hypotheses on the origin and evolution of the New Zealand alpine cicadas (Maoricicada) using multiple-comparison tests of tree topology. Mol. Biol. Evol. 18, 223–234. Carter, J.S., Bowden, F.J., Bastian, I., Myers, G.M., Sriprakash, K.S., Kemp, D.J., 1999. Phylogenetic evidence for reclassification of Calymmatobacterium granulomatis as Klebsiella granulomatis comb. nov. Int. J. Syst. Bacteriol. 49, 1695–1700. Cowan, S.T., Steel, K.J., 1974. Cowan and Steel’s Manual for the Identification of Medical Bacteria. Cambridge University Press, New York, NY. de Vries, E.J., Breeuwer, J.A.J., Jacobs, G., Mollema, C., 2001a. The association of Western flower thrips, Frankliniella occidentalis, with a near Erwinia species gut bacteria: transient or permanent? J. Invertebr. Pathol. 77, 120–128. de Vries, E.J., Jacobs, G., Breeuwer, J.A.J., 2001b. Growth and transmission of gut bacteria in the western flower thrips, Frankliniella occidentalis. J. Invertebr. Pathol. 77, 129–137. de Vries, E.J., Jacobs, G., Sabelis, M.W., Menken, S.B.J., Breeuwer, J.A.J., 2004. Dietdependent effects of gut bacteria on their insect host: the symbiosis of Erwinia sp. and western flower thrips. Proc. R. Soc. Lond. B Biol. Sci. 271, 2171–2178. Dillon, R.J., Dillon, V.M., 2004. The gut bacteria of insects: nonpathogenic interactions. Annu. Rev. Entomol. 49, 71–92. Drancourt, M., Bollet, C., Carlioz, A., Martelin, R., Gayral, J.P., Raoult, D., 2000. 16S ribosomal DNA sequence analysis of a large collection of environmental and clinical unidentifiable bacterial isolates. J. Clin. Microbiol. 38, 3623–3630. Drancourt, M., Bollet, C., Carta, A., Rousselier, P., 2001. Phylogenetic analyses of Klebsiella species delineate Klebsiella and Raoultella gen nov with description of Raoultella ornithinolytica comb nov Raoultella terrigena comb nov and Raoultella planticola comb nov. Int. J. Syst. Evol. Microbiol. 51, 925–932. Drudy, D., O’Rourke, M., Murphy, M., Mullane, N.R., O’Mahony, R., Kelly, L., Fischer, M., Sanjaq, S., Shannon, P., Wall, P., O’Mahony, M., Whyte, P., Fanning, S., 2006. Characterization of a collection of Enterobacter sakazakii isolates from environmental and food sources. Int. J. Food Microbiol. 110, 127–134. Ewing, W.H., 1986. Identification of Enterobacteriaceae. Elsevier Science Publishing Company, New York, NY. Gihring, T.M., Moser, D.P., Lin, L.H., Davidson, M., Onstott, T.C., Morgan, L., Milleson, M., Kieft, T.L., Trimarco, E., Balkwill, D.L., Dollhopf, M.E., 2006. The distribution of microbial taxa in the subsurface water of the Kalahari Shield South Africa. Geomicrobiol. J. 23, 415–430. Gitaitis, R.D., Walcott, R.R., Wells, M.L., Perez, J.C.D., Sanders, F.H., 2003. Transmission of Pantoea ananatis, causal agent of center rot of onion, by tobacco thrips Frankliniella fusca. Plant Dis. 87, 675–678. Harada, H., Oyaizu, H., Kosako, Y., Ishikawa, H., 1997. Erwinia aphidicola, a new species isolated from pea aphid Acyrthosiphon pisum. J. Gen. Appl. Microbiol. 43, 349–354. Harrison, M.D., Quinn, C.E., Sells, I.A., Graham, D.C., 1977. Waste potato dumps as sources of insects contaminated with soft rot coliform bacteria in relation to recontamination of pathogen-free potato stocks. Potato Res. 20, 37–52. Hauben, L., Moore, E.R.B., Vauterin, L., Steenackers, M., Mergaert, J., Verdonck, L., Swings, J., 1998. Phylogenetic position of phytopathogens within the Enterobacteriaceae. Syst. Appl. Microbiol. 21, 384–397. Holt, J.G., Krieg, N.R., Sneath, P.H.A., 1994. Bergey’s Manual of Determinative Bacteriology. Lippincott Williams & Wilkins, Baltimore, MD. Huelsenbeck, J.P., Ronquist, F., Nielsen, R., Bollback, J.P., 2001. Bayesian inference of phylogeny and its impact on evolutionary biology. Science 294, 2310–2314. Hunter, W.B., Ullman, D.E., 1992. Anatomy and ultrastructure of the piercing– sucking mouthparts and Paraglossal Sensilla of Frankliniella occidentalis (Pergande) (Thysanoptera, Thripidae). Int. J. Insect Morphol. Embryol. 21, 17– 35. Ishikawa, H., 2003. Insect symbiosis: an introduction. In: Bourtzis, K.A., Miller, T.A. (Eds.), Insect Symbiosis. CRC Press, Boca Raton, pp. 1–21. Iwasaki, A., Takagi, K., Yoshioka, Y., Fujii, K., Kojima, Y., Harada, N., 2007. Isolation and characterization of a novel simazine-degrading beta-proteobacterium and detection of genes encoding s-triazine-degrading enzymes. Pest Manag. Sci. 63, 261–268. Koga, R., Tsuchida, T., Fukatsu, T., 2003. Changing partners in an obligate symbiosis: a facultative endosymbiont can compensate for loss of the essential endosymbiont Buchnera in an aphid. Proc. R. Soc. Lond. B Biol. Sci. 270, 2543– 2550.

L. Chanbusarakum, D. Ullman / Journal of Invertebrate Pathology 99 (2008) 318–325 Kumar, N.K.K., Ullman, D.E., Cho, J.J., 1995. Frankliniella occidentalis (Thysanoptera, Thripidae) landing and resistance to tomato spotted wilt tospovirus among Lycopersicon accessions with additional comments on Thrips tabaci (Thysanoptera, Thripidae) and Trialeurodes vaporariorum (Homoptera, Aleyrodidae). Environ. Entomol. 24, 513–520. Kwon, S.W., Go, S.J., Kang, H.W., Ryu, J.C., Jo, J.K., 1997. Phylogenetic analysis of Erwinia species based on 16S rRNA gene sequences. Int. J. Syst. Bacteriol. 47, 1061–1067. Lane, D.J., 1991. 16s/23s rRNA sequencing. In: Stackebrandt, E., Goodfellow, M. (Eds.), Nucleic Acid Techniques in Bacterial Systematics. John Wiley & Sons Ltd., Baffins Lane, Chichester, West Sussex, England, pp. 115–176. Lauzon, C.R., Sjogren, R.E., Wright, S.E., Prokopy, R.J., 1998. Attraction of Rhagoletis pomonella (Diptera: Tephritidae) flies to odor of bacteria: apparent confinement to specialized members of Enterobacteriaceae. Environ. Entomol. 27, 853–857. Mergaert, J., Hauben, L., Cnockaert, M.C., Swings, J., 1999. Reclassification of nonpigmented Erwinia herbicola strains from trees as Erwinia billingiae sp. nov.. Int. J. Syst. Bacteriol. 49, 377–383. Montllor, C.B., Maxmen, A., Purcell, A.H., 2002. Facultative bacterial endosymbionts benefit pea aphids Acyrthosiphon pisum under heat stress. Ecol. Entomol. 27, 189–195. Moore, E.R.B., Mau, M., Arnscheidt, A., Bottger, E.C., Hutson, R.A., Collins, M.D., van de Peer, Y., de Wachter, R., Timmis, K.N., 1996. The determination and comparison of the 16S rRNA gene sequences of species of the genus Pseudomonas (sensu stricto) and estimation of the natural intrageneric relationship. Syst. Appl. Microbiol. 19, 478–492. Moran, N.A., 1996. Accelerated evolution and Muller’s rachet in endosymbiotic bacteria. Proc. Natl. Acad. Sci. USA 93, 2873–2878. Moran, N.A., Russell, J.A., Koga, R., Fukatsu, T., 2005. Evolutionary relationships of three new species of Enterobacteriaceae living as symbionts of aphids and other insects. Appl. Environ. Microbiol. 71, 3302–3310. Ochman, H., Elwyn, S., Moran, N.A., 1999. Calibrating bacterial evolution. Proc. Natl. Acad. Sci. USA 96, 12638–12643. Ochman, H., Lawrence, J.G., Groisman, E.A., 2000. Lateral gene transfer and the nature of bacterial innovation. Nature 405, 299–304. Paracer, S., Ahmadjian, V., 2000. Symbiosis. Oxford, New York. Piel, J., 2004. Metabolites from symbiotic bacteria. Nat. Prod. Rep. 21, 519–538. Prescott, L.M., Harley, J.P., Klein, D.A., 2004. Microbiology. McGraw-Hill Science, Columbus. Rangel, J.M., Sparling, P.H., Crowe, C., Griffin, P.M., Swerdlow, D.L., 2005. Epidemiology of Escherichia coli O157: H7 outbreaks United States 1982– 2002. Emerg. Infect. Dis. 11, 603–609. Robacker, D.C., Lauzon, C.R., He, X.D., 2004. Volatiles production and attractiveness to the Mexican fruit fly of Enterobacter agglomerans isolated from apple maggot and Mexican fruit flies. J. Chem. Ecol. 30, 1329–1347. Romero, A., Broce, A., Zurek, L., 2006. Role of bacteria in the oviposition behaviour and larval development of stable flies. Med. Vet. Entomol. 20, 115–121.

325

Ronquist, F., Huelsenbeck, J.P., 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574. Ryan, F., 2002. Darwin’s Blind Spot. Houghton Mifflin Company, Boston. Sapp, J., 2004. The dynamics of symbiosis: an historical overview. Can. J. Bot. 82, 1046–1056. Shimodaira, H., Hasegawa, M., 1999. Multiple comparisons of log-likelihoods with applications to phylogenetic inference. Mol. Biol. Evol. 16, 1114–1116. Smith, D.C., 2001. Symbiosis research at the end of the millenium. Hydrobiologia 461, 49–54. Sproer, C., Mendrock, U., Swiderski, J., Lang, E., Stackebrandt, E., 1999. The phylogenetic position of Serratia Buttiauxella and some other genera of the family Enterobacteriaceae. Int. J. Syst. Bacteriol. 49, 1433–1438. Stackebrandt, E., Goebel, B.M., 1994. A place for DNA–DNA reassociation and 16s ribosomal RNA sequence analysis in the present species definition in Bacteriology. Int. J. Syst. Bacteriol. 44, 846–849. Sumba, L.A., Guda, T.O., Deng, A.L., Hassanali, A., Beier, J.C., Knols, B.G.J., 2004. Mediation of oviposition site selection in the African malaria mosquito Anopheles gambiae (Diptera: Culicidae) by semiochemicals of microbial origin. Int. J. Trop. Insect Sci. 24, 260–265. Swofford, D.L., 2003. PAUP* Phylogenetic Analysis Using Parsimony (* and other methods). Thomson, S.V., 2000. Epidemiology of fire blight. In: Vanneste, J.J. (Ed.), Fire Blight: The Disease and Its Causative Agent Erwinia amylovora. CABI Publishing, Hamilton, pp. 9–36. Trexler, J.D., Apperson, C.S., Zurek, L., Gemeno, C., Schal, C., Kaufman, M., Walker, E., Watson, W., Wallace, L., 2003. Role of bacteria in mediating the oviposition responses of Aedes albopictus (Diptera: Culicidae). J. Med. Entomol. 40, 841–878. Tsuchida, T., Koga, R., Shibao, H., Matsumoto, T., Fukatsu, T., 2002. Diversity and geographic distribution of secondary endosymbiotic bacteria in natural populations of the pea aphid Acyrthosiphon pisum. Mol. Ecol. 11, 2123–2135. Ullman, D.E., Westcot, D.M., Hunter, W.B., Mau, R.F.L., 1989. Internal anatomy and morphology of Frankliniella occidentalis (Pergande) (Thysanoptera Thripidae) with special reference to interactions between thrips and tomato spotted wilt virus. Int. J. Insect Morphol. Embryol. 18, 289–310. Watanabe, K., Sato, M., 1998. Plasmid-mediated gene transfer between insectresident bacteria Enterobacter cloacae and plant-epiphytic bacteria Erwinia herbicola in guts of silkworm larvae. Curr. Microbiol. 37, 352–355. Wertz, J.E., Goldstone, C., Gordon, D.M., Riley, M.A., 2003. A molecular phylogeny of enteric bacteria and implications for a bacterial species concept. J. Evol. Biol. 16, 1236–1248. Whitfield, A.E., Ullman, D.E., German, T.L., 2005. Tospovirus–thrips interactions. Annu. Rev. Phytopathol. 43, 459–489. Williams, M.M., Domingo, J.W.S., Meckes, M.C., Kelty, C.A., Rochon, H.S., 2004. Phylogenetic diversity of drinking water bacteria in a distribution system simulator. J. Appl. Microbiol. 96, 954–964.