Genetic markers in blue crabs (Callinectes sapidus) I: Isolation and characterization of microsatellite markers

Journal of Experimental Marine Biology and Ecology 319 (2005) 3 – 14 www.elsevier.com/locate/jembe

Genetic markers in blue crabs (Callinectes sapidus) I: Isolation and characterization of microsatellite markers Colin R. Stevena,T, Jessica Hillb, Brian Mastersb, Allen R. Placea a

Center of Marine Biotechnology, University of Maryland Biotechnology Institute, 701 East Pratt Street, Baltimore, MD 21202, United States b Department of Biological Sciences, Towson University, Baltimore, MD, United States Received 6 August 2003; received in revised form 2 February 2004; accepted 5 April 2004

Abstract Given the commercial and ecological importance of the dwindling Chesapeake Bay blue crab (Callinectes sapidus) fishery, there is a surprising scarcity of information concerning the molecular ecology of this species. The few studies published to date are based on allozyme data and indicate a single, panmictic population along the Atlantic coast. To address this shortcoming, we have initiated the development of genetic markers from both the nuclear and mitochondrial genomes of the blue crab. To this end, we performed two separate screenings of the blue crab nuclear genome using both dinucleotide and tetranucleotide repeat oligonucleotide probes and the highly efficient bFIASCOQ (Fast Isolation by AFLP of Sequences COntaining repeats) methodology. Our screenings produced 34 microsatellite loci. Genotyping of a captive-mated pair of blue crabs and 30 of their offspring at 10 of our isolated loci shows that eight loci are inherited in true Mendelian fashion, with two loci being monomorphic. Additionally, we genotyped 102 blue crab DNA samples collected from different parts of the Chesapeake Bay with the same 10 loci. The results of these screenings, including heterozygosities ranging between 0.26 and 0.97, indicate that a majority of the loci isolated in our screen will ultimately be useful markers for population genetic studies. The molecular tools described in this paper will be used, in tandem with differences in the blue crab mitochondrial genome [Place, A.R., Feng, X., Steven, C.R., Fourcade, H.M., Boore, J.L., 2005. Genetic markers in blue crabs (Callinectes sapidus) II: Complete mitochondrial DNA sequence and characterization of variation. J. Exp. Mar. Biol. Ecol. 319, 15–27], to investigate potential genetic substructure within the Chesapeake Bay and across the entire Atlantic Coast/Gulf Coast range of the blue crab, as well as monitor the results of restocking hatchery-reared crabs into the Bay. D 2005 Elsevier B.V. All rights reserved. Keywords: Allele frequency; Blue crab; Callinectes sapidus; FIASCO; Microsatellite; PCR

Abbreviations: 6-FAM, 6-carboxyfluorescein; AFLP, amplified fragment length polymorphism; ARC-II, Aquaculture Research Center II; COMB, Center of Marine Biotechnology; DNA, deoxyribonucleic acid; dNTP, deoxynucleotide triphosphate; EDTA, ethylenediaminetetraacetic acid; FIASCO, fast isolation by AFLP of sequences containing repeats; HEX, 6-carboxy-2V,4,4V,5V,7,7V-hexachlorofluorescein; MIH, molt-inhibiting hormone; MIH-SSR, molt-inhibiting hormone simple sequence repeat; mtDNA, mitochondrial deoxyribonucleic acid; PCR, polymerase chain reaction; SDS, sodium dodecyl sulfate; SSR, simple sequence repeat; VNTR, variable number of tandem repeats. T Corresponding author: Tel.: +1 410 234 8828; fax: +1 410 234 8896. E-mail address: [email protected] (C.R. Steven). 0022-0981/$ - see front matter D 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.jembe.2004.04.020

4

C.R. Steven et al. / J. Exp. Mar. Biol. Ecol. 319 (2005) 3–14

1. Introduction The blue crab (Callinectes sapidus) has historically supported one of the largest and most successful commercial and recreational fisheries in the Chesapeake Bay (Cronin, 1998; Rugolo et al., 1998). In recent years, record-low catches of blue crabs have prompted renewed interest in its biological and ecological characteristics. Genetic analysis of population structure in the blue crab has received surprisingly little attention, in view of the commercial and ecological importance of the species. Early studies of protein polymorphisms (allozymes) suggested similar gene frequencies in Chesapeake Bay and Chincoteague Bay populations, but differences between these populations and South Carolina (reviewed in Burton and Feldman, 1982). Heterozygote deficiencies in the Chesapeake Bay and Chincoteague Bay populations reported by Cole and Morgan (1978) may reflect the mixing of genetically differentiated subpopulations, but may also have been a technical artifact resulting from the mis-scoring of gels. McMillen-Jackson et al. (1994) presented a more thorough analysis of geographic variation in the blue crab, in which 750 individuals from 16 near-shore locations were scored for 31 presumptive loci. Significant heterogeneity in allelic frequencies was observed for several loci, but no large-scale geographic patterning was evident, with the exception of one locus (EST-2), which showed a latitudinal gradient in the Atlantic coast samples. Significant temporal variation (between-year and within-year) was also noted at this locus. Overall, the pattern reported by McMillen-Jackson et al. (1994) was one in which ballele frequencies varied significantly on range-wide and local scales, among and within collections, and among and within collecting years. Such a pattern is characteristic of genetic patchiness, which is a spatially and temporally chaotic distribution of heterogeneous allele frequencies in which local variation may be as great as long-distance variationQ (Johnson and Black, 1982). The authors suggest that, in blue crabs, the observed patchiness may be the result of single-generation sampling effects, localized selection, or genetic drift. Since the allozyme era, the advent of molecular techniques has revolutionized the field of population genetics. It is now possible to conduct population-

level surveys using various types of DNA markers, which collectively provide a more robust and reliable picture of population structure in a given species (Lu et al., 2001; Strecker et al., 2003). We have chosen a two-pronged approach to addressing questions of the molecular ecology of the blue crab. The first approach involves identifying variable sequences in the maternally inherited mitochondrial genome (see Place et al., 2005). Our second approach is to identify and examine nuclear microsatellite loci. Microsatellite markers consist of variable numbers of tandemly repeated (VNTRs) simple sequences interspersed throughout the genomes of all organisms (Avise, 1994). Typically microsatellite loci are highly polymorphic and evolve rapidly, making them ideal genetic markers (Balloux and Lugon-Moulin, 2002; Schlo¨tterer, 2000). Microsatellites are highly replicable and have a great ability to resolve genetic differences compared to other classes of genetic markers (Mueller and Wolfenbarger, 1999; Sunnucks, 2000). For these reasons, they are routinely used for forensic identification (Mukaida et al., 2000; Olaisen et al., 1997), pedigree analysis (Itokawa et al., 2003; McCouch et al., 1997), and population structure determination (Goldstein and Schlo¨tterer, 1999; Schlo¨tterer, 2000). We report here the identification of 34 microsatellite loci from the nuclear genome of the blue crab, as well as variation at a dinucleotide microsatellite locus located within the coding region of the gene encoding molt-inhibiting hormone (MIH; Lee et al., 1995).

2. Materials and methods 2.1. General All DNA samples were prepared from either walking leg muscle (adults) or whole animals (juveniles) using the FastDNA Kit (QBIOgene, Carlsbad, CA). 2.2. Microsatellite loci isolation Microsatellite loci were isolated from the genomic DNA of a single blue crab sampled from Chesapeake Bay in May 2002, using the method described in detail by Zane et al. (2002). Briefly, the ingenuity of

C.R. Steven et al. / J. Exp. Mar. Biol. Ecol. 319 (2005) 3–14

this method (FIASCO) lies in the combination of MseI restriction digestion of genomic DNA and ligation of AFLP-based oligonucleotide adaptors (MseI AFLP adaptor: 5V-TACTCAGGACTCAT-3V/ 5V-GACGATGAGTCCTGAG-3V) to the digested DNA followed by an initial round of enrichment PCR using adaptor-specific primers (MseI-N: 5VGATGAGTCCTGAGTAAN-3V, where N=either A, T, G, or C). DNA fragments flanked by MseI AFLP adaptors and containing repeats were isolated by denaturing 500 ng of primary PCR product in the presence of biotin-labeled oligonucleotide probes of known sequence at 95 8C for 3 min and allowing them to anneal for 15 min at room temperature. In our experiments, the dinucleotide probe consisted of 17 repeats of adenosine and cytosine [(AC)17], while the tetranucleotide probes were a mixture of equal parts of eight different repeat motifs [(AAAC)6, (AATC)6, (ACTC)6, (ACCT)6, (ACTG)6, (AAAG)6, (ACAG)6 and (AATG)6]. Recovery of the resulting complexes was accomplished with streptavidin-coated Dynabeads (Dynal Biotech, Lake Success, NY) in combination with a magnetic particle collector (MPC). Following three low-stringency washes (10 mM Tris–HCl, 1 mM EDTA, and 1 M NaCl) and three high-stringency washes (0.2 SSC, 0.1% SDS), two denaturation steps (Step 1=50 Al of 10 mM Tris–HCl, 1 mM EDTA, pH 8.0 (TE); Step 2=0.15 M NaOH) were performed to separate the DNA from the probes. The eluents of the final low- and high-stringency washes as well as the two denaturation steps were saved and used as templates for a secondary round of PCR enrichment using the MseI-N adaptor-specific primers. The secondary PCR products were TAcloned into the pCR4 vector using a TOPO-TA Cloning Kit (Invitrogen, Carlsbad, CA) and sequenced in both directions using the vector-specific primers M13 Forward and M13 Reverse with dGTP chemistry (ABI PRISMR dGTP BigDyek Terminator Cycle Sequencing Kit) on an ABI 377 DNA Sequencer (Applied Biosystems, Foster City, CA). dGTP chemistry was required to overcome sequencing difficulty posed by the presence of repeats. Once an insert was sequenced, repeats were identified using RepeatMasker (A.F.A. Smit and P. Green, unpublished data) software, and duplicate fragments removed from the pool. The cloned microsatellites were partitioned into three categories: perfect, imper-

5

fect, compound (perfect or imperfect), as defined by Weber (1990). Specific primers pairs were designed to the conserved regions flanking the identified repeats, with the forward primer labeled with a fluorescent dye (6-FAM, HEX, or TET) at the 5V end (Qiagen OPERON, Alameda, CA). 2.3. Microsatellite loci screening To determine the variability at the microsatellite loci we isolated, we genotyped two sets of blue crabs at 10 of our loci: CSC-001, CSC-004, CSC-007, CSC074, CSC-094, CSA-035, CSA-073, CSC-092, CSA121, and MIH-SSR (a dinucleotide repeat within the coding region of the molt-inhibiting hormone gene). The first set of animals consisted of 36 blue crabs sampled from the Rhode River in Maryland (n=13 individuals) and the York River in Virginia (n=23 individuals) waters of the Chesapeake Bay. The sex ratios of the two groups of sampled crabs were comparable: 73.9% (17/23) of the Maryland crabs were female, while 69.2% of the Virginia crabs were female. The Maryland crabs had an average carapace width of 15.3F0.44 cm, and ranged between 9.5 and 17.6 cm. The Virginia crabs had an average carapace width of 12.8F0.62 cm and ranged between 8.6 and 16.0 cm. The second set of crabs consisted of 50 mature females collected from the Rhode River in Maryland and 16 sponge females collected from the James River in Virginia. The last set of crabs consisted of a male and female blue crab pair, which were raised and mated entirely in captivity in the Aquaculture Research Center II (ARC-II) at the Center of Marine Biotechnology (COMB), and 30 of the offspring from the first brood that this female produced. The father was captured from the Rhode River and the mother was hatched and raised in captivity in ARC-II, and her mother was captured from the York River, Virginia. The offspring were sampled as juveniles; therefore, no sex could be determined for these animals. To determine the genotype of a crab, approximately 200 ng of total genomic DNA was used as template in a PCR with the microsatellite locusspecific primers designed above. The reactions consisted of 1.5 Al of 10 PCR Buffer (Promega, Madison, WI), 1 Al of 25 mM MgCl2, 3 Al of a 5 AM mixture of the locus-specific forward and reverse primers, 0.3 Al of a 10 mM mixture of all four dNTPs,

6

C.R. Steven et al. / J. Exp. Mar. Biol. Ecol. 319 (2005) 3–14

and 0.08 Al of 5 U/Al Taq polymerase (Promega, Madison, WI) and distilled H2O (dH2O) to a total volume of 15 Al. The forward primers were labeled with a fluorescent dye, 6-FAM (CSC-074, CSC-092, and CSC-094), HEX (CSC-004, CSA-035, CSA-073, and CSA-121), or TET (CSC-001, CSC-007, and MIH-SSR). PCR conditions were an initial denaturation step of 95 8C for 2 min, followed by 30 cycles of 95 8C for 1 min, 30 s at an experimentally determined optimal annealing temperature (Table 4), and 1 min at 70 8C, followed by a final elongation step of 30 min at 70 8C. The PCR products were then diluted 1:20 in dH2O, and 1 Al of this dilution was mixed with 12 Al of deionized formamide and 0.5 Al of GeneScan 500 TAMRA marker. This mixture was denatured at 95 8C for 5 min, cooled on ice for 5 min, and run on an ABI 310 Genetic Analyzer for 30 min at 60 8C and 15 kV. The resulting data were analyzed with GeneScan 3.1 software and scored with GenoTyper v2.1 software (Applied Biosystems, Foster City, CA). In some cases, DNA samples prepared from whole juvenile blue crabs contained some factor that inhibited PCR amplification. We confirmed that it was inhibition by spiking a bnon-amplifiableQ sample with DNA from a sample that had previously proven to amplify, and by observing no amplification. This inhibition was overcome by diluting the DNA template 10-fold to ~10 ng/Al. Statistical analysis of linkage disequilibrium, adherence of gene frequencies to Hardy–Weinberg proportions, and genic and genotypic population differentiation were performed with the GENEPOP software (http://wbiomed.curtin.edu.au/genepop; Raymond and Rousset, 1995). Markov chain parameters used were maintained at the software’s default values (dememorization=1000, batches=100, and iterations per batch=1000). Significance levels were set at Pb0.05.

3. Results Our nomenclature for blue crab microsatellite loci is based on convention in the field, and is set up as follows: the first two letters (CS) indicate the species from which these microsatellites are derived, C. sapidus. The third letter represents the repeat unit, which comprised the probe used to screen our library

(i.e., A=dinucleotide, B=trinucleotide, and C=tetranucleotide). Finally, the numerals simply represent the clone from which the sequence was derived. For example, CSC-094 represents a blue crab tetranucleotide microsatellite locus from clone no. 94. Allele sizes listed (Table 4) are representative of the PCR amplicon size resulting from our locus-specific primers. 3.1. Dinucleotide screen From the dinucleotide screen, we obtained complete and unambiguous (forward and reverse strand sequences matched 100%) sequences from a total of 19 amplicons, all but one of which (94.7%) contained simple sequence repeats (SSRs). SSRs were identified in the sequence, after locating and trimming MSE adaptors from both ends of the insert sequence, using RepeatMasker software (University of Washington; http://repeatmasker.genome.washington.edu/) and a Pustell DNA matrix (MacVector 7.0; Oxford Molecular). A summary of the simple sequence repeats produced by this screen is found in Table 1. In total, we designed primer pairs flanking 15 unique dinucleotide repeat sequences. Gene frequencies from four dinucleotide loci (CSA-035, CSA-073, CSA-092, and CSA-121) are presented. Additionally, a primer pair was designed, flanking a dinucleotide repeat found (MIH-SSR), independently, in the gene encoding the blue crab molt-inhibiting hormone (Lee et al., 1995). Table 1 Results summary of dinucleotide (AC)17 microsatellite screen from the blue crab, Callinectes sapidus Total number of sequenced clones 19 Total number of microsatellite inserts 18 (94.7%) Frequency of microsatellites detected with (AC)17 probe (%) CATA/GTAT 4.3 GA/CT 13.1 GT/CA 74 CTTT/GAAA 4.3 AGAC/TCTG 4.3 Type of repeat (%) By nucleotide string Di 87 Tetra 13 By form Perfect 72.2 Imperfect 11.1 Compound 16.7

C.R. Steven et al. / J. Exp. Mar. Biol. Ecol. 319 (2005) 3–14 Table 2 Results summary of tetranucleotide microsatellite screen from the blue crab, Callinectes sapidus Total number of sequenced clones Total number of microsatellite inserts

36 22 (61.1%)

Frequency of microsatellites detected with tetranucleotide probes (%) CA/GT

CT/GA

GAT/CTA

GAC/CTG

TAC/ATG

27.6

13.8

3.4

3.4

6.9

AAC/TTG

ACC/TGG

GGAA/ CCTT

CAGT/ GTCA

TACA/ ATGT

3.4

3.4

13.8

3.4

3.4

TCTG/AGAC

TCCA/ AGGT

AGATG/ TCTAC

AAGTG/ TTCAC

TTAGG/ AATCC

3.4

3.4

3.4

3.4

3.4

Type of repeat (%) By nucleotide string Di Tri Tetra Penta By form Perfect Imperfect Compound

41.4 20.7 27.6 10.3 60.0 15.0 25.0

Of the 18 repeat-containing clones (GenBank accession nos. AY359551–AY359568), the repeats in three clones were located too near the 5V or 3V end of the fragment so as to preclude the design of a primer set flanking the repeat. The majority of sequenced fragments (78%) contained simple dinucleotide repeats, most of which matched the (AC)17 probe used in the screen. Two clones contained simple tetranucleotide repeat sequences and three clones contained compound (multiple) repeats. Seventy-two percent of the repeats was perfect, 11.1% was imperfect, and 16.7% was compound. The number of repeated units ranged from 7 to 61. 3.2. Tetranucleotide screen From our tetranucleotide screen, which was based on a mixture of tetranucleotide repeat probes, we sequenced a total of 36 clones. A summary of the simple sequence repeats (GenBank accession

7

nos. AY359531–AY359550) identified by this screen is found in Table 2. This screen resulted in a wider variety of repeats in comparison to the first screen, which employed a single type of dinucleotide probe. We designed primer sets flanking 18 tetranucleotide microsatellite loci, for a total of 34 putative microsatellite loci. Results from five loci (CSC-001, CSC-004, CSC-007, CSC-074, and CSC094) are presented. Twenty-two (61.1%) of the clones from this screen contained repeats; one sequence was cloned three separate times. Of the remaining 20 clones, nine contained simple dinucleotide repeats, five contained Table 3 Allele frequencies at 10 loci in 30 blue crab offspring resulting from a controlled mating and spawning at the Aquaculture Research Center II, Baltimore, MD Allele Frequency size (bp) in offspring

Allele Frequency size (bp) in offspring

Locus CSC-004 Mother 165 0.167 246 0.333 Father 169 0.283 201 0.217 v 2=3.867, P=0.2762

Locus CSA-121 Mother 202 and father

1.000

Locus CSC-007 Mother 180 0.217 209 0.283 Father 186 0.283 198 0.217 v 2=1.067, P=0.7851

Locus CSC-094 Mother 237 and father

1.000

Locus CSA-035 Mother 156 0.283 177 0.217 Father 171 0.300 189 0.200 v 2=1.733, P=0.6295

Locus CSC-001 Mother 331 and father

1.000

Locus CSA-073 Mother 254 0.233 Both 252 0.567 Father 263 0.200 v 2=1.200, P=0.5488

Locus CSC-074 Mother 100 and father

1.000

Locus MIH-SSR Mother 137 0.250 142 0.250 Father 131 0.283 144 0.217 v 2=0.533, P=0.9115

Locus CSA-092 Mother 182 and father

1.000

8

Table 4 GenBank accession no.

5V–3V Primer sequence

Repeat motif

Annealing temperature (8C)

Product size range (bp)

Number of alleles

Observed heterozygosity

Expected heterozygosity

Probability of conformation to HWE

CSC-001

AY359531

(CCTT)14

55

307–366

42

CSC-004

AY359533

(TG)16

58

156–252

49

CSC-007

AY359535

(GA)35

59

144–247

42

VA: 0.5455 MD: 0.2679 VA: 0.6296 MD: 0.5077 VA: 0.8846 MD: 0.8889

0.9630 0.9651 0.9595 0.9711 0.9261 0.9616

0.0000 0.0000 0.0058 0.0023 0.0000 0.5328

CSC-074

AY359545

(GT)6

60

100

CSC-094

AY359548

(TCTG)6

64

228–245

13

CSA-035

AY359558

(GT)29

46

145–252

64

CSA-073

AY359564

(GT)57

55

189–296

48

VA: 0.2609 MD: 0.3750 VA: 0.9655 MD: 0.9722 VA: 0.8276 MD: 0.8310

0.8000 0.8736 0.9564 0.9805 0.9577 0.9630

0.0434 0.0000 0.0862 0.2494 0.8100 0.0892

CSA-092

AY359566

(GT)13

52

182

1

CSA-121

AY359568

(AGAC)9

56

198–206

5

MIH-SSR

U19764

F: attgggtggttgcttcat R: acgaggagaaagttgagattgc F: aaacaacggtaattgtacgagaaa R: aggctaatgccaccatcatc F: gggacaaacaacatgaaagtgg R: gaaaacctattccgggaagc F: atgagtactgtggcgtgtttgg R: caaagatgcccccttatttacc F: tgtatccacaactgacttttctcc R: ggagaaacaccctcagaaaacc F: gactggagaaacgataggtg R: gaacaaggagattacacggattc F: gcctatttgcctcgctacccc R: gtcaccaaagttgagcaagactctct F: gtcagtttattgggaatctcttg R: cttccatcctaaaccacacctgc F: gaataagagaacaaacacacgggg R: aactgcttgccttccttccatc F: tgatttattgttacctttgc F: tgctcttcagccactggaac

(GT)24

52

135–201

47

VA: 0.2759 MD: 0.3288 VA: 0.9310 MD: 0.9429

0.3079 0.3049 0.9595 0.9687

1.0000 0.2417 0.5485 0.3115

1

C.R. Steven et al. / J. Exp. Mar. Biol. Ecol. 319 (2005) 3–14

Locus name

C.R. Steven et al. / J. Exp. Mar. Biol. Ecol. 319 (2005) 3–14

simple tetranucleotide repeats, one contained a simple pentanucleotide repeat, and five more contained compound repeats. Sixty percent of the repeats was perfect, 15% was imperfect, and 25% was compound. The number of repeated units ranged from 3 to 49. Two clones could not be used because the repeat was positioned too near the end of the cloned fragment. 3.3. Microsatellite locus screening In our blue crab pedigree, which consisted of two captively mated crabs and 30 of their offspring, both parents were found to be heterozygous for different alleles at loci CSC-004, CSC-007, CSA-035, and MIH-SSR. The four alleles were all present in the parents and each allele was represented at nearly 25% of the offspring genotypes, and the alleles sorted independently in the offspring genotypes (Table 3). At locus CSA-073, both parents were found to be heterozygous for three different alleles and the genotypes of the offspring nearly represented a 1:2:1 ratio (Table 3). The parent crabs were both homo-

9

zygous for the same alleles at CSC-001 (331 bp), CSC-074 (100 bp), CSA-092 (182 bp), CSC-094 (237 bp), and CSA-121 (202 bp). The parent’s homozygosity at these two loci was mirrored in the offspring, which were all homozygous for the same alleles. Ten of the isolated microsatellite loci (Table 4) were used to initially screen 102 blue crabs sampled from distinct parts of the Maryland (n=73) and Virginia (n=29) portions of the Chesapeake Bay. Two of the loci (CSA-092 and CSC-074) were monomorphic for all 102 individuals. Both loci contained the dinucleotide repeat (GT)n and appeared to be in open reading frames throughout the repeat. We analyzed the two populations for adherence to Hardy–Weinberg equilibrium proportions, heterozygosity, linkage disequilibrium, and genic/genotypic differentiation using the GENEPOP v3.1 c software (http://wbiomed.curtin.edu.au/genepop) and have shown that seven of the remaining eight screened loci are not linked. Loci CSC-007 and MIH-SSR displayed significant linkage disequilibrium between

Fig. 1. Allele frequency distribution for two different microsatellite loci between blue crab populations sampled from the Maryland and Virginia portions of the Chesapeake Bay. (A) Locus CSA-121 displays analogous distributions among five different alleles between the Maryland and Virginia crabs. (B) Locus CSC-094 shows significantly differential allele frequency distributions between Maryland and Virginia crabs. There are bprivateQ alleles present in both the Maryland and Virginia samples for loci.

10

C.R. Steven et al. / J. Exp. Mar. Biol. Ecol. 319 (2005) 3–14

the two populations (v 2=12.212, P=0.016). Heterozygosities between the two populations were similar at most loci (Table 4). Allele frequencies at the CSC007 (Virginia population), CSA-035, CSA-121, and

MIH-SSR loci conform to Hardy–Weinberg equilibrium expectations; however allele frequencies at loci CSC-001, CSC-004, CSC-007 (Maryland population), CSC-094, and CSA-073 do not (Table 4). CSC-001,

Fig. 2. Allele frequency distribution for three moderately polymorphic microsatellite loci (CSC-001, CSC-004, and CSC-007) between blue crab populations sampled from the Maryland and Virginia portions of the Chesapeake Bay. (A) Locus CSC-001; (B) locus CSC-004; and (C) locus CSC-007.

C.R. Steven et al. / J. Exp. Mar. Biol. Ecol. 319 (2005) 3–14

11

Fig. 3. Allele frequency distribution for three highly polymorphic microsatellite loci (CSA-036, CSA-073, and MIH-SSR) between blue crab populations sampled from the Maryland and Virginia portions of the Chesapeake Bay. (A) Locus CSA-036; (B) locus CSA-073; and (C) locus MIH-SSR.

12

C.R. Steven et al. / J. Exp. Mar. Biol. Ecol. 319 (2005) 3–14

CSC-004, CSC-007, CSC-094, and CSA-073 displayed a deficit in heterozygotes in both the Maryland and Virginia populations (data not shown). No significant differences in allele frequency distribution were apparent at loci CSC-007, CSA-073, CSA-121, or MIH-SSR; however, statistically significant genic (allelic) differentiation was detected at loci CSC-001 ( P=0.00086, S.E.=0.00039), CSC-004 ( P=0.00843, S.E.=0.00250), CSC-094 ( P=0.00000, S.E.= 0.000000; Fig. 1A), and CSA-035 ( P=0.00005, S.E.=0.00005) as determined by GENEPOP. The significance for CSC-004 was lost when the dataset was examined for genotypic differentiation ( P= 0.3226, S.E.=0.0121). Significant genotypic differentiation was detected at loci CSC-094 ( P=0.0112, S.E.=0.0017) and CSA-035 ( P=0.0001, S.E.= 0.0001). Locus CSC-094 displayed several private alleles: five in the Maryland population and one in the Virginia population. Locus CSA-121 also displayed two private alleles in the Maryland population and one in the Virginia population; however, these may be due to insufficient sampling size. The other five loci also had many private alleles (Figs. 2 and 3)—this was likely a result of the small sample sizes and single age class involved in this study.

4. Discussion Long-term management of blue crab populations in the Chesapeake Bay (and other habitats) must rely on a full understanding of the blue crab’s basic biology, especially the genetic structure of its breeding population. In this paper, we describe the development of microsatellite markers from the blue crab to assist in the study of blue crab population genetics. We performed two rounds of the bFIASCOQ methodology (Zane et al., 2002) in order to isolate dinucleotide and tetranucleotide microsatellite loci from the blue crab. From the initial round, using a dinucleotide (AC)17 probe, we isolated and sequenced a total of 19 clones, 18 of which (94.7%) contained recognizable simple sequence repeats and resulted in 16 primers pairs designed for dinucleotide repeats. From the second round of FIASCO, which employed a mixture of tetranucleotide probes, a total of 36 clones was isolated and sequenced. Of these clones, 23 (63.9%) contained recognizable simple sequence repeats, and

resulted in 18 primer pairs designed against tetranucleotide microsatellite loci for a total of 34 primer pairs flanking unique microsatellite sequences. The dinucleotide round of FIASCO produced a higher percentage of repeat-positive clones than the tetranucleotide screening, which is likely a reflection of the relative complexity of the tetranucleotide probe mixture used in the second round. In summary, we conclude that the FIASCO methodology is an extremely efficient protocol for the isolation of highly informative microsatellite loci. To determine the usefulness of the above described microsatellite loci, we fluorescently labeled 10 primer pairs and genotyped three sets of crabs. The first two sets of crabs that we genotyped were 102 crabs collected from two different portions of the Chesapeake Bay. This experiment was used to get an idea of the allelic variability at these loci. Six loci (CSC-001 CSC-004, CSC-007, CSA-035, CSA073, and MIH-SSR) displayed high numbers of alleles (Table 1). The other two loci (CSA-121 and CSC-094) displayed somewhat less variation, 5 and 13 different alleles within our samples, respectively. No significant differences in allele frequency distributions were seen at loci CSC-007, CSA-073, CSA121, and MIH-SSR; however, statistically significant allelic differentiation between the two Chesapeake Bay populations was apparent at loci CSC-001, CSC-004, CSC-094, and CSA-035. Because three of these loci were out of the Hardy–Weinberg equilibrium, we reanalyzed the data with a more rigorous test that examined genotypic differentiation. When analyzed in this manner, the difference between our two populations at locus CSC-004 lost its significance, but the difference at loci CSC-094, CSA-001, and CSA-035 was still significant. Overall the degree of polymorphism observed at these loci is similar to that reported for Portunus pelgaicus (Yap et al., 2002) and other crustaceans (Avise, 1994). However, some of the blue crab loci (SCS-094 and CAS-121) exhibit quite low heterozygosities. None of the prior population genetic studies has been able to discern differences between crabs within the Chesapeake Bay (Burton and Feldman, 1982). This lack of differences may be due to the lower sensitivity of the genetic markers used in the earlier studies, namely allozymes. Whether the genetic

C.R. Steven et al. / J. Exp. Mar. Biol. Ecol. 319 (2005) 3–14

differentiation we have observed between the two sampled populations is meaningful in a biological or ecological context is difficult to say with certainty due to the limited sample size and scope of this experiment. An additional noteworthy observation from this experiment is the observation of a large amount of variability of the dinucleotide SSR located within the blue crab molt-inhibiting hormone gene. Future experiments will attempt to correlate microsatellite size to molting phenotypes (i.e., fast or slow molting rate). The second set of crabs was a pedigree of two known mated crabs and 30 of their offspring. The results of this experiment allow us to conclude that the ten loci that we have screened to date are inherited in classical Mendelian fashion (i.e., the parental alleles are the only alleles present in the offspring and they are represented equally in the next generation). Taken together, the results from the experiments described in this paper clearly demonstrate that sufficient variation at microsatellite loci in the blue crab exists to permit a more detailed screening of the spatial and temporal genetic structures of Chesapeake Bay blue crab population. Future experiments will include using more loci to screen the blue crab population. The loci that were used in this study were only 10 of 34 putative microsatellite loci isolated from two screenings. It is likely that some of the remaining 24 primer pairs developed here will also prove useful with further optimization. In addition, we will attempt to use a set of seven novel primer sets that have been described for the amplification of introns from nuclear genes in coelomates (Jarman et al., 2002). These primer pairs have been tested on representatives of four coelomate phyla, including Crustacea, which resulted in the amplification of six of the seven loci.

Acknowledgements Many thanks are due to Mike Eackles at the USGS Leetown Science Center for his guidance and direction during the isolation of microsatellite isolation, and to Dr. Matthew Hare at the University of Maryland College Park for insightful discussions regarding the interpretation of results. This is contribution no. 04-596 from the University of Maryland

13

Biotechnology Institute, Center of Marine Biotechnology. This work was funded by a grant from NOAA Award (no. NA17FU2841) Blue Crab Advanced Research Consortium Project to A.R.P. [SS]

References Avise, J.C., 1994. Molecular Markers, Natural History and Evolution. Kluwer Academic Publishers, Boston. Balloux, F., Lugon-Moulin, N., 2002. The estimation of population differentiation with microsatellite markers. Mol. Ecol. 11, 155 – 165. Burton, R.S., Feldman, M.W., 1982. Population genetics of coastal and estuarine invertebrates: does larval behavior influence population structure? In: Kennedy, V.S. (Ed.), Estuarine Comparisons. Academic Press, New York, pp. 537 – 551. Cole, M.A., Morgan II, R.P., 1978. Genetic variation in two populations of the blue crab, Callinectes sapidus. Estuaries 1, 202 – 205. Cronin, L.E., 1998. Early days of crabbing and a brief history for the Chesapeake Bay. J. Shellfish Res. 17, 379 – 382. Goldstein, D.B., Schlftterer, C., 1999. Microsatellites: Evolution and Applications. Oxford University Press, New York. Itokawa, M., Yamada, K., Iwayama-Shigeno, Y., Ishitsuka, Y., Detera-Wadleigh, S., Yoshikawa, T., 2003. Genetic analysis of a functional GRIN2A promoter (GT)n repeat in bipolar disorder pedigrees in humans. Neurosci. Lett. 345, 53 – 56. Jarman, S.N., Ward, R.D., Elliott, N.G., 2002. Oligonucleotide primers for PCR amplification of coelomate introns. Mar. Biotechnol. 4, 347 – 355. Johnson, M.S., Black, R., 1982. Chaotic genetic patchiness in an intertidal limpet, Siphonaria sp. Mar. Biol. 70, 157 – 164. Lee, K.J., Elton, T.S., Bej, A.K., Watts, S.A., Watson, R.D., 1995. Molecular cloning of a cDNA encoding putative molt-inhibiting hormone from the blue crab, Callinectes sapidus. Biochem. Biophys. Res. Commun. 209, 1126 – 1131. Lu, G., Basley, D.J., Bernatchez, L., 2001. Contrasting patterns of mitochondrial DNA and microsatellite introgressive hybridization between lineages of Lake Whitefish (Coregonus clupeaformis); relevance for speciation. Mol. Ecol. 10, 965 – 985. McCouch, S.R., Chen, X., Panaud, O., Temnykh, S., Xu, Y., Cho, Y.G., Huang, N., Ishii, T., Blair, M., 1997. Microsatellite marker development, mapping and applications in rice genetics and breeding. Plant Mol. Biol. 35, 89 – 99. McMillen-Jackson, A.L., Bert, T.M., Steele, P., 1994. Population genetics of the blue crab Callinectes sapidus: modest population structuring in a background of high gene flow. Mar. Biol. 118, 53 – 65. Mueller, U.G., Wolfenbarger, L.L., 1999. AFLP genotyping and fingerprinting. TREE 14, 389 – 394. Mukaida, M., Kimura, H., Takada, Y., Masuda, T., Nakata, Y., 2000. The personal identification of many samples recovered from under the sea. Forensic Sci. Int. 113, 79 – 85.

14

C.R. Steven et al. / J. Exp. Mar. Biol. Ecol. 319 (2005) 3–14

Olaisen, B., Stenersen, M., Mevag, B., 1997. Identification by DNA analysis of the victims of the August 1996 Spitsbergen civil aircraft disaster. Nat. Genet. 15, 402 – 405. Place, A.R., Feng, X., Steven, C.R., Fourcade, H.M., Boore, J.L., 2005. Genetic markers in blue crabs (Callinectes sapidus) II: complete mitochondrial DNA sequence and characterization of variation. J. Exp. Mar. Biol. Ecol. 319, 15 – 27. Raymond, M., Rousset, F., 1995. GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J. Heredity 86, 248 – 249. Rugolo, L., Knotts, K.S., Lange, A.M., 1998. Historical profile of the Chesapeake Bay blue crab (Callinectes sapidus) fishery. J. Shellfish Res. 17, 383 – 394. Schlftterer, C., 2000. Evolutionary dynamics of microsatellite DNA. Chromosoma 109, 365 – 371.

Strecker, U., Bernatchez, L., Wilkens, H., 2003. Genetic divergence between cave and surface populations of Astyanax in Mexico (Characidae, Teleostei). Mol. Ecol. 12, 669 – 710. Sunnucks, P., 2000. Efficient genetic markers for population biology. TREE 15, 199 – 203. Weber, J.L., 1990. Informativeness of human (dC–dA)n (dG–dT)n polymorphisms. Genomics 7, 524 – 530. Yap, E.S., Sezmis, E., Chaplin, J.A., Potter, I.C., Spencer, P.B.S., 2002. Isolation and characterization of microsatellite loci in Portunus pelagicus (Crustacea: Portunidae). Mol. Ecol. Notes 2, 30 – 32. Zane, L., Bargelloni, L., Patarnello, T., 2002. Strategies for microsatellite isolation: a review. Mol. Ecol. 11, 1 – 16.