- Email: [email protected]
Characterization of two novel ADP ribosylation factors from the shrimp Marsupenaeus japonicus
Fish & Shellfish Immunology 29 (2010) 956e962
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Characterization of two novel ADP ribosylation factors from the shrimp Marsupenaeus japonicus Jinyou Ma a, b, Mingchang Zhang a, Lingwei Ruan a, Hong Shi a, c, Xun Xu a, * a
Key Laboratory of Marine Biogenetic Resources, Third Institute of Oceanography, State Oceanic Administration (SOA), 178 Daxue Road, Xiamen Fujian 361005, P.R. China College of Animal Sciences, Henan Institute of Science and Technology, Xinxiang Henan 453003, P.R. China c School of Life Sciences, Xiamen University, Xiamen Fujian 361005, PR China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 22 May 2010 Received in revised form 6 August 2010 Accepted 7 August 2010 Available online 14 August 2010
ADP-ribosylation factors (Arfs) that play an essential role in intracellular trafficking and organelle structure are small GTP-binding proteins, which have been identified recently to be involved in virus infection. However, little is known about the Arfs and their relationships with viral infection in the economically important crustaceans to date. In the present study, two novel members of the Arf family, designated as MjArf1 and MjArfn respectively, were cloned from the shrimp Marsupenaeus japonicus. Sequence and phylogenetic analysis showed that MjArf1 belongs to Class I Arf, which has very high homology in sequence to the known Arf 79F of insects and Arf1 of other animals (96e99%), whereas MjArfn is an unidentified Arf, which has only 62e66% identity to other known Arfs. In High Five cells, the distribution of MjArf1 was dependent on its GDP/GTP binding state but the distribution of MjArfn was not affected by that. Both Arfs were ubiquitously expressed in examined tissues. Further investigation with real-time quantitative PCR revealed that MjArf1 and MjArfn were significantly up-regulated after WSSV challenge. In virus-resistant shrimps, however, no distinct fluctuation of MjArf1 expression was found and MjArfn was even found to be notably repressed. These results suggested that MjArf1 and MjArfn might be involved in the shrimp innate immune response in WSSV infection and MjArfn might play a role in WSSV invasion. These studies may contribute to a better understanding of host defense and/or virus invasion interaction and for the control of marine crustacean diseases. Ó 2010 Elsevier Ltd. All rights reserved.
Keywords: Marsupenaeus japonicus WSSV ADP ribosylation factor MjArf1 MjArfn
1. Introduction Shrimps are the most important crustaceans in the aquaculture industry worldwide. However, white spot syndrome virus (WSSV) has caused severe damages to shrimp industry since its emergence in early 1990s [1,2]. Since then, the molecular mechanism of the shrimp immune defense against virus infection was emerged as a hot spot to be elucidated. Recent studies demonstrated that small GTPases found in shrimp participated in the antiviral immunity by regulating phagocytosis [3,4]. Especially, some members of ADPribosylation factors (Arfs) reported in mammal, which belong to small GTP-binding proteins (w21 kDa), were found to be involved in virus infection [5e7]. So the relationship of the different Arfs with virus invasion was worth investigating.
Abbreviations: Arf, ADP ribosylation factor; WSSV, white spot syndrome virus; GEFs, guanine nucleotide exchange factors; BFA, Brefeldin A; CT,, cycle threshold value; EGFP, enhanced green fluorescence protein. * Corresponding author. Tel./fax: þ86 592 2195296. E-mail address: [email protected] (X. Xu). 1050-4648/$ e see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2010.08.003
Arfs were originally identified as a protein cofactor required for efficient ADP-ribosylation of the Gsa subunit of adenylate cyclase by cholera toxin [8,9], but they were later found to be involved in membrane transport, maintenance of organelle structures and remodeling of the cytoskeleton [10e12]. Arf family members have been identified in a wide variety of organisms including bacteria, yeast, plants, invertebrates and vertebrate. Based on sequence homology and organization, the six mammalian Arf proteins can be divided into three classes, with class I including Arf1, 2, and 3, class II including Arf4 and 5, and class III, its only member is Arf6. Although all Arfs have the ability to regulate the budding and formation of vesicles in the endocytic and exocytic pathways, different Arfs seem to possess different intracellular localizations and functions depends on the specific membrane it binds according to recruitment of the diverse groups of proteins [10,11,13e15]. Furthermore, Arf proteins exist in the formation of GDP-bound and GTP-bound state, and this cycling is also catalyzed by the specific proteins as guanine nucleotide exchange factors (GEFs) and GTPase-activating proteins (GAPs). Arf-GTP can also interact with a diverse group of proteins, including vesicle coat proteins and lipid-metabolizing enzymes [13]. In the evolutionary process of
J. Ma et al. / Fish & Shellfish Immunology 29 (2010) 956e962
interactions between virus infection and host defense, Arf-dependent secretion pathway may induce anti-virus actions through the secretion of interferons and the presentation of viral antigens by MHC I [16,17]. But then, the pathway of secretion or endocytic is easy to be employed to cause viral immune evasion and virus propagation, which Arfs was recruited to the specific target membrane to induce the disintegration of intracellular membranes and formation of specific vesicles by viral proteins mediating their interactors [18,19]. Moreover, Mjcent [20], as the Arf6 GAP, and MjArf4 [21], the member of Arf class II in Marsupenaeus japonicus, were up-regulated after WSSV infection, suggesting that shrimp Arfs may also participate in virus invasion and/or host defense events. In the past two decades, a number of Arf proteins and genes have been identified from various organisms, but the only crustacean Arf has been characterized is MjArf4 [21], a member of class II from the shrimp M. japonicus to date. To investigate the different Arfs and the relationships between the Arfs and WSSV infection in the shrimps, here we report two novel Arf proteins, MjArf1 and MjArfn, in M. japonicus and their involvement in the WSSV infection. 2. Materials and methods 2.1. Cloning of the full-length cDNA of MjArf1 and MjArfn Partial sequence (w310 bp) of Arfs cDNA was amplified from M. japonicus hepatopancreas cDNA using degenerated primers ArfF and ArfR (Table 1) corresponding to the conserved amino acid sequences DAAGKT and NKQDLP in invertebrate and vertebrate Arfs. The missing 50 -terminal and 30 -terminal sequence of MjArf1 and MjArfn were subsequently obtained by PCR using the specific primer pairs, Arf1N/Y2HN, Arf1C/Y2HP, ArfnN/Y2HN, and ArfnC/
Table 1 Oligonucleotide primers used in the experiments. Primer names
Sequences(50 e30 )
ArfF ArfR Arf1N Arf1C ArfnN ArfnC Y2HN Y2HP Arf1F Arf1R ArfnF ArfnR MjArf1F MjArf1R MjArfnF MjArfnR MjArf1-31F MjArf1-31R MjArf1-71F MjArf1-71R MjArfn-31F MjArfn-31R MjArfn-71F MjArfn-71R
GGCCTGGACGCCGC(A/T/C/G)GG(A/T/C/G)AA(A/G)AC CATGGCGTTGGGCAG(A/G)TC(C/T)TG(C/T)TT(A/G)TT CTCTCCAATACGTTCTCGATC CAAATGATCGAGAACGTATTGG CACCGCCATCATTTACGTGG GCGACCAGGAGAGGATAAAG GAGATCGAATTAGGATCCTCTGC GCAGTAATACGACTCACTATAGGG GCGGATCCGTGGCAAAAATGGGCAAC BamH I, italic GCGAATTCTGGTGGCGAGATTTAGCG EcoR I, italic GCGAATTCATCATGGGGATCCTGCTG Ecor I, italic CCAAGCTTCACTTGGAGACCTCCCTG Hind III, italic GCGGTACCGTGGCAAAAATGGGCAAC Kpn I, italic GCGGTACCCGGTTGGCATTCTTCAGC Kpn I, italic ATGGTACCATCATGGGGATCCTGCTG Kpn I, italic ATGGTACCTTGGAGACCTCCCTGG Kpn I, italic CTGGTAAAAacACAATCCTGTATAAGC (ac: mutation site) GCTTATACAGGATTGTgtTTTTACCAG (gt: mutation site) GTTGGCGGACtAGATAAAATCAGGCCAC (t: mutation site) GTGGCCTGATTTTATCTaGTCCGCCAAC (a: mutation site) GCAGGGAAAAaTACAGTTCTCTACAAG (a: mutation site) CTTGTAGAGAACTGTAtTTTTCCCTGC (t: mutation site) GTCGGCGGCCtGGCGAAGCTAAGGCCTT (t: mutation site) AAGGCCTTAGCTTCGCCaGGCCGCCGAC (a: mutation site)
Primers used for Real time PCR Actin-F GACGGTCAGGTGATCACCAT Actin-R CGATTGATGGTCCAGACTCG Arf1rtF GCGCCACTACTTCCAGAACACA Arf1rtR AGCGGTTGGCATTCTTCAGC ArfnrtF AGGCCTTTGTGGAGACACTATTAC ArfnrtR TCTGCTGCTGGAGGTTGAGTC
957
Y2HP (Table 1), respectively, with a M. japonicus hepatopancreas and hemocyte mixed cDNA library constructed into pAD-GAL4-2.1 phagemids as the template. Based on the results of the 50 -terminal and 30 -terminal, the primers Arf1F, Arf1R, ArfnF and ArfnR (Table 1) were designed for PCR amplification of the open reading frames (ORFs) of MjArf1 and MjArfn. 2.2. Sequence analysis Nucleotide sequences and deduced protein similarity analysis were performed using Clustal X [22], the DNA Software (Lynnon BioSoft) and the BLAST programs (http://www.ncbi.nlm.nih.gov/ blast/), respectively. The phylogenic tree was constructed by the neighbor-joining (NJ) method (bootstrap: 1000) with MEGA 4.0 (Molecular Evolutionary Genetics Analysis) program [23]. 2.3. Construction of MjArf1 and MjArfn fusion constructs The T31N mutant had very low affinity for GTP and behaved as a constitutively inactive or dominant negative mutant and the Q71L mutant had behaved partially as a constitutively activated mutant in in vitro assays [24]. Point mutations of MjArf1 and MjArfn were performed by site-directed mutagensis using PrimeSTAR HS DNA Polymerase (Takara). The T31N and Q71L substitutions were introduced using a two-step recombinant PCR technique as previously described [24,25]. Briefly, the primer pairs MjArf1F/MjArf131R and MjArf1-31F/MjArf1R were used to amplify two fragments of MjArf1 separated at position 31. These two fragments were taken as templates for the second round PCR using primers MjArf1F and MjArf1R. The PCR products were finally digested with Kpn I and inserted into pIZ-V5-His/EGFP plasmid (EGFP inserted into pIZV5-His with Xbal I digestion) to form pIZ-V5-His/MjArf1(T31N)/ EGFP. The EGFP was fused at the C-terminus of MjArf1 according to previously described [25,26]. The same method was introduced to construct the pIZ-V5-His/MjArf1(Q71L)/EGFP, pIZ-V5-His/MjArfn (T31N)/EGFP and pIZ-V5-His/MjArfn(Q71L)/EGFP plasmid. The MjArf1 (wild type, wt) and MjArfn (wt) were also subcloned into pIZ-V5-His/EGFP to produce pIZ-V5-His/MjArf1(wt)/EGFP and pIZ-V5-His/MjArfn(wt)/EGFP respectively. 2.4. Cell culture and transfection High FiveÔ cells (Invitrogen) were maintained in SFX medium (Hyclone) at 27 C. The MjArf1 and its mutant constructs were transfected into High Five cells respectively by using Cellfectin transfection reagent (Invitrogen) according to manufacturer’s protocol. EGFP fluorescence signal was observed with an inverted fluorescence microscope (Nikon, TE2000-S) at 48 h post transfection. To observe the effect of Brefeldin A (BFA, Epicentre Technologies) on Arfs localization, cells were incubated with 40 mg/ml BFA at 27 C for 1 h before EGFP observation. The same method was adopted to address MjArfn and its mutant constructs. 2.5. Shrimp culture and WSSV challenge Healthy live wild M. japonicus (w15 g) were cultured in 80 L tanks (at 25 C) filled with air-pumped circulating sea water. To ensure the shrimps were WSSV-free, several shrimps were randomly selected for WSSV detection before WSSV challenge [27]. For the WSSV challenge experiment, 60 shrimps were injected with 100 ml of purified WSSV (approximately 1.0 107 virions/ml in sterile PBS, pH 7.3) each in the lateral area of the fourth abdominal segment. Another 35 shrimps treated with 100 ml sterile PBS each were served as controls. At the time point of 0, 6, 12, 24, 48, 72 and 96 h post injection, four individuals were randomly picked out from
958
J. Ma et al. / Fish & Shellfish Immunology 29 (2010) 956e962
the challenge group and the control group respectively. The hepatopancreas were collected for subsequent real-time quantitative PCR detection. Virus-resistant shrimps were obtained by a method previously described [28]. And the samples (hepatopancreas) of virus-resistant shrimps were provided by Dr. Chen Dandan. 2.6. Tissue distribution of MjArf1 and MjArfn mRNA expression A batch of healthy live shrimps M. japonicus (w15 g) were purchased from a supermarket in Xiamen, China. Total RNAs were isolated from the different tissues using TRIzol reagent (Invitrogen) by a method previously described [20]. After treatment with DNase I, the first-strand cDNA was synthesized by reverse transcriptase SuperScript III (Invitrogen) with Random Hexamer Primer (Fermentas). The first-strand cDNA was diluted to 1:10 for the PCR reaction with the primer pairs Arf1rtF/Arf1rtR and ArfnrtF/ArfnrtR respectively (Table 1). The M. japonicus Actin gene (GenBank AB055975) was served as the internal control. The expression level of MjArf1 and MjArfn transcript in the examined tissues was calculated using ImageJ (Sun Microsystems, Inc.). 2.7. Gene expression of MjArf1 and MjArfn by quantitative RT-PCR For Real-time quantitative PCR, RNA extraction and cDNA synthesis were performed as described in Section 2.6. Primers (Table 1) were designed against the complete nucleotide sequence of MjArf1 and MjArfn, and the Actin (GenBank AB055975) of M. japonicus was used for internal standardization. Real-time quantitative PCR was carried out using SYBR premix Ex Taq (Takara) according to manufacturer’s instructions. Amplification reactions were performed using the Rotor-GeneÔ 6000 (Corbett Life Science) for each sample in a total volume of 20 ml containing 10.0 ml SYBR 2 premix Ex Taq (Takara), 0.4 ml of each primer (20 mM), 2 ml of diluted first-strand cDNA (1:10), and 7.2 ml of sterile distilled water. The reaction program was as follows: 1 cycle of initial denaturation of 30 s at 95 C, followed by 40 cycles of 95 C for 15 s, 59 C for 15 s, and 72 C for 20 s. Fluorescent data were acquired during each extending phase. A melting curve analysis was included for each sample after PCR to detect the specificity of the PCR products. Each sample was repeated for three times. After the PCR program, the data were analyzed with the Rotor-GeneÔ 6000 Series Software (Corbett Life Science) using the 2ΔΔCT method [29]. For statistical analysis, ANOVA test was applied to measure the difference with SPSS software (SPSS Inc., Chicago, IL). A p value less than 0.05 was considered statistically significant. 2.8. Analysis of virus load Viral loads of shrimps with WSSV challenge at every time point were analyzed by PCR as described before [27]. Genomic DNA was extracted as template, and then WSSV-specific DNA fragments were amplified. Actin gene of M. japonicus was set as an internal control. 3. Results 3.1. Cloning of full-length cDNA of MjArf1 and MjArfn The full-length cDNA of MjArf1 and MjArfn were cloned from M. japonicus. MjArf1 contains an open reading frame (ORF) (GenBank accession No. GQ483535), which encodes a protein of 182 deduced amino acids (Fig. 1A) with a calculated molecular weight of 20.70 kDa and a predicted pI of 6.40. For MjArfn (GenBank accession No. GQ483536), the corresponding parameters were 178 deduced amino acids (Fig. 1B), 19.83 kDa and 5.05 respectively.
Fig. 1. Sequence of (A) MjArf1 and (B) MjArfn cDNA and predicted proteins. N-terminal myristoylation site is indicated with grey shadow; p loop is indicated with dot line; switch 1 is indicated with solid line; switch 2 is indicated with dash line and interswitch are shaded with box.
3.2. Molecular characterization of MjArf1 and MjArfn Amino acid sequence analysis showed that MjArf1 shared highly similarity with Arf 79F of insects (Drosophila melanogaster, 99%; Bombyx mori, 98%; Stomoxys calcitrans, 98%; Argas monolakensis,
J. Ma et al. / Fish & Shellfish Immunology 29 (2010) 956e962
98%; Aedes aegypti, 97%) and Arf1 of some animals (Lepeophtheirus salmonis, 97%; Ixodes scapularis, 97%; Homo sapiens, 97%; Mus musculus, 97%, 96%; Gallus gallus, 96%; Xenopus laevis, 97%, 96%; Danio rerio, 96%), ranging from 96% to 99%, and MjArfn was 62e66% identity to Arfs from other organisms [Cryptosporidium pavum (Arf1/2, 66%); Cryptosporidium muris (Arf1, 64%); Aiptasia pulchella (Arf1, 62%); M. japonicus (Arf4, 62%); Lepeophtheirus salmonis (Arf4, 63%); Danio rerio (Arf4, 63%; Arf 5, 63%); Xenopus laevis (Arf4, 63%); Bos taurus (Arf4, 62%)]. The predicted structure indicated that MjArf1 and MjArfn possessed the property of Arfs, including the site of myristoylation at position 2, p loop (GLD(A or G)AGKTT), switch 1, switch2 as well as interswitch regions (Fig. 1A and B). Phylogenetic analysis displayed that MjArf1 formed a clade with Arf 79F and Arf1, but MjArfn was not constructed a cluster with three class Arfs. Moreover, MjArf1 forms a clade with the member of class I Arf in invertebrate, which is paraphyletic relative to another branch constituting with that of class I Arf in vertebrate (Fig. 2). MjArf1 belonged to class I Arfs, whereas MjArfn didn’t match to any of three class Arfs described previously. 3.3. Site mutation analysis of MjArf1 and MjArfn The distribution of MjArf1 and MjArfn proteins in the High five cells was determined by introducing the plasmid of both wild type and the mutants (T31N and Q71L) with EGFP fused to the C-terminus. Cells expressing wt-MjArf1-EGFP exhibited punctuate subcellular structures throughout cytoplasm (Fig. 3A MjArf1-EGFP). Similarly, cells transfected with Q71L-MjArf1-EGFP, in which Gln at position 71 was substituted by Leu, displayed the same localization pattern [Fig. 3A, MjArf1 (Q71L)-EGFP]. The mutant Q71L-MjArf1EGFP maintained the GTP-bound state and functioned in a dominant-active manner. In contrast, T31N-MjArf1-EGFP, which was substituted Asn for Thr at position 31, exerted the GDP-bound state and functioned in a dominant-negative manner. Cells transfected with T31N-MjArf1-EGFP showed the disassociation of the punctuate structure and fluorescence was diffused throughout cytosol [Fig. 3A, MjArf1 (T31N)-EGFP. For MjArfn protein, none of the cells transfected with the wt-MjArfn-EGFP, T31N-MjArfn-EGFP or Q71L-MjArfn-EGFP showed the punctuate structure in the cytoplasm. Accordingly, the fluorescence in the cells was an even distribution (Fig. 3B). So the mutant at position 31 and 71 amino acid had no effect on the distribution of MjArfn protein in the High five cell.
Fig. 2. Phylogenetic analysis by the Neighbor-Jioning method based on amino-acid sequences of Arfs (Arfl2 as outgroup). Mj, Marsupenaeus japonicus. Arfl2: Arf-like protein.
959
3.4. Tissue distribution of MjArf1 and MjArfn mRNA The distribution of MjArf1 and MjArfn mRNA was plumbed in various M. japonicus tissues, including hemocyte, hepatopancreas, gill, heart, intestine and muscle. The RT-PCR results showed that both the mRNA transcripts of MjArf1 and MjArfn can be detected in all the examined tissues with different transcription levels (Fig. 4A and B). The transcription level of MjArf1 was obviously higher in gill, heart and intestine than in hemocyte, hepatopancreas and muscle (Fig. 4A). But the transcription level of MjArfn was high in heart only (Fig. 4B). 3.5. Transcriptional analysis of MjArf1 and MjArfn after WSSV infection Real time quantitative PCR was employed to detect whether the transcription level of MjArf1 and MjArfn was related to WSSV infection. The transcription levels of MjArf1 and MjArfn at different time points after WSSV infection were shown in Fig. 5A and B, and the virus loads was shown in Fig. 5C. The transcription level of MjArf1 was rapidly up-regulated in response to WSSV infection and reached the highest value (8.53-fold, p < 0.01) at 6 h post-infection (Fig. 5A), which strongly suggested that MjArf1 might be triggered by viral infection at the early phase. As time passed, the transcription was regressed to a level similar to 0 h since 12 h post injection. Furthermore, the transcription level of MjArf1 in virusresistant shrimps was nearly consistent with that of WSSVsensitive ones (Fig. 6A). For MjArfn, it was up-regulated 4.83-fold (p < 0.01) at 6 h post injection and then reduced rapidly to a level similar to 0 h at 12 h post-infection. The transcription level of MjArfn was gradually increased for a second time subsequently, and reached to 7.68-fold (p < 0.01) at 72 h post challenge (Fig. 5B). Surprisingly, the transcription level of MjArfn was obviously repressed in virus-resistant shrimps (reduced 12.78-fold) compared to that in WSSV-sensitive ones (Fig. 6B). 4. Discussion The Arf proteins are ubiquitously expressed and well conserved in all eukaryotes with remarkable fidelity [11,30]. In contrast to other arthropods (insects), information about the Arf family in crustaceans was quite limited only one from M. japonicus, designed as MjArf4, have been reported [21]. In the present study, the cDNAs of two Arfs, MjArf1 and MjArfn, were identified from M. japonicus. Data indicated that the predicted MjArf1 and MjArfn proteins belong to the Arf family. MjArf1 is an Arf1 of the Class I Arf, however, MjArfn didn’t match any Arfs of the three classes I/II/III, and it might represent an analog of the Arf. These data indicated that MjArf1 and MjArfn are novel Arf proteins in M. japonicus. MjArf1 and MjArf4 [21] were at the same position in class I and II Arfs in NJ tree respectively, which suggested that the class I and class II Arfs might represent a divergent group from the common ancestor in animals. Some evidences showed that the Arf1 proteins were dependent on its GTP-bound active state to localize to the Golgi membrane or on the GDP-bound inactive state to disassociate from the structure and diffuse into the cytosol [24,25,31]. Consistently, our site mutation analysis showed that the distribution of MjArf1 depended on its GDP/GTP binding state. It exhibited punctuate subcellular structures that might localize to the Golgi membrane throughout cytoplasm in the Arf1-GTP active state and was transferred to the cytosol in the Arf1-GDP inactive form reversibly. In mammalian cells and fungi, treatment with the Arf inhibitor BFA had the same effect as the dominant-negative mutants of Arfs [32,33]. However,
960
J. Ma et al. / Fish & Shellfish Immunology 29 (2010) 956e962
Fig. 3. Intracellular distributions of MjArf1 and MjArfn and their mutants. (A) Intracellular distributions of MjArf1 and its mutants. (B) Intracellular distributions of MjArfn and its mutants. The equivalent amounts of plasmids (0.8 mg) were transfected into High Five cells respectively, and EGFP fluorescent was examined 48 h post-transfection. Bar ¼ 25 mm.
BFA, an inhibitor of the Arf GEF, failed to affect Arf activity in insect cell (Data not shown). It was speculated that the MjArf1 GEF may be insensitive to BFA, and still maintain its activity in High five cells. The distribution of MjArf1 was consistent with that of MjArf4 in High five cells. Unexpectedly, the distribution of the MjArfn proteins was dispersed in the whole cell. This phenomenon may be related to the N-terminus sequence in MjArfn (an amphipathic helix cannot be folded at N-terminal of MjArfn, which results in losing the ability of the GTP-dependent binding to lipids [34]). Recently, it was reported that Ran, Rab and Rho proteins, members of small GTPases in shrimp, had been involved in shrimp
Fig. 4. Tissue transcription profile analysis of MjArf1 and MjArfn from M. japonicus. (A) Transcription analysis of MjArf1 in different tissues by RT-PCR. (B) Transcription analysis of MjArfn in different tissues by RT-PCR. M: 100 bp ladder.
defense response [3,4,35,36], in addition, Arfs in mammalian cells had been found to participate in virus assembly, replication and release [6,7]. Especially, MjArf4, the member of the class II Arf in the shrimp M. japonicus, had also been reported to be involved in WSSV infection [21]. Then, are other Arfs in the shrimp also involved in the WSSV infection? Do the different Arfs have the identical patterns during the WSSV infection? Real time quantitative PCR was performed to investigate the transcription level of MjArf1 and MjArfn during the WSSV infection. The data showed that the transcription level of MjArf1 was significantly up-regulated at the early stage of WSSV infection, whereas the transcription level of MjArf1 gene in virus-resistant shrimps was nearly consistent with that of WSSV-sensitive ones. These phenomena suggested that the MjArf1 gene might play a crucial role in the innate immunity of shrimps. For MjArfn, the transcription level of MjArfn was upregulated in two phases after WSSV challenge. Surprisingly, in virus-resistant shrimps it was down-regulated. The response of MjArfn to the WSSV infection was distinct from that of MjArf1 and MjArf4 (no data of virus-resistant shrimps). These phenomena implicated that the MjArfn gene might be not only involved in host defense but also has a role in viral invasion. It is well known that the Arf GTPases play critical roles in intracellular vesicular trafficking, signal transduction, phagocytosis, endocytosis and remodeling of the cytoskeleton [11,12,14,15,32]. MjArf1, MjArfn and MjArf4 (no data from virus-resistant shrimps) showed different transcription patterns in virus-resistant shrimps and in WSSV infection shrimps. These data implicated that Arf GTPases in M. japonicus play different roles in WSSV infection, but their exact roles in the WSSV infection remained to be elucidated. These discoveries might contribute to a better understanding of the molecular mechanisms of the interaction between host defense and/or virus invasion as well as the control of marine crustacean disease.
J. Ma et al. / Fish & Shellfish Immunology 29 (2010) 956e962
961
Fig. 5. Transcription analysis of MjArf1 and MjArfn at the different time points by real time quantitative PCR. (A) Transcription profile of MjArf1 gene in M. japonicus hepatopancreas at different time points post injection of WSSV and PBS. (B) Transcription profile of MjArfn gene in M. japonicus hepatopancreas at different time points post injection of WSSV and PBS. (C) Viral loads in gills and walking legs of WSSV-infected shrimps after WSSV challenge and Actin gene was set as an internal control. The transcription level in uninfected shrimp (0 h) was normalized to 1, the ratios to the 0 h level in the following time were also calculated. Values were shown as mean S.E. (n ¼ 5). An asterisk indicated the significant difference at P < 0.05 and two asterisk indicated the very significant difference at p < 0.01. M: 100-bp ladder.
Acknowledgements We thank Dr. D.D. Chen for providing the samples of virus-resistant shrimps, M.Y. Li for purified virions and Z.M. Gao for sampling from shrimps. This work was supported by the Key Program of National 501 Natural Science Foundation of China (30830084), the National Basic Science Research Program of China (973 Program 2006CB101804) and the earmarked fund for Modern Agro-industry Technology Research System. References
Fig. 6. Transcription analysis of MjArf1 and MjArfn in WSSV-sensitive and WSSVresistant shrimp by real time quantitative PCR. (A) Transcription analysis of MjArf1 in WSSV-sensitive and WSSV-resistant shrimp by real time quantitative PCR. (B) Transcription analysis of MjArfn in WSSV-sensitive and WSSV-resistant shrimp by real time quantitative PCR. Values were shown as mean S.E. (n ¼ 4). Two asterisk indicated the very significant difference at p < 0.01.
[1] Inouye K, Miwa S, Oseko N, Nakaro H, Kimura T, Momoyama K, et al. Mass mortalities of cultured kuruma shrimp Penaeus japanicus in Japan in 1993: electron microscopic evidence of the causative virus. Fish Pathol 1994;29:149e58. [2] Jory DE, Dixon HM. Shrimp white spot virus in the western hemisphere. Aquac Mag 1999;25:83e91. [3] Wu WL, Zong RR, Xu JY, Zhang XB. Antiviral phagocytosis is regulated by a novel Rab-dependent complex in shrimp Penaeus japonicus. J Proteome Res 2008;7:424e31. [4] Liu WF, Han F, Zhang XB. Ran GTPase regulates hemocytic phagocytosis of shrimp by interaction with myosin. J Proteome Res 2009;8:1198e206. [5] Belov GA, Fogg MH, Ehrenfeld E. Poliovirus protein induce membrane association of GTPase ADP-ribosylation factor. J Virol 2005;79:7207e16. [6] Belov GA, Habbersett C, Franco D, Ehrenfeld E. Activation of cellular Arf GTPases by poliovirus protein 3CD correlates with virus replication. J Virol 2007;81:9259e67. [7] Joshi A, Garg H, Nagashima K, Bonifacino JS, Freed EO. GGA and ARF protein modulate retrovirus assembly and release. Mol Cell 2008;30:227e38. [8] Schleifer LS, Kahn RA, Hanski E, Northup JK, Sternweis PC, Gilman AG. Requirements for cholera toxin-dependent ADP-ribosylation of the purified regulatory component of adenylate cyclase. J Biol Chem 1982;257:20e3. [9] Kahn RA, Gilman AG. Purification of a protein cofactor required for ADPribosylation of the stimulatory regulatory component of adenylate cyclase by cholera toxin. J Biol Chem 1984;259:6228e34. [10] Donaldson JG, Honda A. Localization and function of Arf family GTPase. Biochem Soc Trans 2005;33:639e42. [11] D’Souza-Schorey C, Chavrier P. ARF proteins: roles in membrane traffic and beyond. Nat Rev Mol Cell Biol 2006;7:347e58. [12] Myers KR, Casanova JE. Regulation of actin cytoskeleton dynamics by Arffamily GTPases. Trends Cell Biol 2008;18:184e92. [13] Nie ZZ, Hirsch DS, Randazzo PA. Arf and its many interactors. Curr Opin Cell Biol 2003;15:396e404. [14] Kumari S, Mayor S. ARF1 is directly involved in dynamin-independent endocytosis. Nat Cell Biol 2008;10:30e41. [15] Duijsings D, Lanke KHW, van Dooren SHJ, van Dommelen MMT, Wetzels R, de Mattia F, et al. Differential membrane association properties and regulation of class I and class II Arfs. Traffic 2009;10:316e23.
962
J. Ma et al. / Fish & Shellfish Immunology 29 (2010) 956e962
[16] Doedens JR, Kirkegaard K. Inhibition of cellular protein secretion by poliovirus proteins 2B and 3A. EMBO J 1995;14:894e907. [17] Cuconati A, Molla A, Wimmer E. Brefeldin A inhibits cell-free, de novo synthesis of poliovirus. J Virol 1998;72:6456e64. [18] Belov GA, Altan-Bonnet N, Kovtunovych G, Jackson CL, Lippincott-Schwartz J, Ehrenfeld E. Hijacking components of the cellular secretory pathway for replication of poliovirus RNA. J Virol 2007;81:558e67. [19] Chaudhry A, das Ranjan S, Jameel S, George A, Bal V, Mayor S, et al. HIV-1 Nef induces a Rab11-dependent routing of endocytosed immune costimulatory proteins CD80 and CD86 to the golgi. Traffic 2008;8:1925e35. [20] Wang HF, Ma JY, Ruan LW, Xu X. Cloning of a centaurin-a1 like gene MjCent involved in WSSV infection from shrimp Marsupeneaus japonicus. Fish Shellfish Immunol 2009;26:279e84. [21] Zhang MC, Ma JY, Lei KY, Xu X. Molecular cloning and characterization of a class II ADP ribosylation factor from the shrimp Marsupenaeus japonicus. Fish Shellfish Immunol 2010;28(1):128e33. [22] Jeanmougin F, Thompson JD, Gouy M, Higgins DG, Gibson TJ. Multiple sequence alignment with Clustal X. Trends Biochem Sci 1998;23:403e5. [23] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 2007;24:1596e9. [24] Vasudevan C, Han WP, Tan YD, Nie YM, Li DQ, Shome K, et al. The distribution and translocation of the G protein ADP-ribosylation factor 1 in live cells is determined by its GTPase activity. J Cell Sci 1998;111:1277e85. [25] Dascher C, Balch WE. Dominant inhibitory mutants of ARF1 block endoplasmic reticulum to golgi transport and trigger disassembly of the golgi apparatus. J Biol Chem 1994;269:1437e48. [26] Kahn RA, Randazzo P, Serafini T, Weiss O, Rulka C, Clark J, et al. The amino terminus of ADP-ribosylation factor (ARF) is a critical determinant of ARF activities and is potent and specific inhibitor of protien transport. J Biol Chem 1992;267:13039e46.
[27] Wang W, He J, Yang F, Wu GK, Xu X. Detection of prawn white spot baculovirus by polymerase chain reaction. Acta Oceanol Sin 1999;18:591e8. [28] Chen DD, He NH, Xu X. Mj-DWD, a double WAP domain-containing protein with antiviral relevance in Marsupenaeus japonicus. Fish Shellfish Immunol 2008;25:775e81. [29] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2DDCT method. Methods 2001;25:402e8. [30] Li YW, Kelly WG, Logsdon Jr JM, Schurko AM, Harfe BD, Hill-Harfe KL, et al. Functional genomic analysis of the ADP-ribosylation factor family of GTPases: phylogeny among diverse eukaryotes and function in C. elegans. FASEB J 2004;18:1834e50. [31] Clark J, Moore L, Krasinskas A, Way J, Battey J, Tamkun J, et al. Selective amplification of additional members of the ADP-ribosylation factor (ARF) family: cloning of additional human and Drosophila ARF-like genes. Proc Natl Acad Sci USA 1993;90:8952e6. [32] Chun J, Shapovalova Z, Dejgaard SY, Presley JF, Melançon P. Characterization of class I and II ADP-ribosylation factors (Arfs) in live cells: GDP-bound class II Arfs associate with the ER-golgi intermediate compartment independently of GBF1. Mol Biol Cell 2008;19:3488e500. [33] Lee SC, Show BD. Localization and function of ADP ribosylation factor A in Aspergillus nidulans. FEMS Microbiol Lett 2008;283:216e22. [34] Antonny B, Beraud-Dufour S, Chardin P, Chabre M. N-terminal hydrophobic residues of the G-protein ADP-ribosylation factor-1 insert into membrane phospholipids upon GDP to GTP exchange. Biochemistry 1997;36:4675e84. [35] He NH, Liu HP, Xu X. Identification of genes involved in the response of haemocytes of Penaeus japonicus by suppression subtractive hybridization (SSH) following microbial challenge. Fish Shellfish Immunol 2004;17:121e8. [36] Pan D, He NH, Yang ZY, Liu HP, Xu X. Differential gene expression profile in hepatopancreas of WSSV-resistant shrimp (Penaeus japonicus) by suppression subtractive hybridization. Dev Comp Immunol 2005;29:103e12.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Characterization of two novel ADP ribosylation factors from the shrimp Marsupenaeus japonicus Jinyou Ma a, b, Mingchang Zhang a, Lingwei Ruan a, Hong Shi a, c, Xun Xu a, * a
Key Laboratory of Marine Biogenetic Resources, Third Institute of Oceanography, State Oceanic Administration (SOA), 178 Daxue Road, Xiamen Fujian 361005, P.R. China College of Animal Sciences, Henan Institute of Science and Technology, Xinxiang Henan 453003, P.R. China c School of Life Sciences, Xiamen University, Xiamen Fujian 361005, PR China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 22 May 2010 Received in revised form 6 August 2010 Accepted 7 August 2010 Available online 14 August 2010
ADP-ribosylation factors (Arfs) that play an essential role in intracellular trafficking and organelle structure are small GTP-binding proteins, which have been identified recently to be involved in virus infection. However, little is known about the Arfs and their relationships with viral infection in the economically important crustaceans to date. In the present study, two novel members of the Arf family, designated as MjArf1 and MjArfn respectively, were cloned from the shrimp Marsupenaeus japonicus. Sequence and phylogenetic analysis showed that MjArf1 belongs to Class I Arf, which has very high homology in sequence to the known Arf 79F of insects and Arf1 of other animals (96e99%), whereas MjArfn is an unidentified Arf, which has only 62e66% identity to other known Arfs. In High Five cells, the distribution of MjArf1 was dependent on its GDP/GTP binding state but the distribution of MjArfn was not affected by that. Both Arfs were ubiquitously expressed in examined tissues. Further investigation with real-time quantitative PCR revealed that MjArf1 and MjArfn were significantly up-regulated after WSSV challenge. In virus-resistant shrimps, however, no distinct fluctuation of MjArf1 expression was found and MjArfn was even found to be notably repressed. These results suggested that MjArf1 and MjArfn might be involved in the shrimp innate immune response in WSSV infection and MjArfn might play a role in WSSV invasion. These studies may contribute to a better understanding of host defense and/or virus invasion interaction and for the control of marine crustacean diseases. Ó 2010 Elsevier Ltd. All rights reserved.
Keywords: Marsupenaeus japonicus WSSV ADP ribosylation factor MjArf1 MjArfn
1. Introduction Shrimps are the most important crustaceans in the aquaculture industry worldwide. However, white spot syndrome virus (WSSV) has caused severe damages to shrimp industry since its emergence in early 1990s [1,2]. Since then, the molecular mechanism of the shrimp immune defense against virus infection was emerged as a hot spot to be elucidated. Recent studies demonstrated that small GTPases found in shrimp participated in the antiviral immunity by regulating phagocytosis [3,4]. Especially, some members of ADPribosylation factors (Arfs) reported in mammal, which belong to small GTP-binding proteins (w21 kDa), were found to be involved in virus infection [5e7]. So the relationship of the different Arfs with virus invasion was worth investigating.
Abbreviations: Arf, ADP ribosylation factor; WSSV, white spot syndrome virus; GEFs, guanine nucleotide exchange factors; BFA, Brefeldin A; CT,, cycle threshold value; EGFP, enhanced green fluorescence protein. * Corresponding author. Tel./fax: þ86 592 2195296. E-mail address: [email protected] (X. Xu). 1050-4648/$ e see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2010.08.003
Arfs were originally identified as a protein cofactor required for efficient ADP-ribosylation of the Gsa subunit of adenylate cyclase by cholera toxin [8,9], but they were later found to be involved in membrane transport, maintenance of organelle structures and remodeling of the cytoskeleton [10e12]. Arf family members have been identified in a wide variety of organisms including bacteria, yeast, plants, invertebrates and vertebrate. Based on sequence homology and organization, the six mammalian Arf proteins can be divided into three classes, with class I including Arf1, 2, and 3, class II including Arf4 and 5, and class III, its only member is Arf6. Although all Arfs have the ability to regulate the budding and formation of vesicles in the endocytic and exocytic pathways, different Arfs seem to possess different intracellular localizations and functions depends on the specific membrane it binds according to recruitment of the diverse groups of proteins [10,11,13e15]. Furthermore, Arf proteins exist in the formation of GDP-bound and GTP-bound state, and this cycling is also catalyzed by the specific proteins as guanine nucleotide exchange factors (GEFs) and GTPase-activating proteins (GAPs). Arf-GTP can also interact with a diverse group of proteins, including vesicle coat proteins and lipid-metabolizing enzymes [13]. In the evolutionary process of
J. Ma et al. / Fish & Shellfish Immunology 29 (2010) 956e962
interactions between virus infection and host defense, Arf-dependent secretion pathway may induce anti-virus actions through the secretion of interferons and the presentation of viral antigens by MHC I [16,17]. But then, the pathway of secretion or endocytic is easy to be employed to cause viral immune evasion and virus propagation, which Arfs was recruited to the specific target membrane to induce the disintegration of intracellular membranes and formation of specific vesicles by viral proteins mediating their interactors [18,19]. Moreover, Mjcent [20], as the Arf6 GAP, and MjArf4 [21], the member of Arf class II in Marsupenaeus japonicus, were up-regulated after WSSV infection, suggesting that shrimp Arfs may also participate in virus invasion and/or host defense events. In the past two decades, a number of Arf proteins and genes have been identified from various organisms, but the only crustacean Arf has been characterized is MjArf4 [21], a member of class II from the shrimp M. japonicus to date. To investigate the different Arfs and the relationships between the Arfs and WSSV infection in the shrimps, here we report two novel Arf proteins, MjArf1 and MjArfn, in M. japonicus and their involvement in the WSSV infection. 2. Materials and methods 2.1. Cloning of the full-length cDNA of MjArf1 and MjArfn Partial sequence (w310 bp) of Arfs cDNA was amplified from M. japonicus hepatopancreas cDNA using degenerated primers ArfF and ArfR (Table 1) corresponding to the conserved amino acid sequences DAAGKT and NKQDLP in invertebrate and vertebrate Arfs. The missing 50 -terminal and 30 -terminal sequence of MjArf1 and MjArfn were subsequently obtained by PCR using the specific primer pairs, Arf1N/Y2HN, Arf1C/Y2HP, ArfnN/Y2HN, and ArfnC/
Table 1 Oligonucleotide primers used in the experiments. Primer names
Sequences(50 e30 )
ArfF ArfR Arf1N Arf1C ArfnN ArfnC Y2HN Y2HP Arf1F Arf1R ArfnF ArfnR MjArf1F MjArf1R MjArfnF MjArfnR MjArf1-31F MjArf1-31R MjArf1-71F MjArf1-71R MjArfn-31F MjArfn-31R MjArfn-71F MjArfn-71R
GGCCTGGACGCCGC(A/T/C/G)GG(A/T/C/G)AA(A/G)AC CATGGCGTTGGGCAG(A/G)TC(C/T)TG(C/T)TT(A/G)TT CTCTCCAATACGTTCTCGATC CAAATGATCGAGAACGTATTGG CACCGCCATCATTTACGTGG GCGACCAGGAGAGGATAAAG GAGATCGAATTAGGATCCTCTGC GCAGTAATACGACTCACTATAGGG GCGGATCCGTGGCAAAAATGGGCAAC BamH I, italic GCGAATTCTGGTGGCGAGATTTAGCG EcoR I, italic GCGAATTCATCATGGGGATCCTGCTG Ecor I, italic CCAAGCTTCACTTGGAGACCTCCCTG Hind III, italic GCGGTACCGTGGCAAAAATGGGCAAC Kpn I, italic GCGGTACCCGGTTGGCATTCTTCAGC Kpn I, italic ATGGTACCATCATGGGGATCCTGCTG Kpn I, italic ATGGTACCTTGGAGACCTCCCTGG Kpn I, italic CTGGTAAAAacACAATCCTGTATAAGC (ac: mutation site) GCTTATACAGGATTGTgtTTTTACCAG (gt: mutation site) GTTGGCGGACtAGATAAAATCAGGCCAC (t: mutation site) GTGGCCTGATTTTATCTaGTCCGCCAAC (a: mutation site) GCAGGGAAAAaTACAGTTCTCTACAAG (a: mutation site) CTTGTAGAGAACTGTAtTTTTCCCTGC (t: mutation site) GTCGGCGGCCtGGCGAAGCTAAGGCCTT (t: mutation site) AAGGCCTTAGCTTCGCCaGGCCGCCGAC (a: mutation site)
Primers used for Real time PCR Actin-F GACGGTCAGGTGATCACCAT Actin-R CGATTGATGGTCCAGACTCG Arf1rtF GCGCCACTACTTCCAGAACACA Arf1rtR AGCGGTTGGCATTCTTCAGC ArfnrtF AGGCCTTTGTGGAGACACTATTAC ArfnrtR TCTGCTGCTGGAGGTTGAGTC
957
Y2HP (Table 1), respectively, with a M. japonicus hepatopancreas and hemocyte mixed cDNA library constructed into pAD-GAL4-2.1 phagemids as the template. Based on the results of the 50 -terminal and 30 -terminal, the primers Arf1F, Arf1R, ArfnF and ArfnR (Table 1) were designed for PCR amplification of the open reading frames (ORFs) of MjArf1 and MjArfn. 2.2. Sequence analysis Nucleotide sequences and deduced protein similarity analysis were performed using Clustal X [22], the DNA Software (Lynnon BioSoft) and the BLAST programs (http://www.ncbi.nlm.nih.gov/ blast/), respectively. The phylogenic tree was constructed by the neighbor-joining (NJ) method (bootstrap: 1000) with MEGA 4.0 (Molecular Evolutionary Genetics Analysis) program [23]. 2.3. Construction of MjArf1 and MjArfn fusion constructs The T31N mutant had very low affinity for GTP and behaved as a constitutively inactive or dominant negative mutant and the Q71L mutant had behaved partially as a constitutively activated mutant in in vitro assays [24]. Point mutations of MjArf1 and MjArfn were performed by site-directed mutagensis using PrimeSTAR HS DNA Polymerase (Takara). The T31N and Q71L substitutions were introduced using a two-step recombinant PCR technique as previously described [24,25]. Briefly, the primer pairs MjArf1F/MjArf131R and MjArf1-31F/MjArf1R were used to amplify two fragments of MjArf1 separated at position 31. These two fragments were taken as templates for the second round PCR using primers MjArf1F and MjArf1R. The PCR products were finally digested with Kpn I and inserted into pIZ-V5-His/EGFP plasmid (EGFP inserted into pIZV5-His with Xbal I digestion) to form pIZ-V5-His/MjArf1(T31N)/ EGFP. The EGFP was fused at the C-terminus of MjArf1 according to previously described [25,26]. The same method was introduced to construct the pIZ-V5-His/MjArf1(Q71L)/EGFP, pIZ-V5-His/MjArfn (T31N)/EGFP and pIZ-V5-His/MjArfn(Q71L)/EGFP plasmid. The MjArf1 (wild type, wt) and MjArfn (wt) were also subcloned into pIZ-V5-His/EGFP to produce pIZ-V5-His/MjArf1(wt)/EGFP and pIZ-V5-His/MjArfn(wt)/EGFP respectively. 2.4. Cell culture and transfection High FiveÔ cells (Invitrogen) were maintained in SFX medium (Hyclone) at 27 C. The MjArf1 and its mutant constructs were transfected into High Five cells respectively by using Cellfectin transfection reagent (Invitrogen) according to manufacturer’s protocol. EGFP fluorescence signal was observed with an inverted fluorescence microscope (Nikon, TE2000-S) at 48 h post transfection. To observe the effect of Brefeldin A (BFA, Epicentre Technologies) on Arfs localization, cells were incubated with 40 mg/ml BFA at 27 C for 1 h before EGFP observation. The same method was adopted to address MjArfn and its mutant constructs. 2.5. Shrimp culture and WSSV challenge Healthy live wild M. japonicus (w15 g) were cultured in 80 L tanks (at 25 C) filled with air-pumped circulating sea water. To ensure the shrimps were WSSV-free, several shrimps were randomly selected for WSSV detection before WSSV challenge [27]. For the WSSV challenge experiment, 60 shrimps were injected with 100 ml of purified WSSV (approximately 1.0 107 virions/ml in sterile PBS, pH 7.3) each in the lateral area of the fourth abdominal segment. Another 35 shrimps treated with 100 ml sterile PBS each were served as controls. At the time point of 0, 6, 12, 24, 48, 72 and 96 h post injection, four individuals were randomly picked out from
958
J. Ma et al. / Fish & Shellfish Immunology 29 (2010) 956e962
the challenge group and the control group respectively. The hepatopancreas were collected for subsequent real-time quantitative PCR detection. Virus-resistant shrimps were obtained by a method previously described [28]. And the samples (hepatopancreas) of virus-resistant shrimps were provided by Dr. Chen Dandan. 2.6. Tissue distribution of MjArf1 and MjArfn mRNA expression A batch of healthy live shrimps M. japonicus (w15 g) were purchased from a supermarket in Xiamen, China. Total RNAs were isolated from the different tissues using TRIzol reagent (Invitrogen) by a method previously described [20]. After treatment with DNase I, the first-strand cDNA was synthesized by reverse transcriptase SuperScript III (Invitrogen) with Random Hexamer Primer (Fermentas). The first-strand cDNA was diluted to 1:10 for the PCR reaction with the primer pairs Arf1rtF/Arf1rtR and ArfnrtF/ArfnrtR respectively (Table 1). The M. japonicus Actin gene (GenBank AB055975) was served as the internal control. The expression level of MjArf1 and MjArfn transcript in the examined tissues was calculated using ImageJ (Sun Microsystems, Inc.). 2.7. Gene expression of MjArf1 and MjArfn by quantitative RT-PCR For Real-time quantitative PCR, RNA extraction and cDNA synthesis were performed as described in Section 2.6. Primers (Table 1) were designed against the complete nucleotide sequence of MjArf1 and MjArfn, and the Actin (GenBank AB055975) of M. japonicus was used for internal standardization. Real-time quantitative PCR was carried out using SYBR premix Ex Taq (Takara) according to manufacturer’s instructions. Amplification reactions were performed using the Rotor-GeneÔ 6000 (Corbett Life Science) for each sample in a total volume of 20 ml containing 10.0 ml SYBR 2 premix Ex Taq (Takara), 0.4 ml of each primer (20 mM), 2 ml of diluted first-strand cDNA (1:10), and 7.2 ml of sterile distilled water. The reaction program was as follows: 1 cycle of initial denaturation of 30 s at 95 C, followed by 40 cycles of 95 C for 15 s, 59 C for 15 s, and 72 C for 20 s. Fluorescent data were acquired during each extending phase. A melting curve analysis was included for each sample after PCR to detect the specificity of the PCR products. Each sample was repeated for three times. After the PCR program, the data were analyzed with the Rotor-GeneÔ 6000 Series Software (Corbett Life Science) using the 2ΔΔCT method [29]. For statistical analysis, ANOVA test was applied to measure the difference with SPSS software (SPSS Inc., Chicago, IL). A p value less than 0.05 was considered statistically significant. 2.8. Analysis of virus load Viral loads of shrimps with WSSV challenge at every time point were analyzed by PCR as described before [27]. Genomic DNA was extracted as template, and then WSSV-specific DNA fragments were amplified. Actin gene of M. japonicus was set as an internal control. 3. Results 3.1. Cloning of full-length cDNA of MjArf1 and MjArfn The full-length cDNA of MjArf1 and MjArfn were cloned from M. japonicus. MjArf1 contains an open reading frame (ORF) (GenBank accession No. GQ483535), which encodes a protein of 182 deduced amino acids (Fig. 1A) with a calculated molecular weight of 20.70 kDa and a predicted pI of 6.40. For MjArfn (GenBank accession No. GQ483536), the corresponding parameters were 178 deduced amino acids (Fig. 1B), 19.83 kDa and 5.05 respectively.
Fig. 1. Sequence of (A) MjArf1 and (B) MjArfn cDNA and predicted proteins. N-terminal myristoylation site is indicated with grey shadow; p loop is indicated with dot line; switch 1 is indicated with solid line; switch 2 is indicated with dash line and interswitch are shaded with box.
3.2. Molecular characterization of MjArf1 and MjArfn Amino acid sequence analysis showed that MjArf1 shared highly similarity with Arf 79F of insects (Drosophila melanogaster, 99%; Bombyx mori, 98%; Stomoxys calcitrans, 98%; Argas monolakensis,
J. Ma et al. / Fish & Shellfish Immunology 29 (2010) 956e962
98%; Aedes aegypti, 97%) and Arf1 of some animals (Lepeophtheirus salmonis, 97%; Ixodes scapularis, 97%; Homo sapiens, 97%; Mus musculus, 97%, 96%; Gallus gallus, 96%; Xenopus laevis, 97%, 96%; Danio rerio, 96%), ranging from 96% to 99%, and MjArfn was 62e66% identity to Arfs from other organisms [Cryptosporidium pavum (Arf1/2, 66%); Cryptosporidium muris (Arf1, 64%); Aiptasia pulchella (Arf1, 62%); M. japonicus (Arf4, 62%); Lepeophtheirus salmonis (Arf4, 63%); Danio rerio (Arf4, 63%; Arf 5, 63%); Xenopus laevis (Arf4, 63%); Bos taurus (Arf4, 62%)]. The predicted structure indicated that MjArf1 and MjArfn possessed the property of Arfs, including the site of myristoylation at position 2, p loop (GLD(A or G)AGKTT), switch 1, switch2 as well as interswitch regions (Fig. 1A and B). Phylogenetic analysis displayed that MjArf1 formed a clade with Arf 79F and Arf1, but MjArfn was not constructed a cluster with three class Arfs. Moreover, MjArf1 forms a clade with the member of class I Arf in invertebrate, which is paraphyletic relative to another branch constituting with that of class I Arf in vertebrate (Fig. 2). MjArf1 belonged to class I Arfs, whereas MjArfn didn’t match to any of three class Arfs described previously. 3.3. Site mutation analysis of MjArf1 and MjArfn The distribution of MjArf1 and MjArfn proteins in the High five cells was determined by introducing the plasmid of both wild type and the mutants (T31N and Q71L) with EGFP fused to the C-terminus. Cells expressing wt-MjArf1-EGFP exhibited punctuate subcellular structures throughout cytoplasm (Fig. 3A MjArf1-EGFP). Similarly, cells transfected with Q71L-MjArf1-EGFP, in which Gln at position 71 was substituted by Leu, displayed the same localization pattern [Fig. 3A, MjArf1 (Q71L)-EGFP]. The mutant Q71L-MjArf1EGFP maintained the GTP-bound state and functioned in a dominant-active manner. In contrast, T31N-MjArf1-EGFP, which was substituted Asn for Thr at position 31, exerted the GDP-bound state and functioned in a dominant-negative manner. Cells transfected with T31N-MjArf1-EGFP showed the disassociation of the punctuate structure and fluorescence was diffused throughout cytosol [Fig. 3A, MjArf1 (T31N)-EGFP. For MjArfn protein, none of the cells transfected with the wt-MjArfn-EGFP, T31N-MjArfn-EGFP or Q71L-MjArfn-EGFP showed the punctuate structure in the cytoplasm. Accordingly, the fluorescence in the cells was an even distribution (Fig. 3B). So the mutant at position 31 and 71 amino acid had no effect on the distribution of MjArfn protein in the High five cell.
Fig. 2. Phylogenetic analysis by the Neighbor-Jioning method based on amino-acid sequences of Arfs (Arfl2 as outgroup). Mj, Marsupenaeus japonicus. Arfl2: Arf-like protein.
959
3.4. Tissue distribution of MjArf1 and MjArfn mRNA The distribution of MjArf1 and MjArfn mRNA was plumbed in various M. japonicus tissues, including hemocyte, hepatopancreas, gill, heart, intestine and muscle. The RT-PCR results showed that both the mRNA transcripts of MjArf1 and MjArfn can be detected in all the examined tissues with different transcription levels (Fig. 4A and B). The transcription level of MjArf1 was obviously higher in gill, heart and intestine than in hemocyte, hepatopancreas and muscle (Fig. 4A). But the transcription level of MjArfn was high in heart only (Fig. 4B). 3.5. Transcriptional analysis of MjArf1 and MjArfn after WSSV infection Real time quantitative PCR was employed to detect whether the transcription level of MjArf1 and MjArfn was related to WSSV infection. The transcription levels of MjArf1 and MjArfn at different time points after WSSV infection were shown in Fig. 5A and B, and the virus loads was shown in Fig. 5C. The transcription level of MjArf1 was rapidly up-regulated in response to WSSV infection and reached the highest value (8.53-fold, p < 0.01) at 6 h post-infection (Fig. 5A), which strongly suggested that MjArf1 might be triggered by viral infection at the early phase. As time passed, the transcription was regressed to a level similar to 0 h since 12 h post injection. Furthermore, the transcription level of MjArf1 in virusresistant shrimps was nearly consistent with that of WSSVsensitive ones (Fig. 6A). For MjArfn, it was up-regulated 4.83-fold (p < 0.01) at 6 h post injection and then reduced rapidly to a level similar to 0 h at 12 h post-infection. The transcription level of MjArfn was gradually increased for a second time subsequently, and reached to 7.68-fold (p < 0.01) at 72 h post challenge (Fig. 5B). Surprisingly, the transcription level of MjArfn was obviously repressed in virus-resistant shrimps (reduced 12.78-fold) compared to that in WSSV-sensitive ones (Fig. 6B). 4. Discussion The Arf proteins are ubiquitously expressed and well conserved in all eukaryotes with remarkable fidelity [11,30]. In contrast to other arthropods (insects), information about the Arf family in crustaceans was quite limited only one from M. japonicus, designed as MjArf4, have been reported [21]. In the present study, the cDNAs of two Arfs, MjArf1 and MjArfn, were identified from M. japonicus. Data indicated that the predicted MjArf1 and MjArfn proteins belong to the Arf family. MjArf1 is an Arf1 of the Class I Arf, however, MjArfn didn’t match any Arfs of the three classes I/II/III, and it might represent an analog of the Arf. These data indicated that MjArf1 and MjArfn are novel Arf proteins in M. japonicus. MjArf1 and MjArf4 [21] were at the same position in class I and II Arfs in NJ tree respectively, which suggested that the class I and class II Arfs might represent a divergent group from the common ancestor in animals. Some evidences showed that the Arf1 proteins were dependent on its GTP-bound active state to localize to the Golgi membrane or on the GDP-bound inactive state to disassociate from the structure and diffuse into the cytosol [24,25,31]. Consistently, our site mutation analysis showed that the distribution of MjArf1 depended on its GDP/GTP binding state. It exhibited punctuate subcellular structures that might localize to the Golgi membrane throughout cytoplasm in the Arf1-GTP active state and was transferred to the cytosol in the Arf1-GDP inactive form reversibly. In mammalian cells and fungi, treatment with the Arf inhibitor BFA had the same effect as the dominant-negative mutants of Arfs [32,33]. However,
960
J. Ma et al. / Fish & Shellfish Immunology 29 (2010) 956e962
Fig. 3. Intracellular distributions of MjArf1 and MjArfn and their mutants. (A) Intracellular distributions of MjArf1 and its mutants. (B) Intracellular distributions of MjArfn and its mutants. The equivalent amounts of plasmids (0.8 mg) were transfected into High Five cells respectively, and EGFP fluorescent was examined 48 h post-transfection. Bar ¼ 25 mm.
BFA, an inhibitor of the Arf GEF, failed to affect Arf activity in insect cell (Data not shown). It was speculated that the MjArf1 GEF may be insensitive to BFA, and still maintain its activity in High five cells. The distribution of MjArf1 was consistent with that of MjArf4 in High five cells. Unexpectedly, the distribution of the MjArfn proteins was dispersed in the whole cell. This phenomenon may be related to the N-terminus sequence in MjArfn (an amphipathic helix cannot be folded at N-terminal of MjArfn, which results in losing the ability of the GTP-dependent binding to lipids [34]). Recently, it was reported that Ran, Rab and Rho proteins, members of small GTPases in shrimp, had been involved in shrimp
Fig. 4. Tissue transcription profile analysis of MjArf1 and MjArfn from M. japonicus. (A) Transcription analysis of MjArf1 in different tissues by RT-PCR. (B) Transcription analysis of MjArfn in different tissues by RT-PCR. M: 100 bp ladder.
defense response [3,4,35,36], in addition, Arfs in mammalian cells had been found to participate in virus assembly, replication and release [6,7]. Especially, MjArf4, the member of the class II Arf in the shrimp M. japonicus, had also been reported to be involved in WSSV infection [21]. Then, are other Arfs in the shrimp also involved in the WSSV infection? Do the different Arfs have the identical patterns during the WSSV infection? Real time quantitative PCR was performed to investigate the transcription level of MjArf1 and MjArfn during the WSSV infection. The data showed that the transcription level of MjArf1 was significantly up-regulated at the early stage of WSSV infection, whereas the transcription level of MjArf1 gene in virus-resistant shrimps was nearly consistent with that of WSSV-sensitive ones. These phenomena suggested that the MjArf1 gene might play a crucial role in the innate immunity of shrimps. For MjArfn, the transcription level of MjArfn was upregulated in two phases after WSSV challenge. Surprisingly, in virus-resistant shrimps it was down-regulated. The response of MjArfn to the WSSV infection was distinct from that of MjArf1 and MjArf4 (no data of virus-resistant shrimps). These phenomena implicated that the MjArfn gene might be not only involved in host defense but also has a role in viral invasion. It is well known that the Arf GTPases play critical roles in intracellular vesicular trafficking, signal transduction, phagocytosis, endocytosis and remodeling of the cytoskeleton [11,12,14,15,32]. MjArf1, MjArfn and MjArf4 (no data from virus-resistant shrimps) showed different transcription patterns in virus-resistant shrimps and in WSSV infection shrimps. These data implicated that Arf GTPases in M. japonicus play different roles in WSSV infection, but their exact roles in the WSSV infection remained to be elucidated. These discoveries might contribute to a better understanding of the molecular mechanisms of the interaction between host defense and/or virus invasion as well as the control of marine crustacean disease.
J. Ma et al. / Fish & Shellfish Immunology 29 (2010) 956e962
961
Fig. 5. Transcription analysis of MjArf1 and MjArfn at the different time points by real time quantitative PCR. (A) Transcription profile of MjArf1 gene in M. japonicus hepatopancreas at different time points post injection of WSSV and PBS. (B) Transcription profile of MjArfn gene in M. japonicus hepatopancreas at different time points post injection of WSSV and PBS. (C) Viral loads in gills and walking legs of WSSV-infected shrimps after WSSV challenge and Actin gene was set as an internal control. The transcription level in uninfected shrimp (0 h) was normalized to 1, the ratios to the 0 h level in the following time were also calculated. Values were shown as mean S.E. (n ¼ 5). An asterisk indicated the significant difference at P < 0.05 and two asterisk indicated the very significant difference at p < 0.01. M: 100-bp ladder.
Acknowledgements We thank Dr. D.D. Chen for providing the samples of virus-resistant shrimps, M.Y. Li for purified virions and Z.M. Gao for sampling from shrimps. This work was supported by the Key Program of National 501 Natural Science Foundation of China (30830084), the National Basic Science Research Program of China (973 Program 2006CB101804) and the earmarked fund for Modern Agro-industry Technology Research System. References
Fig. 6. Transcription analysis of MjArf1 and MjArfn in WSSV-sensitive and WSSVresistant shrimp by real time quantitative PCR. (A) Transcription analysis of MjArf1 in WSSV-sensitive and WSSV-resistant shrimp by real time quantitative PCR. (B) Transcription analysis of MjArfn in WSSV-sensitive and WSSV-resistant shrimp by real time quantitative PCR. Values were shown as mean S.E. (n ¼ 4). Two asterisk indicated the very significant difference at p < 0.01.
[1] Inouye K, Miwa S, Oseko N, Nakaro H, Kimura T, Momoyama K, et al. Mass mortalities of cultured kuruma shrimp Penaeus japanicus in Japan in 1993: electron microscopic evidence of the causative virus. Fish Pathol 1994;29:149e58. [2] Jory DE, Dixon HM. Shrimp white spot virus in the western hemisphere. Aquac Mag 1999;25:83e91. [3] Wu WL, Zong RR, Xu JY, Zhang XB. Antiviral phagocytosis is regulated by a novel Rab-dependent complex in shrimp Penaeus japonicus. J Proteome Res 2008;7:424e31. [4] Liu WF, Han F, Zhang XB. Ran GTPase regulates hemocytic phagocytosis of shrimp by interaction with myosin. J Proteome Res 2009;8:1198e206. [5] Belov GA, Fogg MH, Ehrenfeld E. Poliovirus protein induce membrane association of GTPase ADP-ribosylation factor. J Virol 2005;79:7207e16. [6] Belov GA, Habbersett C, Franco D, Ehrenfeld E. Activation of cellular Arf GTPases by poliovirus protein 3CD correlates with virus replication. J Virol 2007;81:9259e67. [7] Joshi A, Garg H, Nagashima K, Bonifacino JS, Freed EO. GGA and ARF protein modulate retrovirus assembly and release. Mol Cell 2008;30:227e38. [8] Schleifer LS, Kahn RA, Hanski E, Northup JK, Sternweis PC, Gilman AG. Requirements for cholera toxin-dependent ADP-ribosylation of the purified regulatory component of adenylate cyclase. J Biol Chem 1982;257:20e3. [9] Kahn RA, Gilman AG. Purification of a protein cofactor required for ADPribosylation of the stimulatory regulatory component of adenylate cyclase by cholera toxin. J Biol Chem 1984;259:6228e34. [10] Donaldson JG, Honda A. Localization and function of Arf family GTPase. Biochem Soc Trans 2005;33:639e42. [11] D’Souza-Schorey C, Chavrier P. ARF proteins: roles in membrane traffic and beyond. Nat Rev Mol Cell Biol 2006;7:347e58. [12] Myers KR, Casanova JE. Regulation of actin cytoskeleton dynamics by Arffamily GTPases. Trends Cell Biol 2008;18:184e92. [13] Nie ZZ, Hirsch DS, Randazzo PA. Arf and its many interactors. Curr Opin Cell Biol 2003;15:396e404. [14] Kumari S, Mayor S. ARF1 is directly involved in dynamin-independent endocytosis. Nat Cell Biol 2008;10:30e41. [15] Duijsings D, Lanke KHW, van Dooren SHJ, van Dommelen MMT, Wetzels R, de Mattia F, et al. Differential membrane association properties and regulation of class I and class II Arfs. Traffic 2009;10:316e23.
962
J. Ma et al. / Fish & Shellfish Immunology 29 (2010) 956e962
[16] Doedens JR, Kirkegaard K. Inhibition of cellular protein secretion by poliovirus proteins 2B and 3A. EMBO J 1995;14:894e907. [17] Cuconati A, Molla A, Wimmer E. Brefeldin A inhibits cell-free, de novo synthesis of poliovirus. J Virol 1998;72:6456e64. [18] Belov GA, Altan-Bonnet N, Kovtunovych G, Jackson CL, Lippincott-Schwartz J, Ehrenfeld E. Hijacking components of the cellular secretory pathway for replication of poliovirus RNA. J Virol 2007;81:558e67. [19] Chaudhry A, das Ranjan S, Jameel S, George A, Bal V, Mayor S, et al. HIV-1 Nef induces a Rab11-dependent routing of endocytosed immune costimulatory proteins CD80 and CD86 to the golgi. Traffic 2008;8:1925e35. [20] Wang HF, Ma JY, Ruan LW, Xu X. Cloning of a centaurin-a1 like gene MjCent involved in WSSV infection from shrimp Marsupeneaus japonicus. Fish Shellfish Immunol 2009;26:279e84. [21] Zhang MC, Ma JY, Lei KY, Xu X. Molecular cloning and characterization of a class II ADP ribosylation factor from the shrimp Marsupenaeus japonicus. Fish Shellfish Immunol 2010;28(1):128e33. [22] Jeanmougin F, Thompson JD, Gouy M, Higgins DG, Gibson TJ. Multiple sequence alignment with Clustal X. Trends Biochem Sci 1998;23:403e5. [23] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 2007;24:1596e9. [24] Vasudevan C, Han WP, Tan YD, Nie YM, Li DQ, Shome K, et al. The distribution and translocation of the G protein ADP-ribosylation factor 1 in live cells is determined by its GTPase activity. J Cell Sci 1998;111:1277e85. [25] Dascher C, Balch WE. Dominant inhibitory mutants of ARF1 block endoplasmic reticulum to golgi transport and trigger disassembly of the golgi apparatus. J Biol Chem 1994;269:1437e48. [26] Kahn RA, Randazzo P, Serafini T, Weiss O, Rulka C, Clark J, et al. The amino terminus of ADP-ribosylation factor (ARF) is a critical determinant of ARF activities and is potent and specific inhibitor of protien transport. J Biol Chem 1992;267:13039e46.
[27] Wang W, He J, Yang F, Wu GK, Xu X. Detection of prawn white spot baculovirus by polymerase chain reaction. Acta Oceanol Sin 1999;18:591e8. [28] Chen DD, He NH, Xu X. Mj-DWD, a double WAP domain-containing protein with antiviral relevance in Marsupenaeus japonicus. Fish Shellfish Immunol 2008;25:775e81. [29] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2DDCT method. Methods 2001;25:402e8. [30] Li YW, Kelly WG, Logsdon Jr JM, Schurko AM, Harfe BD, Hill-Harfe KL, et al. Functional genomic analysis of the ADP-ribosylation factor family of GTPases: phylogeny among diverse eukaryotes and function in C. elegans. FASEB J 2004;18:1834e50. [31] Clark J, Moore L, Krasinskas A, Way J, Battey J, Tamkun J, et al. Selective amplification of additional members of the ADP-ribosylation factor (ARF) family: cloning of additional human and Drosophila ARF-like genes. Proc Natl Acad Sci USA 1993;90:8952e6. [32] Chun J, Shapovalova Z, Dejgaard SY, Presley JF, Melançon P. Characterization of class I and II ADP-ribosylation factors (Arfs) in live cells: GDP-bound class II Arfs associate with the ER-golgi intermediate compartment independently of GBF1. Mol Biol Cell 2008;19:3488e500. [33] Lee SC, Show BD. Localization and function of ADP ribosylation factor A in Aspergillus nidulans. FEMS Microbiol Lett 2008;283:216e22. [34] Antonny B, Beraud-Dufour S, Chardin P, Chabre M. N-terminal hydrophobic residues of the G-protein ADP-ribosylation factor-1 insert into membrane phospholipids upon GDP to GTP exchange. Biochemistry 1997;36:4675e84. [35] He NH, Liu HP, Xu X. Identification of genes involved in the response of haemocytes of Penaeus japonicus by suppression subtractive hybridization (SSH) following microbial challenge. Fish Shellfish Immunol 2004;17:121e8. [36] Pan D, He NH, Yang ZY, Liu HP, Xu X. Differential gene expression profile in hepatopancreas of WSSV-resistant shrimp (Penaeus japonicus) by suppression subtractive hybridization. Dev Comp Immunol 2005;29:103e12.