Characterization of interleukin-1β as a proinflammatory cytokine in grass carp (Ctenopharyngodon idella)

Fish & Shellfish Immunology 46 (2015) 584e595

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Characterization of interleukin-1b as a proinflammatory cytokine in grass carp (Ctenopharyngodon idella) Yun-Xuan Bo a, Xue-Hong Song a, *, Kang Wu a, Bo Hu b, Bing-Yao Sun a, Zhao-Jun Liu a, Jian-Gui Fu a a b

School of Biology and Basic Medical Sciences, Soochow University, Suzhou, Jiangsu 215123, China Institutes of Biology and Medical Sciences, Soochow University, Suzhou, Jiangsu 215123, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 26 February 2015 Received in revised form 25 June 2015 Accepted 27 July 2015 Available online 30 July 2015

Interleukin-1b (IL-1b) is a well-characterized cytokine that plays key roles in cellular responses to infection, inflammation, and immunological challenges in mammals. In this study, we identified and analyzed a grass carp (Ctenopharyngodon idella) ortholog of IL-1b (gcIL-1b), examined its expression patterns in various tissues in both healthy and lipopolysaccharide (LPS)-stimulated specimens, and evaluated its proinflammatory activities. The gcIL-1b gene consists of seven exons and six introns. The full-length cDNA sequence contains an open reading frame of 813 nucleotides. The deduced amino acid sequence exhibits a characteristic IL-1 signature but lacks the typical IL-1b converting enzyme cleavage site that is conserved in mammals. In the phylogenetic tree, IL-1bs from grass carp and other members of the Cyprinidae family clustered into a single group. Expression pattern analysis revealed that gcIL-1b is constitutively expressed in all 11 tissues examined, and LPS stimulation leads to significant up-regulation in muscle, liver, intestine, skin, trunk kidney, head kidney, and gill. Recombinant grass carp IL-1b (rgcIL1b) was generated prokaryotically as a fusion protein of Trx-rgcIL-1b. An anti-rgcIL-1b polyclonal antibody (rgcIL-1b pAb) was raised in mice against the purified Trx-rgcIL-1b. Western blot analysis confirmed that rgcIL-1b pAb reacted specifically with gcIL-1b in C. idella kidney (CIK) cells. Quantitative real-time PCR data indicated that intestinal mRNA expression levels of endogenous IL-1b, IL-1R2, and TNF-a were significantly up-regulated following Trx-rgcIL-1b exposure. The inhibitory activities of rgcIL1b pAb against the inflammatory response were confirmed in a model of Aeromonas hydrophila-induced intestinal inflammation. Our immunohistochemical study revealed that the degree and intensity of inflammatory cell infiltration are fully consistent with the observed mRNA expression patterns of these key inflammatory genes. Taken together, these data suggest that gcIL-1b plays a critical role in the proinflammatory response in the grass carp intestine. © 2015 Elsevier Ltd. All rights reserved.

Keywords: Interleukin-1b (IL-1b) Grass carp Ctenopharyngodon idella mRNA expression profile Recombinant protein expression Proinflammatory activity Immunohistochemical analysis

1. Introduction Since 1984 when the cDNA sequence encoding the human interleukin-1b (IL-1b) precursor was first reported [1], mammalian IL-1b genes have been shown to regulate a variety of biological processes, including cell proliferation, differentiation and apoptosis, inflammation, immune response, metabolic reactions, hematopoietic processes, and tumor progression [2e4]. Numerous studies have demonstrated that IL-1b is a potent proinflammatory cytokine that plays critical roles in the regulation of immune and

* Corresponding author. E-mail address: [email protected] (X.-H. Song). http://dx.doi.org/10.1016/j.fsi.2015.07.024 1050-4648/© 2015 Elsevier Ltd. All rights reserved.

inflammatory responses to infection and immunological challenges in mammals [5,6], especially in the pathogenesis of human inflammatory bowel disease [7,8]. In contrast, limited studies have been devoted to determining the exact roles of IL-1b in the inflammatory response in teleosts. In fish, the first IL-1b cDNA was identified from rainbow trout (Oncorhynchus mykiss) by cDNA library screening; it was the first sequence to be isolated from a non-mammalian vertebrate species [9]. The rainbow trout IL-1b gene lacks the classical IL-1b converting enzyme (ICE) cleavage site required for the maturation of the mammalian IL-1b, and its expression in head kidney leukocytes and macrophages could be induced following lipopolysaccharide (LPS) stimulation [9,10]. This discovery provides compelling evidence that fish IL-1bs likely play vital roles in the immune system

Y.-X. Bo et al. / Fish & Shellfish Immunology 46 (2015) 584e595

similar to those in mammals. Therefore, understanding more about fish IL-1b proteins could provide unique insight into the immune and inflammatory response within vertebrates. To date, IL-1b has been identified in several teleost and cartilaginous fish species, including rainbow trout [9], common carp (Cyprinus carpio) [11], sea bass (Dicentrarchus labrax) [12], Atlantic salmon (Salmo salar) [13], channel catfish (Ictalurus punctatus) [14], Nile tilapia (Oreochromis niloticus) [15], Atlantic cod (Gadus morhua) [16], orange-spotted grouper (Epinephelus coioides) [17], yellowfin seabream (Acanthopagrus latus) [18], roughskin sculpin (Trachidermus fasciatus) [19], ayu (Plecoglossus altivelis) [20], Atlantic bluefin tuna (Thunnus thynnus) [21], and catshark (Scyliorhinus canicula) [22]. Several studies have shown that fish IL-1b proteins are involved in regulating the inflammatory response to bacterial or parasitic infection [23e26]. However, the exact roles of IL-1b in the fish inflammatory response have not yet been elucidated. Under extremely intensive culture conditions, many farmed fish are highly prone to inflammatory diseases due to bacterial, viral, and parasitic infections, which often result in great economic losses [21,27e29]. Therefore, understanding the regulation of inflammation is required to improve sustainable aquaculture. The grass carp (Ctenopharyngodon idella) is an important cultured freshwater fish in China, and it is often subject to numerous inflammatory diseases [30]. To date, several inflammation-associated genes, including tumor necrosis factor (TNF)-a [31], IL-8 [32], IL-17D [33], and IL-1b receptor antagonist [34], have been isolated and characterized in grass carp. However, grass carp IL-1b (gcIL-1b) has not been functionally characterized with regard to its role in the inflammatory response. In the current study, we identified and characterized the fulllength cDNA and genomic DNA encoding IL-1b from grass carp and examined the expression profiles of gcIL-1b mRNA in various resting and LPS-stimulated tissues using quantitative real-time PCR (qPCR). Recombinant IL-1b protein and its polyclonal antibody were generated and verified by western blot analysis. Immunohistochemical studies together with the qPCR analysis of mRNA expression levels of endogenous IL-1b, TNF-a, and IL-1R2 genes confirmed the proinflammatory effects of gcIL-1b in grass carp. 2. Materials and methods 2.1. Animals and kidney cell line Grass carp (mean weight: 25 ± 5 g) were supplied by Wujiang Aquaculture Co., Ltd., Jiangsu, China. Prior to experimental use, fish were held at 28 ± 1
C for at least 2 weeks in 300 l re-circulating tanks containing filtered and oxygenated water. The fish were fed with a commercial diet at 1% body weight once a day. Six 4-week-old female Balb/c mice were obtained from the Laboratory Animal Center of Soochow University, Suzhou, China. Feed and water were supplied to mice in a temperature-controlled environment. All animal experiments were performed in accordance with the Guidelines for Care and Use of Laboratory Animals of Jiangsu Province, China. The C. idella kidney (CIK) cells were kindly provided by Dr. Hui Chen (Jiangsu Provincial Aquatic Animal Disease Control Center, Nanjing, China) and were cultured in modified RPMI-1640 medium (HyClone, Logan, UT, USA) with 10% fetal bovine serum (Gibco, Grand Island, NY, USA) at 24
C. 2.2. Preparation of aeromonas hydrophila cells For bacterial challenge, a strain of Aeromonas hydrophila was inoculated on a lysogeny broth (LB) plate and incubated at 28
C for

585

1 d. A single colony was picked and grown in liquid LB medium for 12 h with shaking at 28
C. The bacterial cells were harvested by centrifugation at 3500 g for 20 min, re-suspended, and diluted to 1.8  108 CFU/ml in sterile phosphate-buffered saline (PBS, pH 7.4). These cells were used to induce intestinal inflammation in grass carp as previously described [30]. The negative control consisted of sterile PBS alone. 2.3. Isolation of full-length gcIL-1b cDNA and genomic DNA Total RNA was extracted from the head kidney of grass carp using TriPure Isolation Reagent (Roche, Mannheim, Germany). The first strand cDNA was synthesized using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Waltham, MA, USA). The full-length cDNA sequence of gcIL-1b was subsequently determined using the rapid amplification of cDNA ends (RACE) procedure. Both 50 and 30 RACE were performed using the SMARTer RACE cDNA Amplification Kit (Clontech, Mountain View, CA, USA) according to the manufacturer's user manual. The 50 and 30 RACE gene-specific primers were designed based on the partial coding sequences of grass carp IL-1b (GenBank accession no. EU047716.1) and are listed in Table 1. RACE was carried out in a 25 ml mixture containing 2.5 ml of 10  PCR buffer, 1.5 mM MgCl2, 1 mM dNTPs, 0.4 mM primers, 1 ml of cDNA, and 1 U of ExTaq DNA polymerase (TaKaRa, Dalian, China) on a gradient thermal cycler (Eppendorf, Hamburg, Germany). The cycling conditions were as follows: an initial denaturation step at 94
C for 3 min followed by 35 cycles of denaturation at 94
C for 30 s, primer annealing at 58
C for 30 s, extension at 72
C for 1 min, and an additional extension step at 72
C for 5 min. Genomic DNA was isolated from fresh grass carp blood using the DNA Extraction Kit (Beyotime, Nantong, China) following the manufacturer's instructions and was used as the template in a PCR reaction to amplify the genomic DNA of the gcIL-1b gene. A pair of specific primers (details in Table 1) was designed based on the gcIL1b cDNA sequence. PCR amplification was performed under the same cycling conditions as those for RACE. PCR products were purified using a DNA Gel Extraction Kit (Sangon, Shanghai, China). Finally, the purified DNA fragment was cloned into the pMD19-T vector (TaKaRa) and sequenced. The cDNA and deduced amino acid sequences of gcIL-1b were analyzed using the BLAST program from the NCBI (http://blast.ncbi. nlm.nih.gov/Blast.cgi). The molecular weight and the isoelectric point of gcIL-1b were predicted using the Compute pI/Mw tool (http://web.expasy.org/compute_pi/). Multiple alignments were analyzed using Clustal W (http://clustalw.ddbj.nig.ac.jp/). The neighbor-joining phylogenetic tree was constructed using MEGA 5.2 software. The exon-intron boundaries were identified by BLAST alignment of the cDNA sequence and genomic DNA sequence of gcIL-1b, and the exon-intron organization was compiled using VECTOR NTI software. 2.4. Expression pattern analysis of gcIL-1b by quantitative realtime PCR To examine the expression pattern of gcIL-1b mRNA induced by LPS treatment, fish were injected intraperitoneally with 100 ml LPS (100 mg/ml in PBS) or with the same volume of PBS as the control. Samples of the muscle, liver, intestine, skin, fin, heart, brain, trunk kidney, head kidney, gill, and spleen tissues were collected from three fish at 4 h, 12 h, 1 d, and 2 d post-injection. Control tissues were also collected from healthy fish at each time point. Total RNA was extracted from fish tissues and reverse-transcribed into cDNA using oligo(dT) primers. The mRNA expression of IL-1b against the internal reference b-actin gene (GenBank accession no. M25013.1)

586

Y.-X. Bo et al. / Fish & Shellfish Immunology 46 (2015) 584e595

Table 1 Nucleotide primers used in this study. Primer name

Sequence (50 e30 )

Applications

IL-1bF IL-1bR rIL-1bF rIL-1bR gIL-1bF gIL-1bR IL-1bqF IL-1bqR IL-1R2qF IL-1R2qR TNF-aqF TNF-aqR b-actinqF b-actinqR

GGAGAATGTGATCGAAGAGCGT GACACACAGGCTGGGATGC CGCGGATCCATGGCATGCGAACGATATGA CCGCTCGAGTCACTTGTTCTCCAGTGTGAA AGAGGAACTCAACTGAACGACTG TTGATTCTTAACTCCGGATCACT TCCTCGTCTGCTGGGTGT CAAGACCAGGTGAGGGGAAG CAGATAAAAGTATCACAGGCAACC TACAAGAAAACACACACCACGAG CTTCACGCTCAACAAGTCTCAG AAGCCTGGTCCTGGTTCACTC AGCCATCCTTCTTGGGTATG GGTGGGGCGATGATCTTGAT

30 -RACE for IL-1b 50 -RACE for IL-1b Recombinant construct; the restriction sites for BamH I and Xho I are underlined, respectively Genomic DNA amplification of IL-1b qPCR expression analysis for IL-1b qPCR expression analysis for IL-1R2 qPCR expression analysis for TNF-a qPCR expression analysis for b-actin (as internal control)

Notes: All primers were commercially synthesized by Sangon Biotech (Shanghai, China). The universal primers used for 30 - and 50 -RACE are not shown in this table.

was measured using qPCR with specific primers (IL-1bqF/IL-1bqR, Table 1). qPCR was performed using the AccuPower 2  Greenstar™ qPCR Master Mix (Bioneer, Daejeon, Korea) on a Bio-Rad CFX96™ Real-time detection system (Bio-Rad, Hercules, CA, USA). The reaction mixture was incubated for 3 min at 95
C followed by 39 cycles of 10 s at 95
C, 30 s at 60
C, and 30 s at 72
C. The Ct values of IL-1b for all samples were analyzed using the 2eDDCT method [35]. The same nucleic acid extraction, reverse transcription, and qPCR methods were used to quantify IL-1b mRNA levels in control and LPS-treated (300 mg/ml) CIK cells 16 h poststimulation. 2.5. Recombinant plasmid construction and prokaryotic expression A pair of special primers, rIL-1bF and rIL-1bR (Table 1), was designed according to the cDNA sequence of gcIL-1b to amplify the entire coding sequence by reverse transcription-PCR. The amplified product was digested with BamH I and Xho I and cloned into pET32a(þ) (Merck, Darmstadt, Germany) using the BamH I and Xho I restriction sites to obtain recombinant plasmid pET32a(þ)-gcIL1b. The resulting plasmid was then transformed into competent Escherichia coli BL21(DE3), and the cells were grown on an LB plate containing 100 mg/ml ampicillin. Subsequently, the clones harboring the correct construct were picked and incubated in 2  YT medium with 75 mg/ml ampicillin at 37
C to an optical density at 600 nm of 0.6. The recombinant fusion protein Trx-rgcIL1b was produced by further incubation at 28
C for 4 h under 1 mM isopropyl b-D-1-thiogalactopyranoside (IPTG) induction. E. coli cells expressing rgcIL-1b were harvested and lysed, and the cell lysates were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) to measure the molecular weight of the rgcIL-1b protein. In parallel, the fusion tag Trx was also obtained by transforming the corresponding empty expression vector pET32a(þ). 2.6. Preparation of anti-rgcIL-1b polyclonal antibody (rgcIL-1b pAb) The E. coli BL21(DE3) cells that expressed rgcIL-1b were resuspended with RIPA lysis buffer (Beyotime) and disrupted by sonication on ice. The fusion protein Trx-rgcIL-1b was excised from the SDS-PAGE gel, electro-eluted, dialyzed against cold PBS, and quantitatively measured using the bicinchoninic acid protein (BCA) assay (Pierce, Woburn, MA, USA). The purified protein was used to raise antiserum in mice. Balb/c mice were immunized alternately by intraperitoneal or subcutaneous injections of 0.5 ml gel-purified Trx-rgcIL-1b (1 mg/ml) emulsified with complete or incomplete

Freund's adjuvant (SigmaeAldrich, St. Louis, MO, USA) at 21d intervals. Seven d after four immunizations, the antiserum was harvested by centrifugation at 12,000 g for 15 min at 4
C. The antirgcIL-1b polyclonal antibody (designated as rgcIL-1b pAb hereafter) was isolated by passing the supernatant over protein A resin (Invitrogen, Shanghai, China) as described in the manufacturer's instructions. The antibody concentration was determined using the BCA method. 2.7. Western blot assay To investigate the specificity of rgcIL-1b pAb, immunoblot analysis was performed using lysates of LPS-stimulated (300 mg/ml) and non-stimulated CIK cells. CIK cells grown in 25 ml bottles were removed by 0.25% trypsin solution (Gibco, Grand Island, NY, USA) treatment for 5 min, washed three times with ice-cold PBS (100 mM, pH 7.4), suspended in 20 ml of PBS, and mixed with same volume of protein loading buffer. The mixture was boiled for 5 min, and then centrifuged at 12,000 g for 5 min at 4
C. The supernatant was collected and the protein concentration was measured using the BCA method. Protein (50 mg) from these cell lysates was subjected to SDS-PAGE using 12% separation gels, transferred to PVDF membranes (Millipore, Bedford, MA, USA), and blocked for 12 h with Tris-buffered saline-Tween plus 4% non-fat dry milk. The membranes were incubated with the rgcIL-1b pAb solution (1:500) that had either been pre-treated with gel-purified Trx-rgcIL-1b (250 mg/ml) or not. Membranes incubated with b-actin mAb (1:5000) (Liankebio, Hangzhou, China) were used as protein loading controls. After 1.5 h of incubation and three washes with PBST (0.05% Tween-20 in PBS), each membrane was incubated with goat anti-mouse IgG (H.L)-horseradish peroxidase (HRP) (1:300) at 37
C for 1 h. Proteins were visualized by staining with 3,3’-diaminobenzidine-tetrahydrochloride (DAB) solution (DAKO, Copenhagen, Denmark). 2.8. Determination of the proinflammatory effects of rgcIL-1b The recombinant Trx-rgcIL-1b produced in E. coli BL21(DE3) accounted for approximately 70% of total cell proteins and was present in inclusion bodies. To obtain soluble and refolded protein, the inclusion bodies were solubilized in denaturing solution (7 M urea) and loaded onto a nickel (Ni)-affinity column (Ni-NTA, Genscript, Nanjing, China) pre-equilibrated with a buffer containing 20 mM TriseHCl (pH 8.0), 0.5 M NaCl, 7 M urea, and 10% [w/v] glycerol. The proteins purified via the 6-His tag were dialyzed against 100 ml of 7 to 0 M urea gradient solution dissolved in PBS. About 4e5 mg of refolded Trx-rgcIL-1b with >95% purity were

Y.-X. Bo et al. / Fish & Shellfish Immunology 46 (2015) 584e595

obtained from 1 L of culture. Trx protein was also obtained in a similar manner from the E. coli BL21(DE3) harboring empty pET32a(þ). After the concentration was determined using the BCA method, the purified Trx-rgcIL-1b protein was used for the proinflammatory activity assay. To detect possible proinflammatory effects of rgcIL-1b, fish were challenged with Ni-NTA-purified rgcIL-1b at 1, 5, and 10 mg/fish or with Trx at 10 mg/fish via anal intubation. Fish infected by A. hydrophila at 1.8  107 CFU/fish were used as the positive control, and those treated with PBS served as the negative control. For each treatment, three replicates were run. The posterior intestine showing visible inflammation was collected at 1 h, 1 d, and 3 d after each treatment and used to measure mRNA expression of IL-1b, IL1R2 (GenBank accession no. KF245425.1), and TNF-a (GenBank accession no. JQ670915.1). 2.9. Validation of the anti-inflammatory activity of rgcIL-1b pAb To examine a potential blocking effect of rgcIL-1b pAb on gcIL-1b activity, the optimal rgcIL-1b pAb dose, which was needed to partially alleviate inflammation in a grass carp model of A. hydrophila-induced intestinal inflammation [30], was determined to be 20.0 ng/fish through pilot experiments conducted by applying different doses ranging from 0.2 to 20.0 ng/fish. Twelve h after the model induction, fish were treated with 10 ml rgcIL-1b pAb at a dose of 20.0 ng via anal intubation. Control fish received an equal volume of normal mouse serum. For each treatment, three replicates were run. The posterior intestine was sampled at 1 h, 1 d, 3 d, and 7 d, respectively. Quantitative mRNA expression analysis of the IL-1b, IL-1R2, and TNF-a genes was performed by qPCR as described in Section 2.4. 2.10. Immunohistochemical analysis For immunohistochemical analysis, the intestine was removed from fish that developed severe inflammation 3 d after receiving an anal intubation of 20.0 ng rgcIL-1b pAb. After being embedded in paraffin, the intestine was cut into 4 mm thick sections, which were mounted on 3-aminopropyltriethoxysilane-coated slides. Tissue sections were deparaffinized in xylene, rehydrated in a graded alcohol series, and subjected to antigen retrieval by heating in sodium citrate buffer (pH 8.0) for 10 min in a microwave oven. After cooling for 20 min and washing in 0.1 M PBS (pH 7.4), endogenous peroxidase was inactivated by incubation with 3% H2O2 for 25 min in the dark, and non-specific antibody binding was blocked by incubation for 30 min in PBS containing 3% bovine serum albumin. Sections were incubated with rgcIL-1b pAb (1:500) overnight at 4
C, then washed three times and further incubated with goat antimouse IgG (H.L)-HRP (Bioworld, Dublin, OH, USA) at room temperature for 50 min. Immunohistochemical staining was performed with DAB solution for 10 min followed by counterstaining with Harris hematoxylin (SigmaeAldrich) for 3 min. The stained sections were mounted in neutral resin for microscopic observations under an inverted fluorescence microscope (Nikon, Tokyo, Japan). 2.11. Statistical analysis For all qPCR assays, the data for individual samples were normalized to the corresponding b-actin mRNA level and are expressed as mean ± SEM of values obtained from three fish. The differences among samples were evaluated by one-way analysis of variance (ANOVA) with SPSS 16.0 software. Differences were considered to be statistically significant at p < 0.05.

587

3. Results 3.1. Cloning of gcIL-1b cDNA and genomic DNA sequences The full-length gcIL-1b cDNA (GenBank accession no. JN705663.2) was obtained by 50 and 30 RACE on the basis of a partial coding sequence of grass carp IL-1b (GenBank accession no. EU047716.1). The cDNA sequence is 1260 bp in length (Fig. 1), and it contains an open reading frame of 813 nucleotides (nt). The 50 untranslated region (UTR) and 30 UTR are 61 bp and 386 bp long, respectively. The 30 UTR includes four copies of an mRNA instability motif (ATTTA) and a putative polyadenylation consensus sequence (AATAAA) that is located 17 bp upstream from the poly(A) tail. The 2863 bp genomic DNA sequence of gcIL-1b was obtained by PCR amplification using specific primers designed based on the cDNA sequence, and it was deposited in GenBank under accession no. JQ692172.1. Fig. 2 shows a schematic gene structure of fish and human IL-1b genes. Comparison of the exon-intron organization of gcIL-1b with its fish and human homologs revealed substantial variation in the number of exons and introns among fish species. The grass carp IL-1b gene, like those of common carp and channel catfish, consists of seven exons and six introns. However, its homologous genes in zebrafish (Danio rerio) and rainbow trout contain six exons, and those in sea bass and yellowfin seabream contain only five exons. Unexpectedly, gcIL-1b shares a similar exon-intron organization with human IL-1b. Therefore, fish IL-1b genes are not strictly conserved in their structures. 3.2. Phylogenetic analysis of the gcIL-1b protein The complete open reading frame of the gcIL-1b gene was predicted to encode a protein of 270 amino acid residues (GenBank accession no. AER38414.2) with a calculated molecular weight of 30.1 kDa and a theoretical isoelectric point of 5.17. An online sequence analysis (http://prosite.expasy.org/) revealed the presence of a 21-amino acid motif of FeSVkyPgwFISTafkdmeqV at position 232 to 252 in the deduced amino acid sequence, which conforms to the consensus signature as [FC]-x-S-[ASLV]-x(2)-Px(2)-[FYLIV]-[LI]-[SCA]-T-x(7)-[LIVM] that is proposed to be characteristic of the IL-1 protein family. However, no significant signal peptide was detected by the SignalP 4.1 Server at http://www.cbs. dtu.dk/services/SignalP/. Fig. 3 shows a multiple alignment of the deduced gcIL-1b amino acid sequence and other orthologs. Sequence comparisons among the putative vertebrate IL-1b amino acid sequences revealed that gcIL-1b shared the highest amino acid identity with zebrafish IL-1b (61%), followed by common carp IL-1b (59%) and rainbow trout IL1b (34%). The sequence identity between gcIL-1b and human IL-1b was as low as 24% despite their identical exon-intron organization. The phylogenetic tree constructed using Clustal W 1.83 and MEGA 5.2 (Fig. 4) revealed that gcIL-1b exhibited more similarity to IL-1b proteins from all aligned species of the Cyprinidae family, including zebrafish, common carp, and rohu carp (Labeo rohita), than from other fish families. IL-1b proteins from the Cyprinidae family were clustered into a single group that was clearly distinct from other fish groups and mammal, amphibian, and reptile clusters. 3.3. gcIL-1b expression pattern in various grass carp tissues preand post-LPS stimulation The qPCR analysis showed that gcIL-1b was constitutively expressed at varying levels in different tissues of healthy grass carp, including the muscle, liver, intestine, skin, fin, heart, brain, trunk kidney, head kidney, gill, and spleen (Fig. 5A). Among these tissues, the highest gcIL-1b expression occurred in spleen, followed by gill,

588

Y.-X. Bo et al. / Fish & Shellfish Immunology 46 (2015) 584e595

Fig. 1. Compiled full-length gcIL-1b cDNA sequence and deduced amino acid. The start and stop codons are underlined. The potential N-glycosylation sites are in italics and bold, respectively. Four copies of the mRNA instability motif (ATTTA) present in the 30 -UTR are in bold. The polyadenylation signal sequence (AATAAA) is double underlined. The IL-1 signature at position 232 to 252, predicted by PROSITE (http://prosite.expasy.org/), is highlighted in grey.

Fig. 2. Schematic illustration of exoneintron organization of IL-1b genes from fish and humans. This scale diagram of the exon-intron organization was generated based on the following IL-1b nucleotide sequences deposited in GenBank: grass carp (Ctenopharyngodon idella), JQ692172.1 (this study); common carp (Cyprinus carpio), AJ245635.1; zebrafish (Danio rerio), FM213388.1; sea bass (Dicentrarchus labrax), AJ311925.1; channel catfish (Ictalurus punctatus), DQ157743.1; rainbow trout (Oncorhynchus mykiss), AJ004821.1; Human (Homo sapiens), M15840.1. The exoneintron organization of yellowfin seabream (Acanthopagrus latus) IL-1b is from Ref. [15]. Exons are denoted by boxes and introns by horizontal lines. The size of each exon is given by a number (in base pairs) above the box, and that of each intron is given below the line.

head kidney, and trunk kidney, whereas the lowest expression was detected in muscle. Relatively low expression levels were found in liver, intestine, and skin. Fig. 5B shows the time course of gcIL-1b mRNA expression following LPS stimulation in all 11 tissues. gcIL-1b mRNA levels changed after LPS stimulation in all tissues except the brain when compared with baseline expression levels in healthy grass carp tissues. The mRNA levels were significantly elevated in muscle,

liver, intestine, skin, trunk kidney, head kidney, and gill (p < 0.05). Peak levels in muscle, skin, fin, and spleen occurred 12 h after LPS stimulation, whereas levels in other tissues peaked at 1 d. 3.4. Recombinant expression of gcIL-1b To maximize protein expression, the IL-1b coding sequence from grass carp was cloned into the prokaryotic expression

Y.-X. Bo et al. / Fish & Shellfish Immunology 46 (2015) 584e595

589

Fig. 3. Multiple alignment of deduced gcIL-1b amino acid sequence with other IL-1b sequences retrieved from GenBank. The gcIL-1b amino acid sequence (GenBank accession no. AER38414.2) was aligned with the following representative sequences from GenBank: yellowfin seabream, AAV74185.1; common carp, AGA92707.1; zebrafish, NP_998009.2; sea bass, CAC41006.1; rainbow trout, NP_001117819.1; ayu (Plecoglossus altivelis), CCN27133.1; gilthead seabream (Sparus aurata), CAD11603.1; Mongolian gerbil (Meriones unguiculatus), BAD67162.1; Human, EAW73607.1. The completely conserved residues across all the aligned sequences are shown in black, and the highly conserved residues are shown in grey. Absent amino acids are indicated by dashes (). The ICE cleavage site believed to be strictly conserved in mammalian IL-1bs is indicated by a downward arrow, whereas that identified in sea bass IL-1b is indicated by a solid arrow. The IL-1 family signature is boxed.

pET32a(þ) vector using the BamH I and Xho I sites. The resulting recombinant plasmid pET32a(þ)-gcIL-1b was transformed into E. coli BL21(DE3) to produce fusion proteins with a Trx tag. The optimal concentration and time of IPTG induction and culture temperature were determined during pilot experiments. The lysates of E. coli cells harboring recombinant pET32a(þ)-gcIL-1b or empty pET32a(þ) with or without IPTG induction were separated by SDS-PAGE gel (Fig. 6). After 1 mM IPTG induction at 28
C for 4 h, cells containing pET32a(þ)-gcIL-1b generated a thick band at ~50 kDa (Fig. 6A, lane 2), approximately corresponding to the predicted size (50.45 kDa) of Trx-rgcIL-1b protein. In contrast, cells without IPTG induction (control) produced only a weak band at the appropriate position (Fig. 6A, lane 1). After Ni column purification, a single band of the same size was present (Fig. 6A, lane 3). These results indicate that the 50-kDa protein was the fusion protein TrxrgcIL-1b. Similarly, we also obtained the Trx tag by growing cells transformed with empty pET32a(þ) vector (Fig. 6B). These cells expressed a ~21 kDa protein after IPTG induction (Fig. 6B, lane 2), which was also present after purification (Fig. 6B, lane 3). No such band was observed in cells without IPTG induction (Fig. 6B, lane 1), which indicates that the 21-kDa protein was the Trx tag.

assay to detect IL-1b mRNA levels in CIK cells. The qPCR results indicated that IL-1b was expressed in CIK cells at a low level and was significantly up-regulated 16 h after stimulation with LPS (Fig. 7A). Western blot analysis was then performed to confirm the specific binding of the rgcIL-1b pAb to gcIL-1b. Following incubation with the rgcIL-1b pAb, two bands of approximately 30 kDa (band I) and 20 kDa (band II) in size were observed in extracts from both LPS-stimulated and non-stimulated CIK cells. The sizes of these two proteins coincide with the predicted sizes of proIL-1b and mature IL-1b. Both of these proteins exhibited a considerable accumulation after LPS stimulation (Fig. 7B). On the other hand, when incubated with the b-actin mAb, a single band (band III) of ~43 kDa appeared with quite similar densities across the different treatments. In contrast, when pre-incubated with purified rgcIL-1b, the rgcIL-1b pAb failed to detect any specific bands in LPSstimulated or non-stimulated CIK cells. Thus, our western blot analysis demonstrated that the rgcIL-1b pAb has a highly specific affinity for both proIL-1b and mature IL-1b.

3.5. Specific binding of rgcIL-1b pAb to gcIL-1b

To probe the potential proinflammatory effects of rgcIL-1b in grass carp intestine, we conducted a qPCR assay to quantify endogenous IL-1b mRNA expression in the intestine. The time

To determine whether CIK cells express IL-1b, we used a qPCR

3.6. rgcIL-1b-induced up-regulation of IL-1b, IL-1R2, and TNF-a genes

590

Y.-X. Bo et al. / Fish & Shellfish Immunology 46 (2015) 584e595

Fig. 4. The phylogenetic tree of IL-1b amino acid sequences from fish and other vertebrate species. This tree was constructed using the MEGA 5.2 program. The GenBank accession number for each amino acid sequence is shown following the species name. The sequence identified in this study is boxed. The number at each branch node represents bootstrap value as percentages of 1000 replications. In this tree, branches are shown when their bootstrap values are greater than 60%.

course of intestinal IL-1b mRNA levels following anal intubation with rgcIL-1b at different doses was evaluated (Fig. 8). Results showed that the temporal patterns of intestinal IL-1b mRNA expression induced by rgcIL-1b were different from that induced by A. hydrophila (positive control). IL-1b mRNA levels peaked by 1 d after treatment with rgcIL-1b at all tested doses, whereas the peak occurred by 3 d after challenge with 1.8  107 CFU of A. hydrophila. In addition, treatment with a moderate dose of rgcIL-1b was more effective than a doubling dose at inducing endogenous IL-1b mRNA expression. As expected, treatment with PBS or Trx resulted in only slight increases in intestinal IL-1b mRNA levels over the whole time course.

We also examined the expression levels of IL-1R2 and TNF-a mRNA in the intestine after fish had been treated by anal intubation with rgcIL-1b at different doses. qPCR quantifications showed that treatment with rgcIL-1b resulted in significant changes in intestinal IL-1R2 and TNF-a levels in both dose- and time-dependent manners (Fig. 9), and the changes in mRNA levels of these two genes followed a similar pattern. In comparison with the Trx-treated control, the IL-1R2 and TNF-a expression levels were significantly up-regulated by the lower doses of rgcIL-1b (1 and 5 mg/fish) and reached maximum levels following a moderate dose of 5 mg/fish. When the dose was increased to 10 mg/fish, the mRNA expressions of IL-1R2 and TNF-a decreased remarkably to a level similar to that

Y.-X. Bo et al. / Fish & Shellfish Immunology 46 (2015) 584e595

Fig. 5. Expression pattern of the grass carp IL-1b gene. (A) Relative mRNA expression levels of the gcIL-1b gene in healthy grass carp tissues. Values are expressed as fold increase over the lowest expression level, which was assigned a relative value of one. (B) Relative mRNA expression levels of the gcIL-1b gene in various tissues following LPS stimulation. Values are expressed as fold increase over the PBS-treated control and represent the mean ± SEM for three fish. Asterisk indicates statistically significant differences (p < 0.05).

of the Trx-treated control (Fig. 9A). Furthermore, changes in intestinal IL-1R2 and TNF-a mRNA levels over time after treatment with 5 mg rgcIL-1b were also monitored. Results showed that IL-1R2 and TNF-a mRNA levels increased and peaked by 1 d following treatment, then gradually decreased over the course of the next 2 d (Fig. 9B). 3.7. Inhibitory activities rgcIL-1b pAb against A. hydrophilainduced intestinal inflammation To further verify the specific binding of rgcIL-1b pAb to the native gcIL-1b and to probe the proinflammatory activities of gcIL1b, we performed immunohistochemical examination of intestinal tissues from A. hydrophila-challenged fish using rgcIL-1b pAb. No

591

positive staining was observed in the intestine sections of PBStreated controls (Fig. 10A). In contrast, strong positive IL-1b signals were observed in fish challenged with A. hydrophila (Fig. 10B), which illustrates the specific binding of rgcIL-1b pAb to the native IL-1b protein. It also suggests that IL-1b might play roles in the A. hydrophila-induced intestinal inflammatory response. Moreover, when fish were treated with A. hydrophila and rgcIL-1b pAb, only weak staining was observed in intestinal tissues, especially in the epithelial cells (Fig. 10C). In fish that received normal mouse serum instead of rgcIL-1b pAb, the intestine displayed a profile roughly identical to that observed in fish challenged with A. hydrophila only (Fig. 10D). These results show that rgcIL-1b pAb could partially suppress the inflammatory response. This premise is supported by the fact that the positive gcIL-1b signals were mainly immunolocalized in the cytoplasm of mucosal epithelial cells and neutrophils in the intestinal submucosa and muscular layer (Fig. 10BeD). To evaluate the inhibitory activities of rgcIL-1b pAb against the inflammatory response, we measured intestinal mRNA levels of IL1b, IL-1R2, and TNF-a at 1 h, 1 d, 3 d, and 7 d following different treatments. Overall, the temporal mRNA expression patterns were remarkably similar among these genes. One hour after treatment, no significant difference in mRNA level for each gene was observed between different treatments, although low expression levels were detectable (Fig. 11). Subsequently, the mRNA levels of all three genes increased significantly until day 3 post-treatment and then declined to be much lower by day 7. It should be noted that rgcIL-1b pAb treatment exerted significant inhibitory effects on mRNA expression of IL-1b and TNF-a but not IL-1R2. In addition, unexpectedly, high mRNA levels of these genes were detected in fish treated with A. hydrophila plus normal mouse serum compared to those treated with A. hydrophila alone. 4. Discussion In this study, a full-length cDNA sequence for grass carp IL-1b (gcIL-1b) was determined by 50 and 30 RACE techniques based on a 448 bp partial coding sequence (GenBank accession no. EU047716.1). The genomic DNA sequence of the gcIL-1b gene then was isolated. The gcIL-1b gene contains seven exons and six introns and contains an 813 bp open reading frame encoding 270 amino acid residues. It is roughly equivalent to the length of homologous proteins in common carp, zebrafish, ayu, Mongolian gerbil (Meriones unguiculatus), and humans but longer by 17 residues than that

Fig. 6. SDS-PAGE analysis of the expression and purification of fusion protein Trx-rgcIL-1b and fusion tag Trx in E. coli BL21(DE3). After the SDS-PAGE separation on a 12% acrylamide gel, the proteins were stained with Coomassie dye R-250. Panels A and B show the expression and purification of Trx-rgcIL-1b and Trx from cells harboring recombinant plasmid pET32a(þ)-gcIL-1b and empty pET32a(þ) vector, respectively. In each panel, the following fractions were electrophoretically separated: lane 1, whole cell lysate without IPTG induction; lane 2, whole cell lysate with 1 mM IPTG induction; lane 3, purified proteins (I, Trx-rgcIL-1b; II, Trx), and lane M, Molecular weight marker in kDa.

592

Y.-X. Bo et al. / Fish & Shellfish Immunology 46 (2015) 584e595

Fig. 7. The specific binding of rgcIL-1b pAb to gcIL-1b from CIK cells. (A) A significant increase in relative gcIL-1b mRNA levels in CIK cells 16 h after LPS stimulation. (B) Western blot analysis of gcIL-1b in lysates of LPS-stimulated (lanes 2 and 4) or non-stimulated (lanes 1 and 3) CIK cells using rgcIL-1b pAb. The anti-b-actin monoclonal antibody was used as a loading control. Lane M is the molecular weight marker in kDa. The bands I, II, and III indicate the pro-IL-1b, mature IL-1b, and b-actin, respectively.

Fig. 8. Time course of intestinal gcIL-1b mRNA expression after exposure to rgcIL1b at different doses. Fish were challenged by anal intubation with gcIL-1b at doses of 1, 5, 10 mg per fish. Fish that received PBS, Trx (10 mg), or A. hydrophila (1.8  107 CFU) via the same route served as controls. The gcIL-1b mRNA expression levels in the intestine were detected by qPCR 1 h, 1 d, 3 d after each treatment. The expression levels were normalized using b-actin as an internal reference. An asterisk indicates a statistically significant difference between treated fish and healthy fish (p < 0.05).

of gilthead seabream (Sparus aurata) and yellowfin seabream IL1bs. Importantly, within the deduced amino acid sequence, a conserved signature characteristic of the IL-1 protein family was identified at position 232 to 252 [36]. The seven exon-six intron organization of gcIL-1b is also found in common carp and channel catfish IL-1b genes, but it differs from that of zebrafish, rainbow trout, sea bass, and yellowfin seabream. Surprisingly, gcIL-1b and its human counterpart exhibit identical exon/intron organization, although they share only 24% amino acid identity. On the other hand, gcIL-1b and zebrafish IL-1b share the highest identity (61%), but they have different exon/intron organization. gcIL-1b also has a high amino acid identity (59%) to its common carp counterpart but exhibits relativity low identity (34%) with rainbow trout IL-1b. This is well illustrated by the phylogenetic tree (Fig. 4), which shows that gcIL-1b clusters together with its fish orthologs from three species in the same family as grass carp. These results show that fish IL-1b genes display significant divergence in their exon-intron architecture compared to their mammalian counterparts [37]. It is widely accepted that IL-1bs are expressed in an inactive precursor form with an NH2-terminal propeptide that is proteolytically removed by ICE, to release the active IL-1b [38]. ICE is regarded as unique due to its stringent specificity for cleaving AspX bonds, where X is proposed to be a hydrophobic residue [25,39]. The ICE cleavage sites are strictly conserved in human and other mammalian IL-1b sequences. The human ICE cleaves the IL-1b precursor (pro-IL-1b) at Asp116-Ala117 or Asp27-Gly28 [39], and

Fig. 9. Changes of intestinal mRNA expression levels of IL-1R2 and TNF-a genes after rgcIL-1b exposure. (A) The mRNA expression levels of IL-1R2 and TNF-a after treatment with rgcIL-1b at doses of 1, 5, and 10 mg/fish for 1 d. Similar treatment with 10 mg of Trx was used as the control. In both panels, the expression levels were normalized to the b-actin level. An asterisk indicates a statistically significant difference (p < 0.05). (B) The mRNA expression levels of IL-1R2 and TNF-a at 1 h, 1 d, 3 d following 5 mg rgcIL-1b treatment.

aspartic acid residues are absolutely required for specific cleavage. Previous studies have shown that ICEs also are involved in processing of fish IL-1bs [25,40,41]. This premise was reinforced by the finding that recombinant gilthead seabream caspase-1 ectopically expressed in HEK293cells exhibited in vitro catalytic properties [40]. However, no ICE cleavage sites identical to those in mammalian IL-1bs have been found in any fish IL-1b identified to date [9,10,18e20,25,41,42], including in gcIL-1b (Fig. 3 of this study). Recently, an ICE cleavage site (Asp100-Ser101) was identified in sea bass IL-1b [41]. Moreover, in zebrafish, three cleavage sites (Asp88Met89, Asp104-Ser105, and Asp122-Gln123) for two caspase-1 orthologs have been identified [25]. Among these three sites, the Asp122-Gln123 site is present at the position corresponding to

Y.-X. Bo et al. / Fish & Shellfish Immunology 46 (2015) 584e595

593

Fig. 10. Immunohistological staining of gcIL-1b protein in the inflamed grass carp intestine using rgcIL-1b pAb. (A) Anal intubation with PBS only; (B) anal intubation with A. hydrophila only; (C) anal intubation with A. hydrophila and intravenous injection with rgcIL-1b pAb; (D) anal intubation with A. hydrophila and intravenous injection with normal mouse serum. Positive signals for gcIL-1b were detected in the cytoplasm of mucosal epithelial cells (indicated by arrows) and neutrophils that resided in the intestinal submucosa (white solid arrows) and muscular layer (black solid arrows). Scale bars in all panels are 100 mm.

Asp100-Ser101 in sea bass IL-1b, where, as shown in Fig. 3, all aligned fish IL-1bs have a phylogenetically conserved aspartic acid residue. In this case, the gcIL-1b precursor should be cleaved at Asp125Gln126 to generate a 16.0-kDa mature, biologically active protein. However, the results of the current study do not support this interpretation. In contrast, the western blot detected a band of ~20 kDa, which coincides with the size of the mature IL-1b when cleaved at Asn91-Ile92, a position that corresponds to the zebrafish cleavage site Asp88-Met89. One possible explanation for this is that the ICE enzyme is not always required for the maturation of IL-1b [43]. On the other hand, this result also suggests that aspartic acid residues are not completely conserved within the ICE cleavage sites in fish. It should be noted that, as in other fish and mammalian IL1bs [20,44], gcIL-1b also lacks a signal peptide and is a nonclassically secreted protein as predicted by the SecretomeP 2.0 Server online tool. It is presently believed that IL-1b is released from cells by a non-classical secretory pathway and functions as a proinflammatory cytokine [44]. LPS has been widely used as an endotoxin to induce the inflammatory response in almost all vertebrates. Several IL-1b gene expression patterns in various LPS-stimulated tissues have been identified in fish [9,12,14e18,45,46]. To investigate the role of grass carp IL-1b in the inflammatory response, we used LPS to induce in vivo inflammation in grass carp. The qPCR assay confirmed that gcIL-1b is constitutively expressed in all 11 tissues examined, with higher levels in the spleen, gill, head kidney, and trunk kidney. Moreover, its mRNA levels in the muscle, liver, intestine, skin, trunk kidney, head kidney, and gill were significantly up-regulated by LPS stimulation at 10 mg/fish. The highest gcIL-1b baseline expression was detected in the spleen, and its level did not change significantly after LPS treatment. These results were also supported by similar

observations in CIK cells at both the mRNA and protein levels in the current study. Our results suggest that gcIL-1b was quickly upregulated in immune sites (such as spleen, head kidney, and liver) and the most exposed tissues (such as skin, gill, and intestine). This finding is highly consistent with an earlier experimental observation demonstrating that sea bass IL-1b in leucocytes from head kidney, spleen, gill, and liver can be up-regulated by LPS [12]. Moreover, the baseline expression levels of gcIL-1b in various tissues measured in this study are in line with those observed in ayu [20]. However, these expression profiles are not in strict accordance with those reported in other fish [17,18]. The discrepancies in IL-1b expression profiles in different species likely are due to distinct immune cell systems, species variation, or differences in experimental systems. To investigate the role of the IL-1b gene in the immune response, various recombinant IL-1b proteins have been evaluated. To date, several studies have described the production of recombinant fish IL-1b, in either mature or precursor form, to perform functional analyses [18,20,46e50]. These studies confirmed that fish IL-1b, like mammalian IL-1b, plays critical roles in antibacterial and antiviral defense. For example, northern blot analysis confirmed that rainbow trout endogenous IL-1b expression was induced 1 h post-stimulation with recombinant mature IL-1b at a dose >10 ng/ml [48]. This result was further supported by transcriptome profiling of rainbow trout RTS-11 macrophage cells [50]. In common carp, DNA injection with plasmids containing IL-1b modulated macrophage functions and conferred enhanced resistance to A. hydrophila infection [51]. In another study, the putative mature peptide of yellowfin seabream IL-1b was generated by alignment with human IL-1b, and the recombinant IL-1b was found to induce transcription of endogenous IL-1b in a dose-dependent

594

Y.-X. Bo et al. / Fish & Shellfish Immunology 46 (2015) 584e595

heterogeneous mouse serum proteins may have mediated an additive effect on the proinflammatory response against A. hydrophila. It is unclear how these recombinant IL-1bs can function like their endogenous counterparts, as only mature IL-1b and not the pro-IL-1b can elicit immune functions [7,41,57]. One probable explanation is that when the recombinant IL-1b molecule is delivered by injection, minor tissue injury occurs at the injection site, resulting in generation of endogenous IL-1b in cells (such as activated macrophages) at the site of injury [58]. After processing by ICE, mature IL-1b together with caspase-1 is secreted by an unconventional secretion pathway to the extracellular space [25,38,58e60], where exogenous recombinant IL-1b is processed into active IL-1b to exert its biological activity. This explanation is supported by our observation that injection with PBS resulted in slight up-regulation of IL-1b and TNF-a. In conclusion, we isolated and characterized genomic DNA and full-length cDNA encoding a grass carp IL-1b and we profiled IL-1b expression patterns in various tissues. LPS stimulation induced significant up-regulation of IL-1b in immune sites and the most exposed tissues, indicating that IL-1b is involved in the inflammatory response. We demonstrated that recombinant IL-1b was able to significantly induce up-regulation of proinflammatory cytokines (IL-1b and TNF-a) or cytokine receptors (IL-1R2). The antibody raised against recombinant IL-1b was found to partially block A. hydrophila-induced intestinal inflammation. Acknowledgments This work was supported by grants from the Natural Science Foundation of Jiangsu (BK2011285) and the Basic Application Foundation of Suzhou (SYN201111). References Fig. 11. The time course of IL-1b, IL-1R2, and TNF-a mRNA expression levels in the intestine following different treatments. Fish were infected by anal intubation with A. hydrophila, A. hydrophila plus normal serum, or A. hydrophila plus rgcIL-1b pAb. The mRNA expression levels in the intestine were measured by qPCR at 1 h, 1 d, 3 d, and 7 d after treatment and normalized to b-actin expression levels. Different letters above bars indicate statistically significant differences (p < 0.05).

manner [18]. Recently, an antibody raised against recombinant ayu pro-IL-1b was also found to reduce monocyte/macrophage killing of Listonella anguillarum [20]. In the current study, we generated recombinant grass carp pro-IL-1b carrying a Trx tag, which has been verified to play a significant role in the intestinal inflammatory response. Collectively, these studies allowed us to conclude that all recombinant fish IL-1bs, whether in the mature or precursor form, exerted their biological activities in their respective fish species of origin. It has generally been recognized that endogenous IL-1b mRNA expression can be induced by treatment with exogenous recombinant IL-1b [48,52e54]. This is also supported by the current study, as treatment with rgcIL-1b induced the transcription of endogenous gcIL-1b. This induction is generally explained by the autostimulation mechanism [55,56]. In this study, a polyclonal antibody to rgcIL-1b was developed, and its specific binding to gcIL1b was demonstrated. Antibody neutralization of proinflammatory IL-1b suppressed the A. hydrophila-induced inflammatory response, and thus reduced IL-1b autostimulation and the resulting increases in IL-1b mRNA in CIK cells. In addition, we also observed that treatment with both A. hydrophila and normal mouse serum induced higher intestinal mRNA levels of IL-1b, TNF-a, and IL-1R2 than treatment with A. hydrophila alone. It is possible that the

[1] P.E. Auron, A.C. Webb, L.J. Rosenwasser, S.F. Mucci, A. Rich, S.M. Wolff, et al., Nucleotide sequence of human monocyte interleukin 1 precursor cDNA, Proc. Natl. Acad. Sci. U. S. A. 81 (1984) 7907e7911. [2] A. Zychlinsky, C. Fitting, J.M. Cavaillon, P.J. Sansonetti, Interleukin 1 is released by murine macrophages during apoptosis induced by Shigella flexneri, J. Clin. Invest 94 (3) (1994) 1328e1332. [3] C. Gabay, C. Lamacchia, G. Palmer, IL-1 pathways in inflammation and human diseases, Nat. Rev. Rheumatol. 6 (4) (2010) 232e241. [4] C. Orelio, E. Haak, M. Peeters, E. Dzierzak, Interleukin-1-mediated hematopoietic cell regulation in the aorta-gonad-mesonephros region of the mouse embryo, Blood 112 (13) (2008) 4895e4904. [5] F. Martinon, K. Burns, J. Tschopp, The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-b, Mol. Cell 10 (2) (2002) 417e426. [6] N.V. Ogryzko, S.A. Renshaw, H.L. Wilson, The IL-1 family in fish: swimming through the muddy waters of inflammasome evolution, Dev. Comp. Immunol. 46 (1) (2014) 53e62. [7] M. McAlindon, C. Hawkey, Y. Mahida, Expression of interleukin 1b and interleukin 1b converting enzyme by intestinal macrophages in health and inflammatory bowel disease, Gut 42 (2) (1998) 214e219. [8] M. Aguilera, T. Darby, S. Melgar, The complex role of inflammasomes in the pathogenesis of inflammatory bowel diseases e lessons learned from experimental models, Cytokine Growth Factor Rev. 25 (6) (2014) 715e730. [9] J. Zou, P.S. Grabowski, C. Cunningham, C.J. Secombes, Molecular cloning of interleukin-1b from rainbow trout Oncorhynchus mykiss reveals no evidence of an ICE cut site, Cytokine 11 (1999) 552e560. [10] L. Grayfer, M. Belosevic, Cytokine regulation of teleost inflammatory responses, in: H. Türker (Ed.), New Advances and Contributions to Fish Biology, InTech, Croatia, 2012, pp. 59e96. [11] K. Fujiki, D.H. Shin, M. Nakao, T. Yano, Molecular cloning and expression analysis of carp (Cyprinus carpio) interleukin-1b, high affinity immunoglobulin E Fc receptor g subunit and serum amyloid A, Fish. Shellfish Immunol. 10 (2000) 229e242. [12] G. Scapigliati, F. Buonocore, S. Bird, J. Zou, P. Pelegrin, C. Falasca, et al., Phylogeny of cytokines: molecular cloning and expression analysis of sea bass Dicentrarchus labrax interleukin-1b, Fish. Shellfish Immunol. 11 (8) (2001) 711e726. [13] H.C. Ingerslev, C. Cunningham, H.I. Wergeland, Cloning and expression of TNFa, IL-1b and COX-2 in an anadromous and landlocked strain of atlantic salmon (Salmo salar L.) during the smolting period, Fish. Shellfish Immunol. 20 (4)

Y.-X. Bo et al. / Fish & Shellfish Immunology 46 (2015) 584e595 (2006) 450e461. [14] Y.P. Wang, Q. Wang, P. Baoprasertkul, E. Peatman, Z.J. Liu, Genomic organization, gene duplication, and expression analysis of interleukin-1b in channel catfish (Ictalurus punctatus), Mol. Immunol. 43 (2006) 1653e1664. [15] D.S. Lee, S.H. Hong, H.J. Lee, L.J. Jun, J.K. Chung, K.H. Kim, et al., Molecular cDNA cloning and analysis of the organization and expression of the IL-1b gene in the nile tilapia, Oreochromis niloticus, Comp. Biochem. Physiol. 143 (2006) 307e314. [16] M. Seppola, A.N. Larsen, K. Steiro, B. Robertsen, I. Jensen, Characterisation and expression analysis of the interleukin genes, IL-1b, IL-8 and IL-10, in atlantic cod (Gadus morhua L.), Mol. Immunol. 45 (4) (2008) 887e897. [17] D. Lu, J. Bei, L. Feng, Y. Zhang, X. Liu, L. Wang, et al., Interleukin-1b gene in orange-spotted grouper, Epinephelus coioides: molecular cloning, expression, biological activities and signal transduction, Mol. Immunol. 45 (2008) 857e867. [18] S. Jiang, D. Zhang, J. Li, Z. Liu, Molecular characterization, recombinant expression and bioactivity analysis of the interleukin-1b from the yellowfin sea bream, Acanthopagrus latus (Houttuyn), Fish. Shellfish Immunol. 24 (2008) 323e336. [19] Y.Y. Liu, S.S. Yu, Y.M. Chai, Q.X. Zhang, H. Yang, Q. Zhu, Lipopolysaccharideinduced gene expression of interleukin-1 receptor-associated kinase 4 and interleukin-1b in roughskin sculpin (Trachidermus fasciatus), Fish. Shellfish Immunol. 33 (4) (2012) 690e698. [20] X. Lu, J. Chen, Y. He, Y. Shi, Molecular characterization of an IL-1b gene from ayu, Plecoglossus altivelis, Fish. Shellfish Immunol. 34 (2013) 1253e1259. [21] I. Lepen Plei
c, C.J. Secombes, S. Bird, I. Mladineo, Characterization of three proinflammatory cytokines, TNFa1, TNFa2 and IL-1b, in cage-reared Atlantic bluefin tuna Thunnus thynnus, Fish. Shellfish Immunol. 36 (1) (2014) 98e112. [22] S. Bird, T. Wang, J. Zou, C. Cunningham, C.J. Secombes, The first cytokine sequence within cartilaginous fish: IL-1b in the small spotted catshark (Scyliorhinus canicula), J. Immunol. 168 (2002) 3329e3340. [23] J. Watzke, K. Schirmer, S. Scholz, Bacterial lipopolysaccharides induce genes involved in the innate immune response in embryos of the zebrafish (Danio rerio), Fish. Shellfish Immunol. 23 (4) (2007) 901e905. [24] R.N. Morrison, N.D. Young, B.F. Nowak, Description of an Atlantic salmon (Salmo salar L.) type II interleukin-1 receptor cDNA and analysis of interleukin-1 receptor expression in amoebic gill disease-affected fish, Fish. Shellfish Immunol. 32 (6) (2012) 1185e1190. [25] L.N. Vojtech, N. Scharping, J.C. Woodson, J.D. Hansen, Roles of inflammatory caspases during processing of zebrafish interleukin-1b in Francisella noatunensis infection, Infect. Immun. 80 (8) (2012) 2878e2885. [26] R.N. Morrison, J. Zou, C.J. Secombes, G. Scapigliati, M.B. Adams, B.F. Nowak, Molecular cloning and expression analysis of tumour necrosis factor-a in amoebic gill disease (AGD)-affected Atlantic salmon (Salmo salar L.), Fish. Shellfish Immunol. 23 (5) (2007) 1015e1031. [27] E. Faliex, C. Da Silva, G. Simon, P. Sasal, Dynamic expression of immune response genes in the sea bass, Dicentrarchus labrax, experimentally infected with the monogenean Diplectanum aequans, Fish. Shellfish Immunol. 24 (6) (2008) 759e767. [28] X. Liu, X. Chang, H. Wu, J. Xiao, Y. Gao, Y. Zhang, Role of intestinal inflammation in predisposition of Edwardsiella tarda infection in zebrafish (Danio rerio), Fish. Shellfish Immunol. 41 (2) (2014) 271e278. [29] X. Mu, J.W. Pridgeon, P.H. Klesius, Comparative transcriptional analysis reveals distinct expression patterns of channel catfish genes after the first infection and re-infection with Aeromonas hydrophila, Fish. Shellfish Immunol. 35 (5) (2013) 1566e1576. [30] X.H. Song, J. Zhao, Y.X. Bo, Z.J. Liu, K. Wu, C.L. Gong, Aeromonas hydrophila induces intestinal inflammation in grass carp (Ctenopharyngodon idella): an experimental model, Aquaculture 434 (2014) 171e178. [31] A. Zhang, D. Chen, H. Wei, L. Du, T. Zhao, X. Wang, et al., Functional characterization of TNF-a in grass carp head kidney leukocytes: induction and involvement in the regulation of NF-kB signaling, Fish. Shellfish Immunol. 33 (5) (2012) 1123e1132. [32] T.T. Wang, X.H. Song, G.M. Bao, L.X. Zhao, X. Yu, J. Zhao, Molecular characterization, expression analysis, and biological effects of interleukin-8 in grass carp Ctenopharyngodon idellus, Fish. Shellfish Immunol. 35 (5) (2013) 1421e1432. [33] L. Du, L. Qin, X. Wang, A. Zhang, H. Wei, H. Zhou, Characterization of grass carp (Ctenopharyngodon idella) IL-17D: molecular cloning, functional implication and signal transduction, Dev. Comp. Immunol. 42 (2) (2014) 220e228. [34] F. Yao, X. Yang, X. Wang, H. Wei, A. Zhang, H. Zhou, Molecular and functional characterization of an IL-1b receptor antagonist in grass carp (Ctenopharyngodon idella), Dev. Comp. Immunol. 49 (2) (2015) 207e216. [35] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCT Method, Methods 25 (4) (2001) 402e408. [36] T. Wang, S. Bird, A. Koussounadis, J.W. Holland, A. Carrington, J. Zou, et al., Identification of a novel IL-1 cytokine family member in teleost fish,

595

J. Immunol. 183 (2) (2009) 962e974. [37] J.T. Soller, H. Murua-Escobar, S. Willenbrock, M. Janssen, N. Eberle, J. Bullerdiek, et al., Comparison of the human and canine cytokines IL-1(a/b) and TNF-a to orthologous other mammalians, J. Hered. 98 (5) (2007) 485e490. [38] G.C. Higgins, J.L. Foster, A.E. Postlethwaite, Interleukin 1 b propeptide is detected intracellularly and extracellularly when human monocytes are stimulated with LPS in vitro, J. Exp. Med. 180 (2) (1994) 607e614. [39] A.D. Howard, M.J. Kostura, N. Thornberry, G.J. Ding, G. Limjuco, J. Weidner, et al., IL-1-converting enzyme requires aspartic acid residues for processing of the IL-1b precursor at two distinct sites and does not cleave 31-kDa IL-1a, J. Immunol. 147 (9) (1991) 2964e2969.
pez-Castejo
n, M.P. Sepulcre, I. Mulero, P. Pelegrín, J. Meseguer, V. Mulero, [40] G. Lo Molecular and functional characterization of gilthead seabream Sparus aurata caspase-1: the first identification of an inflammatory caspase in fish, Mol. Immunol. 45 (1) (2008) 49e57. [41] M.I. Reis, A. do Vale, P.J. Pereira, J.E. Azevedo, N.M. Dos Santos, Caspase-1 and IL-1b processing in a teleost fish, PLoS One 7 (11) (2012) e50450. [42] M.D. Wewers, H.A. Dare, A.V. Winnard, J.M. Parker, D.K. Miller, IL-1b-converting enzyme (ICE) is present and functional in human alveolar macrophages: macrophage IL-1b release limitation is ICE independent, J. Immunol. 159 (12) (1997) 5964e5972. [43] M. Lamkanfi, Emerging inflammasome effector mechanisms, Nat. Rev. Immunol. 11 (3) (2011) 213e220. [44] J.E. Sims, D.E. Smith, The IL-1 family: regulators of immunity, Nat. Rev. Immunol. 10 (2010) 89e102. [45] M.Y. Engelsma, R.J. Stet, J.P. Saeij, B.M. Verburg-van Kemenade, Differential expression and haplotypic variation of two interleukin-1b genes in the common carp (Cyprinus carpio L.), Cytokine 22 (1e2) (2003) 21e32. [46] F. Buonocore, M. Forlenza, E. Randelli, S. Benedetti, P. Bossù, S. Meloni, et al., Biological activity of sea bass (Dicentrarchus labrax L.) recombinant interleukin-1b, Mar. Biotechnol. 7 (2005) 609e617.
rez, J. Zou, C.J. Secombes, The effect of [47] S. Hong, S. Peddie, J.J. Campos-Pe intraperitoneally administered recombinant IL-1b on immune parameters and resistance to Aeromonas salmonicida in the rainbow trout (Oncorhynchus mykiss), Dev. Comp. Immunol. 27 (9) (2003) 801e812. [48] S. Hong, J. Zou, M. Crampe, S. Peddie, G. Scapigliati, N. Bols, et al., The production and bioactivity of rainbow trout (Oncorhynchus mykiss) recombinant IL-1b, Vet. Immunol. Immunopathol. 81 (1e2) (2001) 1e14. [49] S. Peddie, J. Zou, C. Cunningham, C.J. Secombes, Rainbow trout (Oncorhynchus mykiss) recombinant IL-1b and derived peptides induce migration of headkidney leucocytes in vitro, Fish. Shellfish Immunol. 11 (8) (2001) 697e709. [50] S.A. Martin, J. Zou, D.F. Houlihan, C.J. Secombes, Directional responses following recombinant cytokine stimulation of rainbow trout (Oncorhynchus mykiss) RTS-11 macrophage cells as revealed by transcriptome profiling, BMC Genomics 8 (2007) 150. [51] T. Kono, K. Fujiki, M. Nakao, T. Yano, M. Endo, M. Sakai, The immune responses of common carp, Cyprinus carpio L., injected with carp interleukin-1b gene, J. Interferon Cytokine Res. 22 (4) (2002) 413e419. [52] S.J. Warner, K.R. Auger, P. Libby, Interleukin 1 induces interleukin 1. II. Recombinant human interleukin 1 induces interleukin 1 production by adult human vascular endothelial cells, J. Immunol. 139 (6) (1987) 1911e1917. [53] M. Yamato, Y. Tamura, A. Eguchi, S. Kume, Y. Miyashige, M. Nakano, et al., Brain interleukin-1b and the intrinsic receptor antagonist control peripheral toll-like receptor 3-mediated suppression of spontaneous activity in rats, PLoS One 9 (3) (2014) e90950. [54] S.C. Hopp, S. Royer, H.M. Brothers, R.M. Kaercher, H. D'Angelo, I. Bardou, et al., Age-associated alterations in the time-dependent profile of pro- and antiinflammatory proteins within the hippocampus in response to acute exposure to interleukin-1b, J. Neuroimmunol. 267 (1e2) (2014) 86e91.
s Costa, C. Gerhardinger, IL-1b is upregulated in the diabetic [55] Y. Liu, M. Biarne retina and retinal vessels: cell-specific effect of high glucose and IL-1b autostimulation, PLoS One 7 (5) (2012) e36949. € ni-Schnetzler, J. Thorne, G. Parnaud, L. Marselli, J.A. Ehses, J. Kerr-Conte, [56] M. Bo et al., Increased interleukin (IL)-1b messenger ribonucleic acid expression in b-cells of individuals with type 2 diabetes and regulation of IL-1b in human islets by glucose and autostimulation, J. Clin. Endocrinol. Metab. 93 (10) (2008) 4065e4074. [57] N.A. Thornberry, H.G. Bull, J.R. Calaycay, K.T. Chapman, A.D. Howard, M.J. Kostura, et al., A novel heterodimeric cysteine protease is required for interleukin-1b processing in monocytes, Nature 356 (6372) (1992) 768e774. [58] T. Liu, Y. Yamaguchi, Y. Shirasaki, K. Shikada, M. Yamagishi, K. Hoshino, et al., Single-cell imaging of caspase-1 dynamics reveals an all-or-none inflammasome signaling response, Cell Rep. 8 (4) (2014) 974e982. [59] K. Schroder, J. Tschopp, The inflammasomes, Cell 140 (6) (2010) 821e832. [60] B. Siegmund, Interleukin-1b converting enzyme (caspase-1) in intestinal inflammation, Biochem. Pharmacol. 64 (1) (2002) 1e8.