Structure and regulation of the murine γ-casein gene

Biochimica et Biophysica Acta 1579 (2002) 101 – 116 www.bba-direct.com

Structure and regulation of the murine g-casein gene Andreas F. Kolb* Molecular Recognition Group, Hannah Research Institute, Ayr KA6 5HL, Scotland, UK Received 26 June 2002; received in revised form 10 September 2002; accepted 23 September 2002

Abstract The murine casein locus consists of five genes, which are coordinately regulated during mammary development. The levels of caseinspecific mRNAs in mammary epithelial cells increase during the second half of pregnancy and remain high during lactation. The murine gcasein gene, which corresponds to the aS2-casein gene in ruminants, was isolated from a mouse bacterial artificial chromosome (BAC) library (strain 129SV). The gene contains 14 exons, which are distributed over 14 kb of DNA sequence. The expression pattern of the murine g-casein gene mimics that of the neighbouring h-casein gene in terms of developmental induction in vivo. In cell culture, both the h- and gcasein promoter are synergistically induced by prolactin and glucocorticoids. Glucocorticoid induction is critically dependent on prolactinmediated activation of STAT5 in both promoters. Several consensus STAT5 binding sites were identified in the g-casein promoter, some of which may have an additive effect on prolactin induction. mRNA levels of g- and h-casein are similar in lactating mammary tissue. However, promoter segments derived from the g-casein gene are significantly less active in cell culture than comparable fragments of the h-casein promoter. Promoter hybrids between the g- and h-casein promoters revealed that the critical sequences which are responsible for the different in vitro activity are located in a short promoter proximal region. D 2002 Elsevier Science B.V. All rights reserved. Keywords: Milk; Gene regulation; Prolactin; Glucocorticoid; STAT5

1. Introduction Caseins are the major milk proteins in mammals. The casein proteins interact with membranes and are secreted into milk in micelles [1]. In the epithelial cells of the lactating bovine mammary gland, caseins represent up to 80% of the mRNA [2]. The casein genes are clustered at a single gene locus on bovine chromosome 6 [3], human chromosome 4 [4,5] and mouse chromosome 5 [6,7]. Whereas the bovine casein locus harbours four casein genes (aS1, h, aS2 and n), five casein genes are found in the murine casein locus (termed a, h, g, y or q and n). The gene order in the murine casein gene locus is a, h, g, y and n [6,7]. The order in the bovine casein locus is aS1, h, aS2 and n [3]. In accordance with the distribution within the locus, the murine a-casein protein is most homologous to the bovine aS1-casein protein

Abbreviations: BAC, bacterial artificial chromosome; DEPC, di-ethylpyrocarbonate; GR, glucocorticoid receptor; LCR, locus control region; PRLR, prolactin receptor; RT, reverse transcription; STAT, signal transducer and activator of transcription * Tel.: +44-1292-674020; fax: +44-1292-674003. E-mail address: [email protected] (A.F. Kolb).

and the murine g- and y-caseins (originally designated q-casein [8]) are homologous to bovine aS2-casein (data not shown). However, sequence conservation in casein proteins is generally low and largely limited to the signal peptide and the serine clusters, which are major targets for protein phosphorylation [9]. The casein genes are coordinately regulated in that their expression increases during pregnancy, peaks during lactation and ceases after weaning [10,11]. The h-casein promoter of rat and mouse, which has been studied intensively, is activated synergistically by prolactin and glucocorticoids in vitro [12]. Prolactin activation, which is mediated via the JAK/STAT pathway, is a prerequisite for glucocorticoid induction of the h-casein promoter [12,13]. In addition, mammary differentiation and milk protein gene expression is critically dependent on the transcription factor C/EBPh. C/EBPh-deficient mice do not express milk protein genes [14]. However, wild-type mammary epithelium develops normally when transplanted into the stroma of C/EBPh-deficient mice, suggesting that C/ EBPh plays an essential cell autonomous role in the proliferation and differentiation of mammary epithelial cells [14]. C/EBPh is also involved in mediating extracellular matrix signals to milk protein gene promoters [15].

0167-4781/02/$ - see front matter D 2002 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 7 - 4 7 8 1 ( 0 2 ) 0 0 5 3 3 - X

102

A.F. Kolb / Biochimica et Biophysica Acta 1579 (2002) 101–116

One unresolved question is whether the coordination of casein gene expression is controlled by a single genetic master switch like, e.g. a locus control region (LCR, as for example in the human h-globin gene locus [16]) or by the use of functionally identical promoter regions, which respond to identical transcriptional regulators [17]. These options are not mutually exclusive. Experiments in transgenic animals have so far failed to unequivocally delineate an element in the casein gene locus, which fulfils the criteria of an LCR (i.e. leads to transgene expression, which is independent of the transgene integration site and directly dependent on the transgene copy number) [2]. However, transgene constructs under the control of the h- or aS1casein gene promoters have consistently produced higher expression levels than constructs driven by aS2- or n-casein promoter sequences [2,18 – 21]. In order to determine whether the DNA elements that regulate the thoroughly analysed h-casein promoter [12,13] are also functional in other casein promoters, the murine gcasein gene including its promoter region was isolated from a bacterial artificial chromosome (BAC) library. The 30-kb DNA region was sequenced and a battery of reporter gene constructs established. The regulation of the g-casein promoter was subsequently analysed in cell culture model systems and compared to the regulation of the murine hcasein promoter.

2. Materials and methods 2.1. DNA plasmids The murine g-casein gene was isolated from the BAC 490H23 purchased from Research Genetics (Huntsville, AL). The DNA is derived from the mouse strain agouti 129SV. This BAC had previously been identified as carry-

ing the g-casein gene [7]. The BAC DNA was digested with BamHI and ligated to the plasmid pBR322 digested with BamHI. Bacterial colonies carrying g-casein gene fragments were identified by hybridisation with a 594-bp g-caseinspecific cDNA fragment isolated from lactating mouse mammary tissue by reverse transcription (RT)-PCR using oligonucleotides gcas1 and gcas2 (see Table 1). All hybridising colonies carried one of two BamHI fragments of 21 or 10 kb (Fig. 2). EcoRI fragments of these plasmids were subsequently subcloned into pBluescript (Stratagene). When necessary, smaller subclones carrying insert sizes between 150 bp and 1.5 kb were generated. The plasmids were sequenced by MWG (Ebersberg, Germany). The sequences were subsequently ordered into a contig using the SeqMan program in the Lasergene software suite (DNA Star, Madison, WI). The 129SV g-casein gene sequence was deposited to the GenBank under accession number AF50335. After a BAC sequence encompassing the murine gcasein gene was published in the public database (GenBank accession number AC074046; derived from an unidentified mouse strain) the 129SV-derived sequence was aligned to it. Very few discrepancies between the two sequences were detected. Most of them affected the length of repeat regions. No mismatches were detected in the protein encoding sequences (data not shown). To generate a versatile vector backbone for insertion of casein promoter –reporter gene fusions the plasmid pBK-D was derived from the plasmid pBK-CMV (Stratagene) by deletion of the CMV promoter as a 786 bp NsiI/PstI fragment. In order to generate the plasmid pBK-hcas2-luc (Fig. 4), a 3.8-kb HindIII/StyI fragment was excised from the plasmid Cas-lox-luc [22]. The StyI end was blunt ended using the Klenow fragment of E. coli DNA Polymerase I. The 3.8-kb fragment encompassing 380 bp of the mouse hcasein promoter, the first exon, the first intron and 19 bp of the second exon of the mouse h-casein gene linked to the

Table 1 List of oligonucleotides used in this study Name

Length

Sequence

gcas1 gcas2 gcas4 gcas5 gcas6 gcas7 hcas8 hcas9 hcas11 hcas17 hcas21 hcas22 acas4 acas5 h-actin1 h-actin2

25mer 25mer 25mer 24mer 24mer 24mer 20mer 20mer 29mer 20mer 23mer 22mer 23mer 23mer 23mer 23mer

5VAGC AAG GAA CAA GTA ACC ATGa AAG T 3V 5VGCA GCA GTT ATT TTA GGA ATC TTAb G 3V 5VCCT TAG TTG CTT GGA AGA ACA CGC T 3V 5VGGA CAA TAG CGT GTT CTT CCA AAC 3V 5VAGC AGA GCA GTG TGA ACC AGT GGC 3V 5VGCC ACT GGT TCA CAC TGC TCT GCT 3V 5VCAT CCT TTC AGC TTC ACC TC 3V 5VTGT AGC ATG ATC CAA AGG TG 3V 5VACC ACT AGT GGA GGA CAA GAG AGG AGG TG 3V 5VCTG CCT TGT TTA ATG TAC CC 3V 5VGAT GCC CCT CCT TAA CTC TGA AA 3V 5VTTG TGG AAG GAA GGG TGC TAC T 3V 5VAAG TTT CCC CAG CAC AGC AAT CT 3V 5VCCA AAG GGG AAA GGC ATC ATA CT 3V 5VGTC GAC AAC GGS TCC GSC ATG TG 3V 5VCTG TCR GCR ATG CCW GGG TAC AT 3V

a b

Corresponds to the Met-codon at the N-terminus of the murine g-casein protein. Corresponds to the Stop-codon at the C-terminus of the murine g-casein protein.

A.F. Kolb / Biochimica et Biophysica Acta 1579 (2002) 101–116

firefly luciferase gene [23] was ligated into the vector pBKD digested with HindIII and SmaI. In order to generate the plasmid pBK-hcas1-luc (Fig. 4), the plasmid Cas-lox-luc was first digested with NsiI and XhoI, blunt-ended and religated. From the resulting plasmid, a 2.8-kb HindIII/StyI fragment was excised. Again the StyI end was blunt ended using the Klenow fragment of E. coli DNA Polymerase I. The 2.8-kb fragment encompassing 380 bp of the mouse hcasein promoter, the first exon, and 48 bp of the first intron of the mouse h-casein gene linked to the firefly luciferase gene was ligated into the vector pBK-D digested with HindIII and SmaI. The h-casein-derived sequences present in pBK-hcas2-luc were subsequently replaced by various g-casein promoter fragments (Fig. 4). For this purpose, the plasmid pBK-hcas2-luc was digested with BamHI and XhoI and the g-casein promoter fragments were inserted. To generate the chimeric promoter constructs pBKgcas10-luc, pBK-gcas11-luc and pBK-gcas11[as]-luc, a 213-bp fragment of the h-casein promoter was amplified by PCR using the primer pair hcas11 and hcas17 (Fig. 8A). The PCR product was subsequently ligated into the plasmid pBK-gcas1-luc digested with XmnI and BglII (the protruding ends were made blunt by using the Klenow fragment of E. coli DNA polymerase I). Plasmids devoid of the hcasein fragment (pBK-gcas10-luc) and plasmids carrying the h-casein fragment in anti-sense orientation (pBKgcas11[as]-luc) were used as negative controls. To generate the constructs pBK-gcas12-luc and pBK-gcas12[as]-luc, the 213-bp PCR product was digested with AccI. The bigger of the two resulting fragments (146 bp) was again ligated to the plasmid pBK-gcas1-luc digested with XmnI and BglII (Fig. 8A). 2.2. Cells and transfections HC11 murine mammary gland cells were grown in RPMI 1640 medium containing 10% foetal calf serum (FCS), 2 mM glutamine, 5 Ag/ml insulin, 10 ng/ml EGF and antibiotics (100 U/ml penicillin and 100 Ag/ml streptomycin). Baby hamster kidney cells (BHK21, ECACC Ref. No. 85011433) were grown in DMEM medium containing 10% FCS, 2 mM glutamine and antibiotics. MacT bovine mammary epithelial cells [24] were grown in DMEM medium containing 10% FCS, 2 mM glutamine, 5 Ag/ml insulin and antibiotics. Transfections were done by calcium phosphate methodology as described previously [25]. To establish stable pools of transfected HC11 cells, a minimum of 100 cell clones, selected in medium containing 500 Ag/ml G418, were mixed. The vector pBK-D into which the reporter gene cassettes (Fig. 4) were cloned carries a neomycin-phospho-transferase expression cassette. Lactogenic hormone induction in stably transfected HC11 cells was done in RPMI 1640 medium supplemented with 10% FCS, 2 mM glutamine, 5 Ag/ml insulin, 5 Ag/ml prolactin, 1 Ag/ml hydroxycortisone and antibiotics. HC11

103

cells were grown to density and incubated at confluence for 56 h before the induction medium was added. Protein extracts for luciferase measurements were prepared 48-h post induction. Hormone induction in transiently transfected cells was done by co-transfecting the casein– reporter gene construct together with expression plasmids encoding (1) an activated form of the rabbit prolactin receptor (PRLR) [26], (2) the murine STAT5a transcription factor and (3) the human glucocorticoid receptor (GR) alpha and subsequent incubation of the transfected cells in medium supplemented with 1 Ag/ml hydroxycortisone. The activated form of the PRLR carries a 100 amino acid deletion in its extracellular domain and displays full and constitutive activity in the absence of prolactin binding [26]. Therefore, addition of prolactin to the cell culture medium during the induction phase is not required. For each plasmid, 2.5 Ag was transfected per well of a 24-well plate containing 1 ml of medium (a total of 10 Ag of DNA per well). Control transfections were carried out using 2.5 Ag of the casein –reporter gene construct and 7.5 Ag of an unrelated plasmid (pBK-hAPN [27]). Protein extracts for luciferase measurements were prepared 48 h post-transfection as described previously [25]. Unless indicated otherwise, experiments were carried out in triplicate. Transfection efficiencies were controlled by Southern blot analysis of DNA isolated from transfected cells. 2.3. RNA isolation and Northern blotting To isolate total RNA from mouse mammary tissue, 1 g of tissue was removed and immediately frozen in liquid nitrogen. The tissue was ground to powder and disrupted in a tight douncer in a buffer containing 6 M guanidine thiocyanate, 5 mM sodium citrate, 0.1 M h-mercaptoethanol and 0.5% N-lauroylsarkosyl. The RNA was separated from DNA and protein by centrifugation through a cesium chloride cushion (5.7 M CsCl, 0.1 M EDTA). The RNA pellet was dissolved in DEPC-treated water and precipitated by addition of ethanol. Northern blotting was done using the glyoxal method as described in Current Protocols in Molecular Biology [28]. Blots were hybridised with h-casein or gcasein specific cDNA probes in Ambion Ultrahyb solution at 55 jC overnight. The blot was subsequently washed twice with 2  SSC/0.1% SDS and twice with 0.2  SSC/0.1% SDS. Both washes were done at 55 jC. mRNA for quantitative PCR was purified from total RNA via magnetic Oligo-dT beads according to the manufacturer’s instructions (Dynal, Oslo, Norway). Thirty micrograms of total RNA were purified on 80 Al of beads (binding capacity: 10 ng polyA+ RNA per microliter). Tissue culture cell line-derived mRNA was isolated directly from cellular lysates via Oligo-dT beads following manufacturer’s instructions. Lysates from 1  106 cells (equivalent to 10– 30 Ag of total RNA) were purified on 80 Al of beads. In vitro transcripts were generated from the plasmids pBhcas8/9 and pB-gcas1/2 (see below) using T7 RNA poly-

104

A.F. Kolb / Biochimica et Biophysica Acta 1579 (2002) 101–116

merase and T3 RNA polymerase, respectively, according to the instructions of the supplier (Promega).

Table 3 Relative concentrations of casein-specific cDNAs in induced and noninduced HC11 cells as determined by quantitative PCR

2.4. PCR

cDNA

Non-induced

Induced

Fold induction

h-actin a-casein h-casein g-casein

120 F 0 not detectable 0.005 not detectable

230 F 20 0.08 F 0.02 5.57 F 2.44 < 0.001

1.9 not applicable 1114 not applicable

Oligonucleotide primer sequences are summarised in Table 1. A g-casein specific cDNA was generated by RTPCR of polyA+ RNA derived from lactating mouse mammary tissue. cDNA was generated using a MLV reverse transcriptase according to the instructions of the supplier (Promega). g-Casein specific primers were designed using the published g-casein cDNA sequence [29]. To generate a g-casein-specific cDNA, an aliquot of the cDNA synthesis reaction was used as template for a PCR reaction with the primer pair gcas1 and gcas2 and Taq polymerase (Promega). A h-casein cDNA PCR product was generated using the primer pair hcas8 and hcas9. Both PCRs were done with 40 cycles of 30 s at 94 jC, 30 s at 51.2 jC and 2 min at 72 jC. The resulting PCR products of 594 and 841 bp, respectively, were blunt ended by using the Klenow fragment of DNA Polymerase I (Promega) and subsequently phosphorylated by using T4 polynucleotide kinase (New England Biolabs) and ATP. The modified PCR products were cloned into pBluescript (Stratagene) that had previously been digested with SmaI (New England Biolabs) and treated with calf intestinal alkaline phosphatase (Roche). The resulting plasmids pB-gcas1/2 and pB-hcas8/9 were used as template for in vitro transcription reactions and as source for the isolation of hybridisation probes. Long-range PCR was done using the extensor Hi-fidelity PCR master mix (Abgene). BAC DNA was purified as recommended by the supplier (Research Genetics) and used as template for PCRs using primer pairs gcas1 and gcas4, gcas5 and gcas7, gcas6 and gcas2, gcas5 and gcas2, and gcas1 and gcas2 (Table 1). All PCRs were done with 35 cycles of 45 s at 94 jC, 45 s at 54.2 jC and 5 min at 68 jC. Quantitative PCR was performed using the Light Cycler system (Roche) in conjunction with the Fast Start DNA master kit (Roche). Amplifications were done using DNA or cDNA as template. In order to establish standard curves, plasmid dilutions from 10 ng/Al to 1 fg/Al were prepared and used as PCR templates. cDNA synthesis reactions were diluted 1:20, 1:200, 1:2000 and 1:20000 and used as PCR templates. The primer pairs gcas10/gcas11, hcas21/hcas22, acas4/acas5 and h-actin1/h-actin2 were used to amplify aTable 2 Relative concentrations of casein-specific mRNAs in mammary tissue as determined by quantitative PCR Developmental stage

a-casein

h-casein

g-casein

h-actin

Day 15 pregnant Day 18 pregnant Day 6 lactating

450 F 90 1570 F 360 3570 F 150

4375 F 216 11750 F 829 18750 F 1089

400 F 100 2250 F 450 5500 F 1000

28 16 18

Results are shown as pg cDNA/Al reaction (F S.D.). Note the cDNAs in any one row are derived from the same cDNA synthesis reaction.

Results are shown as pg cDNA/Al reaction (F S.D.). Note the cDNAs in any one column are derived from the same cDNA synthesis reaction.

casein-, h-casein-, g-casein- and h-actin-specific cDNAs, respectively. PCRs with a-casein and h-casein specific primers were done with 40 cycles of 15 s at 95 jC, 5 s at 56 jC and 10 s at 72 jC. PCRs with g-casein specific primers were done with 40 cycles of 15 s at 95 jC, 5 s at 54 jC and 10 s at 72 jC. PCRs with h-actin-specific primers were done with 40 cycles of 15 s at 95 jC, 5 s at 60 jC and 10 s at 72 jC. All amplifications were done alongside a negative control, which did not contain the template cDNA. The uniformity of the amplified PCR products was confirmed by using the Light Cycler melting curve program. In addition, all PCR products were analysed by electrophoresis on polyacrylamide gels and agarose gels to confirm their molecular weight. All primer sets were designed such that the correctly sized product could be amplified from a cDNA template but not a genomic DNA template. The crossing points of all dilutions within the range of the standard curves were used to establish mean values and standard deviations. These values are presented as picograms of cDNA per microliter of cDNA synthesis reaction in Tables 2 and 3.

3. Results 3.1. Isolation and sequencing of the murine c-casein gene The murine casein genes are coordinately regulated during pregnancy, lactation and mammary involution [10]. In order to analyse the control elements in the murine gcasein promoter, the respective gene was isolated from a BAC construct containing about 160 kb of the murine casein locus from the mouse strain agouti 129SV (BAC 490H23, Research Genetics). The size of the g-casein gene was estimated by long-range PCR using primers corresponding to cDNA sequences coding for the N and Cterminus of the g-casein protein (Fig. 1). Two BamHI fragments encompassing the entire g-casein gene, spanning a total of 30 958 bp, were isolated from the BAC 490H23. The g-casein gene itself is 14 191-bp long and encompasses 14 exons (Fig. 2). It encodes an mRNA of 920 nt, which is translated into a 21-kDa protein (predicted molecular mass including the signal peptide; 19.4 kDa for the secreted form of the protein). The architecture of the murine g-casein gene is similar to that of other casein genes including the bovine aS2-casein gene (Fig. 2). The first and the last exon do not

A.F. Kolb / Biochimica et Biophysica Acta 1579 (2002) 101–116

105

Fig. 1. Long-range PCR of the murine g-casein gene. BAC DNA was amplified by PCR using overlapping primer pairs in putative exons of the g-casein gene. Five-microliter aliquots of 50 Al PCR reactions were separated on a 0.8% agarose gel and visualised by ethidium bromide staining. The lower half of the figure shows a schematic representation of the murine g-casein mRNA [29]. mRNA and coding region are represented as shaded boxes. The positions of the translational start and stop sites and the polyadenylation signals are indicated. The scale represents the length of the mRNA in nucleotides. The positions of the oligonucleotide binding sites with respect to the g-casein mRNA are indicated. Oligonucleotides gcas1 and gcas2 encompass the translation start (ATG) and stop (TAA) sites, respectively.

contain any coding sequence. The ATG is located in the second exon; the translational stop signal resides in the last but one exon (Fig. 2). The bovine aS2-casein gene, however, is spread over 18 exons encompassing 18 460 bp [30]. Amino acid sequence comparisons of murine and ruminant casein sequences indicate that the murine g-casein protein is less closely related to the ruminant aS2-caseins (23.2%, 24.3% and 23.2% identity to bovine, caprine and ovine aS2-casein) than the murine y-casein protein [8] (30.6%, 30.6% and 31.2% identity to bovine, caprine and ovine aS2-casein). There is limited sequence homology between the murine g- and y-casein proteins (amino acid sequence identity of 22.9%). 3.2. Sequence comparison of casein promoter regions The proximal promoter regions of the murine a-, h- and g-casein genes were aligned with the corresponding bovine aS1-, aS2- and h-casein promoter sequences, the rat gcasein and the goat h-casein promoter using the ClustalV program in the DNA Star sequence analysis software (Fig. 3). The first three nucleotides in all of the aligned casein transcripts are AUC. The conserved sequences in the

promoter regions correspond to previously described regulatory elements: a TATA box ( 24 to 31), a conserved binding site for the Oct1 transcription factor ( 50 to 57) [31], an adjacent AC rich region ( 60 to 67), and two binding sites for STAT5/MGF ( 87 to 97 and 140 to 150) [12]. The g-casein promoter also contains a YY1 site, which does not correspond as well to the consensus [32] as the YY1 binding site in the h-casein promoter [33,34]. The g-casein promoter contains several half sites of glucocorticoid receptor response elements (GRE), which have been shown to be essential for the synergistic activation of the h-casein promoter by prolactin and glucocorticoid hormones [35] (Fig. 3). However, the GRE half sites in the g-casein promoter are located in slightly different positions compared to the sites identified in the rat h-casein promoter [35]. There may also be functional C/EBP binding sites in the g-casein promoter. However, the consensus binding site for C/EBP is highly redundant [36] and the C/EBP binding sites previously identified in the rat h-casein promoter only match this consensus poorly [37] (Fig. 3). Therefore, it is difficult to predict functional C/EBP binding sites in the g-casein promoter by sequence comparison. The binding site for two single-stranded DNA binding proteins,

106

A.F. Kolb / Biochimica et Biophysica Acta 1579 (2002) 101–116

Fig. 2. Schematic representation of the exon – intron structure of the murine g-casein gene and the bovine aS2-casein gene. Exons are represented as solid boxes, introns are shown as horizontal lines. The positions of the translational start and stop sites and the polyadenylation signals are indicated. The scale represents the length of the DNA in base pairs. Important restriction sites are indicated.

which has been identified in the rat h-casein promoter [12,38], is not well conserved in the g-casein promoter (Fig. 3). A perfect match to the consensus of the MAF transcription factor [39] is found at position 270 to 278 (Fig. 3). The 13 kb of g-casein promoter sequence present in one of the cloned BamHI fragments (Fig. 2) was subsequently scanned for STAT5 binding sites using three different patterns in the GeneQuest program of the DNA Star software package. Search pattern 1 (ACTTCTTGGAA; stringency: 80%) corresponds to the proximal STAT5 site in the rat hcasein promoter. Search pattern 2 (CAGAATTTCTTGGGAAAGAAAAT; stringency: 68%) corresponds to the distal STAT5 site in the rat h-casein promoter. Search pattern 3 (TTCTTRGAATT; stringency: 100%) corresponds to the consensus sequence derived from the alignment of the mouse h-, and a-casein, the rat h-, and g-casein and the bovine aS1- and aS2-casein promoters. Ten binding sites were detected, four of which conform to the STAT5 consensus sequence [40,41] (data not shown). The two promoter proximal binding sites in the g-casein promoter are found

at position 85 to 95 (as in all casein promoters) and at position 138 to 148. The distance between the two sites is slightly bigger in the g-casein and aS2-casein promoters than in the a/aS1- and h-casein promoters. In all aligned casein gene promoters, the upstream STAT5 binding site conforms less well to the STAT5 consensus and in case of the murine h-casein promoter, the second site has been shown to display reduced affinity to STAT5 [42]. Interestingly, a second pair of STAT5 sites is found in a more distal position in the g-casein promoter ( 3504 to 3514 and 3625 to 3635). A similar arrangement of promoter distal STAT5 sites has also been detected in the human and bovine hcasein genes [43] and the rabbit aS1-casein gene [44]. These features of promoter architecture may therefore be significant. The role of STAT5 binding sites in the induction of milk protein gene promoters in vivo is unclear at present. STAT5 clearly plays a major role in the development of the mammary gland as knock-out mice devoid of STAT5a fail to establish a functional mammary gland during their first pregnancy [45]. However, mutation of all three promoter

Fig. 3. Sequence alignment of the casein promoter regions. The promoter regions of the murine g-casein gene (accession number: AF50335), the rat g-casein gene (M10936), the bovine aS2-casein gene (M94327), the bovine aS1-casein gene (X59856), the mouse a-casein gene (AC074046), the bovine h-casein gene (X14711), the goat h-casein gene (S74171) and the mouse h-casein gene (X1384) were aligned using the ClustalV program in the DNA Star software package. Residues, which are identical to the mouse g-casein promoter sequence, are indicated as solid circles. Conserved DNA segments corresponding to known transcription factor binding sites (STAT5/MGF, Oct1, YY1, MAF, TATA-box see text) are indicated by light shading. The respective consensus binding sites are shown on top of the mouse g-casein promoter sequence. Transcription factor binding sites, which do not conform well to consensus sites but have been identified experimentally, are also indicated. GRE half-sites [35] are underlined. C/EBP binding sites are marked by dark shading [37]. The binding site for two antagonistic single-stranded DNA-binding proteins (STR/SARP) is indicated by a broken line [38].

A.F. Kolb / Biochimica et Biophysica Acta 1579 (2002) 101–116

107

108

A.F. Kolb / Biochimica et Biophysica Acta 1579 (2002) 101–116

proximal STAT5 binding sites in the ovine h-lactoglobulin (h-LG) promoter did neither abolish transcription nor influence tissue specificity of expression of a h-LG-driven transgene in transgenic mice [46]. Mutation of the three STAT5 binding sites, however, lead to a decrease in trans-

gene expression [46]. Some milk protein gene promoters, most notably the a-lactalbumin promoter, lack promoter proximal STAT5 binding sites and short promoter fragments are therefore not responsive to lactogenic hormone induction in vitro. Hormone responsiveness could be established,

Fig. 4. Schematic representation of the luciferase-reporter constructs. The luciferase gene is indicated as a striped box. g-Casein and h-casein exon sequences are marked as lightly and heavily shaded boxes, respectively. The promoter and intron sequences are indicated as horizontal lines. Binding sites for the transcription factor STAT5 are indicated as arrowheads. A star (*) indicates a perfect match to the STAT5 consensus binding site 5VTTCNNNGAA 3V[40]. An open circle (o) indicates a perfect match to the consensus binding site (5VTTCYNRGAARW 3V) in the MatInspector database (http://www.genomatix.de) [41].

A.F. Kolb / Biochimica et Biophysica Acta 1579 (2002) 101–116

however, by introduction of an artificial STAT5 site into a short a-lactalbumin promoter [47]. This mutated promoter also displayed increased activity in transgenic mice [47]. These observations confirm the significance of STAT5 in the regulation of milk protein genes but also suggest that additional regulatory mechanisms are involved in determining the rate and tissue specificity of milk protein gene transcription. 3.3. Analysis of the c-casein promoter in a murine mammary cell line In order to test the functional significance of the STAT5 binding sites in the c-casein promoter, a collection of luciferase reporter constructs was established in the plasmid backbone of pBK-D (Fig. 4). Some of the reporter constructs were subsequently transfected into the murine mammary cell line HC11 [48]. Luciferase activity was measured

109

in pools of stably transfected cells in the absence and the presence of lactogenic hormones (Fig. 5). The results demonstrated that the g-casein promoter only has marginal activity in the absence of lactogenic hormones. Only in one case (HC11 cells stably transfected with the plasmid pBKgcas4-luc in Fig. 5C) luciferase expression exceeded (1.3fold) the background expression level defined by the control plasmid pBK-gcas0-luc. All other g-casein-driven reporter constructs expressed luciferase levels below background in the absence of lactogenic hormones in both experiments (Fig. 5A,C). Reporter construct carrying 380 bp of the murine h-casein promoter showed basal activity in HC11 cells (2.5 times the background level for hcas1-luc: abbreviated h1 in Fig. 5C; 12 times the background level for hcas2-luc: abbreviated h2 in Fig. 5A). Induction of the HC11 cell pools with lactogenic hormones increased expression from both h-casein (hcas1-luc and hcas2-luc) and two g-casein promoter-driven luciferase reporter constructs

Fig. 5. Expression of luciferase-reporter constructs in stably transfected HC11 cells. HC11 cells were transfected with the indicated constructs and selected in medium containing 500 Ag/ml G418. The resulting cell colonies were pooled and grown to confluence. After reaching confluence, cells were incubated for 56 h before lactogenic hormones were added to one experimental group. Control cells remained in conventional medium. Protein extracts were derived from the cell pools 48 h later and analysed for luciferase activity. (Panel A) Luciferase activity measured in RLU (relative light units) in HC11 cell pools transfected with pBK-gcas0-luc (g0), pBK-gcas1-luc (g1), pBK-gcas2-luc (g2), pBK-gcas4-luc (g4), pBK-gcas1[as]-luc (g1as), pBK-hcas2-luc (h2). Empty columns represent read-outs from non-induced cells ( LH). Striped columns represent read-outs from cells treated with lactogenic hormones ( + LH). Results are derived from three parallel wells of the same cell pool. (Panel B) Induction of reporter plasmids by treatment with lactogenic hormones in the experiment shown in Panel A. (Panel C) Luciferase activity measured in HC11 cell pools transfected with pBK-gcas0-luc (g0), pBK-gcas1-luc (g1), pBK-gcas2-luc (g2), pBK-gcas4-luc (g4), pBK-gcas5-luc (g5), pBK-gcas6-luc (g6), pBK-gcas1[as]-luc (g1as) and pBK-hcas1-luc (h1). Empty columns represent read-outs from non-induced cells ( LH). Striped columns represent read-outs from cells treated with lactogenic hormones ( + LH). (Panel D) Induction of reporter plasmids by treatment with lactogenic hormones in the experiment shown in Panel C.

110

A.F. Kolb / Biochimica et Biophysica Acta 1579 (2002) 101–116

(gcas5-luc and gcas6-luc). Induction from the g-casein promoter did not occur with the gcas1-luc, gcas2-luc and gcas4-luc constructs in this experimental set-up. This is surprising as the g-casein promoter fragments in these constructs contain similar promoter fragments (including the STAT5 binding sites) as the h-casein promoter which was induced 3.5-fold in stably transfected pools of HC11 cells. Longer g-casein promoter fragments (gcas5-luc and gcas6-luc) that contain more potential STAT5 binding sites, however, were able to respond to lactogenic hormone induction. 3.4. Analysis of c-casein expression in vivo and in vitro These experiments raised two questions. First, why is there only marginal basal activity of the g-casein promoter in stably transfected HC11 cell pools (in the absence of lactogenic hormones)? Secondly, why are the short fragments of the g-casein promoter not responsive to lactogenic hormone induction in this experimental format? We first addressed the question whether the differences in g- and h-casein expression are a property of the HC11 cell culture system or whether they reflect the in vivo situation in the lactating mammary gland. Analysis of rat casein gene transcription had demonstrated that the a-, h- and g-casein mRNAs are coordinately up-regulated during pregnancy

and lactation with mRNA concentrations of 17, 22 and 11 Ag per gram of tissue, respectively, at peak lactation [10]. Northern blotting analysis of RNA isolated from murine lactating mammary gland confirmed that the expression levels of murine g- and h-casein are indeed similar (Fig. 6). Quantitative analysis of the Northern blot signals with respect to in vitro transcribed controls revealed that 1 Ag of total RNA isolated from lactating mammary tissue contains 20 ng of h-casein and 14 ng of g-casein specific mRNA (Fig. 6). This result could also be confirmed by quantitative PCR (Table 2). h-casein-specific cDNA was found to be three times more abundant than g-casein-specific cDNA and five times more abundant than a-casein-specific cDNA in lactating mammary tissue. Transcription of the g-casein gene increased more steeply during mammary development (from day 15 of pregnancy to day 6 of lactation) than transcription of the a- and h-casein genes. This is in accordance with data published for the rat casein genes [10]. In HC11 cells treated with lactogenic hormones, however, h-casein-specific transcripts are at least 5000 times more abundant than g-casein transcripts (and about 70 times more abundant than a-casein transcripts) (Table 3). The quantitative PCR analysis also demonstrated that the endogenous h-casein gene was induced more efficiently (at least 500-fold) in HC11 cells than the stably integrated hcasein promoter-driven reporter gene construct (h2 in Fig. 5;

Fig. 6. Northern blot analysis of casein gene transcription. Total RNA (8 and 2.5 Ag) isolated from mouse mammary tissue at peak lactation (day 10) was separated on a 1% agarose gel and blotted to a Nylon membrane (Hybond N, Amersham, UK). Varying amounts of g-casein or h-casein specific in vitro transcript were run alongside the samples (MG = mammary gland). The blots were hybridised with h-casein- and g-casein-specific cDNA probes as indicated and the signals were quantified on a phospho-imager (Molecular Dynamics).

A.F. Kolb / Biochimica et Biophysica Acta 1579 (2002) 101–116

3.5-fold induction). In summary, these results show that HC11 cells are not able to support high levels of g-casein promoter activity. 3.5. Analysis of hormone induction of the murine c-casein promoter To analyse the functionality of the STAT5 binding sites that are present in the g-casein promoter, the constructs gcas0-luc, gcas1-luc, gcas6-luc, gcas7-luc and hcas2-luc (Fig. 4) were transiently transfected into BHK cells (baby hamster kidney fibroblasts) and MacT cells (bovine mammary cells) [24]. In the uninduced state, expression from the plasmids gcas1-luc and gcas6-luc did not exceed expression from the promoterless gcas0-luc construct (Fig. 7A,B). Expression from gcas7-luc was only marginally higher than the background level. Expression from the h-casein promoter, however, was between 50 and 100 times higher than

111

expression of the negative control plasmid. Upon co-transfection of expression plasmids encoding an activated form of the rabbit PRLR [26], murine STA5a and the human GR and subsequent induction of the cells with hydroxycortisone, expression from both casein promoters was increased markedly. This induction occurred in MacT and BHK cells (Fig. 7A,B). Fig. 7C shows a summary of five independent experiments (with triplicate samples in each experiment). In contrast to the experiment in HC11 cells, expression from the 1-kb g-casein promoter fragment in pBK-gcas1-luc could be induced about 10-fold in BHK and MacT cells (by using the co-transfection approach). The construct pBKgcas4-luc (carrying only 248 bp of the g-casein promoter region) was also induced about 8-fold in both BHK and MacT cells (data not shown). However, a 25-fold induction could be achieved with the pBK-gcas6-luc plasmid carrying 13 kb of promoter

Fig. 7. Expression of luciferase-reporter constructs in transiently transfected BHK and MacT cells. (Panel A) Luciferase activity measured in BHK cells transfected with pBK-gcas0-luc (g0), pBK-gcas1-luc (g1), pBK-gcas6-luc (g6), pBK-gcas7-luc (g7) and pBK-hcas2-luc (h2). Empty columns represent readouts from non-induced cells [BHK ( )]. Striped columns represent measurements from cells co-transfected with expression plasmids encoding an activated form of the PRLR, STAT5a and the GR and treated with hydroxycortisone [BHK (+)]. (Panel B) Luciferase activity measured in MacT cells transfected with pBK-g-cas0-luc (g0), pBK-gcas1-luc (g1), pBK-gcas6-luc (g6), pBK-gcas7-luc (g7) and pBK-hcas2-luc (h2). Empty columns represent read-outs from noninduced cells [MacT ( )]. Striped columns represent measurements from cells co-transfected with expression plasmids encoding PRLR, STAT5A and GR and treated with hydroxycortisone [MacT (+)]. (Panel C) Induction of reporter plasmids by lactogenic hormones in BHK cells (empty columns) and MacT cells (striped columns). (Panel D) Induction of pBK-gcas7-luc and pBK-hcas2-luc in BHK cells by glucocorticoids [co-transfection with a GR expression plasmid and induction by hydroxycortisone (G)], prolactin [co-transfection with the PRLR and STAT5 expression plasmids (PS)] and a combination of glucocorticoids and prolactin [co-transfection with all three expression plasmids and induction by hydroxycortisone (PSG)]. For each plasmid, 2.5 Ag was transfected. The transfected DNA was supplemented with the plasmid pBK-hAPN [27] to obtain a total amount of 10 Ag of DNA per transfection reaction.

112

A.F. Kolb / Biochimica et Biophysica Acta 1579 (2002) 101–116

sequence and all 10 putative (four consensus) STAT5 sites. Intriguingly, induction from the plasmids pBK-gcas7-luc (promoter sequence identical to pBK-gcas1-luc) is similar to the induction seen with pBK-gcas6-luc, suggesting that the presence of the intron is also beneficial for the hormone activation of the g-casein promoter. The negative control plasmid pBK-gcas0-luc was only induced marginally under these experimental conditions. Co-transfections of pBKgcas7-luc and pBK-hcas2-luc with PRLR/STAT5 or GR alone demonstrated that the hormonal induction of both casein promoters is synergistic and that the presence of the activated PRLR (and by inference phosphorylated STAT5) is a prerequisite for GR activation of both promoter elements (Fig. 7D). The mechanism by which intron 1 sequences support lactogenic hormone induction is presently unclear. No STAT5 site-like sequences are present in the 1st intron of the g-casein gene. A plasmid (pBK-gcas8-luc), carrying 932 bp of g-casein intron 1 sequences (total intron size: 1164 bp) linked to the luciferase reporter gene, is not activated by lactogenic hormones (data not shown), demonstrating that this DNA segment does not contribute to hormone induction. Intronic sequences have been shown to mediate the glucocorticoid induction of the human fibronectin gene by stabilising nuclear, unspliced transcripts [49]. However, the molecular details of this regulatory mechanism are unknown. These results demonstrate that the g-casein promoter contains (at least one) functional STAT5 binding site(s). The sites that are located in the promoter proximal region (up to position 966) allow for the same level of induction as the STAT5 binding sites in the promoter proximal 380 bp of the h-casein promoter. The inability of HC11 cells to support induction of the g-casein promoter in pBK-gcas1-luc may therefore result (at least in part) from limiting concentrations of signalling molecules, as the same promoter region is readily activated in the presence of excess activated PRLR, GR and STAT5. Transient transfections of HC11 cells with g-casein-driven reporter genes together with PRLR, STAT5 and GR expression constructs, however, did not lead to the same levels of induction that were observed in BHK and MacT cells (data not shown). This suggests that additional factors also limit the induction of g-casein-promoterdriven reporter constructs in HC11 cells. The results also prompted the question whether the gcasein promoter is at all active in tissue culture cells. Theoretically, the casein promoter fragments inserted into the pBK-gcas0-luc plasmid may only act to mediate the lactogenic hormone induction to a cryptic promoter in the vector backbone. In order to determine whether the g-casein promoter can indeed act as a site of transcriptional initiation, the gcas1-luc and gcas7-luc inserts were inserted into the plasmid pT-tk [50]. pT-tk is devoid of eukaryotic promoter elements and accordingly has a very low background activity [22]. At the same time, the plasmid carries an SV40-derived enhancer element, which increases expres-

sion from functional mammalian promoters [23]. The plasmids pT-tk, pT-gcas1-luc, pT-gcas7-luc and the h-casein promoter-driven control plasmid pT-hcas2-luc were transfected into BHK cells. Luciferase expression from the gcasein promoter present in pT-gcas1-luc was 30-fold higher than expression from the negative control plasmid (pT-tk) confirming that the murine g-casein promoter is indeed functional in tissue culture cells (data not shown). Luciferase activity in BHK cells transfected with pT-gcas7-luc was 300-fold higher than in cells transfected with the negative control vector demonstrating the beneficial influence of the first intron (data not shown). Consistent with the results shown in Fig. 7, expression from the h-casein promoterdriven control plasmid pT-hcas2-luc was 10 times higher than expression from the pT-gcas7-luc construct (data not shown). 3.6. Analysis of chimeric casein promoters Expression levels of h-casein promoter-driven reporter genes were consistently higher than expression levels of gcasein promoter-driven reporter genes. This reflects the low activity of the endogenous g-casein promoter in HC11 cells (and probably also in MacT or BHK cells). In order to delineate the promoter fragments, which are responsible for this effect, chimeras of the h- and g-casein promoter were generated (Fig. 8A). A 248-bp g-casein promoter fragment (plus 34 bp of g-casein exon 1) was exchanged against a 170-bp promoter fragment derived from the h-casein promoter (plus h-casein exon 1, 43 bp). Both of the exchanged fragments carry major regulatory elements like Oct1, the STAT5, the C/EBP sites and the GRE half sites. The sequence identity between the fragments is 47% (Fig. 3). The resulting plasmid (pBK-gcas11-luc) was transiently transfected into HC11 cells and MacT cells in parallel with several control plasmids (pBK-gcas1-luc, pBK-hcas1-luc and pBK-gcas10-luc). Luciferase expression was measured after cultivation in the absence of lactogenic hormones. Insertion of the h-casein fragment into the g-casein promoter (in construct pBK-gcas11-luc) leads to a dramatic increase in promoter activity (Fig. 8B). In fact, expression from the chimeric promoter is higher than expression from the h-casein promoter. This is the case in HC11 cells (Fig. 8B) as well as in MacT cells (Fig. 8C). If the h-casein promoter fragment is inserted in anti-sense orientation (pBK-gcas11[as]-luc), the resulting chimeric promoter remains silent. Insertion of a 103-bp h-casein promoter fragment (plus the 43 bp of the h-casein exon 1) into the g-casein promoter still leads to a marked increase in reporter gene expression. However, this chimeric promoter (in construct pBK-gcas12-luc) fails to reach the activity levels of the h-casein promoter. This indicates that important elements required for full activity of the h-casein promoter are absent from the 103-bp fragment. Again, the insertion of the same fragment in antisense orientation (pBK-gcas12[as]luc) only displays marginal promoter activity. The insertion

A.F. Kolb / Biochimica et Biophysica Acta 1579 (2002) 101–116

113

Fig. 8. Chimeric casein promoters. (Panel A) Schematic representation of the reporter gene constructs carrying chimeric h-casein/g-casein promoters. The gcasein and h-casein promoter sequences are presented as a light shaded and dark shaded arrows, respectively. Casein exon sequences are marked as shaded boxes. The luciferase reporter gene is shown as a striped box. Important restriction sites and positions of sequences corresponding to the oligonucleotides hcas11 and hcas17 are indicated. (Panel B) Luciferase activity measured in HC11 cells transiently transfected with pBK-gcas1-luc (g1), pBK-hcas1-luc (h1), pBK-gcas10-luc (g10), pBK-gcas11-luc (g11), pBK-gcas11[as]-luc (g11as), pBK-gcas12-luc (g12) and pBK-gcas12[as]-luc (g12as). (Panel C) Luciferase activity measured in relative light units (RLU) in MacT cells transiently transfected with the same set of plasmids.

114

A.F. Kolb / Biochimica et Biophysica Acta 1579 (2002) 101–116

of h-casein segments into the g-casein promoter did not change the inducibility of the promoter. Both constructs (pBK-gcas1-luc and pBK-gcas11-luc) were induced about 40-fold when co-transfected into BHK cells together with PRLR, STAT5 and GR expression constructs (data not shown). These results demonstrate that the proximal 170 bp of the h-casein promoter are essential for the high activity of this promoter in tissue culture cell lines and that these properties are transferable to the g-casein promoter. Analysis of the h- and g-casein promoter sequences in various analysis programs (Transfac, Mat Inspector, GeneQuest) did not identify any clear candidate transcription factors, which are responsible for the expression difference between the two promoters in cell culture (data not shown). The higher activity of the h-casein promoter is most likely the result of the presence of binding sites for more general transcription factors, which are absent in the g-casein promoter.

4. Discussion Casein gene expression is regulated coordinately during mammary development. The data presented above demonstrate that the g-casein and h-casein genes share many regulatory features. Both genes are abundantly transcribed in mammary tissue at peak lactation [10] and maximum expression levels at that time point are similar as demonstrated by quantitative PCR and Northern blotting. In vitro, both genes are inducible by lactogenic hormones. Glucocorticoid induction in both promoters is critically dependent on the presence of an activated PRLR. This suggests that in the g-casein promoter as in the h-casein promoter, the interaction of the GR with the promoter is mediated by phosphorylated STAT5 protein [35,51,52]. However, the activity of the two promoters is markedly different in vitro. There are two potential reasons for this. First, mammary gland-derived cell lines might not completely replicate the terminally differentiated mammary phenotype. Therefore, transcription factors, which are required for the full activity of the g-casein promoter, may be absent from these cells. Secondly, the promoter regions of the individual casein genes might not be equally potent in isolation, whereas they display similar activities in the context of the casein gene locus. Both of these mechanisms appear to contribute to the low activity of the g-casein promoter in vitro. The first hypothesis is supported by the finding that the endogenous g- and a-casein genes in HC11 cells are expressed at a much lower level than the h-casein gene although all three casein genes are expressed at similar levels in the lactating mammary gland. In the HC11 system, the activity of the casein promoter-driven reporter gene constructs roughly reflects the activity of the corresponding endogenous promoters. This suggests that HC11 cells rep-

resent a stage of mammary development in which the hcasein gene is far more active than the other casein genes. This is in accordance with published results, which suggest that HC11 cells are not representative of fully differentiated mammary epithelial cells [53]. The second hypothesis is supported by the observation that the g-casein promoter is also less active than the hcasein promoter in MacT cells, which are derived from lactating bovine mammary cells [24], in BHK cells or in primary caprine mammary epithelial cells (data not shown). This suggests that the g-casein is generally more fastidious in its requirements for transcription factors than the h-casein promoter. The h-casein promoter may therefore carry transcription factor binding sites that enable partial promoter activity in many epithelial cell types. This property can be transferred onto the g-casein promoter by insertion of h-casein promoter fragments of as little as 103 bp. The promoter chimeras also suggest that the g-casein promoter lacks binding sites for positively acting factors rather than harbouring excess binding sites for negatively acting factors. Different levels of activity have also been observed in transgenic mice carrying casein-promoter-driven transgenes. Bovine aS2-casein constitutes about 10% of cow’s milk protein, whereas h-casein constitutes 30%. Expression of genomic versions of the bovine h- and aS2-casein genes in transgenic mice, however, lead to high levels of bovine hcasein expression (at levels of up to 40% of bovine h-casein in expression in bovine mammary tissue) but only to a low levels of bovine aS2-casein expression (at only 0.1% of the expression in bovine mammary tissue) [2]. This confirms that some casein promoter sequences do not replicate their in vivo activity when they are taken out of the context of the casein gene locus. In summary, the data presented here demonstrate that the g-casein promoter is nearly as active as the h-casein promoter in lactating mammary tissue. Secondly, the data provide evidence that the murine g-casein promoter can be induced synergistically by glucocorticoids and prolactin, and that, as in the h-casein promoter, glucocorticoid induction requires prior prolactin induction. Thirdly, the expression of the endogenous a-, h- and g-casein genes in HC11 cells was characterised. The activity of h-casein and gcasein promoter-driven reporter gene constructs was found to correlate with the expression of the corresponding endogenous genes. Finally, some DNA elements that may be responsible for the differential activity of the g- and hcasein promoters were mapped to the immediate proximal promoter region. Taken together, these data suggest that the promoter regions of casein genes are functionally similar but not identical. Full activity of the murine g-casein promoter may therefore require both, the transcription factors, which are only activated in fully differentiated mammary cells, and additional unknown regulatory DNA elements located outside the immediate promoter region.

A.F. Kolb / Biochimica et Biophysica Acta 1579 (2002) 101–116

Acknowledgements I want to thank Claire Robinson for expert technical assistance, Hinrich Gronemeyer, Jean Djiane, Bernd Groner for plasmids and Linda Pooley for the MacT cells. This work was funded by the Scottish Executive Rural Affairs Department (ROAME 091126).

References [1] R.D. Burgoyne, J.S. Duncan, Secretion of milk proteins, J. Mammary Gland Biol. Neoplasia 3 (1998) 275 – 286. [2] M. Rijnkels, P.M. Kooiman, P.J. Krimpenfort, H.A. de Boer, F.R. Pieper, Expression analysis of the individual bovine beta-, alpha s2and kappa-casein genes in transgenic mice, Biochem. J. 311 (1995) 929 – 937. [3] M. Rijnkels, P.M. Kooiman, H.A. de Boer, F.R. Pieper, Organization of the bovine casein gene locus, Mamm. Genome 8 (1997) 148 – 152. [4] R.S. Menon, Y.F. Chang, K.F. Jeffers, C. Jones, R.G. Ham, Regional localization of human beta-casein gene (CSN2) to 4pter-q21, Genomics 13 (1992) 225 – 226. [5] Y. Fujiwara, M. Miwa, M. Nogami, K. Okumura, T. Nobori, T. Suzuki, M. Ueda, Genomic organization and chromosomal localization of the human casein gene family, Hum. Genet. 99 (1997) 368 – 373. [6] M. Rijnkels, D.A. Wheeler, H.A. de Boer, F.R. Pieper, Structure and expression of the mouse casein gene locus, Mamm. Genome 8 (1997) 9 – 15. [7] S. George, A.J. Clark, A.L. Archibald, Physical mapping of the murine casein locus reveals the gene order as alpha-beta-gamma-epsilonkappa, DNA Cell Biol. 16 (1997) 477 – 484. [8] L.G. Hennighausen, A. Steudle, A.E. Sippel, Nucleotide sequence of cloned cDNA coding for mouse epsilon casein, Eur. J. Biochem. 126 (1982) 569 – 572. [9] M.R. Ginger, M.R. Grigor, Comparative aspects of milk caseins, Comp. Biochem. Physiol., Part B Biochem. Mol. Biol. 124 (1999) 133 – 145. [10] A.A. Hobbs, D.A. Richards, D.J. Kessler, J.M. Rosen, Complex hormonal regulation of rat casein gene expression, J. Biol. Chem. 257 (1982) 3598 – 3605. [11] L.R. Lund, J. Romer, N. Thomasset, H. Solberg, C. Pyke, M.J. Bissell, K. Dano, Z. Werb, Two distinct phases of apoptosis in mammary gland involution: proteinase-independent and -dependent pathways, Development 122 (1996) 181 – 193. [12] B. Groner, F. Gouilleux, Prolactin-mediated gene activation in mammary epithelial cells, Curr. Opin. Genet. Dev. 5 (1995) 494 – 587. [13] W. Doppler, S. Geymayer, H.G. Weirich, Synergistic and antagonistic interactions of transcription factors in the regulation of milk protein gene expression. Mechanisms of cross-talk between signalling pathways, Adv. Exp. Med. Biol. 480 (2000) 139 – 146. [14] G.W. Robinson, P.F. Johnson, L. Hennighausen, E. Sterneck, The C/EBPbeta transcription factor regulates epithelial cell proliferation and differentiation in the mammary gland, Genes Dev. 12 (1998) 1907 – 1916. [15] G. Jolivet, C. Meusnier, G. Chaumaz, L.M. Houdebine, Extracellular matrix regulates alpha s1-casein gene expression in rabbit primary mammary cells and CCAAT enhancer binding protein (C/EBP) binding activity, J. Cell. Biochem. 82 (2001) 371 – 386. [16] F. Grosveld, Activation by locus control regions? Curr. Opin. Genet. Dev. 9 (1999) 152 – 157. [17] L.Y. Yu-Lee, L. Richter-Mann, C.H. Couch, A.F. Stewart, A.G. Mackinlay, J.M. Rosen, Evolution of the casein multigene family: conserved sequences in the 5Vflanking and exon regions, Nucleic Acids Res. 14 (1986) 1883 – 1902. [18] H. Meade, L. Gates, E. Lacy, N. Lonberg, Bovine alpha S1-casein

[19]

[20]

[21]

[22]

[23] [24]

[25]

[26]

[27]

[28]

[29] [30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

115

gene sequences direct high level expression of active human urokinase in mouse milk, Biotechnology (NY) 8 (1990) 443 – 446. M. Baranyi, A. Aszodi, E. Devinoy, M.L. Fontaine, L.M. Houdebine, Z. Bosze, Structure of the rabbit kappa-casein encoding gene: expression of the cloned gene in the mammary gland of transgenic mice, Gene 174 (1996) 27 – 34. M. Rijnkels, P.M. Kooiman, G.J. Platenburg, M. van Dixhoorn, J.H. Nuijens, H.A. de Boer, F.R. Pieper, High-level expression of bovine alpha s1-casein in milk of transgenic mice, Transgenic Res. 7 (1998) 5 – 14. M. Uusi-Oukari, J.M. Hyttinen, V.P. Korhonen, A. Vasti, L. Alhonen, O.A. Janne, J. Janne, Bovine alpha s1-casein gene sequences direct high level expression of human granulocyte-macrophage colony-stimulating factor in the milk of transgenic mice, Transgenic Res. 6 (1997) 75 – 84. A.F. Kolb, R. Ansell, J. McWhir, S.G. Siddell, Insertion of a foreign gene into the beta-casein locus by Cre-mediated site-specific recombination, Gene 227 (1999) 21 – 31. S.K. Nordeen, Luciferase reporter gene vectors for analysis of promoters and enhancers, BioTechniques 6 (1988) 454 – 457. H.T. Huynh, G. Robitaille, J.D. Turner, Establishment of bovine mammary epithelial cells (MAC-T): an in vitro model for bovine lactation, Exp. Cell Res. 197 (1991) 191 – 199. A.F. Kolb, S.G. Siddell, Genomic targeting of a bicistronic DNA fragment by Cre-mediated site-specific recombination, Gene 203 (1997) 209 – 216. I. Gourdou, L. Gabou, J. Paly, A.Y. Kermabon, L. Belair, J. Djiane, Development of a constitutively active mutant form of the prolactin receptor, a member of the cytokine receptor family, Mol. Endocrinol. 10 (1996) 45 – 56. A.F. Kolb, J. Maile, A. Heister, S.G. Siddell, Characterization of functional domains in the human coronavirus HCV 229E receptor, J. Gen. Virol. (1996) 2515 – 2521. F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, K. Struhl, Current Protocols in Molecular Biology, Wiley, New York, 2001. T. Sasaki, M. Sasaki, J. Enami, Mouse gamma-casein cDNA: PCR cloning and sequence analysis, Zoolog. Sci. 10 (1993) 65 – 72. M.A. Groenen, R.J. Dijkhof, A.J. Verstege, J.J. van der Poel, The complete sequence of the gene encoding bovine alpha s2-casein, Gene 123 (1993) 187 – 193. M.A. Groenen, R.J. Dijkhof, J.J. van der Poel, R. van Diggelen, E. Verstege, Multiple octamer binding sites in the promoter region of the bovine alpha s2-casein gene, Nucleic Acids Res. 20 (1992) 4311 – 4318. R.P. Hyde-de Ruyscher, E. Jennings, T. Shenk, DNA binding sites for the transcriptional activator/repressor YY1, Nucleic Acids Res. 23 (1995) 4457 – 4465. B. Raught, B. Khursheed, A. Kazansky, J. Rosen, YY1 represses beta-casein gene expression by preventing the formation of a lactation-associated complex, Mol. Cell. Biol. 14 (1994) 1752 – 1763. V.S. Meier, B. Groner, The nuclear factor YY1 participates in repression of the beta-casein gene promoter in mammary epithelial cells and is counteracted by mammary gland factor during lactogenic hormone induction, Mol. Cell. Biol. 14 (1994) 128 – 137. J. Lechner, T. Welte, J.K. Tomasi, P. Bruno, C. Cairns, J. Gustafsson, W. Doppler, Promoter-dependent synergy between glucocorticoid receptor and Stat5 in the activation of beta-casein gene transcription, J. Biol. Chem. 272 (1997) 20954 – 20960. E. Wingender, X. Chen, R. Hehl, H. Karas, I. Liebich, V. Matys, T. Meinhardt, M. Pruss, I. Reuter, F. Schacherer, TRANSFAC: an integrated system for gene expression regulation, Nucleic Acids Res. 28 (2000) 316 – 319. W. Doppler, T. Welte, S. Philipp, CCAAT/enhancer-binding protein isoforms beta and delta are expressed in mammary epithelial cells and bind to multiple sites in the beta-casein gene promoter, J. Biol. Chem. 270 (1995) 17962 – 17969.

116

A.F. Kolb / Biochimica et Biophysica Acta 1579 (2002) 101–116

[38] S. Altiok, B. Groner, Regulation of gene expression in mammary epithelial cells by cellular confluence and sequence-specific DNA binding factors, Biochem. Soc. Symp. 63 (1998) 115 – 131. [39] S. Mink, E. Hartig, P. Jennewein, W. Doppler, A.C. Cato, A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor, Mol. Cell. Biol. 12 (1992) 4906 – 4918. [40] T. Malewski, Computer analysis of distribution of putative cis- and trans-regulatory elements in milk protein gene promoters, Biosystems 45 (1998) 29 – 44. [41] G.B. Ehret, P. Reichenbach, U. Schindler, C.M. Horvath, S. Fritz, M. Nabholz, P. Bucher, DNA binding specificity of different STAT proteins. Comparison of in vitro specificity with natural target sites, J. Biol. Chem. 276 (2001) 6675 – 6688. [42] A. Kanai, N. Nonomura, M. Yoshimura, T. Oka, DNA-binding proteins and their cis-acting sites controlling hormonal induction of a mouse beta-casein: CAT fusion protein in mammary epithelial cells, Gene 126 (1993) 195 – 201. [43] P. Winklehner-Jennewein, S. Geymayer, J. Lechner, T. Welte, L. Hansson, S. Geley, W. Doppler, A distal enhancer region in the human beta-casein gene mediates the response to prolactin and glucocorticoid hormones, Gene 217 (1998) 127 – 139. [44] G. Jolivet, C. L’Hotte, S. Pierre, N. Tourkine, L.M. Houdebine, A MGF/STAT5 binding site is necessary in the distal enhancer for high prolactin induction of transfected rabbit alpha s1-casein-CAT gene transcription, FEBS Lett. 389 (1996) 257 – 262. [45] X. Liu, G.W. Robinson, K.U. Wagner, L. Garrett, A. Wynshaw-Boris, L. Hennighausen, Stat5a is mandatory for adult mammary gland development and lactogenesis, Genes Dev. 11 (1997) 179 – 186.

[46] T.G. Burdon, K.A. Maitland, A.J. Clark, R. Wallace, C.J. Watson, Regulation of the sheep beta-lactoglobulin gene by lactogenic hormones is mediated by a transcription factor that binds an interferongamma activation site-related element, Mol. Endocrinol. 8 (1994) 1528 – 1536. [47] S. Soulier, L. Lepourry, M.G. Stinnakre, B. Langley, P.J. L’Huillier, J. Paly, J. Djiane, J.C. Mercier, J.L. Vilotte, Introduction of a proximal Stat5 site in the murine alpha-lactalbumin promoter induces prolactin dependency in vitro and improves expression frequency in vivo, Transgenic Res. 8 (1999) 23 – 31. [48] R.K. Ball, R.R. Friis, C.A. Schoenenberger, W. Doppler, B. Groner, Prolactin regulation of beta-casein gene expression and of a cytosolic 120-kd protein in a cloned mouse mammary epithelial cell line, EMBO J. 7 (1988) 2089 – 2095. [49] C.P. Ehretsmann, L.A. Chandler, S. Bourgeois, A nuclear post-transcriptional mechanism mediates the induction of fibronectin by glucocorticoids, Mol. Cell. Endocrinol. 110 (1995) 185 – 194. [50] A.F. Kolb, S.G. Siddell, Genomic targeting with an MBP-Cre fusion protein, Gene 183 (1996) 53 – 60. [51] E. Sto¨cklin, M. Wissler, F. Gouilleux, B. Groner, Functional interactions between Stat5 and the glucocorticoid receptor, Nature 383 (1996) 726 – 728. [52] E. Sto¨cklin, M. Wissler, R. Moriggl, B. Groner, Specific DNA binding of Stat5, but not of glucocorticoid receptor, is required for their functional cooperation in the regulation of gene transcription, Mol. Cell. Biol. 17 (1997) 6708 – 6716. [53] M. Schmitt-Ney, W. Doppler, R.K. Ball, B. Groner, Beta-casein gene promoter activity is regulated by the hormone mediated relief of transcriptional repression and a mammary-gland-specific nuclear factor, Mol. Cell. Biol. 11 (1991) 3745 – 3755.