- Email: [email protected]
Characterization of murine interferon-alpha 12 (MuIFN-α12): Biological activities and gene expression
www.elsevier.com/locate/issn/10434666 Cytokine 37 (2007) 138–149
Characterization of murine interferon-alpha 12 (MuIFN-a12): Biological activities and gene expression Sai Leong Tsang a, Po Chu Leung a, Ka Kit Leung a, Wai Lok Yau a, Matthew P. Hardy b, Nai Ki Mak c, Kwok Nam Leung d, Ming Chiu Fung a,* a
d
Department of Biology, The Chinese University of Hong Kong, Shatin, Hong Kong b CSL Limited, 45 Poplar Road, Parkville, Vic. 3052, Australia c Department of Biology, Hong Kong Baptist University, Kowloon, Hong Kong Department of Biochemistry, The Chinese University of Hong Kong, Shatin, Hong Kong
Received 7 May 2006; received in revised form 12 February 2007; accepted 12 March 2007
Abstract Interferon alpha (IFN-a) belongs to the type I interferon family and consists of multiple subtypes in many species. In the mouse, there are at least 14 IFN-a genes and 3 IFN-a pseudogenes, the most recently identified of which are murine interferon-alpha 12 (MuIFN-a12), MuIFN-a13 and MuIFN-a14. To further study the biological activities of MuIFN-a12, we have produced a recombinant MuIFN-a12 (rMuIFN-a12) protein using COS-1 cells. rMuIFN-a12 was found to inhibit the growth of murine myeloid leukemia JCS cells. Flow cytofluorometric analysis with propidium iodide staining showed that the growth inhibitory activity of rMuIFN-a12 may be caused by the induction of apoptosis. Flow cytofluorometric analysis also revealed that rMuIFN-a12 was able to up-regulate the expression of MHC-I on both JCS cells and primary macrophages. Functional studies indicated that a MuIFN-a12 transgene could induce an anti-viral state in L929 cells against Influenza A virus. Moreover, expression of MuIFN-a12 was not detectable by RT-PCR in untreated, Influenza A virus infected, polyI:polyC induced L929 cells, or in a wide range of normal murine tissues. Taken together, this data shows that MuIFN-a12 is a protein with all the biological traits of a type I IFN. 2007 Elsevier Ltd. All rights reserved. Keywords: Interferon alpha-12; Subtype; Antiviral; Apoptosis; Antiproliferation; Gene expression
1. Introduction Interferon (IFN) was first reported by Isaacs and Lindenmann in 1957 as an anti-viral protein [1]. IFNs are now classified into two distinct types, type I and type II. Type I IFN consists of seven classes: interferon a, b, x [2], s [3], j [4], e [5] and d [6]. Four IFN-like cytokines have also been reported: limitin [7,8] (found only in mice), interleukin-28A (IL-28A), IL-28B, and IL-29 found in humans
*
Corresponding author. Fax: +852 2603 5745. E-mail addresses: [email protected] (S.L. Tsang), terisapc@ yahoo.com (P.C. Leung), [email protected] (K.K. Leung), wailok@cuhk. edu.hk (W.L. Yau), [email protected] (M.P. Hardy), nkmak@hkbu. edu.hk (N.K. Mak), [email protected] (K.N. Leung), mingchiufung@ cuhk.edu.hk (M.C. Fung). 1043-4666/$ - see front matter 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.cyto.2007.03.002
and other mammals [9,10]. For a recent review of interferons please refer to Pestka et al. [11]. In addition to its wellknown anti-viral activity, IFN-a has anti-proliferative activity on target cells by proposed mechanisms of cellcycle arrest and apoptosis [12,13]. IFN-a also plays an important role in the regulation of MHC-I expression, and in the augmentation of natural killer cells [14,15]. The mouse type I IFN gene cluster has recently been characterized. [5,16] The murine interferon-alpha (MuIFN-a) family consists of at least 14 subtypes. Within the MuIFN-a cluster, the alpha genes were flanked at 5 0 and 3 0 ends by beta and epsilon genes while having a limitin cluster in the centre. As the different MuIFN-a gene have high nucleotide and amino acid similarity, it is likely that these genes arose by gene duplication via unequal recombination following the divergence of MuIFN-a and MuIFN-b
S.L. Tsang et al. / Cytokine 37 (2007) 138–149
[17–19]. The most recently cloned subtypes MuIFN-a12, MuIFN-a13 and MuIFN-a14 were found to have antiviral and anti-proliferative activity [16]. Unlike other IFN-a subtypes, MuIFN-a13 is constitutively expressed in uninduced L929 cells, and this expression level does not increase upon viral infection [20]. MuIFN-a12 was suggested to be expressed in mice during embryonic development [5,21]. The MuIFN-a12 gene was also found to encode a functional protein [16]. However, the regulation of MuIFN-a12 expression and its biological activities have not yet been fully characterized. In this study, we examined MuIFN-a12 for its ability to act functionally as a type I IFN. We analyzed its biological activities such as cell growth, apoptosis and IFN-mediated gene induction (demonstrated by MHC-I induction), and examined the regulation of MuIFN-a12 expression by RT-PCR in a range of normal and induced cell lines and tissues. What we identified was a functional member of the type I interferon family. 2. Materials and methods 2.1. Cell culture and virus strain COS-1 cell line was a gift from Dr. Ge Wei (The Chinese University of Hong Kong, CUHK) and was passed in Dulbecco’s modified Eagle’s medium with 10% fetal calf serum (FCS) (DMEM-10). L929 cell line was obtained from Dr. K.N. Leung (CUHK) and passed either in EMEM-10 (Eagle’s minimal essential medium), DMEM-10 or RPMI-10 (RPMI-1640). JCS cell line was also obtained from Dr. K.N. Leung and was maintained in RPMI-10. MDCK cell line, used in the titration of Influenza A virus, was a gift from Dr. Vincent Ooi (CUHK). For suspension cell lines, they were split into new medium according to the ratio suggested by ATCC. For adherent cell lines, they were passed before confluent. The Influenza A virus used was ATCC VR-219, strain A/NWS/33, obtained from Dr. N. K. Mak (Hong Kong Baptist University). 2.2. Construction of clones for protein expression MuIFN-a12 was amplified from L929 genomic DNA using Advantage 2 polymerase (Clontech) and primer pair (MF1012/MF1013). The PCR products were TA-cloned into pGEM-T vector (Promega). The gene was then excised by EagI and SpeI and subcloned into a pBluescriptII (SK) vector (Stratagene) cut with EagI and XbaI. The MuIFN-a12 gene harbored in pBluescriptII (SK) vector was then excised by SacI and BamHI, subcloned into the SacI and BamHI sites of the expression vector pEGFP-N1 (Clontech), giving pEGFP-N1_MuIFN-a12. MuIFN-a4 was amplified by Pfx polymerase (Invitrogen) with primer pair (MF696/MF697). The blunt end PCR product was then ligated into pEGFP-N1 previously cut with SmaI. The recombinant plasmid was designated as pEGFPN1_MuIFN-a4. Sequencing of the DNA insert confirmed
139
correct orientation and no mutations. In all constructs, no part of the EGFP protein was expressed. 2.3. Production of recombinant MuIFN-a (rMuIFN-a) and production of native MuIFN-a by polyI:polyC induction COS-1 cells (2 · 105)/well were seeded in 6-well plates and incubated at 37 C, 5% CO2 overnight or until 60–80% confluent. The cells were transfected by 3 lg of DNA using 4 ll of DMRIE-C reagent (Invitrogen). The culture medium was collected 2 d later. Fresh DMEM-10 was added, collected again 2 d thereafter and this procedure was repeated three times till day 8. The supernatants collected were 0.22 lm filter sterilized and kept at 4 C for temporary storage. Whenever possible, they were adjusted to pH 2 by 1 N HCl, incubated at 20 C for 24 h and then neutralized back to pH 7–7.5 by 1 M NaOH. The IFN preparations were then filter sterilized and stored at 4 C. The induction of native, mixed type I IFN from L929 by polyI:polyC was done according to the paper of Trapman [22]. IFN in the supernatant was then collected, FCS equal to 1/9th of the volume was added to adjust the samples into DMEM-10, and was then acidified as above. The FCS was added to extend the shelf-life of the MuIFN-a. 2.4. MTT cell-proliferation assay The assay was performed similarly as described by Loveland et al. [23]. Twofold serial dilution of MuIFN-a samples were made in 100 ll RPMI-10 medium using 96well U-bottom plates. JCS (3 · 102) cells in 100 ll RPMI10 medium were then added to each well. Seventy-two hours later, 20 ll MTT solution (5 mg/ml) was added to each well and mixed. The cells were further incubated at 37 C, 5% CO2 for 3 h. The cells were then spun at 1500 rpm for 10 min and medium were removed. One hundred microliters of DMSO was added to each well to elute the dye and the color intensity at 540 and 690 nm was measured by ELISA plate reader. The final readings were OD540 OD690. The data were reported as % of growth vs dilution of MuIFN preparation, in which the % of growth was calculated as (OD of sample/OD of averaged cell only control) · 100%. The results were then analyzed by Prism 4.0, a rectangular hyperbola curve was fitted to each set of data. The goodness of fit was measured in R2 value. The data points which were out of range of a previously established linear relationship, between the OD value and the cell number, were omitted. Means ± SEM were plotted from triplicate determinations. 2.5. Quantification of MuIFN preparations and estimation of specific activity To quantify the MuIFN samples in terms of IU/ml, the amount of samples used to make 50% growth inhibition in the MTT cell proliferation assay described was compared
140
S.L. Tsang et al. / Cytokine 37 (2007) 138–149
to that using the NIH IFN standard (NIAID Cat. No. Ga02-901-511) for murine interferon. The values were directly calculated using Prism 4.0. The amount of IFN protein present in the samples was estimated by ELISA using the NIH IFN standard as the reference material. This standard was made using a purified mixed type I IFN, with specific activity of 1.7 · 106 IU/mg, as starting material. Thus 1 IU will be approximately 0.59 ng of IFN protein. Briefly, 2-fold serial dilutions of NIH IFN standard or samples in carbonate coating buffer (pH 9.6, 0.15 M sodium carbonate, 0.35 M sodium bicarbonate) was coated onto an ELISA plate. The plate was left in 37 C for 4 h. The plate was then washed with PBS–Tween (PBS with 0.05% Tween 20) and incubated for 1 h using NIH IFN antiserum (NIAID Cat. No. G024-501-568) at 1:5000, washed and then incubated for 1 h using 1:3000 alkaline phosphatase conjugated, rabbit anti-goat antibody (Sigma Cat. No. A-4187) and the signal was then developed using p-nitrophenylphosphate (Bio-Rad alkaline phosphatase substrate kit, Cat. No. 172–1063). The signals were measured at 405 nm and results were calculated from triplicate determinations. 2.6. Flow cytofluorometric analysis of cell cycle by propidium iodide staining JCS cells (1 · 106) were seeded in 10 ml RPMI-10 medium in four 25 cm2 flasks. Two-hundred microliters mock supernatant, approximately 200 IU/ml rMuIFN-a12 or approximately 200 IU/ml rMuIFN-a4 were added to three of the flasks. One was left untreated throughout the study. Twenty-four hours later, the cells were spun down and washed with cold Dulbecco’s phosphate-buffered saline (DPBS) (Gibco). The pellets were then resuspended and fixed in 2 ml cold 70% ethanol and left overnight at 4 C. Twenty-four hours later, the cells were spun down and washed twice with cold DPBS as before. Finally the cells were resuspended in 1.8 ml cold DPBS with RNaseA (final concentration 50 lg/ml), and 200 ll propidium iodide solution (0.5 mg/ml) was added. The samples were incubated for 30 min at 37 C, protected from light and then immediately analyzed by the Beckman Dickinson FACS machine. The DNA content of the cells was measured and the cell numbers were counted. The data and cell-cycle distributions were analyzed by ModFit and then by Prism 4.0. Data are means ± SEM of three independent experiments. P values were calculated with t test. 2.7. FACS study on the effect of MuIFN on MHC-I upregulation in JCS cells JCS cells (1 · 106) were incubated in 2 ml RPMI-10, with approximately 5, 50 or 500 IU/ml of different MuIFN-a. Thirty-six hours later the cells were harvested by leaving at room temperature for 30 min. Cells (1 · 106) were spun at 1500 rpm for 5 min and were resuspended in 200 ll FACS medium (2% heat-inactivated FCS
and 0.05% NaN3 in DPBS). Cells were washed once by FACS medium. The pellets were then resuspended again with 2 lg rat IgG and 2 lg mouse IgG in 200 ll DPBS and incubated at 4 C for 30 min with occasional shaking. The cells were washed once with FACS medium and then resuspended with 0.5 ll FITC-conjugated anti-mouse MHC-I antibody (0.5 mg/ml, BD Biosciences Cat. No. 553565) in 100 ll solution which consisted of 50 ll DPBS and 50 ll FACS medium. The samples were incubated at 4 C for 1 h and then washed twice with FACS medium. Finally the pellets were resuspended in 600 ll FACS fixative (1% formaldehyde in DPBS) and the analysis was performed in the FACS machine. 2.8. FACS study on the effect of MuIFN on MHC-I upregulation in primary macrophages from BALB/c mice Two 8- to 10-week male BALB/c mice were injected intraperitoneally with 1.5 ml 3% thioglycollate solution. Three days later, the mice were sacrificed and the peritoneal exudate cells (PEC) were harvested with cold DPBS in 15 ml centrifuge tube and washed with RPMI-10 medium. Cells (1 · 106) were added to each well of a 6-well plate. Three hours later the unattached cells were washed away using RPMI-10 medium. Two days later, mock supernatant or approximately 500 IU/ml of rMuIFN-a12, rMuIFN-a4 or mixed type I IFN were added. Forty-eight hours later, the cells were harvested with DPBS containing 0.2% EDTA and then processed as above. 2.9. Anti-viral activity acquired by transfection of MuIFN-a gene The assay was performed similar to the setup by Harle et al. [24], except the virus we used here was Influenza A virus. L929 cells (2 · 105) per well were seeded in a 6-well plate until 60–80% confluent. The cells were then transfected with 3 lg plasmid DNA using DMRIE-C as described above. Twenty-four hours later the cells were challenged with virus at MOI (multiplicity of infection) of 0.2 as in Fung et al. [25] 16–20 h later, the cultures were observed under light microscope and photos were taken. The protection was determined by the degree of cytopathic effect. 2.10. RNA extractions 2.10.1. RNA extraction by CsCl method, Trizol reagent and treatment with RNase-free DNaseI To collect RNA by CsCl method, the cells were lysed in 4 M Guanidinium thiocyanate (GT) solution, loaded onto 5.7 M CsCl cushion and ultracentrifuged at 4 C and 160,000g for 16 h. The supernatant was carefully removed and the RNA was eluted with DEPC-treated water. The RNA samples were further purified by Trizol reagent (Invitrogen) as described in the manufacturer’s manual. After that the samples were further treated by RNase-free DNaseI (RQ1 RNase-Free Dnase, Promega). The RNA
S.L. Tsang et al. / Cytokine 37 (2007) 138–149
samples were then immediately extracted with phenol/chloroform/isoamyl mixture (PCI) and ethanol precipitated. RNA extraction from 15–18-day embryos of BALB/c mice: Several 15–18 day embryos were obtained from pregnant BALB/c mice. The head and internal organs were removed. The remaining parts were cut into small pieces and homogenized in Trizol reagent. RNA was then treated with RNase-free DNaseI as described above. RNA extraction from L929 cell lines, with or without Influenza A virus infection or polyI:polyC induction: L929 cells were seeded in 6-well plates until confluent. Then 200 lg/ml polyI:polyC and 100 lg/ml Dextran were added. After 9 h of incubation, RNA was collected by the CsCl method as described. For the cells infected with Influenza A virus at MOI of 0.2, the RNA was also collected by the CsCl method 9 h after the re-supply of medium. RNA extraction from tissues of BALB/c mouse: three male 8–10 week BALB/c mice were sacrificed and the brains, bone marrows, hearts, kidneys, livers, lungs, spleens and thymuses were collected. They were lysed in 4 M GT solution. The lysates were then processed as above. 2.11. Reverse transcription RNA were diluted into 1 lg in 10 ll and added to 10 ll reaction mixture which contained 2 ll DTT, 4 ll 5 · 1st strand buffer, 1 ll dNTP (10 mM each), 1 ll 0.1 lg/ll oligo dT, 1 ll Rnasin and 1 ll of MMLV-RT enzyme (Invitrogen). The RT reactions were carried out at 37 C for 1 h and then boiled at 95 C for 5 min. DEPC-treated water was used in place of MMLV-RT enzyme in RT negative control (RT). 2.12. Polymerase chain reaction (PCR) For cloning purpose, the PCRs were done using polymerase with proof-reading ability, e.g. Advantage 2 (Clontech) or Pfx (Invitrogen). For analysis purpose, they were performed using Thermoprime plus polymerase (AB gene). For a 50-ll reaction, 25 pmol of each primer was used, and 1 ll 10 mM dNTP mix was added. For cloning of MuIFN-a12 and MuIFN-a4, the PCR profile used was 94 C 4 min, 25 cycles of 94 C 1 min, 56 C 1 min, 72 C 1 min and then extension at 72 C for 3 min. For RT-PCR detection of MuIFN-a12, MuIFNa4 and GAPDH, 35 cycles but otherwise the same PCR profile was used. In preparing templates for direct sequencing, PCR of 50 cycles was performed with the above profile. The sequences of the primers were shown in Table 1. Fig. 1 illustrates the expected primer binding sites for primers MF1012, MF1013, MF1014 and MF1015. Primers (MF1014/MF1015) bind within the open-reading frame of MuIFN-a12 while primers (MF1012/MF1013) bind on 5 0 -UTR and 3 0 -UTR, respectively. The two sets of primers (MF1014/MF1015) and (MF1012/MF1013) were expected to be specific to
141
MuIFN-a12 as they can be used to amplify MuIFN-a12 either from genomic DNA or from RT products made from embryo RNA, in which the PCR products were confirmed by direct sequencing. 3. Results 3.1. The antiproliferative effects of recombinant MuIFN In order to determine whether MuIFN-a12 has antiproliferative properties, we expressed a recombinant form of MuIFN-a12 as a secreted protein from COS-1 cells by transient transfection and tested it in an anti-proliferative assay on JCS cells. As positive controls in the anti-proliferative assay, NIH IFN standard, rMuIFN-a4 and polyI:polyC induced mixed type I IFN were used. Supernatant taken from COS-1 cells transfected with vector alone was used as a negative control. As shown in Fig. 2, the mock supernatant had no effect on the rate of JCS cell proliferation, even at low dilutions. In contrast, the positive control samples (rMuIFN-a4, mixed type I IFN and NIH IFN standard) were able to inhibit the proliferation of JCS cells in a dose-dependent manner (from dilution of 1:40 to 1:1280) up to 80% for the lowest dilution tested. When the rMuIFN-a12-containing COS-1 cell supernatant was tested, we also observed a dose-dependent inhibition of proliferation to a level similar to that of the other type I IFNs, suggesting that rMuIFN-a12 has antiproliferative activity. The goodness of fit was measured by R2 and was 0.0318 for the mock supernatant and >0.930 for rMuIFN-a12, rMuIFN-a4, NIH IFN standard and mixed type I IFN. 3.2. Quantification of MuIFN preparations and estimation of specific activity To quantify the amount of MuIFN produced by the transfected COS-1 cells, the amount of MuIFN that made 50% growth inhibition based on the MTT cell-proliferation assay aforementioned was compared to that using NIH IFN standard. Our MuIFN preparations were found to give about 1000 IU/ml. Since the mock supernatant had little effect on JCS cell growth at all dilutions, its potency could not be determined, and so a comparable volume to the rMuIFN-a12 preparation used was chosen as control in later experiments. The mean of triplicate estimations of specific activity (IU/mg) of rMuIFN-a12 and rMuIFN-a4 were 2.91 and 2.47 · 108 IU/mg, respectively, both with ranges in the order of 1 · 108 IU/mg (data not shown). 3.3. Cell-cycle analysis of rMuIFN-a-treated JCS cells To further study the antiproliferative effects of recombinant MuIFN-a12, we performed a cell-cycle analysis on rMuIFN-a12-treated JCS cells. The rMuIFN-a-treated or -untreated JCS cells were stained with propidium iodide
142
S.L. Tsang et al. / Cytokine 37 (2007) 138–149
Table 1 PCR primers used in cloning and RT-PCR of the MuIFN-as Name
Sequence (5 0 –3 0 )
Purpose
Direction
MF214 MF215 MF696 MF697 MF1012 MF1013 MF1014 MF1015
ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA CAGAGAGCGACCAGCATGTAC AACACGGTTTTGCATATTGAGAAG CCAAACAGCCCAGAGGACAAA ATGACAGTTCTCTCCATTTTGCT CTTTCCTGATGACCCTGCTAG TCTTGATCTGCTGGGCATTCC
RT-PCR of GAPDH
Sense Antisense Sense Antisense Sense Antisense Sense Antisense
Cloning and RT-PCR of MuIFN-a4 Cloning and RT-PCR of MuIFN-a12 RT-PCR of MuIFN-a12
up-regulation of MHC-I expression was observed (Fig. 4(b)), suggesting that rMuIFN-a12 can lead to IFN mediated gene induction. For both rMuIFN-a12 and rMuIFN-a4, the fluorescence can be increased to around 10-fold.
Fig. 1. Primers for amplification of MuIFN-a12 MF1014/MF1015 bind within the open-reading frame of MuIFN-a12 while MF1012/MF1013 bind in the 5 0 -UTR and 3 0 -UTR, respectively.
and subjected to FACS analysis as described. Since cells with DNA content less than diploid (sub-G1 peak) are apoptotic, we calculated the percentage of untreated JCS cells or cells treated with mock supernatant, rMuIFN-a12 or rMuIFN-a4, undergoing apoptosis (Fig. 3). In the case of untreated cells, only very few cells (<0.5%) were found to be apoptotic. No significant difference was observed in JCS cells treated with mock supernatant (<0.5%), (P > 0.5). However, for JCS cells treated with approximately 200 IU/ml of rMuIFN-a12 or rMuIFN-a4, apoptosis were found to be significantly higher (P < 0.05), at about 10.0% (Fig. 3). These data suggest that induction of apoptosis can be one of the mechanisms by which MuIFN-a12 exerts anti-proliferative effect. 3.4. FACS analysis of the effect of different MuIFN-a subtypes on MHC-I expression in JCS cell line To test whether MuIFN-a12 can lead to IFN-mediated gene induction similar to other type I IFNs, we measured its ability to up-regulate the expression of MHC-I in JCS cells. JCS cells were treated with different dosages (approximately 5, 50 and 500 IU/ml) of rMuIFN-a12, rMuIFN-a4, mixed type I IFN or comparable volume of mock supernatant for 36 h. The cells were then subjected to FACS staining as described. As shown in Fig. 4(a), mock supernatant did not alter MHC-I expression in JCS cells. However, approximately 5, 50 and 500 IU/ml rMuIFN-a4 (Fig. 4(c)) and mixed type I IFN (Fig. 4(d)) was able to up-regulate MHC-I expression in JCS cells in a dose-dependent manner. When the same concentrations of rMuIFN-a12 were tested for their ability to modulate MHC-I expression on JCS cells, a similar, dose-dependent
3.5. FACS analysis of the effect of different MuIFN-a subtypes on MHC-I expression in primary macrophages of BALB/c mice To test whether MuIFN-a12 also exerts its IFN-mediated gene induction effect on MHC-I expression on primary cells in addition to cell lines such as JCS cells, we repeated the above experiment on primary macrophages taken from untreated BALB/c mice. Primary macrophages were treated with approximately 500 IU/ml of rMuIFNa12, rMuIFN-a4 or mixed type I IFN. Fig. 5(a)–(d) show the effect of mock supernatant, rMuIFN-a12, rMuIFN-a4 or mixed type I IFN on MHC-I expression in primary macrophages prepared from BALB/c mice. rMuIFN-a12, rMuIFN-a4 and mixed type I IFN could up-regulate the MHC-I expression in primary macrophages. However, this time the magnitude of increase in fluorescence is only around 3- to 5-fold, less than that in JCS cells. 3.6. Effect of MuIFN-a12 on Influenza A virus challenged L929 cells In order to determine whether MuIFN-a12 has antiviral properties, its ability to protect cells against viral infection was examined. L929 cells were transiently transfected with expression constructs encoding MuIFN-a12, MuIFN-a4 as a positive control, and empty vector as a negative control. In addition, untreated L929 cells were used to show the healthy status of the L929 cells. Except the untreated L929 cells, other L929 cells were transfected and then challenged with the Influenza A virus. As shown in Fig. 6, virally infected cells previously transfected with empty vector showed significant morphology changes and cell-death relative to untreated cells, as observed with light microscopy. In contrast, cells transfected with either MuIFN-a4 or MuIFN-a12 showed the ability to completely protect L929 cells against Influenza A virus (Fig. 6). This data demonstrates that MuIFN-a12 has the ability to confer an antiviral state on cells.
S.L. Tsang et al. / Cytokine 37 (2007) 138–149
143
Fig. 2. Anti-proliferative effect of different rMuIFN-a subtypes on murine myeloid leukemia cell line JCS. The figure shows the dose–response curves of different rMuIFN-a (rMuIFN-a12, rMuIFN-a4), NIH IFN standard, mixed type I IFN, and mock supernatant on the growth of murine myeloid leukemia cell line JCS. Our recombinant samples were compared to NIH IFN standard for quantification. Rectangular hyperbola was fit onto the data points by Prism 4.0 and R2 is calculated. The mock supernatant could hardly give any growth inhibition, thus its potency could not be determined. R2 was 0.0318 for the mock supernatant and >0.930 for rMuIFN-a12, rMuIFN-a4, NIH IFN standard and mixed type I IFN. Each point represents the means ± SEM of triplicate determinations. Approximately, 1.024 IU of NIH IFN standard could make a 50% growth inhibition in the aforementioned MTT assay.
144
S.L. Tsang et al. / Cytokine 37 (2007) 138–149
Fig. 3. Cell-cycle analysis of rMuIFN-a treated JCS cells by propidium iodide staining. JCS cells were treated with 200 ll mock supernatant, approximately 200 IU/ml of rMuIFN-a12 or 200 IU/ml of rMuIFN-a4 for 24 h and then fixed and stained with propidium iodide and subjected to FACS analysis as described. The % of cells undergone apoptosis, i.e. cells have sub-G1 peak, were analyzed by the software Modfit. (a) untreated JCS cells; (b) JCS cells treated with 200 ll mock supernatant; (c) JCS cells treated with 200 IU/ml rMuIFN-a12; (d) JCS cells treated with 200 IU/ml rMuIFN-a4. When compared to untreated JCS cells, P > 0.5 for mock supernatant, P < 0.05 for rMuIFN-a12 and rMuIFN-a4. Data are means ± SEM of three independent experiments and P values are calculated by t test.
3.7. MuIFN-a12 expression in 15- to 18-day embryos of BALB/c mice To demonstrate MuIFN-a12 expression in BALB/c embryos, PCRs were performed on reverse-transcribed embryonic RNA using two different primer pairs (MF1014/MF1015) or (MF1012/MF1013). As shown in Fig. 7, bands of expected size (200 bp for MF1014/ MF1015 and 650 bp for MF1012/MF1013) appeared only in RT+ samples but not in RT samples. Since MuIFN-a12 is an intron-less gene, this RT control importantly shows that the PCR fragment was not amplified from a genomic contaminant, but from cDNA. GAPDH was used as a control. The band obtained using the primer pair (MF1012/MF1013) was purified from gel and directly sequenced. BLAST search results of the sequenced PCR fragment confirmed the identity of MuIFN-a12.
3.8. MuIFN-a12 expression in untreated, Influenza A virus infected or polyI:polyC induced L929 cells and normal murine tissues In order to help elucidate the role of MuIFN-a12, we tested whether it can be detected after induction by Influenza A virus or polyI:polyC. The conditions used were the same as our previous study on other MuIFN-as [25] for a fair comparison. Total RNA were prepared after 9 h of induction, the time point at which the most significant difference in expression levels of different IFN-a sub-
types occurred. RNA samples were then subjected to RTPCR to look for MuIFN-a4 and MuIFN-a12 expression [using the specific primer pairs (MF696/MF697) and (MF1014/MF1015)] as described. The amplification of a band using L929 genomic DNA as +ve control suggests that the PCR reaction functioned properly for all transcripts tested. As shown in Fig. 8(a), up-regulation of MuIFN-a4 RNA was observed in L929 cells infected by Influenza virus, or in cells induced with 200 lg/ml polyI:polyC. However, it was not detected in untreated L929 cells or the RT samples, suggesting that its regulation was specific. However, although MuIFN-a12 RNA was also undetectable in untreated L929 cells, it was also not detected 9 h after virus infection nor polyI:polyC treatment. This data suggests that although MuIFN-a12 shared several of the biological activities of other type I IFNs such as MuIFN-a4, it appears to be differentially regulated. In order to determine the expression profile of MuIFNa12 in normal murine tissues, total RNA samples were prepared from brains, bone marrows, hearts, kidneys, livers, lungs, spleens and thymuses of 8- to 10-week male untreated BALB/c mice as described. RNA samples were then subjected to RT-PCR using a pair of MuIFN-a12 specific primers (MF1012/MF1013) as described. As shown in Fig. 8(b), no MuIFN-a12 RNA was detected in RNA samples obtained from any of the normal murine tissues tested, which suggests that this gene has a restricted expression profile, possibly embryonic-specific. As above, L929 genomic DNA and MilliQ water were used as +ve and ve templates for the PCR reaction respectively. Taken together, our findings demonstrate that although MuIFN-a12 has biological activities similar to those of other type I IFNs, its expression profile differs markedly. 4. Discussion In this study, we have generated biologically active, recombinant MuIFN-a12 in COS-1 cells with all the hallmarks of a type I IFN. We demonstrated not only MuIFN-a12’s anti-proliferative and anti-viral activities, but also its ability on IFN mediated gene induction, as shown by up-regulation of MHC-I in both primary and transformed cells. We directly demonstrated MuIFN-a12 expression in 15- to 18-day embryos of BALB/c mice by RT-PCR. However, we were unable to demonstrate that MuIFN-a12 expression could be regulated, suggesting that in this area, MuIFN-a12 differs from other type I IFNs such as MuIFN-a4, whose expression is regulated by viral infection. IFN-a is believed to bring about its anti-proliferative effects by cell-cycle arrest and/or by inducing apoptosis. These two pathways have been shown to be independent of each other [12]. We took a similar approach to that of Yanai et al. [26] and Oritani et al. [7], by using propidium iodide staining and flow cytometry to analyze the DNA content of JCS cells. We found that rMuIFN-a12 could
S.L. Tsang et al. / Cytokine 37 (2007) 138–149
145
Fig. 4. Effect of different rMuIFN-a subtypes on the expression of MHC-I in JCS cell line. JCS cells were incubated with approximately 5, 50 or 500 IU/ ml of various rMuIFN-a for 36 h and then stained with FITC-conjugated anti-mouse MHC-I antibody as described. X-axis denotes the log FL1 signal while the Y-axis denotes the events (cell number counted). (b–d) The open peaks from left to right are showing the responses to 5, 50 and 500 IU/ml of rMUIFN-a, respectively. (a–d) Mock supernatant, rMuIFN-a12, rMuIFN-a4 and mixed type I IFN.
induce apoptosis in approximately 10.0% of cells, similar to the level observed for rMuIFN-a4. In contrast, less than 0.5% of JCS cells were apoptotic when left untreated or treated with a placebo. Our results suggest that rMuIFNa12 can induce apoptosis and we speculate that this to be a possible mechanism for the anti-proliferative effects of rMuIFN-a12. The specific activity of MuIFN-a12 was estimated to be in the order of 1 · 108 IU/mg. As a control of this measurement, MuIFN-a4 was also included and found to be about the same order. These results agree with the previous findings by van Pesch et al. [16] that MuIFN-a12 have a slightly higher potency than MuIFN-a4. The result suggests that MuIFN-a12 may be working at physiological relevant concentrations (e.g. in embryonic stages) in which only limited amounts of IFN mRNA or proteins were detected. To test for anti-viral activity, we chose to take the approach similar to the one described by Harle et al. [24],
which involved transfecting L929 cells with MuIFN-a12 transgene and challenging with Influenza A virus. Our results agree with previous work by van Pesch et al. [16] by the clear antiviral effect of MuIFN-a12 transgene on cells. Type I IFNs are important in the first stage of the immune response against pathogens, especially in eliciting innate immune responses [27,28]. These effects include induction of anti-viral state, up-regulation of MHC-I expression, activation of NK cells and many others [1,14,15]. The experimental setup we employed to determine whether MuIFN-a12 can lead to IFN-mediated gene induction, as demonstrated by MHC-I expression, was similar to Yanai et al. [26] We showed that rMuIFN-a12, like the other MuIFN-a subtypes tested, could up-regulate the expression of MHC-I on murine JCS cells in a dosedependent manner within the first 36 h of induction. We also repeated the experiment using primary macrophages, which concurred with the earlier experiments. These results
146
S.L. Tsang et al. / Cytokine 37 (2007) 138–149
Fig. 5. Effect of different rMuIFN-a subtypes on MHC-I expression of primary macrophages from BALB/c mice. (a–d) Showed the effect of different rMuIFN-a subtypes on MHC-I expression of primary macrophages prepared from 8–10 weeks male untreated BALB/c mice. Macrophages were prepared from two 8–10 weeks male BALB/c mice as described. Approximately 500 IU/ml of rMuIFN-a12, rMuIFN-a4, mixed type I IFN, (b–d) or comparable amount of mock supernatant (a) were added to the primary macrophages and incubated for 48 h. The cells were then harvested, stained with FITCconjugated anti-mouse MHC-I antibody and subjected to FACS analysis. The X-axis denotes the log FL1 signal while the Y-axis denotes the events (cell number counted).
demonstrate that rMuIFN-a12 can regulate MHC-I expression and thus may lead to IFN-mediated gene induction. Previous reports indicate that MuIFN-a12 is expressed during murine embryonic development. Reigo et al. [21] cloned a partial sequence of MuIFN-a12 from undifferentiated embryonal carcinoma cell line P19, while Hardy et al. [5] detected MuIFN-a12 in a MEF cDNA library made from mice of mixed origin. In this report, we directly demonstrate MuIFN-a12 expression in BALB/c embryos by RT-PCR, which concurs with the previous evidence described above. Several MuIFN-a subtypes such as MuIFN-a4 are highly up-regulated by both virus and polyI:polyC [25]. However, the regulation of MuIFN-a12 has not yet been investigated directly. To answer this question, we looked to see whether MuIFN-a12 mRNA levels could be altered
in cells infected with Influenza A virus or induced by polyI:polyC, under conditions which many other subtypes did in our previous report [25]. In addition, we also tested a range of normal murine tissues to gain an understanding of the spatial expression profile of MuIFN-a12. MuIFNa12 expression was unaffected by the inducers under the conditions used, suggesting that the mechanisms of regulation of MuIFN-a12 differ from that of MuIFN-a4, whose expression could be induced by these agents 9 h after induction. According to van Pesch et al. [16], the IRF-3 binding site of MuIFN-a12, but not MuIFN-a4, in C57BL/6 have two nucleotides different from that of consensus sequence of virus-response element of IFN-a promoter. This may thus also account for the different response of MuIFN-a12 and MuIFN-a4 in our experiments. In addition, different viruses are known to differentially regulate expression of several MuIFN-a subtypes
S.L. Tsang et al. / Cytokine 37 (2007) 138–149
147
Fig. 6. Effect of MuIFN-a subtype transgene on L929 cells infected with Influenza A virus. L929 cells in 6-well plate were transfected with 3 lg of (a) pEGFP-N1, (b) pEGFP-N1_MuIFN-a12 or (c) pEGFP-N1_MuIFN-a4 DNA as described. Twenty-four hours later, they were challenged with Influenza A virus at MOI of 0.2. Sixteen hours later, photographs of the cell culture were taken under light microscopy.
Fig. 7. Demonstration of MuIFN-a12 in embryo RNA by RT-PCR The gel photo showed the results of PCR on RT+ and RT templates made from embryo RNA using GAPDH primer pair (MF214/MF215) and MuIFN-a12-specific primers (MF1014/MF1015) and (MF1012/MF1013) as described. The RT-PCR products obtained using primer pair (MF1012/ MF1013) was gel purified and directly sequenced.
(e.g. MuIFN-a1) [25], suggesting that MuIFN-a12 expression could still be induced by other viruses or inducers. The lack of detectable expression of MuIFN-a12 in normal adult murine tissues has two implications. First, the expression may be temporally regulated. We have shown that MuIFN-a12 was expressed during murine embryonic development. This is also backed up by previous data which showed the MuIFN-a12 cDNA cloned from MEFs [5] and that other type I IFNs are also expressed during
development [21]. Second, MuIFN-a12 may be expressed in a relatively small population of cells (e.g. Langerhan’s cells, kupffer cells) that may be difficult to isolate and amplify by RT-PCR, or in tissues not tested in this study. Although van Pesch et al. [20] was able to demonstrate MuIFN-a12 expression in murine brain tissue, we were unable to detect expression. However, there are differences in the mouse strain from which these tissues derived (BALB/c versus IFNAR-1/ 129/Sv), which may account for the experimental differences observed. Given the high level of nucleotide and amino acid homology between MuIFN-a12 and the other alpha family members (such as MuIFN-a8/6 and MuIFN-a1), it is difficult to interpret expression information gained from other sources such as expressed sequence tag databases. Recently, Hadj-Slimane et al. [29] have reported the differential expression of MuIFN-a12 in the spleens of MRL/ lpr mice when comparing to MRL+/+ mice. Together with the fact that MuIFN-a12 and MuIFN-aA are cloned among other MuIFN-a subtypes in mouse embryo [21], these uncommon properties of MuIFN-a12 deserve further investigation which may help in the understanding of differences, if any, among the various MuIFN-a subtypes. In conclusion, we have demonstrated that the MuIFNa12 gene encodes a functional protein with anti-proliferative
148
S.L. Tsang et al. / Cytokine 37 (2007) 138–149
Fig. 8. Detection of MuIFN-a12 transcripts in untreated, Influenza A virus-infected or polyI:polyC-induced L929 cells as well as normal murine tissues from BALB/c mice. (a) RT-PCR for the detection of GAPDH, MuIFN-a4 or MuIFN-a12 in untreated, Influenza A virus infected or polyI:polyC-induced L929 cells. (b) RT-PCR for the detection of MuIFN-a12 using RT+ and RT templates obtained from various tissues of untreated BALB/c mice. Lanes (1 and a): bone marrow, (2 and b): brain, (3 and c): heart, (4 and d): kidney, (5 and d): liver, (6 and f): lung, (7 and g): spleen, (8 and h): thymus, (i) L929 genomic DNA as +ve control, (j) H2O as ve control.
and anti-viral functions. As it can also up-regulate MHC-I expression, it may lead to IFN-mediated gene induction. These results make it a very likely candidate for a novel, bona fide, type I IFN. Acknowledgments We thank Mr Lau, Kwok Wing, Miss Kong, Lai Ping, Mr Kwok, Chi Hung and staff from Laboratory Animal Services Centre of CUHK for technical assistances. We also thank Miss Leung, Chung Yee and Miss Yiu, Nai Sum for their help in the preparation of Influenza A virus, and NIAID Antiviral Substances Program of NIH for providing an antibody preparation and the IFN standards for use in the preparation of our MuIFN. References [1] Isaacs A, Lindenmann J. Virus interference. I. The interferon. Proc R Soc Lond B Biol Sci 1957;147:258–67. [2] Hauptmann R, Swetly P. A novel class of human type I interferons. Nucleic Acids Res 1985;13:4739–49.
[3] Roberts RM, Cross JC, Leaman DW. Unique features of the trophoblast interferons. Pharmacol Ther 1991;51:329–45. [4] LaFleur DW, Nardelli B, Tsareva T, Mather D, Feng P, Semenuk M, et al. Interferon-kappa, a novel type I interferon expressed in human keratinocytes. J Biol Chem 2001;276:39765–71. [5] Hardy MP, Owczarek CM, Jermiin LS, Ejdeback M, Hertzog PJ. Characterization of the type I interferon locus and identification of novel genes. Genomics 2004;84:331–45. [6] Lefevre F, Guillomot M, D’Andrea S, Battegay S, La BC. Interferondelta: the first member of a novel type I interferon family. Biochimie 1998;80:779–88. [7] Oritani K, Medina KL, Tomiyama Y, Ishikawa J, Okajima Y, Ogawa M, et al. Limitin: an interferon-like cytokine that preferentially influences B-lymphocyte precursors. Nat Med 2000;6:659–66. [8] Oritani K, Kincade PW, Zhang C, Tomiyama Y, Matsuzawa Y. Type I interferons and limitin: a comparison of structures, receptors, and functions. Cytokine Growth Factor Rev 2001;12:337–48. [9] Kotenko SV, Gallagher G, Baurin VV, Lewis-Antes A, Shen M, Shah NK, et al. IFN-lambdas mediate antiviral protection through a distinct class II cytokine receptor complex. Nat Immunol 2003;4:69–77. [10] Sheppard P, Kindsvogel W, Xu W, Henderson K, Schlutsmeyer S, Whitmore TE, et al. IL-28, IL-29 and their class II cytokine receptor IL-28R. Nat Immunol 2003;4:63–8. [11] Pestka S, Krause CD, Walter MR. Interferons, interferon-like cytokines, and their receptors. Immunol Rev 2004;202:8–32.
S.L. Tsang et al. / Cytokine 37 (2007) 138–149 [12] Sandoval R, Xue J, Pilkinton M, Salvi D, Kiyokawa H, Colamonici OR. Different requirements for the cytostatic and apoptotic effects of type I interferons. Induction of apoptosis requires ARF but not p53 in osteosarcoma cell lines. J Biol Chem 2004;279:32275–80. [13] Clemens MJ. Interferons and apoptosis. J Interferon Cytokine Res 2003;23:277–92. [14] Reiter Z, Fischer DG, Rubinstein M. The protective effect of interferon against natural killing activity is not mediated via the expression of class I MHC antigens. Immunol Lett 1988;17:323–8. [15] Reiter Z. Interferon – a major regulator of natural killer cell-mediated cytotoxicity. J Interferon Res 1993;13:247–57. [16] van Pesch V, Lanaya H, Renauld JC, Michiels T. Characterization of the murine alpha interferon gene family. J Virol 2004;78:8219–28. [17] Diaz MO, Pomykala HM, Bohlander SK, Maltepe E, Malik K, Brownstein B, et al. Structure of the human type-I interferon gene cluster determined from a YAC clone contig. Genomics 1994;22:540–52. [18] Hughes AL. The evolution of the type I interferon gene family in mammals. J Mol Evol 1995;41:539–48. [19] Capon DJ, Shepard HM, Goeddel DV. Two distinct families of human and bovine interferon-alpha genes are coordinately expressed and encode functional polypeptides. Mol Cell Biol 1985;5:768–79. [20] Van Pesch V, Michiels T. Characterization of interferon-alpha 13, a novel constitutive murine interferon-alpha subtype. J Biol Chem 2003;278:46321–8. [21] Riego E, Perez A, Martinez R, Castro FO, Lleonart R, de la FJ. Differential constitutive expression of interferon genes in early mouse embryos. Mol Reprod Dev 1995;41:157–66.
149
[22] Trapman J. A systematic study of interferon production by mouse L929 cells induced with poly(I):poly(C) and DEAE-dextran. FEBS Lett 1979;98:107–10. [23] Loveland BE, Johns TG, Mackay IR, Vaillant F, Wang ZX, Hertzog PJ. Validation of the MTT dye assay for enumeration of cells in proliferative and antiproliferative assays. Biochem Int 1992;27:501–10. [24] Harle P, Cull V, Agbaga MP, Silverman R, Williams BR, James C, et al. Differential effect of murine alpha/beta interferon transgenes on antagonization of herpes simplex virus type 1 replication. J Virol 2002;76:6558–67. [25] Fung MC, Sia SF, Leung KN, Mak NK. Detection of differential expression of mouse interferon-alpha subtypes by polymerase chain reaction using specific primers. J Immunol Methods 2004;284:177–86. [26] Yanai Y, Sanou O, Yamamoto K, Yamauchi H, Ikegami H, Kurimoto M. The anti-tumor activities of interferon (IFN)-alpha in chronic myelogenous leukaemia (CML)-derived cell lines depends on the IFN-alpha subtypes. Cancer Lett 2002;185:173–9. [27] Kadowaki N, Antonenko S, Lau JY, Liu YJ. Natural interferon alpha/beta-producing cells link innate and adaptive immunity. J Exp Med 2000;192:219–26. [28] Tough DF. Type I interferon as a link between innate and adaptive immunity through dendritic cell stimulation. Leuk Lymphoma 2004;45:257–64. [29] Hadj-Slimane R, Chelbi-Alix MK, Tovey MG, Bobe P. An essential role for IFN-alpha in the overexpression of Fas ligand on MRL/lpr lymphocytes and on their spontaneous Fas-mediated cytotoxic potential. J Interferon Cytokine Res 2004;24:717–28.
Characterization of murine interferon-alpha 12 (MuIFN-a12): Biological activities and gene expression Sai Leong Tsang a, Po Chu Leung a, Ka Kit Leung a, Wai Lok Yau a, Matthew P. Hardy b, Nai Ki Mak c, Kwok Nam Leung d, Ming Chiu Fung a,* a
d
Department of Biology, The Chinese University of Hong Kong, Shatin, Hong Kong b CSL Limited, 45 Poplar Road, Parkville, Vic. 3052, Australia c Department of Biology, Hong Kong Baptist University, Kowloon, Hong Kong Department of Biochemistry, The Chinese University of Hong Kong, Shatin, Hong Kong
Received 7 May 2006; received in revised form 12 February 2007; accepted 12 March 2007
Abstract Interferon alpha (IFN-a) belongs to the type I interferon family and consists of multiple subtypes in many species. In the mouse, there are at least 14 IFN-a genes and 3 IFN-a pseudogenes, the most recently identified of which are murine interferon-alpha 12 (MuIFN-a12), MuIFN-a13 and MuIFN-a14. To further study the biological activities of MuIFN-a12, we have produced a recombinant MuIFN-a12 (rMuIFN-a12) protein using COS-1 cells. rMuIFN-a12 was found to inhibit the growth of murine myeloid leukemia JCS cells. Flow cytofluorometric analysis with propidium iodide staining showed that the growth inhibitory activity of rMuIFN-a12 may be caused by the induction of apoptosis. Flow cytofluorometric analysis also revealed that rMuIFN-a12 was able to up-regulate the expression of MHC-I on both JCS cells and primary macrophages. Functional studies indicated that a MuIFN-a12 transgene could induce an anti-viral state in L929 cells against Influenza A virus. Moreover, expression of MuIFN-a12 was not detectable by RT-PCR in untreated, Influenza A virus infected, polyI:polyC induced L929 cells, or in a wide range of normal murine tissues. Taken together, this data shows that MuIFN-a12 is a protein with all the biological traits of a type I IFN. 2007 Elsevier Ltd. All rights reserved. Keywords: Interferon alpha-12; Subtype; Antiviral; Apoptosis; Antiproliferation; Gene expression
1. Introduction Interferon (IFN) was first reported by Isaacs and Lindenmann in 1957 as an anti-viral protein [1]. IFNs are now classified into two distinct types, type I and type II. Type I IFN consists of seven classes: interferon a, b, x [2], s [3], j [4], e [5] and d [6]. Four IFN-like cytokines have also been reported: limitin [7,8] (found only in mice), interleukin-28A (IL-28A), IL-28B, and IL-29 found in humans
*
Corresponding author. Fax: +852 2603 5745. E-mail addresses: [email protected] (S.L. Tsang), terisapc@ yahoo.com (P.C. Leung), [email protected] (K.K. Leung), wailok@cuhk. edu.hk (W.L. Yau), [email protected] (M.P. Hardy), nkmak@hkbu. edu.hk (N.K. Mak), [email protected] (K.N. Leung), mingchiufung@ cuhk.edu.hk (M.C. Fung). 1043-4666/$ - see front matter 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.cyto.2007.03.002
and other mammals [9,10]. For a recent review of interferons please refer to Pestka et al. [11]. In addition to its wellknown anti-viral activity, IFN-a has anti-proliferative activity on target cells by proposed mechanisms of cellcycle arrest and apoptosis [12,13]. IFN-a also plays an important role in the regulation of MHC-I expression, and in the augmentation of natural killer cells [14,15]. The mouse type I IFN gene cluster has recently been characterized. [5,16] The murine interferon-alpha (MuIFN-a) family consists of at least 14 subtypes. Within the MuIFN-a cluster, the alpha genes were flanked at 5 0 and 3 0 ends by beta and epsilon genes while having a limitin cluster in the centre. As the different MuIFN-a gene have high nucleotide and amino acid similarity, it is likely that these genes arose by gene duplication via unequal recombination following the divergence of MuIFN-a and MuIFN-b
S.L. Tsang et al. / Cytokine 37 (2007) 138–149
[17–19]. The most recently cloned subtypes MuIFN-a12, MuIFN-a13 and MuIFN-a14 were found to have antiviral and anti-proliferative activity [16]. Unlike other IFN-a subtypes, MuIFN-a13 is constitutively expressed in uninduced L929 cells, and this expression level does not increase upon viral infection [20]. MuIFN-a12 was suggested to be expressed in mice during embryonic development [5,21]. The MuIFN-a12 gene was also found to encode a functional protein [16]. However, the regulation of MuIFN-a12 expression and its biological activities have not yet been fully characterized. In this study, we examined MuIFN-a12 for its ability to act functionally as a type I IFN. We analyzed its biological activities such as cell growth, apoptosis and IFN-mediated gene induction (demonstrated by MHC-I induction), and examined the regulation of MuIFN-a12 expression by RT-PCR in a range of normal and induced cell lines and tissues. What we identified was a functional member of the type I interferon family. 2. Materials and methods 2.1. Cell culture and virus strain COS-1 cell line was a gift from Dr. Ge Wei (The Chinese University of Hong Kong, CUHK) and was passed in Dulbecco’s modified Eagle’s medium with 10% fetal calf serum (FCS) (DMEM-10). L929 cell line was obtained from Dr. K.N. Leung (CUHK) and passed either in EMEM-10 (Eagle’s minimal essential medium), DMEM-10 or RPMI-10 (RPMI-1640). JCS cell line was also obtained from Dr. K.N. Leung and was maintained in RPMI-10. MDCK cell line, used in the titration of Influenza A virus, was a gift from Dr. Vincent Ooi (CUHK). For suspension cell lines, they were split into new medium according to the ratio suggested by ATCC. For adherent cell lines, they were passed before confluent. The Influenza A virus used was ATCC VR-219, strain A/NWS/33, obtained from Dr. N. K. Mak (Hong Kong Baptist University). 2.2. Construction of clones for protein expression MuIFN-a12 was amplified from L929 genomic DNA using Advantage 2 polymerase (Clontech) and primer pair (MF1012/MF1013). The PCR products were TA-cloned into pGEM-T vector (Promega). The gene was then excised by EagI and SpeI and subcloned into a pBluescriptII (SK) vector (Stratagene) cut with EagI and XbaI. The MuIFN-a12 gene harbored in pBluescriptII (SK) vector was then excised by SacI and BamHI, subcloned into the SacI and BamHI sites of the expression vector pEGFP-N1 (Clontech), giving pEGFP-N1_MuIFN-a12. MuIFN-a4 was amplified by Pfx polymerase (Invitrogen) with primer pair (MF696/MF697). The blunt end PCR product was then ligated into pEGFP-N1 previously cut with SmaI. The recombinant plasmid was designated as pEGFPN1_MuIFN-a4. Sequencing of the DNA insert confirmed
139
correct orientation and no mutations. In all constructs, no part of the EGFP protein was expressed. 2.3. Production of recombinant MuIFN-a (rMuIFN-a) and production of native MuIFN-a by polyI:polyC induction COS-1 cells (2 · 105)/well were seeded in 6-well plates and incubated at 37 C, 5% CO2 overnight or until 60–80% confluent. The cells were transfected by 3 lg of DNA using 4 ll of DMRIE-C reagent (Invitrogen). The culture medium was collected 2 d later. Fresh DMEM-10 was added, collected again 2 d thereafter and this procedure was repeated three times till day 8. The supernatants collected were 0.22 lm filter sterilized and kept at 4 C for temporary storage. Whenever possible, they were adjusted to pH 2 by 1 N HCl, incubated at 20 C for 24 h and then neutralized back to pH 7–7.5 by 1 M NaOH. The IFN preparations were then filter sterilized and stored at 4 C. The induction of native, mixed type I IFN from L929 by polyI:polyC was done according to the paper of Trapman [22]. IFN in the supernatant was then collected, FCS equal to 1/9th of the volume was added to adjust the samples into DMEM-10, and was then acidified as above. The FCS was added to extend the shelf-life of the MuIFN-a. 2.4. MTT cell-proliferation assay The assay was performed similarly as described by Loveland et al. [23]. Twofold serial dilution of MuIFN-a samples were made in 100 ll RPMI-10 medium using 96well U-bottom plates. JCS (3 · 102) cells in 100 ll RPMI10 medium were then added to each well. Seventy-two hours later, 20 ll MTT solution (5 mg/ml) was added to each well and mixed. The cells were further incubated at 37 C, 5% CO2 for 3 h. The cells were then spun at 1500 rpm for 10 min and medium were removed. One hundred microliters of DMSO was added to each well to elute the dye and the color intensity at 540 and 690 nm was measured by ELISA plate reader. The final readings were OD540 OD690. The data were reported as % of growth vs dilution of MuIFN preparation, in which the % of growth was calculated as (OD of sample/OD of averaged cell only control) · 100%. The results were then analyzed by Prism 4.0, a rectangular hyperbola curve was fitted to each set of data. The goodness of fit was measured in R2 value. The data points which were out of range of a previously established linear relationship, between the OD value and the cell number, were omitted. Means ± SEM were plotted from triplicate determinations. 2.5. Quantification of MuIFN preparations and estimation of specific activity To quantify the MuIFN samples in terms of IU/ml, the amount of samples used to make 50% growth inhibition in the MTT cell proliferation assay described was compared
140
S.L. Tsang et al. / Cytokine 37 (2007) 138–149
to that using the NIH IFN standard (NIAID Cat. No. Ga02-901-511) for murine interferon. The values were directly calculated using Prism 4.0. The amount of IFN protein present in the samples was estimated by ELISA using the NIH IFN standard as the reference material. This standard was made using a purified mixed type I IFN, with specific activity of 1.7 · 106 IU/mg, as starting material. Thus 1 IU will be approximately 0.59 ng of IFN protein. Briefly, 2-fold serial dilutions of NIH IFN standard or samples in carbonate coating buffer (pH 9.6, 0.15 M sodium carbonate, 0.35 M sodium bicarbonate) was coated onto an ELISA plate. The plate was left in 37 C for 4 h. The plate was then washed with PBS–Tween (PBS with 0.05% Tween 20) and incubated for 1 h using NIH IFN antiserum (NIAID Cat. No. G024-501-568) at 1:5000, washed and then incubated for 1 h using 1:3000 alkaline phosphatase conjugated, rabbit anti-goat antibody (Sigma Cat. No. A-4187) and the signal was then developed using p-nitrophenylphosphate (Bio-Rad alkaline phosphatase substrate kit, Cat. No. 172–1063). The signals were measured at 405 nm and results were calculated from triplicate determinations. 2.6. Flow cytofluorometric analysis of cell cycle by propidium iodide staining JCS cells (1 · 106) were seeded in 10 ml RPMI-10 medium in four 25 cm2 flasks. Two-hundred microliters mock supernatant, approximately 200 IU/ml rMuIFN-a12 or approximately 200 IU/ml rMuIFN-a4 were added to three of the flasks. One was left untreated throughout the study. Twenty-four hours later, the cells were spun down and washed with cold Dulbecco’s phosphate-buffered saline (DPBS) (Gibco). The pellets were then resuspended and fixed in 2 ml cold 70% ethanol and left overnight at 4 C. Twenty-four hours later, the cells were spun down and washed twice with cold DPBS as before. Finally the cells were resuspended in 1.8 ml cold DPBS with RNaseA (final concentration 50 lg/ml), and 200 ll propidium iodide solution (0.5 mg/ml) was added. The samples were incubated for 30 min at 37 C, protected from light and then immediately analyzed by the Beckman Dickinson FACS machine. The DNA content of the cells was measured and the cell numbers were counted. The data and cell-cycle distributions were analyzed by ModFit and then by Prism 4.0. Data are means ± SEM of three independent experiments. P values were calculated with t test. 2.7. FACS study on the effect of MuIFN on MHC-I upregulation in JCS cells JCS cells (1 · 106) were incubated in 2 ml RPMI-10, with approximately 5, 50 or 500 IU/ml of different MuIFN-a. Thirty-six hours later the cells were harvested by leaving at room temperature for 30 min. Cells (1 · 106) were spun at 1500 rpm for 5 min and were resuspended in 200 ll FACS medium (2% heat-inactivated FCS
and 0.05% NaN3 in DPBS). Cells were washed once by FACS medium. The pellets were then resuspended again with 2 lg rat IgG and 2 lg mouse IgG in 200 ll DPBS and incubated at 4 C for 30 min with occasional shaking. The cells were washed once with FACS medium and then resuspended with 0.5 ll FITC-conjugated anti-mouse MHC-I antibody (0.5 mg/ml, BD Biosciences Cat. No. 553565) in 100 ll solution which consisted of 50 ll DPBS and 50 ll FACS medium. The samples were incubated at 4 C for 1 h and then washed twice with FACS medium. Finally the pellets were resuspended in 600 ll FACS fixative (1% formaldehyde in DPBS) and the analysis was performed in the FACS machine. 2.8. FACS study on the effect of MuIFN on MHC-I upregulation in primary macrophages from BALB/c mice Two 8- to 10-week male BALB/c mice were injected intraperitoneally with 1.5 ml 3% thioglycollate solution. Three days later, the mice were sacrificed and the peritoneal exudate cells (PEC) were harvested with cold DPBS in 15 ml centrifuge tube and washed with RPMI-10 medium. Cells (1 · 106) were added to each well of a 6-well plate. Three hours later the unattached cells were washed away using RPMI-10 medium. Two days later, mock supernatant or approximately 500 IU/ml of rMuIFN-a12, rMuIFN-a4 or mixed type I IFN were added. Forty-eight hours later, the cells were harvested with DPBS containing 0.2% EDTA and then processed as above. 2.9. Anti-viral activity acquired by transfection of MuIFN-a gene The assay was performed similar to the setup by Harle et al. [24], except the virus we used here was Influenza A virus. L929 cells (2 · 105) per well were seeded in a 6-well plate until 60–80% confluent. The cells were then transfected with 3 lg plasmid DNA using DMRIE-C as described above. Twenty-four hours later the cells were challenged with virus at MOI (multiplicity of infection) of 0.2 as in Fung et al. [25] 16–20 h later, the cultures were observed under light microscope and photos were taken. The protection was determined by the degree of cytopathic effect. 2.10. RNA extractions 2.10.1. RNA extraction by CsCl method, Trizol reagent and treatment with RNase-free DNaseI To collect RNA by CsCl method, the cells were lysed in 4 M Guanidinium thiocyanate (GT) solution, loaded onto 5.7 M CsCl cushion and ultracentrifuged at 4 C and 160,000g for 16 h. The supernatant was carefully removed and the RNA was eluted with DEPC-treated water. The RNA samples were further purified by Trizol reagent (Invitrogen) as described in the manufacturer’s manual. After that the samples were further treated by RNase-free DNaseI (RQ1 RNase-Free Dnase, Promega). The RNA
S.L. Tsang et al. / Cytokine 37 (2007) 138–149
samples were then immediately extracted with phenol/chloroform/isoamyl mixture (PCI) and ethanol precipitated. RNA extraction from 15–18-day embryos of BALB/c mice: Several 15–18 day embryos were obtained from pregnant BALB/c mice. The head and internal organs were removed. The remaining parts were cut into small pieces and homogenized in Trizol reagent. RNA was then treated with RNase-free DNaseI as described above. RNA extraction from L929 cell lines, with or without Influenza A virus infection or polyI:polyC induction: L929 cells were seeded in 6-well plates until confluent. Then 200 lg/ml polyI:polyC and 100 lg/ml Dextran were added. After 9 h of incubation, RNA was collected by the CsCl method as described. For the cells infected with Influenza A virus at MOI of 0.2, the RNA was also collected by the CsCl method 9 h after the re-supply of medium. RNA extraction from tissues of BALB/c mouse: three male 8–10 week BALB/c mice were sacrificed and the brains, bone marrows, hearts, kidneys, livers, lungs, spleens and thymuses were collected. They were lysed in 4 M GT solution. The lysates were then processed as above. 2.11. Reverse transcription RNA were diluted into 1 lg in 10 ll and added to 10 ll reaction mixture which contained 2 ll DTT, 4 ll 5 · 1st strand buffer, 1 ll dNTP (10 mM each), 1 ll 0.1 lg/ll oligo dT, 1 ll Rnasin and 1 ll of MMLV-RT enzyme (Invitrogen). The RT reactions were carried out at 37 C for 1 h and then boiled at 95 C for 5 min. DEPC-treated water was used in place of MMLV-RT enzyme in RT negative control (RT). 2.12. Polymerase chain reaction (PCR) For cloning purpose, the PCRs were done using polymerase with proof-reading ability, e.g. Advantage 2 (Clontech) or Pfx (Invitrogen). For analysis purpose, they were performed using Thermoprime plus polymerase (AB gene). For a 50-ll reaction, 25 pmol of each primer was used, and 1 ll 10 mM dNTP mix was added. For cloning of MuIFN-a12 and MuIFN-a4, the PCR profile used was 94 C 4 min, 25 cycles of 94 C 1 min, 56 C 1 min, 72 C 1 min and then extension at 72 C for 3 min. For RT-PCR detection of MuIFN-a12, MuIFNa4 and GAPDH, 35 cycles but otherwise the same PCR profile was used. In preparing templates for direct sequencing, PCR of 50 cycles was performed with the above profile. The sequences of the primers were shown in Table 1. Fig. 1 illustrates the expected primer binding sites for primers MF1012, MF1013, MF1014 and MF1015. Primers (MF1014/MF1015) bind within the open-reading frame of MuIFN-a12 while primers (MF1012/MF1013) bind on 5 0 -UTR and 3 0 -UTR, respectively. The two sets of primers (MF1014/MF1015) and (MF1012/MF1013) were expected to be specific to
141
MuIFN-a12 as they can be used to amplify MuIFN-a12 either from genomic DNA or from RT products made from embryo RNA, in which the PCR products were confirmed by direct sequencing. 3. Results 3.1. The antiproliferative effects of recombinant MuIFN In order to determine whether MuIFN-a12 has antiproliferative properties, we expressed a recombinant form of MuIFN-a12 as a secreted protein from COS-1 cells by transient transfection and tested it in an anti-proliferative assay on JCS cells. As positive controls in the anti-proliferative assay, NIH IFN standard, rMuIFN-a4 and polyI:polyC induced mixed type I IFN were used. Supernatant taken from COS-1 cells transfected with vector alone was used as a negative control. As shown in Fig. 2, the mock supernatant had no effect on the rate of JCS cell proliferation, even at low dilutions. In contrast, the positive control samples (rMuIFN-a4, mixed type I IFN and NIH IFN standard) were able to inhibit the proliferation of JCS cells in a dose-dependent manner (from dilution of 1:40 to 1:1280) up to 80% for the lowest dilution tested. When the rMuIFN-a12-containing COS-1 cell supernatant was tested, we also observed a dose-dependent inhibition of proliferation to a level similar to that of the other type I IFNs, suggesting that rMuIFN-a12 has antiproliferative activity. The goodness of fit was measured by R2 and was 0.0318 for the mock supernatant and >0.930 for rMuIFN-a12, rMuIFN-a4, NIH IFN standard and mixed type I IFN. 3.2. Quantification of MuIFN preparations and estimation of specific activity To quantify the amount of MuIFN produced by the transfected COS-1 cells, the amount of MuIFN that made 50% growth inhibition based on the MTT cell-proliferation assay aforementioned was compared to that using NIH IFN standard. Our MuIFN preparations were found to give about 1000 IU/ml. Since the mock supernatant had little effect on JCS cell growth at all dilutions, its potency could not be determined, and so a comparable volume to the rMuIFN-a12 preparation used was chosen as control in later experiments. The mean of triplicate estimations of specific activity (IU/mg) of rMuIFN-a12 and rMuIFN-a4 were 2.91 and 2.47 · 108 IU/mg, respectively, both with ranges in the order of 1 · 108 IU/mg (data not shown). 3.3. Cell-cycle analysis of rMuIFN-a-treated JCS cells To further study the antiproliferative effects of recombinant MuIFN-a12, we performed a cell-cycle analysis on rMuIFN-a12-treated JCS cells. The rMuIFN-a-treated or -untreated JCS cells were stained with propidium iodide
142
S.L. Tsang et al. / Cytokine 37 (2007) 138–149
Table 1 PCR primers used in cloning and RT-PCR of the MuIFN-as Name
Sequence (5 0 –3 0 )
Purpose
Direction
MF214 MF215 MF696 MF697 MF1012 MF1013 MF1014 MF1015
ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA CAGAGAGCGACCAGCATGTAC AACACGGTTTTGCATATTGAGAAG CCAAACAGCCCAGAGGACAAA ATGACAGTTCTCTCCATTTTGCT CTTTCCTGATGACCCTGCTAG TCTTGATCTGCTGGGCATTCC
RT-PCR of GAPDH
Sense Antisense Sense Antisense Sense Antisense Sense Antisense
Cloning and RT-PCR of MuIFN-a4 Cloning and RT-PCR of MuIFN-a12 RT-PCR of MuIFN-a12
up-regulation of MHC-I expression was observed (Fig. 4(b)), suggesting that rMuIFN-a12 can lead to IFN mediated gene induction. For both rMuIFN-a12 and rMuIFN-a4, the fluorescence can be increased to around 10-fold.
Fig. 1. Primers for amplification of MuIFN-a12 MF1014/MF1015 bind within the open-reading frame of MuIFN-a12 while MF1012/MF1013 bind in the 5 0 -UTR and 3 0 -UTR, respectively.
and subjected to FACS analysis as described. Since cells with DNA content less than diploid (sub-G1 peak) are apoptotic, we calculated the percentage of untreated JCS cells or cells treated with mock supernatant, rMuIFN-a12 or rMuIFN-a4, undergoing apoptosis (Fig. 3). In the case of untreated cells, only very few cells (<0.5%) were found to be apoptotic. No significant difference was observed in JCS cells treated with mock supernatant (<0.5%), (P > 0.5). However, for JCS cells treated with approximately 200 IU/ml of rMuIFN-a12 or rMuIFN-a4, apoptosis were found to be significantly higher (P < 0.05), at about 10.0% (Fig. 3). These data suggest that induction of apoptosis can be one of the mechanisms by which MuIFN-a12 exerts anti-proliferative effect. 3.4. FACS analysis of the effect of different MuIFN-a subtypes on MHC-I expression in JCS cell line To test whether MuIFN-a12 can lead to IFN-mediated gene induction similar to other type I IFNs, we measured its ability to up-regulate the expression of MHC-I in JCS cells. JCS cells were treated with different dosages (approximately 5, 50 and 500 IU/ml) of rMuIFN-a12, rMuIFN-a4, mixed type I IFN or comparable volume of mock supernatant for 36 h. The cells were then subjected to FACS staining as described. As shown in Fig. 4(a), mock supernatant did not alter MHC-I expression in JCS cells. However, approximately 5, 50 and 500 IU/ml rMuIFN-a4 (Fig. 4(c)) and mixed type I IFN (Fig. 4(d)) was able to up-regulate MHC-I expression in JCS cells in a dose-dependent manner. When the same concentrations of rMuIFN-a12 were tested for their ability to modulate MHC-I expression on JCS cells, a similar, dose-dependent
3.5. FACS analysis of the effect of different MuIFN-a subtypes on MHC-I expression in primary macrophages of BALB/c mice To test whether MuIFN-a12 also exerts its IFN-mediated gene induction effect on MHC-I expression on primary cells in addition to cell lines such as JCS cells, we repeated the above experiment on primary macrophages taken from untreated BALB/c mice. Primary macrophages were treated with approximately 500 IU/ml of rMuIFNa12, rMuIFN-a4 or mixed type I IFN. Fig. 5(a)–(d) show the effect of mock supernatant, rMuIFN-a12, rMuIFN-a4 or mixed type I IFN on MHC-I expression in primary macrophages prepared from BALB/c mice. rMuIFN-a12, rMuIFN-a4 and mixed type I IFN could up-regulate the MHC-I expression in primary macrophages. However, this time the magnitude of increase in fluorescence is only around 3- to 5-fold, less than that in JCS cells. 3.6. Effect of MuIFN-a12 on Influenza A virus challenged L929 cells In order to determine whether MuIFN-a12 has antiviral properties, its ability to protect cells against viral infection was examined. L929 cells were transiently transfected with expression constructs encoding MuIFN-a12, MuIFN-a4 as a positive control, and empty vector as a negative control. In addition, untreated L929 cells were used to show the healthy status of the L929 cells. Except the untreated L929 cells, other L929 cells were transfected and then challenged with the Influenza A virus. As shown in Fig. 6, virally infected cells previously transfected with empty vector showed significant morphology changes and cell-death relative to untreated cells, as observed with light microscopy. In contrast, cells transfected with either MuIFN-a4 or MuIFN-a12 showed the ability to completely protect L929 cells against Influenza A virus (Fig. 6). This data demonstrates that MuIFN-a12 has the ability to confer an antiviral state on cells.
S.L. Tsang et al. / Cytokine 37 (2007) 138–149
143
Fig. 2. Anti-proliferative effect of different rMuIFN-a subtypes on murine myeloid leukemia cell line JCS. The figure shows the dose–response curves of different rMuIFN-a (rMuIFN-a12, rMuIFN-a4), NIH IFN standard, mixed type I IFN, and mock supernatant on the growth of murine myeloid leukemia cell line JCS. Our recombinant samples were compared to NIH IFN standard for quantification. Rectangular hyperbola was fit onto the data points by Prism 4.0 and R2 is calculated. The mock supernatant could hardly give any growth inhibition, thus its potency could not be determined. R2 was 0.0318 for the mock supernatant and >0.930 for rMuIFN-a12, rMuIFN-a4, NIH IFN standard and mixed type I IFN. Each point represents the means ± SEM of triplicate determinations. Approximately, 1.024 IU of NIH IFN standard could make a 50% growth inhibition in the aforementioned MTT assay.
144
S.L. Tsang et al. / Cytokine 37 (2007) 138–149
Fig. 3. Cell-cycle analysis of rMuIFN-a treated JCS cells by propidium iodide staining. JCS cells were treated with 200 ll mock supernatant, approximately 200 IU/ml of rMuIFN-a12 or 200 IU/ml of rMuIFN-a4 for 24 h and then fixed and stained with propidium iodide and subjected to FACS analysis as described. The % of cells undergone apoptosis, i.e. cells have sub-G1 peak, were analyzed by the software Modfit. (a) untreated JCS cells; (b) JCS cells treated with 200 ll mock supernatant; (c) JCS cells treated with 200 IU/ml rMuIFN-a12; (d) JCS cells treated with 200 IU/ml rMuIFN-a4. When compared to untreated JCS cells, P > 0.5 for mock supernatant, P < 0.05 for rMuIFN-a12 and rMuIFN-a4. Data are means ± SEM of three independent experiments and P values are calculated by t test.
3.7. MuIFN-a12 expression in 15- to 18-day embryos of BALB/c mice To demonstrate MuIFN-a12 expression in BALB/c embryos, PCRs were performed on reverse-transcribed embryonic RNA using two different primer pairs (MF1014/MF1015) or (MF1012/MF1013). As shown in Fig. 7, bands of expected size (200 bp for MF1014/ MF1015 and 650 bp for MF1012/MF1013) appeared only in RT+ samples but not in RT samples. Since MuIFN-a12 is an intron-less gene, this RT control importantly shows that the PCR fragment was not amplified from a genomic contaminant, but from cDNA. GAPDH was used as a control. The band obtained using the primer pair (MF1012/MF1013) was purified from gel and directly sequenced. BLAST search results of the sequenced PCR fragment confirmed the identity of MuIFN-a12.
3.8. MuIFN-a12 expression in untreated, Influenza A virus infected or polyI:polyC induced L929 cells and normal murine tissues In order to help elucidate the role of MuIFN-a12, we tested whether it can be detected after induction by Influenza A virus or polyI:polyC. The conditions used were the same as our previous study on other MuIFN-as [25] for a fair comparison. Total RNA were prepared after 9 h of induction, the time point at which the most significant difference in expression levels of different IFN-a sub-
types occurred. RNA samples were then subjected to RTPCR to look for MuIFN-a4 and MuIFN-a12 expression [using the specific primer pairs (MF696/MF697) and (MF1014/MF1015)] as described. The amplification of a band using L929 genomic DNA as +ve control suggests that the PCR reaction functioned properly for all transcripts tested. As shown in Fig. 8(a), up-regulation of MuIFN-a4 RNA was observed in L929 cells infected by Influenza virus, or in cells induced with 200 lg/ml polyI:polyC. However, it was not detected in untreated L929 cells or the RT samples, suggesting that its regulation was specific. However, although MuIFN-a12 RNA was also undetectable in untreated L929 cells, it was also not detected 9 h after virus infection nor polyI:polyC treatment. This data suggests that although MuIFN-a12 shared several of the biological activities of other type I IFNs such as MuIFN-a4, it appears to be differentially regulated. In order to determine the expression profile of MuIFNa12 in normal murine tissues, total RNA samples were prepared from brains, bone marrows, hearts, kidneys, livers, lungs, spleens and thymuses of 8- to 10-week male untreated BALB/c mice as described. RNA samples were then subjected to RT-PCR using a pair of MuIFN-a12 specific primers (MF1012/MF1013) as described. As shown in Fig. 8(b), no MuIFN-a12 RNA was detected in RNA samples obtained from any of the normal murine tissues tested, which suggests that this gene has a restricted expression profile, possibly embryonic-specific. As above, L929 genomic DNA and MilliQ water were used as +ve and ve templates for the PCR reaction respectively. Taken together, our findings demonstrate that although MuIFN-a12 has biological activities similar to those of other type I IFNs, its expression profile differs markedly. 4. Discussion In this study, we have generated biologically active, recombinant MuIFN-a12 in COS-1 cells with all the hallmarks of a type I IFN. We demonstrated not only MuIFN-a12’s anti-proliferative and anti-viral activities, but also its ability on IFN mediated gene induction, as shown by up-regulation of MHC-I in both primary and transformed cells. We directly demonstrated MuIFN-a12 expression in 15- to 18-day embryos of BALB/c mice by RT-PCR. However, we were unable to demonstrate that MuIFN-a12 expression could be regulated, suggesting that in this area, MuIFN-a12 differs from other type I IFNs such as MuIFN-a4, whose expression is regulated by viral infection. IFN-a is believed to bring about its anti-proliferative effects by cell-cycle arrest and/or by inducing apoptosis. These two pathways have been shown to be independent of each other [12]. We took a similar approach to that of Yanai et al. [26] and Oritani et al. [7], by using propidium iodide staining and flow cytometry to analyze the DNA content of JCS cells. We found that rMuIFN-a12 could
S.L. Tsang et al. / Cytokine 37 (2007) 138–149
145
Fig. 4. Effect of different rMuIFN-a subtypes on the expression of MHC-I in JCS cell line. JCS cells were incubated with approximately 5, 50 or 500 IU/ ml of various rMuIFN-a for 36 h and then stained with FITC-conjugated anti-mouse MHC-I antibody as described. X-axis denotes the log FL1 signal while the Y-axis denotes the events (cell number counted). (b–d) The open peaks from left to right are showing the responses to 5, 50 and 500 IU/ml of rMUIFN-a, respectively. (a–d) Mock supernatant, rMuIFN-a12, rMuIFN-a4 and mixed type I IFN.
induce apoptosis in approximately 10.0% of cells, similar to the level observed for rMuIFN-a4. In contrast, less than 0.5% of JCS cells were apoptotic when left untreated or treated with a placebo. Our results suggest that rMuIFNa12 can induce apoptosis and we speculate that this to be a possible mechanism for the anti-proliferative effects of rMuIFN-a12. The specific activity of MuIFN-a12 was estimated to be in the order of 1 · 108 IU/mg. As a control of this measurement, MuIFN-a4 was also included and found to be about the same order. These results agree with the previous findings by van Pesch et al. [16] that MuIFN-a12 have a slightly higher potency than MuIFN-a4. The result suggests that MuIFN-a12 may be working at physiological relevant concentrations (e.g. in embryonic stages) in which only limited amounts of IFN mRNA or proteins were detected. To test for anti-viral activity, we chose to take the approach similar to the one described by Harle et al. [24],
which involved transfecting L929 cells with MuIFN-a12 transgene and challenging with Influenza A virus. Our results agree with previous work by van Pesch et al. [16] by the clear antiviral effect of MuIFN-a12 transgene on cells. Type I IFNs are important in the first stage of the immune response against pathogens, especially in eliciting innate immune responses [27,28]. These effects include induction of anti-viral state, up-regulation of MHC-I expression, activation of NK cells and many others [1,14,15]. The experimental setup we employed to determine whether MuIFN-a12 can lead to IFN-mediated gene induction, as demonstrated by MHC-I expression, was similar to Yanai et al. [26] We showed that rMuIFN-a12, like the other MuIFN-a subtypes tested, could up-regulate the expression of MHC-I on murine JCS cells in a dosedependent manner within the first 36 h of induction. We also repeated the experiment using primary macrophages, which concurred with the earlier experiments. These results
146
S.L. Tsang et al. / Cytokine 37 (2007) 138–149
Fig. 5. Effect of different rMuIFN-a subtypes on MHC-I expression of primary macrophages from BALB/c mice. (a–d) Showed the effect of different rMuIFN-a subtypes on MHC-I expression of primary macrophages prepared from 8–10 weeks male untreated BALB/c mice. Macrophages were prepared from two 8–10 weeks male BALB/c mice as described. Approximately 500 IU/ml of rMuIFN-a12, rMuIFN-a4, mixed type I IFN, (b–d) or comparable amount of mock supernatant (a) were added to the primary macrophages and incubated for 48 h. The cells were then harvested, stained with FITCconjugated anti-mouse MHC-I antibody and subjected to FACS analysis. The X-axis denotes the log FL1 signal while the Y-axis denotes the events (cell number counted).
demonstrate that rMuIFN-a12 can regulate MHC-I expression and thus may lead to IFN-mediated gene induction. Previous reports indicate that MuIFN-a12 is expressed during murine embryonic development. Reigo et al. [21] cloned a partial sequence of MuIFN-a12 from undifferentiated embryonal carcinoma cell line P19, while Hardy et al. [5] detected MuIFN-a12 in a MEF cDNA library made from mice of mixed origin. In this report, we directly demonstrate MuIFN-a12 expression in BALB/c embryos by RT-PCR, which concurs with the previous evidence described above. Several MuIFN-a subtypes such as MuIFN-a4 are highly up-regulated by both virus and polyI:polyC [25]. However, the regulation of MuIFN-a12 has not yet been investigated directly. To answer this question, we looked to see whether MuIFN-a12 mRNA levels could be altered
in cells infected with Influenza A virus or induced by polyI:polyC, under conditions which many other subtypes did in our previous report [25]. In addition, we also tested a range of normal murine tissues to gain an understanding of the spatial expression profile of MuIFN-a12. MuIFNa12 expression was unaffected by the inducers under the conditions used, suggesting that the mechanisms of regulation of MuIFN-a12 differ from that of MuIFN-a4, whose expression could be induced by these agents 9 h after induction. According to van Pesch et al. [16], the IRF-3 binding site of MuIFN-a12, but not MuIFN-a4, in C57BL/6 have two nucleotides different from that of consensus sequence of virus-response element of IFN-a promoter. This may thus also account for the different response of MuIFN-a12 and MuIFN-a4 in our experiments. In addition, different viruses are known to differentially regulate expression of several MuIFN-a subtypes
S.L. Tsang et al. / Cytokine 37 (2007) 138–149
147
Fig. 6. Effect of MuIFN-a subtype transgene on L929 cells infected with Influenza A virus. L929 cells in 6-well plate were transfected with 3 lg of (a) pEGFP-N1, (b) pEGFP-N1_MuIFN-a12 or (c) pEGFP-N1_MuIFN-a4 DNA as described. Twenty-four hours later, they were challenged with Influenza A virus at MOI of 0.2. Sixteen hours later, photographs of the cell culture were taken under light microscopy.
Fig. 7. Demonstration of MuIFN-a12 in embryo RNA by RT-PCR The gel photo showed the results of PCR on RT+ and RT templates made from embryo RNA using GAPDH primer pair (MF214/MF215) and MuIFN-a12-specific primers (MF1014/MF1015) and (MF1012/MF1013) as described. The RT-PCR products obtained using primer pair (MF1012/ MF1013) was gel purified and directly sequenced.
(e.g. MuIFN-a1) [25], suggesting that MuIFN-a12 expression could still be induced by other viruses or inducers. The lack of detectable expression of MuIFN-a12 in normal adult murine tissues has two implications. First, the expression may be temporally regulated. We have shown that MuIFN-a12 was expressed during murine embryonic development. This is also backed up by previous data which showed the MuIFN-a12 cDNA cloned from MEFs [5] and that other type I IFNs are also expressed during
development [21]. Second, MuIFN-a12 may be expressed in a relatively small population of cells (e.g. Langerhan’s cells, kupffer cells) that may be difficult to isolate and amplify by RT-PCR, or in tissues not tested in this study. Although van Pesch et al. [20] was able to demonstrate MuIFN-a12 expression in murine brain tissue, we were unable to detect expression. However, there are differences in the mouse strain from which these tissues derived (BALB/c versus IFNAR-1/ 129/Sv), which may account for the experimental differences observed. Given the high level of nucleotide and amino acid homology between MuIFN-a12 and the other alpha family members (such as MuIFN-a8/6 and MuIFN-a1), it is difficult to interpret expression information gained from other sources such as expressed sequence tag databases. Recently, Hadj-Slimane et al. [29] have reported the differential expression of MuIFN-a12 in the spleens of MRL/ lpr mice when comparing to MRL+/+ mice. Together with the fact that MuIFN-a12 and MuIFN-aA are cloned among other MuIFN-a subtypes in mouse embryo [21], these uncommon properties of MuIFN-a12 deserve further investigation which may help in the understanding of differences, if any, among the various MuIFN-a subtypes. In conclusion, we have demonstrated that the MuIFNa12 gene encodes a functional protein with anti-proliferative
148
S.L. Tsang et al. / Cytokine 37 (2007) 138–149
Fig. 8. Detection of MuIFN-a12 transcripts in untreated, Influenza A virus-infected or polyI:polyC-induced L929 cells as well as normal murine tissues from BALB/c mice. (a) RT-PCR for the detection of GAPDH, MuIFN-a4 or MuIFN-a12 in untreated, Influenza A virus infected or polyI:polyC-induced L929 cells. (b) RT-PCR for the detection of MuIFN-a12 using RT+ and RT templates obtained from various tissues of untreated BALB/c mice. Lanes (1 and a): bone marrow, (2 and b): brain, (3 and c): heart, (4 and d): kidney, (5 and d): liver, (6 and f): lung, (7 and g): spleen, (8 and h): thymus, (i) L929 genomic DNA as +ve control, (j) H2O as ve control.
and anti-viral functions. As it can also up-regulate MHC-I expression, it may lead to IFN-mediated gene induction. These results make it a very likely candidate for a novel, bona fide, type I IFN. Acknowledgments We thank Mr Lau, Kwok Wing, Miss Kong, Lai Ping, Mr Kwok, Chi Hung and staff from Laboratory Animal Services Centre of CUHK for technical assistances. We also thank Miss Leung, Chung Yee and Miss Yiu, Nai Sum for their help in the preparation of Influenza A virus, and NIAID Antiviral Substances Program of NIH for providing an antibody preparation and the IFN standards for use in the preparation of our MuIFN. References [1] Isaacs A, Lindenmann J. Virus interference. I. The interferon. Proc R Soc Lond B Biol Sci 1957;147:258–67. [2] Hauptmann R, Swetly P. A novel class of human type I interferons. Nucleic Acids Res 1985;13:4739–49.
[3] Roberts RM, Cross JC, Leaman DW. Unique features of the trophoblast interferons. Pharmacol Ther 1991;51:329–45. [4] LaFleur DW, Nardelli B, Tsareva T, Mather D, Feng P, Semenuk M, et al. Interferon-kappa, a novel type I interferon expressed in human keratinocytes. J Biol Chem 2001;276:39765–71. [5] Hardy MP, Owczarek CM, Jermiin LS, Ejdeback M, Hertzog PJ. Characterization of the type I interferon locus and identification of novel genes. Genomics 2004;84:331–45. [6] Lefevre F, Guillomot M, D’Andrea S, Battegay S, La BC. Interferondelta: the first member of a novel type I interferon family. Biochimie 1998;80:779–88. [7] Oritani K, Medina KL, Tomiyama Y, Ishikawa J, Okajima Y, Ogawa M, et al. Limitin: an interferon-like cytokine that preferentially influences B-lymphocyte precursors. Nat Med 2000;6:659–66. [8] Oritani K, Kincade PW, Zhang C, Tomiyama Y, Matsuzawa Y. Type I interferons and limitin: a comparison of structures, receptors, and functions. Cytokine Growth Factor Rev 2001;12:337–48. [9] Kotenko SV, Gallagher G, Baurin VV, Lewis-Antes A, Shen M, Shah NK, et al. IFN-lambdas mediate antiviral protection through a distinct class II cytokine receptor complex. Nat Immunol 2003;4:69–77. [10] Sheppard P, Kindsvogel W, Xu W, Henderson K, Schlutsmeyer S, Whitmore TE, et al. IL-28, IL-29 and their class II cytokine receptor IL-28R. Nat Immunol 2003;4:63–8. [11] Pestka S, Krause CD, Walter MR. Interferons, interferon-like cytokines, and their receptors. Immunol Rev 2004;202:8–32.
S.L. Tsang et al. / Cytokine 37 (2007) 138–149 [12] Sandoval R, Xue J, Pilkinton M, Salvi D, Kiyokawa H, Colamonici OR. Different requirements for the cytostatic and apoptotic effects of type I interferons. Induction of apoptosis requires ARF but not p53 in osteosarcoma cell lines. J Biol Chem 2004;279:32275–80. [13] Clemens MJ. Interferons and apoptosis. J Interferon Cytokine Res 2003;23:277–92. [14] Reiter Z, Fischer DG, Rubinstein M. The protective effect of interferon against natural killing activity is not mediated via the expression of class I MHC antigens. Immunol Lett 1988;17:323–8. [15] Reiter Z. Interferon – a major regulator of natural killer cell-mediated cytotoxicity. J Interferon Res 1993;13:247–57. [16] van Pesch V, Lanaya H, Renauld JC, Michiels T. Characterization of the murine alpha interferon gene family. J Virol 2004;78:8219–28. [17] Diaz MO, Pomykala HM, Bohlander SK, Maltepe E, Malik K, Brownstein B, et al. Structure of the human type-I interferon gene cluster determined from a YAC clone contig. Genomics 1994;22:540–52. [18] Hughes AL. The evolution of the type I interferon gene family in mammals. J Mol Evol 1995;41:539–48. [19] Capon DJ, Shepard HM, Goeddel DV. Two distinct families of human and bovine interferon-alpha genes are coordinately expressed and encode functional polypeptides. Mol Cell Biol 1985;5:768–79. [20] Van Pesch V, Michiels T. Characterization of interferon-alpha 13, a novel constitutive murine interferon-alpha subtype. J Biol Chem 2003;278:46321–8. [21] Riego E, Perez A, Martinez R, Castro FO, Lleonart R, de la FJ. Differential constitutive expression of interferon genes in early mouse embryos. Mol Reprod Dev 1995;41:157–66.
149
[22] Trapman J. A systematic study of interferon production by mouse L929 cells induced with poly(I):poly(C) and DEAE-dextran. FEBS Lett 1979;98:107–10. [23] Loveland BE, Johns TG, Mackay IR, Vaillant F, Wang ZX, Hertzog PJ. Validation of the MTT dye assay for enumeration of cells in proliferative and antiproliferative assays. Biochem Int 1992;27:501–10. [24] Harle P, Cull V, Agbaga MP, Silverman R, Williams BR, James C, et al. Differential effect of murine alpha/beta interferon transgenes on antagonization of herpes simplex virus type 1 replication. J Virol 2002;76:6558–67. [25] Fung MC, Sia SF, Leung KN, Mak NK. Detection of differential expression of mouse interferon-alpha subtypes by polymerase chain reaction using specific primers. J Immunol Methods 2004;284:177–86. [26] Yanai Y, Sanou O, Yamamoto K, Yamauchi H, Ikegami H, Kurimoto M. The anti-tumor activities of interferon (IFN)-alpha in chronic myelogenous leukaemia (CML)-derived cell lines depends on the IFN-alpha subtypes. Cancer Lett 2002;185:173–9. [27] Kadowaki N, Antonenko S, Lau JY, Liu YJ. Natural interferon alpha/beta-producing cells link innate and adaptive immunity. J Exp Med 2000;192:219–26. [28] Tough DF. Type I interferon as a link between innate and adaptive immunity through dendritic cell stimulation. Leuk Lymphoma 2004;45:257–64. [29] Hadj-Slimane R, Chelbi-Alix MK, Tovey MG, Bobe P. An essential role for IFN-alpha in the overexpression of Fas ligand on MRL/lpr lymphocytes and on their spontaneous Fas-mediated cytotoxic potential. J Interferon Cytokine Res 2004;24:717–28.