Characterization of microsatellite markers to diagnose ADPKD

Molecular and Cellular Probes 18 (2004) 155–159 www.elsevier.com/locate/ymcpr

Characterization of microsatellite markers to diagnose ADPKD Yoonhee Baea, Hyunho Kima, Myoah Paika, Junggeon Leeb, Daeyeon Hwangb, Younghwan Hwangb, Curie Ahnb, Seongman Kanga,* a

Graduate School of Biotechnology, Korea University, Seoul 136-701, South Korea b College of Medicine, Seoul National University, Seoul 110-744, South Korea Received 27 May 2003; accepted for publication 1 December 2003

Abstract Autosomal dominant polycystic kidney disease (ADPKD) maps to chromosome 16p13.3 (PKD1) and to chromosome 4q21-23 (PKD2), with the likelihood of a third unmapped locus. The size and genomic complexity of the PKD1 gene make it impractical to detect mutations for prenatal diagnosis. Therefore, pedigree-based linkage analysis remains useful for diagnosis of ADPKD. Since, the complete genome sequences of chromosome 16p13.3 and 4q21-23 including PKD1 and PKD2, respectively, were reported very recently, in order to do more precise diagnosis of ADPKD, we tried to find microsatellite markers. We performed database searches of 2000 kb of genome sequence across the 16p13.3 and the 4q21-23. To determine the distribution of alleles and the degree of polymorphism of the microsatellites, genotyping experiments were performed on 48 Korean individuals. We found novel 14 microsatellite markers around ADPKD that are more polymorphic and closer to PKD1 or PKD2 than the known markers. The novel microsatellite markers were applied to diagnose ADPKD families. These novel microsatellite markers are not only useful for presymptomatic and prenatal diagnosis of ADPKD, but also applicable in the study of positional cloning, human evolution and tumor biology. q 2003 Elsevier Ltd. All rights reserved. Keywords: Autosomal dominant polycystic kidney disease; Microsatellite marker; PKD1; PKD2; Heterozygosity

1. Introduction Autosomal dominant polycystic kidney disease (ADPKD) is one of the most common inherited diseases in humans; it is estimated to affect 1 in 1000 of the population [1]. Renal cysts are the major clinical features of the disease and appear to increase in size and number throughout the lifetime of an individual. This process results in renal failure in approximately half of the affected individuals by age 50 [2 – 4]. Although, the renal lesion is the most prominent feature, ADPKD is a systemic disorder with a variety of other manifestations including liver cysts, cerebral aneurysms, and cardiac valvular abnormalities [5,6]. Linkage studies have determined that there are at least three forms of ADPKD [7,8]. PKD1, which is most common and accounts for 85% of all cases, maps to chromosome 16p13.3. The second type, PKD2, which affects most of the remaining families, maps to chromosome 4q21-23. A small number of families have another form, which has not yet * Corresponding author. Tel.: þ 82-2-3290-3448; fax: þ82-2-927-9028. E-mail address: [email protected] (S. Kang). 0890-8508/$ - see front matter q 2003 Elsevier Ltd. All rights reserved. doi:10.1016/j.mcp.2003.12.001

been mapped [9]. Although, all types of ADPKD present with an identical profile of extrarenal manifestations (including liver cysts and aneurysms), PKD1 is the most severe, with a lower median survival and a higher risk of progressing to end-stage renal disease. PKD1 encodes a 14 kb mRNA that is transcribed from approximately 50 kb of genomic DNA. The PKD1 gene product, polycystin-1, is 4302 amino acids in length and is likely to be an integral membrane glycoprotein that regulates cell –cell or cell – matrix interactions. PKD2 encodes a 2.9 kb mRNA and shows about 25% identity and 50% similarity with the translation product of PKD2, polycystin-2, and about 450 amino acids of polycystin-1 [10]. ADPKD has clinically been diagnosed by determining the presence of renal cysts by ultrasonography and computed tomography of the kidneys [11]. However, clinical diagnosis may occur after the growth of renal cysts and does not determine whether a patient has a PKD1 or PKD2 mutation. Moreover, the direct mutation analysis of ADPKD genes is complicated because PKD1 contains a 12,906 bp coding sequence and the 50 region of the gene,

156

Y. Bae et al. / Molecular and Cellular Probes 18 (2004) 155–159

from upstream of exon1 to exon33, is embedded in a complex genomic area repeated more than four times on the same chromosome. Therefore, pedigree-based linkage analysis is useful for diagnosis of ADPKD. Microsatellite markers that are characterized by high levels of heterozygosity (HET) and by the number of alleles provide ideal tools for pedigree-based linkage analysis [12]. Based on the recently available genomic sequences of chromosome 16p13.3 and 4q21-23 which include the PKD1 and PKD2 genes, respectively, we developed microsatellite markers in both loci. These markers should be useful for ADPKD diagnosis.

2. Materials and methods 2.1. Genomic DNAs To investigate length variants of microsatellites, genomic DNAs were obtained from blood samples from 48 healthy Korean adults during the annual health check-up in the Korean Institute of Tuberculosis. DNA was extracted according to the recommendations of the manufacturer using the QIAamp blood Kit (Qiagen) and the concentrations were measured by UV spectrophotometry. Members of a two generation family consisting of a parent and five children (Fig. 4) were diagnosed by ultrasonography in the College of Medicine, Seoul National University, Seoul, Korea. The clinical diagnosis of ADPKD was determined by the presence of several renal cysts distributed between both kidneys.

dCTP, 1 mi of 32PdCTP, 0.5 U of Taq polymerase (Promega), and 2 pmol of each primer. PCR amplification was performed with a TaKaRa PCR Thermal cycle MP under the following conditions; 95 8C for 5 min, then 30 cycles of denaturation at 95 8C for 1 min, annealing for 1 min at temperature in Tables 1 and 2, and extension at 72 8C for 10 min. 2.3. Microsatellite genotyping Microsatellite genotyping was carried out as described previously [13]. Polymorphic microsatellite markers were amplified using the PCR. The PCR products were mixed with an equal volume of a loading buffer (95% formamide, 20 mM EDTA, 0.05% bromophenol blue, 0.05% xylene cyanol), heated to 95 8C for 5 min and were then chilled on ice. The PCR products were separated by electrophoresis on 6% denaturing polyacrylamide gel (5 M urea). After the electrophoresis was performed, the gels were vacuum-dried and exposed to a film (Kodak BioMax MR) with intensifying screens at 2 70 8C. 2.4. Statistics For informativeness of the markers, the HET and polymorphism information content (PIC) values were calculated according to the formulas below HET ¼ 1 2

X

p2i

where pi is the frequency of the ith allele 2.2. Polymerase chain reaction amplification Genomic DNA (20 ng) was used as a template for Polymerase chain reaction (PCR) in a final volume of 20 ml containing 10 mM Tris-Cl (pH 9.0), 50 mM KCl, 1.5 mM MgCl2, 200 mM each of dATP, dGTP, dTTP and 20 mM

PIC ¼ 1 2

X 2 XX 2 2 2pi pj pi 2

where pi is the frequency of the ith allele, and pi is the frequency of the jth ðj ¼ i þ 1Þ allele.

Table 1 Characterization of novel microsatellite markers in chromosome 16p13.3 Locus

Primer sequence 50 ! 30

Repeat Sequence

MGPKD1-2

GAAAGGATATCGCTTGAACCGT CTAAATTCTGAGCAGAGC CTAAGTCTGGCACGGCCTTCAA GAAGACACTCCTTCATCC AAAGCCCCTCCTTGAATTACCCA GGCAGCTCTGAAAGTGG GAGAAGCGCTTTCTGAGTCGCA CCTTAACCTTTCCTCCAG GCAACCTCAACCTCCCAAACTAG GAAGATTGCTTGAGTGC CACCAAAGCCCTAAAGTAGCATC CATGGATGGGTTTGGAG AAGAGGAACACCTCTAGAAGTC TCACACAAATGCAGGCAG

(CA)n

MGPKD1-3 MGPKD1-5 MGPKD1-6 MGPKD1-7 MGPKD1-8 MGPKD1-10

Allele (n)

Anneal Temp (8C)

HET

PIC

6

58

0.6701

0.5794

(CA)n

9

52

0.7061

0.6273

(CA)n

5

55

0.5213

0.4233

(CA)n

13

50

0.8934

0.7934

(CA)n

7

55

0.7842

0.7404

(CA)n

6

55

0.7062

0.6962

(CA)n

9

52

0.8525

0.8496

Y. Bae et al. / Molecular and Cellular Probes 18 (2004) 155–159

157

Table 2 Characterization of novel microsatellite markers in chromosome 4q21-23 Locus

Primer sequence 50 ! 30

Repeat Sequence

Allele ðnÞ

Anneal Temp (8C)

HET

PIC

MGPKD2-1

ACAGGTGTAGAATGCTCATG CTAGCCAGGCACAATGGTGC GTACCGAGAGATGTCGGACT GATCTCCTCGAGTTGTCTCT CGTCATTAAGTGTGTGTCCG GCTGTTAAACTGTCGTAGTG CAGAAATCTAAAGAGGACCG ACCACCCTGGCCAATATAAC GGCGGATATCCCATAGTCAC GACTGTAGTACATCGTGCGT CATCTCCGGTTCAAAACGGT GACCTGTCTCTTCGTACACC CTGGAGTCTGAAGTGCAGTG CTCATGCCAGTGATCTCAGC

(CA)n

3

55

0.3741

0.3214

(AG)n (AT)n

6

55

0.6887

0.6142

(CA)n

3

55

0.3213

0.3021

(AG)n (CA)n

5

55

0.6514

0.5682

(CA)n

6

55

0.7014

0.6273

(AAAC)n

6

55

0.7573

0.7016

(CA)n

6

62

0.7064

0.6782

MGPKD2-2 MGPKD2-3 MGPKD2-4 MGPKD2-6 MGPKD2-7 MGPKD2-10

3. Results In order to find polymorphic microsatellites in the close proximity to PKD1 or PKD2, we performed database searches of 2000 kb of genome sequence (from contig NT_03788 to NT_01055; http://www.ncbi.gov/genome/seq. cgi) across 16p13.3 where PKD1 is located and 560 kb of genome sequence (contig NT_006204; http://www.ncbi. gov/genome/seq.cgi) across 4q21-23 where PKD2 is located. A number of dinucleotide or tetranucleotide repeats were found, and 19 microsatellites that contain more than 13 contiguous repeats were chosen for further investigation. Genotyping experiments were performed on 48 Korean individuals. The distribution of alleles and the degree of polymorphisms was identified through PCR experiments and subsequent 6% denaturing polyacrylamide gel electrophoresis. Two of these microsatellites, MGPKD1-6 from PKD1 locus and MGPKD2-7 from PKD2 locus, are shown in Fig. 1. Nineteen microsatellites were investigated for polymorphisms in 96 chromosomes. Fourteen microsatellites were polymorphic for a variable number of dinucleotide or tetranucleotide repeats and five were monomorphic. To determine the informativeness of the markers, the HET and PIC values (Tables 1 and 2) were calculated as described in Section 2. In addition, Tables 1 and 2 show optimum temperature for the amplification of each marker. Most of the markers are composed of CA repeats and the HET scores and the number of alleles ranged from 0.3213 to 0.8934 and 3 to 13, respectively. A greater number of highly polymorphic microsatellites occur in the PKD1 locus (Table 1) than in the PKD2 locus (Table 2). It is interesting that MGPKD2-7 is highly polymorphic (0.7573) in contrast to the general view that tetranucleotide repeats are less polymorphic than dinucleotide repeats. We constructed a physical map of the fourteen microsatellite markers across the chromosome 16p13.3 or

4q21-23 regions and the physical distance from PKD1 (Fig. 2) and PKD2 (Fig. 3) to each microsatellite marker was measured. MGPKD2-2, which consists of (AG)n(AT)n, occurs in the intron of PKD2 gene. We could not find a microsatellite marker within the PKD1 gene that has more than 13 di- or tetranucleotide repeats. To demonstrate whether these novel microsatellite markers could be applied to diagnosis of an ADPKD family we constructed a pedigree of an ADPKD family of unknown type and performed a genotyping experiment using microsatellite markers, MGPKD1-7 and MGPKD1-3 (Fig. 4).

Fig. 1. Genotyping of novel microsatellite markers. Genomic DNAs were amplified with primers (Tables 1 and 2) using the polymerase chain reaction and genotyped on 6% denaturing polyacrylamide gels (5 M urea). MGPKD1-6 and MGPKD2-7 are located in the PKD1 and PKD2 locus, respectively.

158

Y. Bae et al. / Molecular and Cellular Probes 18 (2004) 155–159

Fig. 2. A map of the new microsatellite markers along chromosome 16p13.3. The distance between the markers and the PKD1 gene is shown on the right.

Fig. 3. A map of the new microsatellite markers along chromosome 4q21-23. The distance between the markers and the PKD2 gene is shown on the right. MGPKD2-2 occurs in the intron of PKD2 gene.

Y. Bae et al. / Molecular and Cellular Probes 18 (2004) 155–159

159

studies. The microsatellites reported here may be useful for genetic linkage and evolutionary studies, in general, but especially for presymptomatic diagnosis of ADPKD.

Acknowledgements This work was supported in part by a grant of the Ministry of Health and Welfare, Republic of Korea (02-PJ1PG3-21001-0014) and by a grant of the Korea University. Fig. 4. Application of MGPKD1-7 and MGPKD1-3 as diagnotic markers. A pedigree of an ADPKD family of unknown type. I-2, II-1, II-2, and II-5 are affected individuals. Genotyping results using microsatellite markers, MGPKD1-7 and MGPKD1-3, are numbered according to the allele scored.

The results show that allele 1 of MGPKD1-7 and allele 2 of MGPKD1-3 from PKD1 is linked to ADPKD in this family. However, the microsatellite markers in PKD2 locus did not show linkage with ADPKD (data not shown). The data indicates that individuals II-3 and II-4 will not develop ADPKD in the future.

4. Discussion In this study, we characterized fourteen microsatellite markers that are located in the PKD1 and PKD2 loci. Because presymptomatic clinical diagnosis of ADPKD is limited molecular diagnosis is in strong demand [11]. Genetic analysis can be performed using two different approaches: direct investigation of the disease-causing mutation or indirect diagnosis by linkage analysis using linked DNA markers. Mutation detection in the PKD1 gene is complicated by the fact that it is a very large gene with all but 3.5 kb repeated proximally on the same chromosome. Further, there are no reported hot spots for mutation [7,8]. Indirect diagnosis has been performed using linkage analysis with the known microsatellite markers, D16S521, D16S3070, D16S475, D16S521, D16S510, D4S1542, D4S1563, and D4S2460. These are located far from the PKD1 and PKD2 thus increase the possibility of recombination between the marker and the gene. The eightmicrosatellite markers reported here are closer to both PKD1 and PKD2 and should be better for linkage analysis. They also demonstrate high HET. MGPKD1-3 and MGPKD2-2 are the closest microsatellite markers to PKD1 and PKD2, respectively, among those known at the present. MGPKD2-2 is located in the intron of PKD2 and MGPKD1-3 is located 484 kb from PKD1 D16S3070, which has, until now, been the closest marker among the PKD1 microsatellites, and is located 665 kb from the gene. Microsatellite markers developed for linkage analysis have become standard markers for the physical mapping of the human genome and are valuable tools for genetic

References [1] Lieske JC, Toback FG. Autosomal dominant polycystic kidney disease. J Am Soc Nephrol 1993;3:1442–50. [2] Gabow PA, Johnson AM, Kaehny WD, Kimberling WJ, Lezotte DC, Duley IT, Jones RH. Factors affecting the progression of renal disease in autosomal-dominant polycystic kidney disease. Kidney Int 1992; 41:1311–9. [3] Devuyst O. Variable renal disease progression in autosomal dominant polycystic kidney disease: a role for nitric oxide? J Nephrol 2003; 16(3):449– 52. [4] Qian F, Watnick TJ, Onuchic LF, Germino GG. The molecular basis of focal cyst formation in human autosomal dominant polycystic kidney disease type I. Cell 1996;87:979– 87. [5] Gieteling EW, Rinkel GJ. Characteristics of intracranial aneurysms and subarachnoid haemorrhage in patients with polycystic kidney disease. J Neurol 2003;250(4):418 –23. [6] Rossetti S, Chauveau D, Kubly V, Slezak JM, Saggar-Malik AK, Pei Y, Ong AC, Stewart F, Watson ML, Bergstralh EJ, Winearls CG, Torres VE, Harris PC. Association of mutation position in polycystic kidney disease 1 (PKD1) gene and development of a vascular phenotype. Lancet 2003;361(9376):2196–201. [7] Ravine D, Walker RG, Gibson RN, Forrest SM, Richards RI, Friend K, Sheffield LJ, Kincaid-Smith P, Danks DM. Phenotype and genotype heterogeneity in autosomal dominant polycystic kidney disease. Lancet 1992;340:1330–3. [8] Constantinou-Deltas CD, Papageorgiou E, Boteva K, Christodoulou K, Breuning MH, Peter DJ, Pierides A. Genetic heterogeneity in adult dominant polycystic kidney disease in Cypriot families. Hum Genet 1995;95:416 –23. [9] Daoust MC, Reynolds DM, Bichet DG, Somlo S. Evidence for a third genetic locus for autosomal dominant polycystic kidney disease. Genomics 1995;25:733– 6. [10] Mochizuki T, Wu G, Hayashi T, Stavroulla L, Xenophontons X, Veldhuisen B, Saris JJ, Reynolds DM, Cai Y, Gabow PA, Pierides A, Kimberling WJ, Martijn H, Breuning C, Deltas C, Peters DJM, Somlo S. PKD2, a Gene for polycystic kidney disease that encodes an integral membrane protein. Science 1996;272:1339– 42. [11] Parfrey PS, Bear JC, Morgan J, Cramer BC, McManamon PJ, Gault MH, Churchill DN, Singh M, Hewitt R, Somlo S. The diagnosis and prognosis of autosomal dominant polycystic kidney disease. N Engl J Med 1990;323:1085–90. [12] Francis PJ, Johnson S, Edmunds B, Kelsell RE, Sheridan E, Garrett C, Holder GE, Hunt DM, Moore AT. Genetic linkage analysis of a novel syndrome comprising North Carolina-like macular dystrophy and progressive sensorineural hearing loss. Br J Ophthalmol 2003;87(7): 893–8. [13] Bae Y, Kim H, Namgoong H, Baek M, Lee J, Hwang D, Hwang Y, Ahn C, Kang S. Characterization of microsatellite markers adjacent to AP-4 on chromosome 16p13.3. Mol Cell Probes 2001; 15:313–5.