Structure and expression of the murine calcyon gene

Gene 311 (2003) 111–117 www.elsevier.com/locate/gene

Structure and expression of the murine calcyon geneq Rujuan Dai, Clare Bergson* Medical College of Georgia, Department of Pharmacology and Toxicology, 1459 Laney Walker Blvd, Augusta, GA 30912-2300, USA Received 20 December 2002; received in revised form 4 March 2003; accepted 25 March 2003

Abstract Calcyon was recently identified as a D1 dopamine receptor (DR1) interacting protein. Previous studies show that calcyon can potentiate DR1 mediated intracellular Ca2þ release in transfected HEK293 cells, and may play an important role in DR1 Ca2þ signaling in brain. We report that similar to the genomic structure of the human gene, the mouse calcyon gene contains six relatively short exons, with a large intron (about 8.4 kb) between exons one and two. The mouse and human calcyon genes exhibit a high level of sequence homology (77.5% at the nucleotide level) within coding regions. Northern blot and RT-PCR analyses reveal that mouse calcyon transcripts are most abundant in brain, but also present in testis and ovary, as well as in kidney and heart at much lower levels. The most distal of the transcript initiation sites identified by 50 RACE is located 159 nucleotides upstream of the putative start of translation. BLAST search of the NCBI mouse EST database and RT-PCR analysis uncovered two differentially spliced transcripts, ‘mcal-A’ and ‘mcal-B.’ The two transcripts are identical, except that mcal-B contains a longer 30 untranslated region due to retention of a short intron (I5) between exons five and six. However, mcal-A represents the predominant calcyon transcript in mouse tissue. Further, the presence of I5 produced no detectable differences in the biosynthesis of calcyon polypeptide when expressed in HEK293, MDCK and Neuro2a cells. q 2003 Elsevier Science B.V. All rights reserved. Keywords: Dopamine receptor interacting protein; Mouse; Splicing; Transcription start site; Exon; Intron

1. Introduction The D1-like dopamine receptor family (including the D1 and D5 subtypes) plays an important role in modulating excitatory and inhibitory neurotransmission in cortical and subcortical areas of mammalian brain (Nicola et al., 2000; Yang et al., 1999). D1-like receptors stimulate the formation of cAMP by coupling to the Gas heterotrimeric G protein when heterologously expressed (Zhou et al., 1990; Grandy et al., 1991). However, endogenous D1-like DA receptors have also been reported to stimulate inositol 3,4,5 triphosphate (IP3) turnover in brain and kidney homogenates (Undie and Friedman, 1990; Yu et al., 1995). Little is known about the signaling pathway(s) by which D1-like receptors stimulate IP3 formation, and release the intracellular Ca2þ (Ca2þ i ). Calcyon, a recently identified receptor interacting q

Acknowledgements: NIH MH63271; MH44866. Abbreviations: RT-PCR, reverse transcription polymerase chain reaction; RACE, rapid amplification of cDNA ends; kD, kiloDalton; kb, kilobase; DA, dopamine; DR1, D1 DA receptor; Ca2þ, calcium; NCBI, National Center for Biotechnology Information. * Corresponding author. Tel.: þ 1-706-721-1926; fax: þ1-706-721-2347. E-mail address: [email protected] (C. Bergson).

protein, may be a link to better understanding this aspect of D1/D5 receptor signaling since previous studies indicate release activated by D1 and that calcyon potentiates Ca2þ i D5 receptors when heterologously expressed (Lezcano et al., 2000). Human calcyon is a 217 residue single transmembrane protein, whereas the rat calcyon cDNA appears to encode a slightly larger protein (226 residues). Nevertheless, there is a high degree of sequence identity between the human and rat proteins (Zelenin et al., 2002). Calcyon mRNA and protein are abundantly expressed both in non-human primate and rat brain where higher levels of expression are detected in prefrontal cortex, hippocampus, and cerebellum. In contrast, lower levels of calcyon have been detected in striatum suggesting that the role of calcyon in D1R signaling in the basal ganglia may differ from that in cortex. Here, we report the isolation of the mouse calcyon gene, and describe the exonic organization of the locus. Homology searches of the EST database identified two major classes of calcyon transcripts. The expression of both types of transcripts was examined in mouse brain and peripheral tissues by RT-PCR and Northern blotting. Knowledge of the genomic structure of mouse calcyon

0378-1119/03/$ - see front matter q 2003 Elsevier Science B.V. All rights reserved. doi:10.1016/S0378-1119(03)00564-X

112

R. Dai, C. Bergson / Gene 311 (2003) 111–117

should make it possible to delineate the role of calcyon in various neurobehavioral functions specified by D1-like DA receptors in mice.

2. Material and methods 2.1. Mouse genomic library screening PCR primers mcal5s-1: GACCATCATCCACCATGGT GAAGC and mcal3s-1: GACCCTCCAAATCTGCAAA CTTCT were used to screen a mouse 129svj lambda genomic library purchased from Stratagene (La Jolla, CA) (Israel, 1993). PCR conditions were 4 min at 94 8C followed by 35 cycles of 94 8C for 15 s, 58 8C for 30 s, 72 8C for 90 s, and a final extension at 72 8C for 10 min. Briefly, the library was subdivided into ten fractions (each fraction contained approximately 2 £ 105 phage), and amplified. PCR was performed to identify positive clones using 1 ml of amplified phage stock. Fractions yielding PCR products of the expected size were subdivided further into ten aliquots (each fraction contained approximately 2 £ 104 phage), reamplified, and re-screened again by PCR. After three rounds of aliquoting and screening, fractions with at least one positive clone per 2 £ 103 pfu were plated, and membrane lifts hybridized with a 32P-dCTP- labeled 1.5 kb mouse calcyon genomic fragment. 2.2. RACE amplification of 5 0 ends Total RNA was isolated from mouse brain tissue using TRIzol reagent (Invitrogen, Carlsbad, CA). The 50 ends of full-length, mature calcyon transcripts were amplified using ‘GeneRacer’ (Invitrogen, Carlsbad, CA). This kit selectively amplifies full-length transcripts via elimination of truncated messages (Maruyama and Sugano, 1994). Uncapped RNAs were dephosphorylated using calf intestinal phosphatase. Subsequently, m7G protected, capped, full-length transcripts were decapped by tobacco acid pyrophosphatase (TAP), and then ligated to a GeneRacer RNA oligo adapter. Reverse transcription was performed using GeneRacer oligodT. PCR was performed using the calcyon gene-specific primer Race3s-3: GGGCTGATCAG AGGGACGCTGTCCAT, and the GeneRacer 50 primer which is located in the RNA oligo adapter. The 50 end of mouse calcyon cDNA was amplified and subcloned into a Topo TA vector (Invitrogen, Carlsbad, CA), and ten clones isolated and sequenced. 2.3. DNA sequencing DNA sequence determination was performed by the Molecular Core facility at the Medical College of Georgia using an Applied Biosystems automated DNA sequencer (Model 377XL).

2.4. Northern blot analysis Total RNA was isolated from different mouse tissues using TRIzol reagent. The RNA samples were separated on a 1% agarose gel containing 2.2 M formaldehyde, and transferred to a Immobilon-NY nylon membrane (Millipore, Bedford, MA). Membranes were hybridized with a mouse calcyon cDNA fragment generated by RT-PCR from mouse brain using primer musH50 164-185: AGACCAGGATGG GGCTGCCATG and musH30 521 –499: CTCGGTCTTGT AGTACATCTCCAG. The PCR product was labeled with 32 P – dCTP using a random primer labeling kit (Roche, Indianapolis, IN, USA). 2.5. RT-PCR cDNA templates were generated from total RNA using SuperScripte first-strand synthesis system for RT-PCR (Invitrogen, Carlsbad, CA). The following primers were used for RT-PCR: mcal5s-1, muscal50 640– 663: AGCATAAGGGCACTACCCCTGCG and muscal30 949 – 928: ACAGAGTCAGAGGTCCACCAGG. The mouse b-actin gene was amplified as a loading control using mActin up: TGACGGGGTCACCCACACTGTGCCCAT CTA, and mActin down: CTAGAAGCATTTGCGGTGGA CGATGGAGGG. PCR conditions were 92 8C for 4 min, followed by 30 or 35 cycles of 92 8C for 15 s, 58 8C for 30 s, 72 8C for 60 s, then 72 8C for 10 min. PCR products were separated on 1 or 1.5% agarose gels based on the expected size of the product. 2.6. Plasmid constructs Full length mcal-A was amplified from the mouse BMAP EST clone UI-M-AMI-agb-C-02-0-UI purchased from Invitrogen, whereas mcal-B was RT-PCR amplified from mouse cortex total RNA. The amplified mcal-A and mcal-B products were subcloned into pCMV-Tag2B vector (Stratagene, La Jolla, CA), yielding the plasmids pFLAG-mcalA and pFLAG-mcal-B. Primers mcal-FLAG50 : CGGGAT CCGTGAAGCTAGGCTGCAGCTTCTCAG and mcalFLAG30 : ACGCGTCGACCAGATAGATGTGAATCTTT ACTTAAAGAAAAGCAACAGAGTCAGAGGTCCAC CAG were used to generate the full-length epitope tagged constructs. 2.7. Cell transfection and western blot Human embryonic kidney (HEK293), Madin Darby Canine Kidney (MDCK), and mouse neuroblastoma Neuro2a cells were transiently transfected using Effectene (Qiagen, Valencia, CA) with 1 mg pFLAG-mcal-A or pFLAG-mcal-B per 35 mm dish. Twenty four hours later, cells were harvested for RT-PCR and western blotting. Protein concentrations in the transfected cell lysates were determined by BCA assay (Biorad, Hercules, CA). Protein

R. Dai, C. Bergson / Gene 311 (2003) 111–117

samples (30 mg) were separated on SDS containing 12% polyacrylamide precast gels (Bio-Rad, Hercules, CA), and transferred to PVDF membrane. Membranes were probed with anti-FLAG M2 monoclonal antibody (Sigma, St. Louis, MO), and bound antibodies detected with horseradish peroxidase conjugated (HRP) goat anti-mouse antibodies followed by ECL (Amersham, Piscataway, NJ).

3. Results and discussion 3.1. Cloning and structure of mouse Calcyon genomic DNA BLAST searches of the NCBI GenBank data base with the human calcyon cDNA sequence identified two fulllength mouse homologs (GenBank accession no. AK003400 and AK002979). Primers (mcal 5s-1 and mcal 3s-1), designed based on the mouse calcyon cDNA sequences, yielded a 1.5 kilobase pair (kb) PCR product using mouse genomic DNA as template. Two genomic DNA clones (designated mCal#6 and mCal#18) were subsequently isolated by PCR screening of approximately 2 £ 106 mouse 129svj genomic clones using the mcal5s-1 and mcal3s-1 primers (Fig. 1). Alignment of the cDNA and genomic DNA sequences resulted in the identification of six coding regions (exons) interspersed with approximately 11.7 kb of non-coding DNA. The exons ranged in size from 114 to 365 nucleotides, whereas the introns ranged from 278 nucleotides to approximately 8.4 kb. GT/AG dinucleotide sequences recognized by U1/U2-containing spliceosomes were located at each of the putative exon/intron junctions. These data suggest that the total size of the mouse calcyon gene, including introns, is approximately 12.7 kb (Fig. 1). Comparison of the mouse calcyon gene reported here, with the genomic structure of human calcyon determined by the human genome project (GenBank accession no. NT_017795) indicated a high degree of overall similarity in the organization of the calcyon gene across species

113

(Fig. 1). The human calcyon gene, like the mouse gene, contains six exons with an 8 kb intron located between exons one and two. In addition, the beginning of the longest open reading frame (ORF) maps to the second exon of both the human and mouse genes (Fig. 1). 3.2. Analysis of mouse calcyon cDNAs and deduced protein Comparison of the 50 ends of AK003400 and AK002979 suggested that there may be several potential transcription start sites for calcyon mRNA since both mouse cDNA clones were identified in a CAP-trapped full-length cDNA library yet contain different 50 ends (2 112 and 2 69, respectively, upstream of the translation start codon). A modified 50 RACE protocol was used to characterize the transcription start sites of the mouse calcyon gene. In this method, only capped, full-length mRNA can be ligated to an RNA adaptor after dephosphorylation and cap removal, a strategy which aids in the isolation of the intact 50 ends of cDNAs (Volloch et al., 1994). The longest mouse calycon 50 RACE product identified contained 159 nucleotides of 50 UTR sequence. We also identified several 50 RACE clones that start at 2 117, 2 82, 2 71 and 2 69 nucleotides upstream of the initial ATG codon (Fig. 2A). Taken together, the results support the idea that initiation of calcyon transcription occurs at several different positions. Alignment of AK002979 and AK003400 cDNA clones revealed that the 30 end of AK002979 included a 278 nucleotide sequence not found in AK003400. The insertion was located after the predicted stop codon. In addition, there was a single ‘C’ nucleotide inserted before the stop codon in AK003400 which would result in a frame shift at the 30 end of the open reading frame, and the potential to encode a larger protein (283 residues). However, comparison of the genomic sequence obtained with that of various RT-PCR products amplified for this region of the calcyon cDNA suggests that the ‘C’ nucleotide insertion most likely

Fig. 1. Genomic structure of the mouse and human calcyon genes. The exon/intron structure of the human gene was derived from the NCBI database (accession no. NT_017795). Segments of the gene included in the two isolated lambda clones designated mCal#6 and mCal#18 are shown.

114

R. Dai, C. Bergson / Gene 311 (2003) 111–117

Fig. 2. Murine calcyon cDNAs. A: Partial sequence of mouse calcyon showing transcription start sites, PCR primers, the positions of exon/intron junctions. Exon sequences are shown in capital letters, and intron sequences, in italic, lowercase letters. Dinucleotides recognized by the splicesome are underlined. Intron 5, which is not efficiently spliced out in mcal-B is shown in bold, italic lowercase letters. The transcription start sites determined by 50 RACE are indicated by shadowed, bold letters. Translation start and stop codons are in bold and underlined. Oligonucleotide sequences (or the reverse complement in the case of the reverse primers) used as PCR primers are underscored with arrows. B: Alignment of the mouse, rat and human calcyon protein sequences. Conserved amino acids are boxed, and differences from consensus are shaded.

resulted from an error in the sequence submitted. Taken together, these results indicate that although AK003400 and AK002979 correspond to different transcripts, they contain identical open reading frames, and encode a 226 residue protein. Therefore, similar to the rat (Zelenin et al., 2002), the putative mouse calcyon protein

includes an additional nine residues at the carboxy terminus which are not found in the human polypeptide (Fig. 2B). Sequence alignment of the full-length mouse and human calcyon cDNAs revealed a high level of sequence identity: 77.5% identity at the nucleotide level in coding regions, and 78% at the amino acid level. The

R. Dai, C. Bergson / Gene 311 (2003) 111–117

115

Fig. 3. Differential splicing and regional expression of calcyon mRNA. (A) Proposed structure of mouse calcyon RNA isoforms, mcal-A and mcal-B. The position of primers mcal5s-1 and muscal 30 949–928 are indicated above exons two and six, respectively. (B) RT-PCR analysis of 0.1 mg RNA isolated from the indicated mouse brain regions and peripheral tissues yielded two products corresponding to mcal-A and mcal-B. Calcyon transcripts in kidney and heart were detected after 35 cycles of PCR, whereas a 30 cycle PCR was sufficient to amplify calcyon transcripts from first-strand cDNA prepared from cerebral cortex, cerebellum, hippocampus, striatum, ovary, and testis RNA. Mouse actin was amplified as an internal control. Panel B: Northern blot of total RNA isolated from tissues or brain regions specified. 20 mg of total RNA was loaded in each lane, except the lanes labeled striatum and hippocampus, where 7.5 and 13 mg, respectively, was loaded. The blot in the upper panel was hybridized with a 32P-labeled calcyon probe, stripped and reprobed with a 32P-labeled GAPDH probe (lower panel).

mouse and rat genes are 94.6% and 93.4% identical at the nucleotide and protein levels, respectively. There is a higher percentage of sequence divergence in untranslated regions, although 30 UTRs of the three species are more similar than the 50 UTRs. 3.3. Expression analysis of mouse calcyon Alignment of genomic clone mCal#6 with the AK003400 and AK002979 cDNAs revealed that the insertion of 278 nucleotides in AK002979 likely results from retention of the fifth intron (Fig. 3A). To test this possibility, a specific primer, muscal 30 949 – 928, was designed to pair with mcal5s-1 to RT-PCR amplify both types of transcripts. RT-PCR of various mouse tissue and brain regions yielded two products, and DNA sequencing confirmed that the two products differed in size by 278 nucleotides, and presumably correspond to two alternative calycon transcripts designated mcal-A and mcal-B (þ 278

nucleotide) (Fig. 3B). The relative amount of the two PCR fragments suggests that the mcal-A form is the predominant form, and that the mcal-B form is present at much lower levels. Consistent with this idea, BLAST search of the mouse EST database with the cDNA including the 278 nucleotide intron five sequence yielded thirty-nine calcyon EST clones of which four represented the mcal-B form of the calcyon transcript (AV168463, BB309493, BI729885, BB355817). To determine whether the alternative splice forms of calcyon mRNA are unique to mouse, we used the human intron five sequence to BLAST search the NCBI human EST database, and identified one EST clone (AW614685) that contains the entire intron 5 sequence. This clone presumably represents the hcal-B transcript. Calcyon gene expression was also analyzed by Northern blotting. A 1.3 kb calcyon transcript was detected in several areas of mouse brain including cerebral cortex, cerebellum, hippocampus and striatum (Fig. 3C). An additional transcript of 3.5 Kb, presumably corresponding

116

R. Dai, C. Bergson / Gene 311 (2003) 111–117

to unprocessed calcyon mRNA was also detected. Like in the human and rat, RT-PCR and Northern analysis indicated that calcyon transcripts are most abundant in mouse brain (Fig. 3B,C). However, in contrast to the rat, the RT-PCR analysis revealed calcyon mRNA expression in mouse testis and ovary at moderate levels, as well as in kidney and heart tissue at lower levels. We have also detected calcyon expression in human kidney (C.B., unpublished data). 3.4. Expression analysis of splice forms mcal-A and mcal-B Considering that mcal-B is present at lower levels in brain than mcal-A, we sought to test whether retention of intron 5 affects the stability of mcal-B mRNA, or subsequent translation of the calcyon polypeptide (Heese et al., 2002; Schwerin et al., 2002). To accomplish this, we generated pFLAG-mcal-A and pFLAG-mcal-B expression plasmids encoding FLAG-tagged full length mouse calcyon, and containing the complete 30 UTR of mcal-A or mcal-B, respectively. The two constructs were transiently expressed in HEK293, MDCK and Neuro2a cells, and subjected to

RT-PCR and western blot analyses. Primers muscal 50 640 –663 and muscal 30 949– 928 were used to amplify both forms of mouse calcyon mRNA. A 310 nucleotide PCR product was detected in pFLAG-mcalA transfected HEK293, MDCK and Neuro2a cells. In the pFLAG-mcalB transfected cells, a 588 nucleotide band was detected in addition to the 310 nucleotide band (Fig. 4A). The intensity of the 310 nucleotide band was noticeably stronger than that of the 588 nucleotide band in the mcal-B transfected HEK293 and MDCK cells, but not in the Neuro2A cells. Similar results were obtained in each of three independent transfection experiments. These results suggest that the mcal-B transcript likely represents a transient splice form that is eventually fully spliced to yield mcal-A. In addition, the reduced efficiency with which the mcal-B form is converted to mcal-A in the Neuro2a cells raises the possibility that cell-specific components of the spliceosome complex may influence the rate of intron five removal (Black, 1995). Western blot analysis of transfected cells lysates with FLAG antibodies identified bands of 33, and 45 kD in the pFLAG-mcal-A and pFLAG-mcal-B in HEK293 and MDCK cells. A FLAG antibody reactive band of 40 kD

Fig. 4. Expression of mcal-A and mcal-B RNA isoforms in HEK293, MDCK and Neuro2a cells. (A) RT-PCR detection of mcal-A and mcal-B transcripts in pFLAG-mcal-A or pFLAG-mcal-B 24 h after transfection of HEK293, MDCK and Neuro2a cells. PCR products were amplified with forward and reverse primers, muscal 50 640 –663 and muscal 30 949– 928, respectively. (B) Immunoblot analysis of the FLAG-calcyon proteins in HEK293, MDCK and Neuro2a cells 24 h after transfection.

R. Dai, C. Bergson / Gene 311 (2003) 111–117

was also detected in the lysates of transfected Neuro2a cells. The intensity of the 33, 40, and 45 kD bands varied between cell types presumably reflecting cell-specific differences in post-translational modifications (Fig. 4B). However, no major differences were detected either in the size or abundance of the FLAG-calcyon proteins expressed by the tagged mcal-A and mcal-B constructs within a given cell line. An explanation for this result is that since intron five is located downstream of the calcyon open reading frame, differences in splicing efficiency would not be expected to alter the protein product produced in the mcal-A and mcal-B transfected cells. It is also possible that only the mcal-A form is translated since the mcal-A form of the calcyon transcript is also detected in cells transfected with pFLAGmcal-B. However, further experimentation is necessary to test this idea. Likewise, the mcal-B form may represent a reserve pool of transcripts, and the complete processing of mcal-B may be prevented or enhanced under certain experimental conditions. This type of scenario would be analogous to the cis-acting sequence dependent regulation of aCamKII mRNA translation in hippocampus during synaptic activity (Wu et al., 1998). While further studies in neurons are necessary to test this possibility, the reduced efficiency by which mcal-B is converted to mcal-A in Neuro2a hints that cell type specific factors may regulate the splicing of intron five.

References Black, D.L., 1995. Finding splice sites within a wilderness of RNA. RNA 1, 763–771. Grandy, D.K., Zhang, Y.A., Bouvier, C., Zhou, Q.Y., Johnson, R.A., Allen, L., Buck, K., Bunzow, J.R., Salon, J., Civelli, O., 1991. Multiple human D5 dopamine receptor genes: a functional receptor and two pseudogenes. Proc. Natl. Acad. Sci. USA 88, 9175–9179. Heese, K., Nagai, Y., Sawada, T., 2002. The 30 untranslated region of the

117

new rat synaptic vesicle protein 2B mRNA transcript inhibits translationaly efficiency. Brain Res Mol Brain Res. 104, 127 –131. Israel, D.I., 1993. A PCR-based method for high stringency screening of DNA libraries. Nucleic Acids Res. 21, 2627–2631. Lezcano, N., Mrzljak, L., Eubanks, S., Levenson, R., Goldman-Rakic, P., Bergson, C., 2000. Dual signaling regulated by calcyon, a D1 dopamine receptor interacting protein. Science 287, 1660–1664. Maruyama, K., Sugano, S., 1994. Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene 138, 171 –174. Nicola, S.M., Surmeier, J., Malenka, R.C., 2000. Dopaminergic modulation of neuronal excitability in the striatum and nucleus accumbens. Annu. Rev. Neurosci. 23, 185–215. Schwerin, M., Maak, S., Hagendorf, A., von Lengerken, G., Syfert, H.M., 2002. A 30 -UTR variant of the inducible porcine hsp70.2 gene affects mRNA stability. Biochem Biophys Acta 1578, 90 –94. Undie, A.S., Friedman, E., 1990. Stimulation of a dopamine D1 receptor enhances inositol phosphates formation in rat brain. J. Pharmacol. Exp. Ther. 253, 987–992. Volloch, V., Schweitzer, B., Rits, S., 1994. Ligation-mediated amplification of RNA from murine erythroid cells reveals a novel class of beta globin mRNA with an extended 50 - untranslated region. Nucleic Acids Res. 22, 2507–2511. Wu, L., Wells, D., Tay, J., Mendis, D., Abbott, M.-A., Barnitt, A., Quinlan, E., Heynen, A., Fallon, J.R., Richter, J.D., 1998. CPEB-mediated cytoplasmic polyadenylation and the regulation of experiencedependent translation of a-CaMKII mRNA at synapses. Neuron 21, 1129–1139. Yang, C.R., Seamans, J.K., Gorelova, N., 1999. Developing a neuronal model for the pathophysiology of schizophrenia based on the nature of electrophysiological actions of dopamine in the prefrontal cortex. Neuropsychopharmacology 21, 161–194. Yu, P.Y., Asico, L.D., Eisner, G.M., Jose, P.A., 1995. Differential regulation of renal phospholipase C isoforms by catecholamines. J. Clin. Invest 95, 304–308. Zelenin, S., Aperia, A., Diaz, H.R., 2002. Calcyon in the rat brain: cloning of cDNA and expression of mRNA. J. Comp Neurol. 446, 37–45. Zhou, Q.Y., Grandy, D.K., Thambi, L., Kushner, J.A., Van Tol, H.H., Cone, R., Pribnow, D., Salon, J., Bunzow, J.R., Civelli, O., 1990. Cloning and expression of human and rat D1 dopamine receptors. Nature 347, 76– 80.