Characterization of three pheromone-binding proteins (PBPs) of Helicoverpa armigera (Hübner) and their binding properties

Journal of Insect Physiology 58 (2012) 941–948

Contents lists available at SciVerse ScienceDirect

Journal of Insect Physiology journal homepage: www.elsevier.com/locate/jinsphys

Characterization of three pheromone-binding proteins (PBPs) of Helicoverpa armigera (Hübner) and their binding properties Tian-Tao Zhang a,b, Xiang-Dong Mei a, Ji-Nian Feng b, Bente G. Berg c, Yong-Jun Zhang a,⇑, Yu-Yuan Guo a,b,⇑ a

State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing 100193, China Northwest A&F University, Yangling, 712100 Shanxi, China c Department of Psychology, Norwegian University of Science and Technology, N-7491 Trondheim, Norway b

a r t i c l e

i n f o

Article history: Received 1 December 2011 Received in revised form 22 April 2012 Accepted 23 April 2012 Available online 28 April 2012 Keywords: Pheromone-binding proteins Prokaryotic expression Binding experiment 3-D structure Helicoverpa armigera

a b s t r a c t Three pheromone-binding proteins of Helicoverpa armigera were cloned and expressed in Escherichia coli. In order to characterize their physiological properties, ligand-binding experiments were performed using five biologically relevant substances including sex pheromones and interspecific signals. The results showed that one of the pheromone-binding proteins, HarmPBP1, binds strongly to each of the two principal pheromone components of H. armigera, (Z)-11-tetradecenal and (Z)-9-hexadecenal, but not to the interspecific signal (Z)-9-tetracecenal. The two remaining pheromone-binding proteins, HarmPBP2 and HarmPBP3, showed only weak affinities with the ligands tested. The 3-D structure of HarmPBP1 was predicted and the docking experiments indicate that the key binding site of (Z)-9-hexadecenal to HarmPBP1 includes Thr112, Lys111, and Phe119 whereas that of (Z)-11-tetradecenal includes Ser9, Trp37, Phe36, and Phe119. Crown Copyright Ó 2012 Published by Elsevier Ltd. All rights reserved.

1. Introduction Pheromones play an indispensable role for reproductive success of individuals within many species of the animal kingdom. A female moth, for example, emits sex pheromones to attract an appropriate male for mating. These female-produced signals are detected by highly specific receptor neurons housed inside specialized sensilla on the male antennae. In order to reach the dendritic membrane, the airborne pheromones have to pass through the sensillum lymph. To achieve optimal interaction with the relevant receptors, the sex pheromones, as well as other lipophilic odorants, are assumed to rely on a group of small water-soluble proteins called odorant-binding proteins (OBPs). These OBPs are present at high concentrations in the olfactory sensillum lymph where the initial steps of olfactory signal transduction occur (Vogt et al., 1991b; Zhang et al., 2001). The final peripheral event is the transduction of chemical energy to in form of action potentials being transmitted along the antennal nerve to the brain. Depending on the odor signals, a certain behavioral response may take place (Pelosi and Maida, 1995; Zhou, 2010).

⇑ Corresponding authors. Address: Institute of Plant Protection, Chinese Academy of Agricultural Sciences, West Yuan Ming Yuan Road, Beijing 100193, China. Tel.: +86 10 62815929; fax: +86 10 62894786 (Y. Zhang), tel./fax: +86 10 62894786 (Y. Guo). E-mail addresses: [email protected] (Y. Zhang), [email protected] (Y. Guo).

The first insect OBP characterized was in fact a pheromonebinding protein (PBP) of a lepidopteran species, more precisely the giant moth Antheraea polyphemus (Vogt and Riddiford, 1981). In addition to the PBPs, OBPs are reported to include two other subgroups, the general odorant-binding proteins (GOBPs) and the antennal-binding proteins (ABPs) (Breer et al., 1990; Krieger et al., 1996; Vogt et al., 1991a; Vogt and Riddiford, 1981). Immunolabeling experiments have demonstrated that PBPs are predominantly localized in the pheromone-specific sensilla trichodea whereas GOBPs are mainly present in the plant odor-specific sensilla basiconica (Krieger et al., 1993; Zhang et al., 2001). However, several reports have shown that the expression of a particular OBP is not necessarily associated with a distinct morphological type of sensilla (Laue and Steinbrecht, 1997; Maida et al., 1997). Common to all OBPs are six conserved cysteines that are formed by three interlocked disulfide bridges (Briand et al., 2001; Honson and Plettner, 2006; Leal et al., 1999; Scaloni et al., 1999). In addition to the first PBP, ApolPBP1, which was found in A. polyphemus (Vogt and Riddiford, 1981), many insect PBPs have been identified and physiologically characterized over the last 30 years. Most of them have been reported in moths, e.g., Lymantria dispar (Vogt et al., 1989), Mamestra brassicae (MaÏbÈche-Coisne et al., 1997), Antheraea pernyi (Du et al., 1994), and Manduca sexta (Feng and Prestwich, 1997). In a recent publication describing the OBP gene family from the genome of the Bombyx mori silkworm, four of the totally forty-four members were identified as candidate PBPs (Gong et al., 2009). In general, many insect PBPs are reported,

0022-1910/$ - see front matter Crown Copyright Ó 2012 Published by Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.jinsphys.2012.04.010

942

T. Zhang et al. / Journal of Insect Physiology 58 (2012) 941–948

via affinity tests, to bind pheromones (Honson et al., 2005). The hypothesis of selectively transported pheromone components is supported by binding studies involving PBPs from the silk moth species A. polyphemus and A. pernyi (Maida et al., 2000). Also in B. mori, the BmorPBP1 has been demonstrated to selectively bind the main pheromone component bombykol (Große-Wilde et al., 2006). Regarding heliothine moths, three OBPs have been identified in the American tobacco budworm Heliothis virescens, one of which is classified as a PBP (Krieger et al., 1993). In the related but allopatric species, Helicoverpa armigera, twelve OBPs have been identified and physiologically characterized (Wang et al., 2003, 2004; Zhang et al., 2011). Both heliothine species utilize the same signal molecule as the primary component of the pheromone blend, namely (Z)-11-hexadecenal (Z11–16:ALD). Regarding the secondary pheromone constituent, however, H. virescens uses (Z)-9-tetradecenyl (Z9–14:ALD) whereas H. armigera uses (Z)-9-hexadecenal (Z9–16:ALD). Thus, a mixture of Z11–16:ALD and Z9–16:ALD is necessary and sufficient for eliciting the male sexual response in H. armigera (Kehat et al., 1980). The secondary pheromone component in H. virescens, Z9–14:ALD, is utilized as an interspecific signal in H. armigera (Kehat and Dunkelblum, 1990). This substance is produced by Heliothis peltigera which is sympatric with H. armigera. In the present study, we have identified three candidate PBPs from the antennae cDNA library of the cotton bollworm, H. armigera, named HarmPBP1, HarmPBP2, and HarmPBP3. We have expressed the three PBPs in Escherichia coli and used a binding assay technique to measure their affinities for five biologically relevant insect-produced substances, including the two principal sex pheromone components of the species. As H. armigera is a considerable agricultural pest, knowledge about its species-specific signaling system that is linked to reproduction may suggest new potent strategies for insect control.

2.2. RNA extraction and cDNA synthesis Total RNA was isolated from the above-mentioned antennae using Trizol reagent (Invitrogen) and digested with DNase (Invitrogen). cDNA was then synthesized using the Access RT-PCR system (Promega) in accordance with the manufacturer’s protocol. 2.3. Polymerase chain reaction The PCR reaction system included 5 lL 10 ExTaq Buffer, 37.75 lL ddH20, 4 lL dNTPs (2.5 mM), 1 lL forward primer, 1 lL reverse primer, 0.25 lL ExTaq DNA polymerase (Takara) and 1 lL of cDNA (200 ng/lL). After a denaturating step at 94 °C for 3 min, 33 cycles were performed (30 s at 94 °C, 30 s at 56 °C, 1 min at 72 °C), followed by 10 min at 72 °C. All PCR experiments were performed in the same conditions. The accession numbers of the three PBPs in the National Center of Biotechnology Information (NCBI) are shown in Table 1, and the three pairs of primer were as follows: HarmPBP1-F: GGCCATGGCGTCGCAAGATGTTATTA (Nco I) HarmPBP1-R: GGAAGCTTTTAGACTTCGGCCAAG (Hind III) HarmPBP2-F: CAGGATCCTCCAAGGAACTGCTTAC (BamHI) HarmPBP2-R: CAACTCGAGCTAGGCGGCAGTCATGAT (Xho I) HarmPBP3-F: GACCATGGCTTCGAAAGACGCTATGCA (Nco I) HarmPBP3-R: CGCAAGCTTCTATATCTCAGTGAGCACC (Hind III) The restriction enzymes are noted in parentheses after each primer, and the cutting sites are underlined. 2.4. Cloning and sequencing The PCR products were purified and ligated into a pGEM-T Easy Vector (Promega) and incubated overnight at 4 °C. The subsequent ligation product was then transformed into DH5a E. coli competent cells and grown on LB solid medium with 10 mg/mL ampicillin, 1 M isopropyl b-D-thiogalactoside (IPTG) 40 lL, and X-gal 40 lL. Positive colonies were selected using colony PCR and sequencing.

2. Materials and methods 2.5. Construction of expression vector 2.1. Insects The cotton bollworm H. armigera was reared on artificial diet in the laboratory of the Institute of Plant Protection, Chinese Academy of Agricultural Sciences, China. A laboratory colony was established and maintained at 26 ± 1 °C, 60% ± 5% RH, and L 14 h:D 10 h. Male and female antennae were removed from the moths three days after eclosion and were immediately stored in liquid nitrogen.

The plasmids of the positive clones and the PET30a(+) vector were digested with corresponding restriction enzymes. The target fragments were ligated into the digested PET30a(+) plasmids, and the recombinant plasmids were transformed into DH5a competence cells and grown on LB solid medium with 10 lL kanamycin (10 mg/mL). Selected colonies were grown in LB liquid medium with kanamycin and then incubated in a shaker at 200 rpm, 37 °C overnight. The plasmids were then extracted from the

Table 1 The message of three PBPs. Protein

Genbank Accession No.

ORF

Molecular weight (kD)

pI

Signal peptide

Extinction coefficients (280 nm)

HarmPBP1 HarmPBP2 HarmPBP3

HQ436362 HQ436360 AF527054

513 498 495

21 21 21

5.77 5.94 6.05

27 23 22

0.896 0.892 0.893

Table 2 Displacement of a fluorescent probe as a measure of ligand binding by three H. armigera PBPs (Unit: lM). Z11–16:ALD

HarmPBP1 HarmPBP2 HarmPBP3

Z9–14:ALD

Z11–14:ALD

Z11–16:Ac

Z9–16:ALD

IC50

Ki

IC50

Ki

IC50

Ki

IC50

Ki

IC50

Ki

5.5 ± 0.4 40.5 ± 3.3 –

3.5 ± 0.2 37.1 ± 3.0 –

– – –

– – –

22.4 ± 2.3 28.5 ± 2.8 31.5 ± 1.9

14.2 ± 1.5 26.1 ± 2.6 26.1 ± 1.7

14.2 ± 1.2 21.4 ± 2.9 12.3 ± 0.4

10.4 ± 0.8 19.6 ± 2.7 10.2 ± 0.36

1.9 ± 0.2 30.7 ± 1.6 12.5 ± 0.8

1.4 ± 0.1 28.2 ± 1.5 10.3 ± 0.7

T. Zhang et al. / Journal of Insect Physiology 58 (2012) 941–948

E. coli and transformed into BL21(DE3)-competent cells. A single clone was identified and cultivated overnight in LB liquid medium including kanamycin on a shaker. 2.6. Expression and purification of the three PBPs Each bacterial strain containing a plasmid with a PBP gene was grown in LB with 10 mg/mL kanamycin overnight. The cultures were diluted to 1:100 in fresh medium with kanamycin and then

943

shaken (200 rpm) at 37 °C for 2.5 h. Next, a final concentration of 0.2 mM IPTG was added, and the cells were then incubated for an additional 5 h. After centrifuge, the cells were collected and resuspended with 1 phosphate-buffered saline (PBS). Then crushed with ultrasonic, the pellet and supernatant was collected by centrifuge analyzed by SDS–PAGE. The protein pellets were resuspended twice in 10 mM Tris–HCl (pH 8.0) with 0.2% Triton X-100. After centrifugation at 16, 000 rpm for 10 min, the sediment was diluted in 5 mL 8 M urea

Fig. 1. Sequence alignment with other lepidopteran PBPs. Bases that are identical in all sequences are marked with dark color, and the six conserved cysteine residues are marked by ‘‘⁄’’. The accession numbers of the sequence used for alignment are as follows: BmorPBP: NM_001044029; BmorPBP3: NM_001083626; HarmPBP1: HQ436362; HarmPBP2: HQ436360; HarmPBP3: AF527054; HassPBP2: EU316186; HassPBP3: DQ286414; HvirPBP: X96861; LdisPBP1: AF007867; MbraPBP1: AF051143; SlitPBP1: DQ004497.

Fig. 2. SDS–PAGE analysis of recombinant H. armigera. (A) Expression of HarmPBP1in Escherichia coli; (B) Expression of HarmPBP2 in Escherichia coli; (C) Expression of HarmPBP3 in Escherichia coli. 1: Non-induced pET30a(+)/HarmPBP1; 2: induced pET30a(+)/HarmPBP1; 3: supernatant of the induced pET30a(+)/HarmPBP1; 4: inclusion body of induced pET30a(+)/HarmPBP1; 5: the purified protein of pET30a(+)/HarmPBP1; 6: enterokinase-digested pET30a(+)/HarmPBP1; 7: non-induced pET30a(+)/HarmPBP2; 8: induced pET30a(+)/HarmPBP2; 9: supernatant of the induced pET30a(+)/HarmPBP2; 10: inclusion body of induced pET30a(+)/HarmPBP2; 11: the purified protein of pET30a(+)/HarmPBP2; 12: enterokinase-digested pET30a(+)/HarmPBP2; 13: non-induced pET30a(+)/HarmPBP3; 14: induced pET30a(+)/HarmPBP3; 15: supernatant of the induced pET30a(+)/HarmPBP3; 16: inclusion body of induced pET30a(+)/HarmPBP3; 17: the purified protein of pET30a(+)/HarmPBP3; 18: enterokinase-digested pET30a(+)/ HarmPBP3; M: standard protein marker.

944

T. Zhang et al. / Journal of Insect Physiology 58 (2012) 941–948

Table 3 The characters of sex pheromones. Molecular weight

Formula

Z11–16:ALD

238.23

C16H30O

Z9–14:ALD

210.20

C14H26O

Z11–14:ALD

210.36

C14H26O

Z11–16:Ac

282.26

C18H34O2

Structural formula

CAS No. 53939-28-9

O

53939-27-8

O

35237-64-0

O

34010-21-4

O O

Z9–16:ALD

238.23

56219-04-6

C16H30O

O

and then treated with 10 mM DTT and 5 mL 200 mM Tris–HCl. The mixture was incubated at room temperature for 1 h before 1.6 mL 0.5 M NaOH including 5 mM cystine was added. Then a ten times volume of solution buffer (100 mM Tris–HCl (pH 8.0) including mM cysteine) was added to the mixture. After 24 h, the mixture was centrifuged at 1200 rpm for 2 min at 37 °C to obtain the supernatant. The proteins were purified by means of a Ni–NTA column, desalted, and concentrated. To remove the His-tag, the purified proteins were digested with enterokinase and incubated at 16 °C for 16 h. The microplate reader Synergy HT (BioTek, USA) was used to test the concentrate by means of the Bradford method. 2.7. Binding experiments To study the ability of the three PBPs to bind to the insectproduced substances, we used a fluorescence-binding assay to measure the binding constant (Ban et al., 2003). N-phenyl-1-naphthylamine (1-NPN) was used as the fluorescent ligand. The final

concentration of the proteins was 2 lM. The data with the three replicates were analyzed by GraphPad Prism 5, and the binding constant was calculated by the following formula: Ki = [IC50]/ (1 + [1-NPN]/K1-NPN). The five insect-produced substances used in the binding experiments were as follows: Z11–16:ALD, Z9–16:ALD, Z9–14:ALD, (Z)-11-tetradecenal (Z11–14:ALD), and (Z)-11-hexadecenyl-1-acetate (Z11–16:Ac). Details of the insectproduced substances are explained in Table 3; thus, Z11–16:ALD and Z9–16:ALD are the principal pheromone components of H. armigera, whereas Z9–14:ALD and Z11–16:Ac are interspecific signals interrupting the male sexual behavior. Concerning Z11–14:ALD, this substance is a commonly produced compound among heliothine females (Almaas et al., 1991). 2.8. 3-D structure modeling In order to search for structural homologues, the signal peptide of the amino acid sequence of HarmPBP1 was submitted

Fig. 3. Binding of 1-NPN to HarmOBP5. Protein was in 2 lM Tris buffer, pH 7.4. Aliquots of a 1 mM methanol solution of 1-NPN were added to the protein at final concentrations of 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 lM, and the emission spectra were recorded between 390 and 500 nM. (A) HarmPBP1 binding with different concentrations of 1-NPN; (B) HarmPBP2 binding with different concentrations of 1-NPN; (C) HarmPBP3 binding with different concentrations of 1-NPN.

T. Zhang et al. / Journal of Insect Physiology 58 (2012) 941–948

945

3. Results 3.1. Sequence analysis of the three PBPs The three PBPs, HarmPBP1, HarmPBP2, and HarmPBP3, contain six conserved cysteine residues (Fig. 1). There are three amino acid residues between the second and third cysteine residues, and eight amino acid residues between the fifth and sixth cysteine residues. The amino acid sequences of all three proteins show certain similarities with previously identified PBPs in heliothine moths. Thus, HarmPBP1 is quite similar to HassPBP (Accession number: AY864775) and HvirPBP1 (Accession number: X96861), with similarities of 75.29% and 88.82%, respectively. Comparing HarmPBP2 with HassPBP2 (Accession number: EU316186) and HvirPBP2 (Accession number: AM403491), the similarity is approximately 83.03% and 86.67%, respectively. HarmPBP3, in its turn, is comparable with HassPBP3 (Accession number: DQ286414) showing an identity of 97.56%. 3.2. Binding assay

Fig. 4. Competitive binding curves of the tested ligands’ interaction with HarmPBP1 (A), HarmPBP2 (B) and HarmPBP3 (C). A low relative fluorescence value indicates strong binding between the PBP and the ligand. (A) HarmPBP1 showed a high affinity for the two principal pheromone components, Z11–16:ALD and Z9–16:ALD, of which the second component, Z9–16:ALD, bound strongest. Whereas Z11–16:AC and Z11–14:ALD bound relatively weakly, Z9–14:ALD showed no interaction with the HarmPBP1. (B) Except from Z9–14:ALD which showed no interaction with HarmPBP2, the four remaining ligands bound weakly. (C) Except from Z9–14:ALD and Z11–16:ALD, which showed no interaction with the HarmPBP3, the three remaining ligands bound weakly. However, the second principal component, Z9– 16:ALD, showed an affinity at the lowest concentration that was pronounced stronger than those of the other ligands. Z11–16:ALD; marked with blue color; Z9– 16:ALD: marked with pink color; Z11–14:ALD: marked with red color; Z11–16:AC: marked with brown color.

to the Meta Server (http://www.bioinfo.pl/meta/) (Ginalski et al., 2003). As template, the BmPBP from the silkmoth B. mori (PDB ID code 1dqe) was selected. Various alternative 3D models were constructed by the Modeler module in Discovery Studio 2.0 (Accelrys Software Inc.), based on the identified structural template and the corresponding sequence alignments. The main pheromone components of the cotton bollworm, Z11–16:ALD and Z9–16:ALD, were used in molecular docking with the suggested models of HarmPBP1by means of Tthe Profiles-3D method. Thus, after evaluating the fitness between the sequences and each of the alternative 3D models, the model with the highest score was chosen.

The results from the analysis via SDS–PAGE show that the expressed products were present mainly in the form of inclusion bodies (Fig. 2). Before we tested the binding affinity of the three PBPs with the odor ligands, we tested the binding constants of a fluorescent ligand, 1-NPN, with the three PBPs. As shown in Fig. 3, the binding curves and Scatchard plots from these experiments demonstrate that the binding of the fluorescent ligand to each of the three PBPs increases with increasing concentrations of the 1-NPN. The results from the binding assay experiments including the biologically relevant odorants demonstrated that recombinant HarmPBP1 has a strong affinity for the two principal components of the pheromone blend of H. armigera, i.e. Z11– 16:ALD and Z9–16:ALD (Fig. 4A). The binding to the second pheromone component, Z9–16:ALD, was even stronger than that to the primary one, Z11–16:ALD. Among the three remaining substances tested, Z11–14:ALD and Z11–16:Ac showed weak binding to HarmPBP1 (Fig. 4A), whereas Z9–14:ALD showed no binding (not shown). Also HarmPBP2 and HarmPBP3 lacked an affinity for Z9–14:ALD (not shown). Beyond that, HarmPBP2 showed a general weak binding with the remaining four ligands (Fig. 4B). HarmPBP3, in its turn, showed a marked binding with Z9–16:ALD at the lowest concentration (Fig. 4C). In addition, it interacted weakly with Z9–16:ALD, Z11–16:Ac, and Z11–14:ALD (Fig 4C) whereas Z11–16:ALD showed no binding (not shown). 3.3. 3D model of HarmPBP1 From the amino acid sequence of HarmPBP1 we predict that its structure includes seven a-helices, six of which are located between residues 2–23 (a1), 29–34 (a2), 46–58 (a3), 70–80 (a4), 84–100(a5), and 108–126 (a6) (Fig. 5A). Docking experiments including the two principal pheromone components suggest a 3D-model of the HarmPBP1 as shown in Fig. 5B and C. Furthermore, the docking experiments indicate that the key binding site of Z9–16:ALD to HarmPBP1 includes Thr112, Lys111, and Phe119 (Fig. 5A) whereas that of Z11–16:ALD includes Ser9, Trp37, Phe36, and Phe119 (Fig. 5B). 4. Discussion 4.1. Sequence analysis Three PBP genes, HarmPBP1, HarmPBP2, and HarmPBP3, were obtained from the antennae cDNA library of H. armigera (Zhang

946

T. Zhang et al. / Journal of Insect Physiology 58 (2012) 941–948

Fig. 5. Structural modeling and molecular docking of HarmPBP1. (A) Sequence alignment between HarmPBP1 and BomPBP from Meta Server. The secondary structure elements for HarmOBP5 are shown on the top of the sequences. The a-helices are displayed as squiggles. Strictly identical residues are highlighted in white letters with a red background. Residues with similar physico-chemical properties are shown in red letters. Alignment positions are framed in blue if the corresponding residues are identical or similar. (B) Molecular docking between Z9–16:ALD and HarmPBP1. The red marked is Z9–16:ALD and key amino acids were marked by sky-blue color; (C) Molecular docking between Z11–16:ALD and HarmPBP1. The key amino acids were marked by sky-blue color.

et al., 2011). Through an alignment inspection by means of the DNAMAN software, all three PBPs were shown to possess the characteristic pattern of six conserved cysteine residues, which is well known from PBPs/OBPs of other insect species. Besides, the general amino acid sequence of each protein showed a high degree of similarity with other lepidopteran PBPs, particularly those identified in heliothine moths. Highly conserved PBPs of Helicoverpa assulta and H. virescens have previously been reported (Picimbon and Gadenne, 2002; Zhang et al., 2011). As demonstrated from the evolutionary tree of lepidopteran PBPs (Fig. 6), the sequences of the PBPs presented here, from H. armigera, are also very close to those of H. assulta, and H. virescens. Since the main function of the PBPs is assumed to be binding of relevant sex pheromones, probably from a mixture of many odorants, this corresponds well with the similarities of the principal pheromone constituents utilized by the three homologous species. Actually, H. armigera and H. assulta use the same components, but in an opposite ratio. Regarding the number of PBPs, the identification of three, as presented here, is in agreement with previous findings in many other moth species including, for example, B. mori (Forstner et al., 2006), A. polyphemus, A. pernyi, and H. assulta (Maida et al., 2000). In H. virescens, however, only two PBPs have been found so far.

4.2. Binding abilities Data from the displacement assay experiments show that Harm PBP1 is able to bind the two principal pheromone components, Z11:16:ALD and Z9–16:ALD, relatively strongly. Actually, the affinity for the second component, Z9–16:ALD was strongest. Also HarmPBP3 displayed a marked affinity for Z9–16:ALD at the lowest concentration. Regarding Harm PBP2, however, it showed only weak interaction with both principal pheromone components. Surprisingly, one of the ligands tested, namely Z9–14:ALD which serves as an interspecific signal interrupting the male sexual behavior in H. armigera, lacked affinity to all three PBPs. Whether this is caused by methodological conditions, the absence of the relevant PBP, or other circumstances is difficult to say. Anyway, it is interesting to observe that HarmPBP1, which showed a strong affinity for the two pheromone constituents, did not interact with the interspecific signal. Generally, all three PBPs bind single unsaturated fatty aldehydes that are 14–16 carbons in length, as well as the 16-carbon acetate. As shown in Table 2, the binding constants are significantly different, which suggests that each PBP might bind distinct ligands. In particular, it seems likely that HarmPBP1 plays a key role in sex pheromone recognition. This assumption

T. Zhang et al. / Journal of Insect Physiology 58 (2012) 941–948

947

Fig. 6. Phylogenetic comparison of the PBP protein in Lepidoptera. An unrooted distance (neighbor-joining) tree was constructed using an alignment of the PBP sequences in Lepidoptera. Bootstrap support (1000 replications) is indicated at the major nodes.

is also supported by the fact that the association/dissociation constants (Ki/Kd values) of the two principal pheromone components, Z11–16:ALD and Z9–16:ALD, with HarmPBP1, which were 3.5 and 1.4 lM, respectively, match to a certain extent corresponding Ki/Kd values reported in other moth species. In A. pernyi and A. polyphemus, for example, the Kd value reported for E6, Z11-C16-AC to PBP1s is 1.83 and 0.63 lM, respectively (Du and Prestwich, 1995) whereas the Kd values for dispalure (+) and ( ) enantiomers to L. dispar PBP1 and PBP2 are reported to be 1.8– 7.4 lM (Kowcun et al., 2001; Plettner et al., 2001). Slightly lower binding constants of two particular pheromones and their corresponding PBPs have been reported in M. brassica (0.2–0.29 and 0.48–0.51 lM, respectively (Campanacci et al., 2001) . The competitive binding technique utilized here presupposes that the ligands can replace the 1-NPN from the complex and thereby reduce the fluorescence value. The presence of ligands may influence the association and dissociation kinetics of 1-NPN, and also the other way around, i.e. an effect on the association and dissociation kinetics of the ligands caused by 1-NPN (Gong et al., 2010). The Ki value can be calculated from the concentration gradient of the ligand and the Kd of 1-NPN. The Ki of Z11–16:ALD and Z9–16:ALD with HarmPBP1 were 3.5 and 1.4, respectively. These values are quite close to the Kd value reported for E6,Z11-C16-AC to PBP1s of A. pernyi (1.83 lM; Du and Prestwich, 1995). A similar Kd value of the dissociation constants of dispalure (+) and ( ) enantiomers to L. dispar PBP1 and PBP2 (1.8–7.4 lM) has also been reported (Kowcun et al., 2001; Plettner et al., 2001). A slightly lower binding constant of the relevant pheromone to the PBP1s of M. brassica (Campanacci et al., 2001). In spite of several publications reporting that H. armigera responds strongest to Z11–16:ALD, both in behavioral and electrophysiological tests (Zhao et al., 2006), the three PBPs presented here bind strongest to the second component, Z9–16:ALD, and weaker to the primary one, Z11–16:ALD. The results from the behavioral and electrophysiological studies can be explained by the relative abundance of the olfactory receptor neuron types. It has been reported that the A-type sensilla containing the receptor neuron type tuned to Z11–16:ALD constitute approximately

70–90% of the total number of male specific sensilla in the heliothine species, Heliothis subflexa, H. virescens, and H. zea (Almaas et al., 1991; Baker et al., 2004; Berg et al., 2002). Also in H. armigera, the receptor neurons recognizing Z11–16:ALD are considerably more numerous than those recognizing the second pheromone constituent, in this case Z9–16:ALD. In general, the relatively strong receptivity to the primary pheromone is probably ensured by the abundant Z11–16:ALD-responding neurons – and necessarily not by a PBP having the strongest affinity for this compound. 4.3. Three-dimensional structure Consistent with the results from the binding assay tests, we have predicted two putative binding pockets, one for each of the two principal pheromone components. Even though the only difference between their structures is the position of the double bond, we assume that they have distinct binding sites, i.e. Thr112, Lys111, and Phe119 for Z9–16:ALD and Ser9, Trp37, Phe36, and Phe119 for Z11–16:ALD. Interestingly, one amino acid, Phe119, constitutes a part of both binding pockets. Future investigations will include site directed mutagenesis technology on these key amino acids in order to address questions concerning structural details of the HarmPBP1. Acknowledgements This work was supported by the China National ‘‘973’’ Basic Research Program (2012CB114104), the National Natural Science Foundation of China (30871640 and 31171858), and the State High Technology Development Program (2008AA02Z307 to Z.Z.). References Almaas, T.J., Christensen, T.A., Mustaparta, H., 1991. Chemical communication in heliothine moths. Journal of Comparative Physiology A: Neuroethology, Sensory, Neural, and Behavioral Physiology 169, 249–258. Baker, T.C., Ochieng’, S.A., Cossé, A.A., Lee, S.G., Todd, J.L., Quero, C., Vickers, N.J., 2004. A comparison of responses from olfactory receptor neurons of Heliothis subflexa and Heliothis virescens to components of their sex pheromone. Journal

948

T. Zhang et al. / Journal of Insect Physiology 58 (2012) 941–948

of Comparative Physiology A: Neuroethology, Sensory, Neural, and Behavioral Physiology 190, 155–165. Ban, L., Scaloni, A., Brandazza, A., Angeli, S., Zhang, L., Yan, Y., Pelosi, P., 2003. Chemosensory proteins of Locusta migratoria. Insect Molecular Biology 12, 125– 134. Berg, B.G., Galizia, C.G., Brandt, R., Mustaparta, H., 2002. Digital atlases of the antennal lobe in two species of tobacco budworm moths, the oriental Helicoverpa assulta (male) and the american Heliothis virescens (male and female). The Journal of Comparative Neurology 446, 123–134. Breer, H., Krieger, J., Raming, K., 1990. A novel class of binding proteins in the antennae of the silk moth Antheraea pernyi. Insect Biochemistry 20, 735–740. Briand, L., Nespoulous, C., Huet, J.C., Pernollet, J.C., 2001. Disulfide pairing and secondary structure of ASP1, an olfactory-binding protein from honeybee (Apis mellifera L.). The Journal of Peptide Research 58, 540–545. Campanacci, V., Krieger, J., Bette, S., Sturgis, J.N., Lartigue, A., Cambillau, C., Breer, H., Tegoni, M., 2001. Revisiting the specificity of Mamestra brassicae and Antheraea polyphemus pheromone-binding proteins with a fluorescence binding assay. Journal of Biological Chemistry 276, 20078–20084. Du, G., Prestwich, G.D., 1995. Protein structure encodes the ligand binding specificity in pheromone binding proteins. Biochemistry 34, 8726–8732. Du, G., Ng, C.S., Prestwich, G.D., 1994. Odorant binding by a pheromone binding protein: active site mapping by photoaffinity labeling. Biochemistry 33, 4812– 4819. Feng, L., Prestwich, G.D., 1997. Expression and characterization of a lepidopteran general odorant binding protein. Insect Biochemistry and Molecular Biology 27, 405–412. Forstner, M., Gohl, T., Breer, H., Krieger, J., 2006. Candidate pheromone binding proteins of the silkmoth Bombyx mori. Invertebrate Neuroscience 6, 177–187. Ginalski, K., Elofsson, A., Fischer, D., Rychlewski, L., 2003. 3D-Jury: a simple approach to improve protein structure predictions. Bioinformatics 19, 1015– 1018. Gong, D.P., Zhang, H.J., Zhao, P., Xia, Q.Y., Xiang, Z.H., 2009. The odorant binding protein gene family from the genome of silkworm, Bombyx mori. BMC Genomics 10, 332. Gong, Y., Tang, H., Bohne, C., Plettner, E., 2010. Binding conformation and kinetics of two pheromone-binding proteins from the gypsy moth Lymantria dispar with biological and nonbiological ligands. Biochemistry 49, 793–801. Große-Wilde, E., Svatoš, A., Krieger, J., 2006. A pheromone-binding protein mediates the bombykol-induced activation of a pheromone receptor in vitro. Chemical Senses 31, 547–555. Honson, N., Plettner, E., 2006. Disulfide connectivity and reduction in pheromonebinding proteins of the gypsy moth, Lymantria dispar. Naturwissenschaften 93, 267–277. Honson, N.S., Gong, Y., Plettner, E., 2005. Structure and function of insect odorant and pheromone-binding proteins (OBPs and PBPs) and chemosensory-specific proteins (CSPs). In: John, T.R. (Ed.), Recent Advances in Phytochemistry. Elsevier, pp. 227–268. Kehat, M., Dunkelblum, E., 1990. Behavioral responses of male Heliothis armigera (Lepidoptera: Noctuidae) moths in a flight tunnel to combinations of components identified from female sex pheromone glands. Journal of Insect Behavior 3, 75–83. Kehat, M., Gothilf, S., Dunkelblum, E., Greenberg, S., 1980. Field evaluation of female sex pheromone components of the cotton bollworm, Heliothis armigera. Entomologia Experimentalis et Applicata 27, 188–193. Kowcun, A., Honson, N., Plettner, E., 2001. Olfaction in the gypsy moth, Lymantria dispar: effect of pH, ionic strength and reductants on pheromone transport by pheromone binding proteins. Journal of biological chemistry 276, 44770– 44776. Krieger, J., Ganble, H., Raming, K., Breer, H., 1993. Odorant binding proteins of Heliothis virescens. Insect Biochemistry and Molecular Biology 23, 449–456. Krieger, J., von Nickisch-Rosenegk, E., Mameli, M., Pelosi, P., Breer, H., 1996. Binding proteins from the antennae of Bombyx mori. Insect Biochemistry and Molecular Biology 26, 297–307.

Laue, M., Steinbrecht, R.A., 1997. Topochemistry of moth olfactory sensilla. International Journal of Insect Morphology and Embryology 26, 217–228. Leal, W.S., Nikonova, L., Peng, G., 1999. Disulfide structure of the pheromone binding protein from the silkworm moth, Bombyx mori. FEBS Letters 464, 85–90. MaÏbÈche-Coisne, M., Sobrio, F., Delaunay, T., Lettere, M., Dubroca, J., Jacquin-Joly, E., Meillour, P.N.L., 1997. Pheromone binding proteins of the moth Mamestra brassicae: specificity of ligand binding. Insect Biochemistry and Molecular Biology 27, 213–221. Maida, R., Proebstl, T., Laue, M., 1997. Heterogeneity of odorant-binding proteins in the antennae of Bombyx mori. Chemical Senses 22, 503–515. Maida, R., Krieger, J., Gebauer, T., Lange, U., Ziegelberger, G., 2000. Three pheromone-binding proteins in olfactory sensilla of the two silkmoth species Antheraea polyphemus and Antheraea pernyi. European Journal of Biochemistry 267, 2899–2908. Pelosi, P., Maida, R., 1995. Odorant-binding proteins in insects. Comparative Biochemistry and Physiology. Part B. Biochemistry and Molecular Biology 111, 503–514. Picimbon, J., Gadenne, C., 2002. Evolution of noctuid pheromone binding proteins: identification of PBP in the black cutworm moth, Agrotis ipsilon. Insect Biochemistry and Molecular Biology 32, 839–846. Plettner, E., Lazar, J., Prestwich, E.G., Prestwich, G.D., 2001. Discrimination of pheromone enantiomers by two pheromone binding proteins from the gypsy Moth Lymantria dispar. Biochemistry 39, 8953–8962. Scaloni, A., Monti, M., Angeli, S., Pelosi, P., 1999. Structural analysis and disulfidebridge pairing of two odorant-binding proteins from Bombyx mori. Biochemical and Biophysical Research Communications 266, 386–391. Vogt, R.G., Riddiford, L.M., 1981. Pheromone binding and inactivation by moth antennae. Nature 293, 161–163. Vogt, R., Kohne, A., Dubnau, J., Prestwich, G., 1989. Expression of pheromone binding proteins during antennal development in the gypsy moth Lymantria dispar. The Journal of Neuroscience 9, 3332–3346. Vogt, R., Prestwich, G., Lerner, M., 1991a. Odorant-binding-protein subfamilies associate with distinct classes of olfactory receptor neurons in insects. Journal of Neurobiology 22, 74–84. Vogt, R., Rybczynski, R., Lerner, M., 1991b. Molecular cloning and sequencing of general odorant-binding proteins GOBP1 and GOBP2 from the tobacco hawk moth Manduca sexta: comparisons with other insect OBPs and their signal peptides. The Journal of Neuroscience 11, 2972–2984. Wang, G.R., Wu, K.M., Guo, Y.Y., 2003. Cloning, expression and immunocytochemical localization of a general odorant-binding protein gene from Helicoverpa armigera (Hübner). Insect Biochemistry and Molecular Biology 33, 115–124. Wang, G.R., Wu, K.M., Guo, Y.Y., 2004. Molecular cloning and bacterial expression of pheromone binding protein in the antennae of Helicoverpa armigera (Hübner). Archives of Insect Biochemistry and Physiology 57, 15–27. Zhang, S.-g., Maida, R., Steinbrecht, R.A., 2001. Immunolocalization of odorantbinding proteins in Noctuid Moths (Insecta, Lepidoptera). Chemical Senses 26, 885–896. Zhang, T., Gu, S., Wu, K., Zhang, Y., Guo, Y., 2011. Construction and analysis of cDNA libraries from the antennae of male and female cotton bollworms Helicoverpa armigera (Hübner) and expression analysis of putative odorant-binding protein genes. Biochemical and Biophysical Research Communications 407, 393–399. Zhao, X.C., Yan, Y.H., Wang, C.Z., 2006. Behavioral and electrophysiological responses of Helicoverpa assulta, H. armigera, (Lepidoptera: Noctuidae), their hybrids and backcross progenies to sex pheromone component blends. Journal of Comparative Physiology A: Neuroethology, Sensory, Neural, and Behavioral Physiology 192, 1037–1047. Zhou, J.J., 2010. Odorant-binding proteins in insects. In: Gerald, L. (Ed.), Vitamins & Hormones. Academic Press, Burlington, pp. 241–272.