Identification, genomic organization and expression profiles of four heat shock protein genes in the western flower thrips, Frankliniella occidentalis

Journal of Thermal Biology 57 (2016) 110–118

Contents lists available at ScienceDirect

Journal of Thermal Biology journal homepage: www.elsevier.com/locate/jtherbio

Identification, genomic organization and expression profiles of four heat shock protein genes in the western flower thrips, Frankliniella occidentalis Ming-Xing Lu a,1, Hong-Bo Li a,b,1, Yu-Tao Zheng a, Liang Shi a, Yu-Zhou Du a,n a b

School of Horticulture and Plant Protection & Institute of Applied Entomology, Yangzhou University, Yangzhou 225009, China Guizhou Institute of Plant Protection, Guiyang 550006, China

art ic l e i nf o

a b s t r a c t

Article history: Received 30 September 2015 Received in revised form 11 March 2016 Accepted 13 March 2016 Available online 15 March 2016

The western flower thrips, Frankliniella occidentalis, is an important invasive pest with a strong tolerance for extreme temperatures; however, the molecular mechanisms that regulate thermotolerance in this insect remain unclear. In this study, four heat shock protein genes were cloned from F. occidentalis and named Fohsp90, Fohsc701, Fohsc702 and Fohsp60. These four Hsps exhibited typical characteristics of heat shock proteins. Subcellular localization signals and phylogenetic analysis indicated that FoHsp90 and FoHsc701 localize to the cytosol, whereas FoHsc702 and FoHsp60 were located in the endoplasmic reticulum and mitochondria, respectively. Analysis of genomic sequences revealed the presence of introns in the four genes (three, four, seven, and five introns for Fohsp90, Fohsc701, Fohsc702 and Fohsp60, respectively). Both the number and position of introns in these four genes were quite different from analogous genes in other species. qRT-PCR indicated that the four Fohsps were detected in second-stage larvae, one-day-old pupae, and one-day-old adults, and mRNA expression levels were lowest in larvae and highest in pupae. Fohsc701 and Fohsc702 possessed similar expression patterns and were not induced by cold or heat stress. Expression of Fohsp60 was significantly elevated by heat, and Fohsp90 was rapidly up-regulated after exposure to both cold and heat stress. Exposure to
8 °C had no effect on expression of the four Fohsps; however, expression of Fohsp90 and Fohsp60 was highest after a 2-h incubation at 39 °C. Furthermore, cold and heat hardening led to significant up-regulation of the four Fohsps compared to their respective controls. Collectively, our results indicate that the four FoHsps contribute to insect development and also function in rapid cold or heat hardening; furthermore, FoHsp90 and FoHsp60 contribute to thermotolerance in F. occidentalis. & 2016 Elsevier Ltd. All rights reserved.

Keywords: Heat shock proteins Frankliniella occidentalis Expression profile Development Temperature

1. Introduction Temperature is an important environmental factor that can determine the distribution and abundance of insects (Bale et al., 2002; Bale, 2002). A slight change in temperature can result in a substantial challenge to insects and can impact survival (Hoffmann et al., 2003). Insects have evolved various strategies to adapt to adverse temperatures, including diapause and rapid cold or heat hardening (Denlinger, 2002; Hoffmann et al., 2003; Wang et al., 2003; Clark and Worland, 2008; Zheng et al., 2011; Lu et al., 2014). Several genes have been associated with thermotolerance, including senescence marker protein-30 (Dca) (Goto, 2000), frost (Fst) (Goto, 2001), heat shock RNA-omega (Hsrω) (Singh and n

Corresponding author. E-mail address: [email protected] (Y.-Z. Du). 1 These authors contribute to this work equally.

http://dx.doi.org/10.1016/j.jtherbio.2016.03.005 0306-4565/& 2016 Elsevier Ltd. All rights reserved.

Lakhotia, 1984) and Hsps, which encode heat shock proteins (Feder and Hofmann, 1999). Among these, Hsps are very important genes for response to extreme temperatures (Hoffmann et al., 2003; King and MacRae, 2015); furthermore, heat shock proteins function as molecular chaperones and play essential roles in metabolism, folding, translocation, and refolding of denatured proteins under normal and stressful conditions (Lindquist and Craig, 1988; Deshaies et al., 1988; Feder and Hofmann, 1999). Hsps belong to a large superfamily that can be divided into five smaller families based on molecular weight and sequence similarity, including Hsp90, Hsp70, Hsp60, Hsp40 and sHsps (small Hsps with molecular masses ranging from 12 to 43 kDa) (Lindquist and Craig, 1988; Moseley, 1997; Borkan and Gullans, 2002; Sørensen et al., 2003). Based on expression patterns, Hsp family members can be further subdivided into different groups; for example, Hsp70 can be divided into inducible (Hsp70) and cognate forms (Hsc70s). Furthermore, animal forms of Hsps are subdivided based on cellular localization; e.g. endoplasmic reticulum (ER), mitochondrial,

M.-X. Lu et al. / Journal of Thermal Biology 57 (2016) 110–118

and cytosolic forms (De, 1999; Renner and Waters, 2007). Although Hsps are best known for responsiveness to heat shock, they can be induced by other stressors and are also associated with insect diapause (Rinehart et al., 2007; Zhang and Denlinger, 2010; Lu et al., 2013). Furthermore, recent studies have indicated that Hsps are also involved in insect development (Huang et al., 2009; Lu et al., 2014). In the present study, we investigate the role of Hsps in Frankliniella occidentalis, which is a hyperpaurometamorphosis insect known as the western flower thrips. F. occidentalis is an important insect pest of vegetables and ornamentals grown in greenhouse and field conditions (Kirk and Terry, 2003). F. occidentalis can cause serious damage due to direct feeding and also indirectly by transmitting plant viruses (Kirk, 2002; Kirk and Terry, 2003). This pest originated in North America and has since spread to South America, Europe, Africa, Australia and Asia (Kirk and Terry, 2003). In China, F. occidentalis was first identified in Beijing in 2003 (Zhang et al., 2003) and has since spread to more than ten provinces (Chen et al., 2011). Interestingly, F. occidentalis has no specific diapause during its life cycle (Ishida et al., 2003). Previous studies demonstrated that F. occidentalis can tolerate extreme temperatures because it can adapt to rapid cold and heat hardening (Mcdonald et al., 1997; Tsumuki et al., 2007; Gai et al., 2010; Li et al., 2011a, 2011b). Five genes encoding heat shock proteins were shown to be associated with thermotolerance in F. occidentalis (Wang et al., 2014). To further understand the molecular basis of thermotolerance in F. occidentalis, we investigate the expression patterns of Hsps during development and temperature stress. This was accomplished by isolating both full-length cDNA and genomic DNA sequences of four Hsp genes from F. occidentalis. The expression patterns of the four Hsps were evaluated and compared during development and temperature shock using quantitative real-time PCR.

2. Material and methods

111

Table 1 The primers used in the study. Gene

RT-PCR hsp90

Primer name

Primer sequences (5′-3′)

F R

GWGTYTTCATYATGGAMAA GRACKACATATTCATCAATRGG AAHGTGGAGATCATCGCCAA CTTGCCRCAGAAGAAGTTYTG AAGTTWTRGAAGATKCYGA TTTTGATCRTTVGTRATDAC GCTGATGCTGTTGCWTAAC TGAAGCAACACCHGCAGCAT

hsc701

F R

hsc702

F R F R

hsp60

RACE PCR Fohsp90 3′ 5′

Tm (°C)

CCACGAAGACAGCACCAACCGCAAGA CCTTCATGCGGCTAACGTACTCCT

Length (bp)

492

999

562 1469

1094 68.0 1446 68.0

Fohsc701 3′

CCTCCATCACCCGTGCTCGTTTT

1220 68.0

5′

TGGCAGCAGCAGTGGGCTCGTTG

643 68.0

Fohsc702 3′ 5′

CAACGGTATTCTGCAGGTGTCTGCTGAG GAGGACAAGGGAACTGGCAACCG

1429 68.0 1684 68.0

Fohsp60

3′

GGACCGTGTAAATGATGCCCTGTG

1137 68.0

5′

GTTGCACACAGGGCATCATTTACACG Genome amplification Fohsp90 F TGCGACTTTGTTCCCTGTG R TGGCGAACAAATAAATGAG Fohsc701 F ATGGCAGCCCCCGCTATTGG R TTGTCAGTTGGGTTGTCCGT Fohsc702 F CCACCATGAAGTTAATCCTAG R ATTGAGGTTGGCAGTCTTAAAG Fohsp60 F TATATTATCGTTCAAAATGTTTCGGC R TAGCAGGCAAGATACTACAAT QPCR Fohsp90 F TGCTCTGCTTTCATCTGGTTTC

1382 68.0 3156 2568 2737 2600

54.4

2.1. Insect cultures and sampling at different developmental stages 145

F. occidentalis were originally collected in 2008 from Hangzhou (Zhejiang Province), and reared in the in the laboratory as described by Li et al. (2011a). Developmental stages sampled (120 for each stage) included second-stage larvae, one-day-old pupae, and one-day-old adults.

R Fohsc701 F

ATCGGGCATCTCAACATCCT CCCGCTATTGGTATTGATTTGG

57.5

TCCAATGAGACGCTCGGTG CCCGCTATTGGTATTGATTTGG

61.9

R F

TCCAATGAGACGCTCGGTG GGTTTGGTCCAGAGGTCCGT

58.4

R F

GCCTGCTTCTTCATTGGTATTATTC AACACGGGAAACCTCACCA

55.4a

R F

CAGACAAATCGCTCCACCAA TCAAGGAACTGCGTCGTGGAT

58.6a

R F

ACAGGGGTGTAGCCGTTAGAG CAACATCGGTTATGGAAGCA

143 R Fohsc702 F 165

2.2. Cold and heat shock treatments Fohsp60

Second instar larvae (n¼ 120) were collected and placed in small glass tubes and exposed to various temperatures for 2 h. Target temperatures included exposure to cold (0 to
10 °C at 2 °C decreasing increments) and heat (31–41 °C at 2 °C increasing increments) using a temperature controller (DC-3010, Ningbo, China). Second instar larvae (n ¼120) were exposed to
8 °C or 39 °C for 0, 1, 2, 4, or 8 h to examine the effect of exposure time. The thrips were allowed to recover at 26 °C for 1 h and then frozen in liquid nitrogen and stored at
70 °C. The control group consisted of thrips maintained at 26 °C, and all treatments were replicated four times. 2.3. Rapid cold and heat hardening (RCH and RHH) Our previous studies demonstrated that pretreatment at sublethal temperatures for short periods of time can induce rapid cold and heat hardening responses (RCH and RHH, respectively) in the larvae of F. occidentalis (Li et al., 2011a, 2011b). In the present study, second instar larvae (n¼ 120) were hardened at sub-lethal

238 18S 116 EF-1 130 RPL32

141 55.0a

R

ACAGCGTGGGCAATTTCAGC

a

The QPCR primers of EF-1, RPL32 and 18S rRNA were validated (Zheng et al., 2014).

temperatures (0 °C for RCH and 33 °C for RHH) for 2 h and then exposed to
8 °C or 39 °C for 2 h, respectively. The thrips were allowed to recover at 26 °C for 1 h and then frozen in liquid nitrogen and stored at
70 °C. Thrips exposed to
8 °C or 39 °C

112

M.-X. Lu et al. / Journal of Thermal Biology 57 (2016) 110–118

Table 2 Hsps sequences aligned the clusters and constructed the phylogenetic tree. Species

Type

Accession number

Multiple alignment Panonychus citri Harpegnathos saltator Nilaparvata lugens Bemisia tabaci Spodoptera litura Trichoplusia ni Nasonia vitripennis Nilaparvata lugens Aedes aegypti Culex quinquefasciatus Nasonia vitripennis

Hsp90 Hsp90 Hsp90 Hsp90 Hsc70 Hsc70 Hsc70 Hsc70 Hsc70 Hsc70 Hsc70

ADQ20111.1 ENF88374.1 AD34169.1 ADO14474.1 ADM66138 ABH09732.1 NP_001166228.1 ADE34170.1 ABF18258.1 XP_001845218.1 XP_001606463.1

Phylogenetic analysis Frankliniella occidentalis Helicoverpa armigera Helicoverpa assulta Helicoverpa zea Mamestra brassicae Mythimna separate Ostrinia furnacalis Loxostege sticticalis Chilo suppressalis Plutella xylostella Bombyx mori Microplitis mediator Nasonia vitripennis Apis florae Apis mellifera Harpegnathos saltator Acromyrmex echinatior Nilaparvata lugens Bemisia tabaci

Hsp90 Hsp90 Hsp90 Hsp90 Hsp90 Hsp90 Hsp90 Hsp90 Hsp90 Hsp90 Hsp90 Hsp90 Hsp90 Hsp90 Hsp90 Hsp90 Hsp90 Hsp90 Hsp90

JX002707 ADM26743.1 ADM26742.1 ACV32639.1 BAF03554.1 ADM26740.1 ADM26737.1 ABW8779.1 BAE44307.1 BAE48742.1 BAB41209.1 ABV55506.1 XP_003424204.1 XP_003694932.1 XP_395168.4 EFN88374.1 EGN61913.1 ADE34169.1 ADQ14474.1

Campontous floridanus Acromyrmex echinatior Apis mellifera Pteromalus puparum Macrocentrus cingulum Chilo suppressalis Bombyx mori Spodotera litura Mythimna separate Helicoverpa zea Culex quinquefasciatus Acyrthosiphon pisum Aedes aegypti Culex quinquefasciatus Danaus plexippus Trichoplusia ni Bombyx mori Nasonia vitripennis Bombus impatiens Camponotus floridanus Harpegnathos saltator

Hsc70 Hsc70 Hsc70 Hsc70 Hsc70 Hsc70 Hsc70 Hsc70 Hsc70 Hsc70 Hsc70 Hsc70 Hsc70 Hsc70 Hsc70 Hsc70 Hsc70 Hsc70 Hsc70 Hsc70 Hsc70 Hsc70 Hsc70

JX002706 KC422577 EFN65945.1 EGI62314.1 NP_001153522.1 EU340838 ACD84945.1 BAE44308.1 NP_001036892.1 ADK55518.1 ABY55233.1 ACV32641.1 XP_001850527.1 NP_001156420.1 ABF18258.1 XP_001845218.1 EHJ73638.1 ABH09735.1 AEI58998.1 XP_001606 463.1 XP_003490898.1 EFN61604.1 EFN86831.1

Frankliniella occidentalis Acromyrmex echinatior Aedes aegypti Apis florae Apis mellifera Bombus impatiens Culex quinquefasciatus Culicoides variipennis Harpegnathos saltator Liriomyza huidobrensis Liriomyza sativae Pediculus humanus corporis Polypedilum vanderplanki Pteromalus puparum Nasonia vitripennis

Hsp60 Hsp60 Hsp60 Hsp60 Hsp60 Hsp60 Hsp60 Hsp60 Hsp60 Hsp60 Hsp60 Hsp60 Hsp60 Hsp60 Hsp60

JX002705 EGI60183 XP_001661764 XP_003691286 XP_392899 XP_003491864 XP_001850501 AAB94640 EFN79769 AAW30392 AAW49251 XP_002428684 ADM13383 ACO57619.1 XP_001600045

Frankliniella occidentalis

with no hardening period were included as controls. All treatments were replicated four times. 2.4. RNA extraction, cDNA synthesis and RT-PCR Total RNA was extracted from bodies of western flower thrips using the SV Total RNA isolation system (Promega, USA). The concentration and quality of RNA were determined by spectrophotometry and agarose gel electrophoresis. Total RNA (1 μg) was transcribed into cDNA. Based on hsp90, hsc701, hsc702 and hsp60 sequences from other species, degenerate primers of the four genes were designed and synthesized to amplify internal fragments (Table 1). The PCR reaction conditions were as follows: 94 °C for 3 min, 19 cycles of 94 °C for 30 s, 65–45 °C (decreasing by 1 °C/cycle) for 30 s, 72 °C for 1 min, and then 25 cycles of 94 °C for 30 s, 45 °C for 30 s, and 72 °C for 1 min, with extension at 72 °C for 10 min. Purified products were cloned into the pGEM-T Easy vector (Promega, USA) and sequenced. 2.5. Rapid amplification of cDNA ends (RACE) According to the sequence information obtained from internal fragments, gene-specific primers were designed to amplify 5′ and 3′ fragments using the SMART RACE cDNA Amplification Kit (Clontech, USA) (Table 1). PCR parameters were as follows: 94 °C for 3 min, 35 cycles of 94 °C for 30 s, 68 °C for 30 s, and 72 °C for 3 min, followed by extension at 72 °C for 10 min. Bands of the expected size were cloned and sequenced as described above. 2.6. Bioinformatic analysis Nucleotide and amino acid sequence similarities were evaluated using the BLAST programs available at the NCBI website (http://www.blast.ncbi.nlm.nih.gov/Blast). Open reading frames (ORFs) were identified using ORF finder (http://www.ncbi.nlm.nih. gov/projects/gorf/). The online tool ScanProsite was used to identify the features of Hsp families (http://www.expasy.org/). Phylogenetic trees were constructed with the neighbor joining (NJ) method using MEGA v. 5.0 (Tamura et al., 2011). 2.7. Amplification of genomic DNA Genomic DNA was extracted from single adults of F. occidentalis using previously described methods (Qiu et al., 2003). A pair of specific primers flanking the ORF was designed to amplify genomic sequences of the four genes. Touch-down PCR was performed as follows: 94 °C for 5 min, 14 cycles of 94 °C for 30 s, 60–45 °C (decreasing by 1 °C/cycle) for 30 s, 72 °C for 2 min 30 s, and then 25 cycles of 94 °C for 30 s, 45 °C for 30 s, and 72 °C for 2 min 30 s, with a final extension of 72 °C for 10 min. PCR products were cloned and sequenced as described above. 2.8. Quantitative real-time reverse transcriptase PCR (qRT-PCR) To calculate the roles of the four hsps in response to cold and heat shock, specific primers were designed to investigate mRNA expression (Table 1). Validated EF-1, 18S rRNA and RPL32 were chosen as housekeeping genes for developmental stages, cold, and heat treatments, respectively (Zheng et al., 2014). Total RNA (0.5 μg) was reverse-transcribed to cDNA in 20 μL reaction volumes, and the cDNA was used as the template (1:10 dilution) in the qRT-PCR analysis. PCR reactions were performed in 20 μL reaction volumes that included iTaq Universal SYBR Green Supermix (2x) (Bio-Rad, USA), 1 μL of each forward and reverse primer (10 μM), 2 μL of cDNA template (2.5  10
4 μg/μL), and 6 μL of ddH2O. Reactions were conducted using a CFX-96 Real-Time PCR

M.-X. Lu et al. / Journal of Thermal Biology 57 (2016) 110–118

113

system (Bio-Rad). The PCR parameters were as follows: 95 °C for 3 min, 40 cycles of 95 °C for 15 s, and incubation at the Tm value of primer pairs (Table 1, see QPCR) for 15 s, followed by melting curve analysis to determine the specificity of PCR products. The cDNA samples of each treatment were replicated four times, and ΔΔ each reaction was run in triplicate. The 2
Ct method was used to evaluate fold changes in mRNA expression levels. 2.9. Statistical analysis One-way ANOVA was used to detect significant differences in mRNA levels among treatments, followed by Tukey's multiple comparison with P o0.05. A t-test was used to examine differences between control treatments and those subject to rapid cold or heat hardening. Data were analyzed using SPSS v. 16.0 (SPSS, Chicago, IL, USA).

3. Results 3.1. Isolation and characterization of four Fohsps The full-length Fohsp90 cDNA consisted of a 2169 bp ORF encoding 722 amino acids (aa); the predicted protein was 83.26 kDa and was deposited in GenBank (accession no. JX002707, Fig. S1A). Five canonical signatures that define the Hsp90 family were found in FoHsp90, including YSNKEIFLRELISNSSDALDKIR (aa residues 3153), LGTIAKSGT (100-108), IGQFGVGFYS AYLVAD (124-139), IKLYVRRVFI (351-360), and GVVDSEDLPLNISRE (376-391). Furthermore, the conserved motif EEVD was identified at the C-terminus of FoHsp90 (Fig. S2A). Two hsc70 genes, Fohsc701 and Fohsc702, were identified; these encode proteins containing 639 and 660 aa with predicted masses of 69.81 (accession no. JX002706) and 72.93 kDa (accession no. KC422577), respectively (Fig. S1B and C). The deduced FoHsc70 proteins contained typical features of the Hsc70 family at the following aa residues: 35-42 (IDLGTTYS), 223-236 (IFDLGGGTFDVSLL), and 360-374 (IVLVGGSTRIPK VQQ). A putative ATP-GDA binding site [AEAYLGKK(P)] and a non-organelle consensus motif (RARFEEL) were also identified in the two FoHsc70s FoHsc701 and FoHsc702 contained conserved motifs EEVD and KDEL, respectively, at the C-terminus (Fig. S2B and C). Sequence analysis revealed that Fohsp60 was a 1728bp ORF encoding a protein comprised of 575 aa with a predicted mass of 60.87 kDa (accession no. JX002705) (Fig. S1D). FoHsp60 was characterized by a pre-sequence (AAVEEGIVPGGG) at residues 2637, an ATP/Mg2 þ binding site (KEGVITVKDGKTLHDELEV) at residues 191-209, and a conserved GGM motif at the C-terminus (Fig. S2D). 3.2. Sequence alignment and phylogenetic analysis Amino acid alignments revealed that the four Hsps shared 80– 91% identity with other insect species. Heat shock proteins generally possess highly-conserved signature motifs that are typical of their respective family. A basic helix-loop-helix (bHLH) protein folding motif, a putative bipartite nuclear localization signal, and the putative ATP-GDA binding site were found respectively in Hsp90, Hsc701 and Hsc702 (Fig. S2). Twenty full-length Hsp90 proteins from Lepidoptera, Hymenoptera, Thysanoptera, and Hemiptera were used for phylogenetic analysis and tree construction using the NJ method. As shown in Fig. 1, the Thysanoptera was well-separated from other insect orders and had a close evolutionary relationship with Nilaparvata lugens and Bemisia tabaci. Phylogenetic analysis of Hsc70 showed that the tree was clearly divided into two branches that included localization to different subcellular compartments (cytoplasm and ER). As

Fig. 1. Phylogenetic analysis of Hsp90 (A), Hsc70 (B) and Hsp60 (C) from F. occidentalis using the NJ method. The species names and sequence accession numbers are presented in Table 2. The percentage bootstrap values obtained from 1000 resamplings are shown at the nodes.

expected, FoHsc701 grouped with Hsc70s having a cytoplasmic location, whereas FoHsc702 was associated with Hsc70s localizing to the ER. Hsp60 from F. occidentalis was most closely related to

114

M.-X. Lu et al. / Journal of Thermal Biology 57 (2016) 110–118

Fig. 3. Expression levels of Fohsp90, Fohsc701, Fohsc702 and Fohsp60 in secondstage larvae, one-day-old pupae, and one-day-old adults of F. occidentalis. The expression value for each hsp was normalized to EF-1, and histograms indicate relative expression levels. All statistics are presented as means 7SE. Columns labeled with different letters indicate significant differences using one-way ANOVA followed by Tukey's multiple comparison analysis.

3.4. Expression of four Fohsps in different developmental stages The mRNA levels of the four Fohsps were evaluated in different developmental stages of F. occidentalis, and expression was lowest in larvae and highest in pupae (Fohsp90: F2,11 ¼2.84, P ¼0.049; Fohsc701: F2,11 ¼ 9.66, P ¼0.007; Fohsc702: F2,11 ¼ 11.89, P ¼0.004; and Fohsp60: F2,11 ¼2.89, P ¼0.048). Expression of Fohsp60 and Fohsp90 in pupae and adults was not significantly different, but Fohspc701 and Fohspc702 expression levels were significantly higher in pupae than adults. Expression of all four Fohsps genes was significantly lower in larvae than pupae (Fig. 3). 3.5. Expression of four Fohsps in response to cold and heat shock Fig. 2. Comparison of genomic structure of four Fohsps from F. occidentalis with homologous genes in other insect species. Horizontal lines represent the cDNA sequences of hsps, black-shaded rectangles indicate intron positions, and the numbers above the rectangles indicate intron length (in bp).

Hsp60 of Pediculus corporis; the other forms of Hsp60 segregated into groups that correlated with the insect order (Fig. 1).

3.3. Genomic structure analysis of four Fohsps A pair of Fohsp90 cDNA specific primers was designed to amplify a 3156 bp sequence from the F. occidentalis genome (accession no. JX967579). Comparison of the genomic and cDNA sequences revealed the presence of three introns in Fohsp90; these included a 689-bp intron in the 5′-UTR, and 118-and 79-bp introns in the coding region of Fohsp90. The Fohsc701 and Fohsc702 genomic DNAs were 2568 bp (accession no. KC148536) and 2,737 bp (accession no. KC430097), respectively. Fohsc701 contained four introns ranging from 76 to 302 bp, while Fohsc702 contained seven introns ranging from 76 to 146 bp. Furthermore, the location of introns in Fohsc701 was quite different from hsc70 introns in other insects (Fig. 2B). The Fohsp60 genomic DNA was 2,600 bp (accession no. JX967580) and contained five introns ranging from 77 to 197 bp. Intron size for hsp60 in other insect species ranged from 64 to 203 bp (Fig. 2C).

As shown in Fig. 4, the expression of Fohsp60, Fohsc701 and Fohsc702 was not significantly altered in response to cold shock (Fohsc701: F7,31 ¼1.56, P ¼0.201; Fohsc702: F7,31 ¼2.29, P¼ 0.063; Fohsp60: F7,31 ¼1.56, P ¼0.196) (Fig. 4A). Expression of Fohsp90 was up-regulated at 0 °C, and this level of expression was significantly higher than the controls (F7,31 ¼ 3.04, P ¼0.022). Heat shock had no effect on expression of the two genes encoding hsc70 (Fohsc701: F6,27 ¼2.22, P ¼0.084; Fohsc702: F6,27 ¼2.10, P ¼0.13); however, expression of Fohsp60 and Fohsp90 was remarkably induced in response to heat (Fohsp90: F6,27 ¼7.48, P ¼0.0003; Fohsp60: F6,27 ¼6.90, P ¼0.0004) (Fig. 4B). The induced expression of the two Fohsps reached very high levels at 33 °C (hsp60: 3.07-fold higher than control) and 37 °C (hsp90: 5.87-fold higher than control). In cold shock treatments, exposure time had no effect on Fohsps expression (Fohsp90: F3,11 ¼0.44, P ¼0.78; Fohsc701: F3,11 ¼0.01, P¼ 1.00; and Fohsc702: F3,11 ¼0.03, P ¼0.99; Fohsp60: F3,15 ¼0.74, P¼ 0.58) (Fig. 5A). With respect to heat shock, exposure time did not significantly alter the expression of the two hsc70 genes (Fohsc701: F3,11 ¼0.50, P ¼0.73; Fohsc702: F3,11 ¼2.04, P ¼0.14). However, the expression levels of Fohsp60 and Fohsp90 was influenced by exposure time and was highest at 2 h (Fohsp90: F3,11 ¼32.00, P o0.0001; Fohsp60: F3,11 ¼6.14, P ¼0.005) (Fig. 5B). 3.6. Expression of four Fohsps in response to RCH and RHH RCH and RHH significantly induced the upregulation of all four Fohsps (RCH statistics for Fohsp90: t¼8.94, P ¼0.024; Fohsc701:

M.-X. Lu et al. / Journal of Thermal Biology 57 (2016) 110–118

115

t¼8.4, P ¼0.027; Fohsc702: t ¼41.67, P¼ 0.001; Fohsp60: t¼27.78, P¼ 0.002; RHH statistics for Fohsp90: t ¼23.95, P ¼0.003; Fohsc701: t¼16.69, P ¼0.006; Fohsc702: t¼14.47, P ¼0.009; Fohsp60: t¼12.02, P ¼0.026). For RCH, the expression levels of Fohsp60, Fohsp90, Fohsc70, and Fohsc702 were 2.33-, 3.14-, 3.70-, and 2.53fold higher than controls, respectively (Fig. 6A). For RHH, the expression levels of Fohsp60, Fohsp90, Fohsc70, and Fohsc702 were 6.90-, 2.90-, 2.61-, and 2.42-fold higher than controls, respectively (Fig. 6B).

4. Discussion

Fig. 4. Expression levels of Fohsp60, Fohsp90, Fohsc701, and Fohsc702 during a 2-h exposure to cold shock (A) and heat shock (B), respectively. Fohsp expression levels were normalized with respect to 18S rRNA and RPL32, respectively, and histograms indicate relative expression levels. All statistics indicate means 7 SE. Columns labeled with different letters indicate significant differences using one-way ANOVA followed by Tukey's multiple comparison analysis.

Fig. 5. Expression levels of Fohsp60, Fohsp90, Fohsc701, and Fohsc702 at 0, 1, 2, 4, and 8 h of exposure to
8 °C (A) and 39 °C (B). Fohsp expression levels during temperature shock were normalized with respect to 18S rRNA and RPL32, respectively, and histograms indicate relative expression levels. All statistics indicate means 7 SE. Columns labeled with different letters indicate significant differences using one-way ANOVA followed by Tukey's multiple comparison analysis.

Hsps have been identified in a variety of organisms including microbes, plants and animals. In this study, we identified four Hsps from the invasive insect F. occidentalis, including a member of the Hsp90 family (Fohsp90), two members of the Hsc70 family (Fohsc701 and Fohsc702), and an Hsp60 family member (Fohsp60). Sequence analysis suggested that the four Fohsps identified in our study are similar to hsps in other insect species. Both FoHsp90 and FoHsc701 have the conserved motif EEVD at the C-terminus, suggesting a cytoplasmic location (Shim et al., 2006; Wang et al., 2008; Zhang and Denlinger, 2010; Xu and Qin, 2012). However, FoHsc702 contains the conserved motif KDEL at the C-terminal end, suggesting that it localizes to the ER and belongs to the Hsc70 family (Karlin and Brocchieri, 1998; Li et al., 2009; Yang et al., 2012). Interestingly, a (GGM)n repeat motif was found in FoHsp60, suggesting that this protein is a member of the Hsp60 family that localizes to mitochondria (Wong et al., 2004; Xu and Qin, 2012). Phylogenetic analysis revealed that FoHsp90 was clustered with Hsp90s of Hemiptera species, which is consistent with known classification. FoHsc701 and FoHsc702 could be clearly divided into two branches. FoHsc701 was grouped with cytoplasmic Hsc70s, whereas FoHsc702 grouped with Hsc70s that target the ER. This result is consistent with studies conducted on two species of mites (Li et al., 2009; Yang et al., 2012). Hsp60 proteins from different insect orders could also be subdivided, and it is noteworthy that Wang et al. (2014) suggested that Hsp60 could be used for taxonomic classification at the ordinal level. It is interesting to speculate that Hsp families in insects may be derived from the same ancestral gene, but have since diverged during a long period of evolution. Therefore, Hsps may be a potential marker for phylogenetic analysis in insects. The four Fohsps genomic sequences contained introns, and the number and position of introns were very different from analogous genes encoding HSPs in other insect species. To our surprise, we discovered that intron numbers and positions were quite different in Fohsc701 and Fohsc702, which may be the result of divergent functions and dissimilar cellular locations. Thus, our results suggest that the evolution of hsc70 varies among species (Wang et al., 2008), and intra-specific variation can lead to differences in genomic structure, function and cellular localization. It is well-established that highly-expressed genes either lack introns or have relatively short introns relative to weakly-expressed genes (Castillo-Davis et al., 2002). In our study, Fohsp90 possessed fewer introns than the other Fohsp genes and was highly induced by temperature stress. The role of heat shock proteins in insect development is an active area of research. Our results demonstrate that expression of the four hsps varied with the developmental stage of F. occidentalis and was highest in pupae and lowest in adults. Huang et al. (2009) reported that four large hsps (hsp90 and three hsp60s) were expressed during development of Liriomyza sativa; interestingly, the expression level of hsps increased in pupae and reached maximal levels in adults. Similar expression patterns were observed in hsp90 and hsc70 of Plutella xylostella (Sonoda et al., 2006) and

116

M.-X. Lu et al. / Journal of Thermal Biology 57 (2016) 110–118

Fig. 6. Expression levels of Fohsp90, Fohsc701, Fohsc702 and Fohsp60 during rapid cold (A) and heat hardening (B). A: The second instar larvae of F. occidentalis (n ¼120) were hardened at 0 °C for 2 h and then were exposed to
8 °C for 2 h. Controls consisted of second instar larvae exposed to
8 °C with no hardening period. B: The second instar larvae of F. occidentalis (n ¼120) were hardened at 33 °C for 2 h and then exposed to 39 °C for 2 h. Controls consisted of second instar larvae exposed to 39 °C with no hardening period. Fohsp expression values were normalized to 18S and RPL32, respectively. Histograms indicate relative expression levels, and statistics indicate means 7SE. Columns labeled with different letters indicate significant differences using t-test analysis.

Spodoptera litura (Shu et al., 2011). The unique expression pattern of hsps in F. occidentalis may be associated with its distinct metamorphosis and development. Collectively, these results indicate that genes encoding heat shock proteins are highly regulated during insect development, and hsp expression patterns are widely variable among species. As their nomenclature implies, Hsps are very sensitive to heat, and even brief exposure to heat can induce up-regulation. However, increasing evidence has confirmed that Hsps can be induced by a range of other stressors such as cold (Rinehart et al., 2007), desiccation (Tammariello et al., 1999; Hayward et al., 2004), and chemicals (Shu et al., 2011). Our results suggested that Fohsp90 was induced by cold and heat. The two Fohsc70s (Fohsc701 and Fohsc702) were not induced by heat or cold shock, which was consistent with other studies (Qin et al., 2003; Shim et al., 2006; Zhang and Denlinger, 2010). However, our results contrasted with findings reported for Macrocentrus cingulum (Xu et al., 2010), Pteromalus puparum (Rinehart et al., 2007), and P. xylostella (Sonoda et al., 2006), which indicated that hsc70 was significantly upregulated by heat shock. In our study, the two Fohsc70s possessed similar expression patterns during heat and cold stress. Thus hsc70 expression patterns clearly differ amount insect species. Compared to Hsp90 and Hsc70, less is known about Hsp60. Our results indicated that Fohsp60 was clearly up-regulated by heat when exposed to 33 °C for 2 h, which is consistent with studies conducted in two species of leaf miners, Lucilia cuprina and Chilo suppressalis (Huang and Kang, 2007; Cui et al., 2010; Singh et al., 2015). However, studies conducted with Trichinella spiralis indicated that hsp60 was not induced by cold or heat (Wong et al., 2004). In our study, Fohsp60 and Fohsp90 exhibited a clear timedependent expression pattern under thermal stress. Similar results were observed in Helicoverpa zea, Spodoptera exigua and Laodelphax striatellus (Zhang and Denlinger, 2010; Xu et al., 2011; Zhang et al., 2014). Studies in many insects have indicated that pretreatment at sub-lethal temperatures for short periods of time can significantly improve survival when insects are subsequently exposed to lethal temperatures (Krebs and Loeschcke, 1994; Mcdonald et al., 1997;

Sisodia and Singh, 2006; Chidawanyika and Terblanche, 2011); this phenomenon is called rapid heat and cold hardening (Mcdonald et al., 1997; Loeschcke and Sørensen, 2005). Previous studies indicated that pretreatment at 0 °C or 33 °C for 2 h significantly improved survival of F. occidentalis larvae after exposure to potentially lethal cold or hot temperatures, respectively (Li et al., 2011a, 2011b). However, prior to this study, it was not clear whether enhanced thermotolerance was associated with the induction of Fohsps. Our results indicate that expression of the four Fohsps in cold and heat hardening treatments was much higher than controls, suggesting a correlation between Fohsp expression and improved thermotolerance of F. occidentalis. In this respect, our data are consistent with studies in Drosophila spp. and B. tabaci (Dahlgaard et al., 1998; Gong and Golic, 2006; Bettencourt et al., 2008; Kalosaka et al., 2009; Wang et al., 2011; Díaz et al., 2015). Therefore, the heat shock proteins presumably play very important roles in the process of rapid temperature hardening in F. occidentalis. In this study, we isolated both cDNA and genomic sequences of four hsps from F. occidentalis. The four Fohsps were expressed in all stages of insect development, but expression patterns were widely variable. Fohsc701, Fohsc702 and Fohsp60 were not induced by cold, and Fohsp60 and Fohsp90 were rapidly up-regulated after exposure to heat. Interestingly, we discovered that rapid cold and heat hardening significantly induced expression of the four Fohsps. Therefore, we speculate that rapid cold or heat hardening and the induction of Fohsps could contribute to the thermotolerance of F. occidentalis. In summary, our results indicated that the four FoHsps are associated with both insect development and temperature adaption; however, the underlying molecular basis for these roles warrants further investigation.

Acknowledgements The authors thank the Testing Center of Yangzhou University for assistance. This research was funded by the Special Fund for Agro-Scientific Research in the Public Interest (201103026,

M.-X. Lu et al. / Journal of Thermal Biology 57 (2016) 110–118

200803025), the Scientific Program of Changzhou (CJ20140052) and the Scientific Innovation Program Promoting Graduate Research in Jiangsu Province, China (CXZZ12_0910).

Appendix A. Supporting information Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.jtherbio.2016.03.005.

References Bale, J.S., Masters, G.J., Hodkinson, I.D., Awmak, C., Bezemer, T.M., Brown, V., Butterfield, J., Buse, A., Coulson, J.C., Farrar, J., Good, J.E.G., Hartley, R., Jones, T.H., Lindroth, R.L., Press, M.C., Symrnioudis, I., Watt, A., Whittaker, J.B., 2002. Herbivory in global climate change research: direct effects of rising temperature on insect herbivores. Glob. Chang. Biol. 8, 1–16. Bale, J.S., 2002. Insects and low temperatures: from molecular biology to distributions and abundance. Philos. Trans. R. Soc. Lond. B 357, 849–861. Bettencourt, B.R., Hogan, C.C., Nimali, M., Drohan, B.W., 2008. Inducible and constitutive heat shock gene expression responds to modification of Hsp70 copy number in Drosophila melanogaster but does not compensate for loss of thermotolerance in Hsp70 null flies. BMC Biol. 6, 5–15. Borkan, S.C., Gullans, S.R., 2002. Molecular chaperones in the kidney. Ann. Rev. Physiol. 64, 503–527. Castillo-Davis, C.I., Mekhedov, S.L., Hartl, D.L., Koonin, E.V., Kondrashov, F.A., 2002. Selection for short introns in highly expressed genes. Nat. Genet. 31, 415–418. Chen, X.L., Yuan, L.Z., Du, Y.Z., Zhang, Y.J., Wang, J.J., 2011. Cross-resistance and biochemical mechanisms of abamectin resistance in the western flower thrips Frankliniella occidentalis. Pestic. Biochem. Physiol. 101, 34–38. Chidawanyika, F., Terblanche, J.S., 2011. Rapid thermal response and thermal tolerance in adult codling moth Cydia pomonella (Lepidoptera: Tortricidae). J. Insect Physiol. 57, 108–117. Clark, M.C., Worland, M.R., 2008. How insects survive the cold: molecular mechanisms—a review. J. Comp. Physiol. B 178, 917–933. Cui, Y.D., Du, Y.Z., Lu, M.X., Qiang, C.K., 2010. Cloning of the heat shock protein 60 gene from the stem borer, Chilo suppressalis, and analysis of expression characteristics under heat stress. J. Insect Sci. 10, 1–13. Dahlgaard, J., Loeschcke, V., Michalak, P., Justesen, J., 1998. Induced thermotolerance and associated expression of the heat shock protein Hsp70 in adult Drosophila melanogaster. Funct. Ecol. 12, 786–793. De, M.A., 1999. Heat shock proteins: facts, thoughts, and dreams. Shock 11, 1–12. Denlinger, D.L., 2002. Regulation of diapause. Annu. Rev. Entomol. 47, 93–122. Deshaies, R.J., Koch, B.D., Werner-Washburne, M., Craig, E.A., Schekman, R., 1988. A subfamily of stress proteins facilitates translocation of secretory and mitochondrial precursor polypeptides. Nature 332, 800–805. Díaz, F., Orobio, R.F., Chavarriaga, P., Toro-Perea, N., 2015. Differential expression patterns among heat-shock protein genes and thermal responses in the whitefly Bemisia tabaci (MEAM 1). J. Therm. Biol. 52, 199–207. Feder, M.E., Hofmann, G.E., 1999. Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Ann. Rev. Physiol. 61, 243–282. Gai, H.T., Zhi, J.R., Li, Z.X., Jiang, Y.J., 2010. Survival rates of Frankliniella occidentalis and F. intonsa after exposure to adverse temperature conditions. Chin. J. Ecol. 29, 1533–1537 (in Chinese). Gong, W.J., Golic, K.G., 2006. Loss of Hsp70 in Drosophila is pleiotropic, with effects on thermotolerance, recovery from heat shock and neuro-degeneration. Genetics 172, 275–286. Goto, S.G., 2000. Expression of Drosophila homologue of senescence marker protein-30 during cold acclimation. J. Insect Physiol. 46, 1111–1120. Goto, S.G., 2001. A novel gene that is up-regulated during recovery from cold shock in Drosophila melanogaster. Gene 270, 259–264. Hayward, S.A., Rinehart, J.P., Denlinger, D.L., 2004. Desiccation and rehydration elicit distinct heat shock protein transcript responses in flesh fly pupae. J. Exp. Biol. 207, 963–971. Hoffmann, A.A., Sørensen, J.G., Loeschcke, V., 2003. Adaptation of Drosophila to temperature extremes: bringing together quantitative and molecular approaches. J. Therm. Biol. 28, 175–216. Huang, L.H., Kang, L., 2007. Cloning and interspecific altered expression of heat shock protein genes in two leafminer species in response to thermal stress. Insect Mol. Biol. 16, 491–500. Huang, L.H., Wang, C.Z., Kang, L., 2009. Cloning and expression of five heat shock protein genes in relation to cold hardening and development in the leafminer Liriomyza sativa. J. Insect Physiol. 55, 279–285. Ishida, H., Murai, T., Sonoda, S., Yoshida, H., Izumi, Y., Tsumuki, H., 2003. Effects of temperature and photoperiod on development and oviposition of Frankliniella occidentalis (Pergande) (Thysanoptera: Thripidae). Appl. Entomol. Zool. 38, 65–68. Kalosaka, K., Soumaka, E., Politis, N., Mintzas, A.C., 2009. Thermotolerance and HSP70 expression in the Mediterranean fruit fly Ceratitis capitata. J. Insect Physiol. 55, 568–573.

117

Karlin, S., Brocchieri, L., 1998. Heat shock protein 70 family: multiple sequence comparisons, function, and evolution. J. Mol. Evol. 47, 565–577. King, A.M., MacRae, T.H., 2015. Insect heat shock proteins during stress and diapause. Annu. Rev. Entomol. 60, 59–75. Kirk, W.D.J., Terry, L.I., 2003. The spread of the western flower thrips, Frankliniella Occidentalis (Pergande). Agric. For. Entomol. 5, 301–310. Kirk, W.D.J., 2002. The pest and vector from the West: Frankliniella occidentalis. In: Marullo, R., Mound, L.A. (Eds.), Thrips and Tospoviruses: Proceedings of the Seventh International Symposium on Thysanoptera Australian National Insect Collection, Canberra, pp. 33–44. Krebs, R.A., Loeschcke, V., 1994. Effect of exposure to short-term heats tress on fitness components in Drosophila melanogaster. J. Evol. Biol. 7, 39–49. Li, H.B., Shi, L., Lu, M.X., Wang, J.J., Du, Y.Z., 2011a. Thermal tolerance of Frankliniella occidentalis: effects of temperature, exposure time, and gender. J. Therm. Biol. 36, 437–442. Li, H.B., Shi, L., Wang, J.J., Du, Y.Z., 2011b. Rapid cold hardening of western flower thrips, Frankliniella occidentalis, and its ecological cost. Acta Ecol. Sin. 31, 7196–7202. Li, M., Lu, W.C., Feng, H.Z., He, L., 2009. Molecular characterization and expression of three heat shock protein70 genes from the carmine spider mite, Tetranychus cinnabarinus (Boisduval). Insect Mol. Biol. 18, 183–194. Lindquist, S., Craig, E.A., 1988. The heat-shock proteins. Annu. Rev. Genet. 22, 631–677. Loeschcke, V., Sørensen, J.G., 2005. Acclimation, heat shock and hardening-a response from evolutionary biology. J. Therm. Biol. 30, 255–257. Lu, M.X., Du, Y.Z., Liu, Z.X., Hua, J., Liu, P.Y., Li, J.Y., 2013. Diapause, signal and molecular characteristics of overwintering Chilo suppressalis. Sci. Rep. 3, 3211. Lu, M.X., Liu, Z.X., Cui, Y.D., Du, Y.Z., 2014. Expression patterns of three heat shock proteins in Chilo suppressalis (Lepidoptera: Pyralidae). Ann. Entomol. Soc. Am. 107, 667–673. Mcdonald, J.R., Bale, J.S., Walters, K.F.A., 1997. Rapid cold hardening in the western flower thrips Frankliniella occidentalis. J. Insect Physiol. 43, 759–766. Moseley, P.L., 1997. Heat shock proteins and heat adaptation of the whole organism. J. Appl. Physiol. 83, 1413–1417. Qin, W., Tyshenko, M.G., Wu, B.S., Walker, V.K., Robertson, R.M., 2003. Cloning and characterization of a member of the Hsp70 gene family from Locusta migratoria, a highly thermo-tolerant insect. Cell Stress Chaperones 8, 144–152. Qiu, B.L., Ren, S.X., Wen, S.Y., Mandour, N.S., 2003. Biotype identification of the populations of Bemisia tabaci (Homoptera: Aleyrodidae) in China using RAPDPCR. Acta Entomol. Sin. 46, 605–608 (in Chinese). Renner, T., Waters, E.R., 2007. Comparative genomic analysis of the Hsp70s from five diverse photosynthetic eukaryotes. Cell Stress Chaperones 12, 172–185. Rinehart, J.P., Li, A., Yocum, G.D., Robich, R.M., Hayward, S.A., Denlinger, D.L., 2007. Up-regulation of heat shock proteins is essential for cold survival during insect diapause. Proc. Natl. Acad. Sci. USA 104, 11130–11137. Shim, J.K., Jung, D.O., Park, J.W., Kim, D.W., Ha, D.M., Lee, K.Y., 2006. Molecular cloning of the heat shock cognate 70 (Hsc70) gene from the two-spotted spider mite, Tetranychus urticae, and its expression in response to heat shock and starvation. Comp. Biochem. Physiol. B 145, 288–295. Shu, Y.H., Du, Y., Wang, J.W., 2011. Molecular characterization and expression patterns of Spodoptera litura heat shock protein 70/90, and their response to zinc stress. Comp. Biochem. Physiol. A 158, 102–110. Singh, A.K., Lakhotia, S.C., 1984. Lack of effects of microtubule poisons on the 93D and 93D like heat shock puffs in Drosophila. Indian J. Exp. Biol. 20, 569–576. Singh, M.K., Janardhan Reddy, P.V., Sreedhar, A.S., Tiwari, P.K., 2015. Molecular characterization and expression analysis of hsp60 gene homologue of sheep blowfly, Lucilia cuprina. J. Therm. Biol. 52, 24–37. Sisodia, S., Singh, B.N., 2006. Effect of exposure to short-term heat stress on survival and fecundity in Drosophila ananassae. Can. J. Zool. 84, 895–899. Sonoda, S., Ashfaq, M., Tsumuki, H., 2006. Cloning and nucleotide sequencing of three heat shock protein genes (hsp90, hsc70, and hsp19.5) from the diamondback moth, Plutella xylostella (L.) and their expression in relation to developmental stage and temperature. Arch. Insect Biochem. Physiol. 62, 80–90. Sørensen, J.G., Kristensen, T.N., Loeschcke, V., 2003. The evolutionary and ecological role of heat shock proteins. Ecol. Lett. 6, 1025–1037. Tammariello, S.P., Rinehart, J.P., Denlinger, D.L., 1999. Desiccation elicits heat shock protein transcription in the flesh fly, Sarcophaga crassipalpis, but does not enhance tolerance to high or low temperatures. J. Insect Physiol. 45, 933–938. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Tsumuki, H., Ishida, H., Yoshida, H., Sonoda, S., Izumi, Y., Murai, T., 2007. Cold hardiness of adult western flower thrips, Frankliniella occidentalis (Pergande) (Thysanoptera: Thripidae). Appl. Entomol. Zool. 42, 223–229. Wang, H., Dong, S.Z., Li, K., Hu, C., Ye, G.Y., 2008. A heat shock cognate 70 Gene in the endoparasitoid, Pteromalus puparum, and its expression in relation to thermal stress. BMB Rep. 41, 388–393. Wang, H., Lei, Z., Li, X., Oetting, R.D., 2011. Rapid cold hardening and expression of heat shock protein genes in the B-biotype Bemisia tabaci. Environ. Entomol. 40, 132–139. Wang, H.H., Reitz, S.R., Wang, L.X., Wang, S.Y., Li, X., Lei, Z.R., 2014. The mRNA expression profiles of five heat shock protein genes from Frankliniella occidentalis at different stages and their responses to temperatures and insecticides. J. Integr. Agric. 13, 2196–2210. Wang, X.H., Qi, X.L., Kang, L., 2003. Rapid cold hardening process of insects and its

118

M.-X. Lu et al. / Journal of Thermal Biology 57 (2016) 110–118

ecologically adaptive significance. Prog. Nat. Sci. 13, 641–647. Wong, C.S., Mak, C.H., Ko, R.C., 2004. Cloning and characterization of the mitochondrial heat-shock protein 60 gene of Trichinella spiralis. Parasitol. Res. 93, 461–467. Xu, P.J., Xiao, J.H., Liu, L., Li, T., Huang, D.W., 2010. Molecular cloning and characterization of four heat shock protein genes from Macrocentrus cingulum (Hymenoptera: Braconidae). Mol. Biol. Rep. 37, 2265–2272. Xu, Q., Zou, Q., Zheng, H.Z., Zhang, F., Tang, B., Wang, S.G., 2011. Three heat shock proteins from Spodoptera exigua: Gene cloning, characterization and comparative stress response during heat and cold shocks. Comp. Biochem. Physiol. B 159, 92–102. Xu, Q.H., Qin, Y., 2012. Molecular cloning of heat shock protein 60 (PtHSP60) from Portunus trituberculatus and its expression response to salinity stress. Cell Stress Chaperones 17, 589–601. Yang, L.H., Jiang, H.B., Liu, Y.H., Dou, W., Wang, J.J., 2012. Molecular characterization of three heat shock protein 70 genes and their expression profiles under

thermal stress in the citrus red mite. Mol. Biol. Rep. 39, 3585–3596. Zhang, Q., Lu, M.X., Zhu, S.D., 2014. Cloning, sequence analysis and expression profiling of heat shock protein 90 gene in the small brown plant hopper, Laodelphax striatellus (Hemiptera: Delphacidae). Acta Entomol. Sin. 57, 777–786. Zhang, Q.R., Denlinger, D.L., 2010. Molecular characterization of heat shock protein 90, 70 and 70 cognate cDNAs and their expression patterns during thermal stress and pupal diapause in the corn earworm. J. Insect Physiol. 56, 138–150. Zhang, Y.J., Wu, Q.J., Xu, B.Y., Zhu, G.R., 2003. The occurrence and damage of Frankliniella occidentalis (Thysanoptera: Thripidae): a dangerous alien invasive pest in Beijing. Plant Prot. 24, 58–59 (in Chinese). Zheng, X.L., Cheng, W.J., Wang, X.P., Lei, C.L., 2011. Enhancement of supercooling capacity and survival by cold acclimation, rapid cold and heat hardening in Spodoptera exigua. Cryobiology 63, 164–169. Zheng, Y.T., Li, H.B., Lu, M.X., Du, Y.Z., 2014. Evaluation and validation of reference genes for qRT-PCR normalization in Frankliniella occidentalis (Thysanoptera: Thripidae). PLoS One 9, e111369.