- Email: [email protected]
Cloning and characterization of three novel WSSV recognizing lectins from shrimp Marsupenaeus japonicus
Fish & Shellfish Immunology 28 (2010) 596e603
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Cloning and characterization of three novel WSSV recognizing lectins from shrimp Marsupenaeus japonicus Kang-Kang Song, Deng-Feng Li, Ming-Chang Zhang, Hai-Jie Yang, Ling-Wei Ruan, Xun Xu* Key Laboratory of Marine Biogenetic Resources, Third Institute of Oceanography, State Oceanic Administration (SOA), 184# DaXue Road, Xiamen 361005, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 27 August 2009 Received in revised form 14 December 2009 Accepted 15 December 2009 Available online 1 January 2010
C-type lectins (CTLs) acting as pattern recognition receptors play essential roles in shrimp innate immune responses. Using WSSV envelope proteins (VP26, VP28, and VP281) to screen a phage display library of Marsupenaeus japonicus, three lectins (termed as MjLecA, MjLecB, and MjLecC) were found to interact with WSSV. Sequence analysis revealed that these MjLecs shared low similarities with each other. Phylogenetic analysis indicated MjLecA and MjLecB are likely to belong to the same lectin subfamily, while MjLecC belongs to another sub-family. These MjLecs showed broad, unique carbohydrate binding spectra. Also, the three MjLecs could interact with several envelope proteins of WSSV and could recognize a wide range of microorganisms. Moreover, binding of MjLecA or MjLecB to WSSV reduced the viral infection rate in vitro. These results suggest that various kinds of CTLs with structural and functional diversities may constitute a recognizing network against invading pathogens such as bacteria and virus, and play essential roles in the defence system of shrimp. Ó 2009 Elsevier Ltd. All rights reserved.
Keywords: Marsupenaeus japonicus C-type lectins Pattern recognition receptor WSSV
1. Introduction Invertebrate lacks adaptive immunity and must completely rely on non-self-recognition molecules to discriminate and clear invading pathogens [1]. Hence, a family of germ-line encoded pattern recognition receptors (PRRs) in the innate immune system is indispensable for invertebrates. Lectins are important PRRs in the innate immune system, and are glycoproteins capable of binding sugar moieties through specific interactions with single or multiple carbohydrate recognition domains (CRD) [2,3]. There are diversiform lectins among which C-type lectins (CTLs) have been well studied in penaeid shrimp [4e16]. For example, FC-L, a purified plasma lectin from Fenneropenaeus chinensis, had binding activity to some Gram-negative bacteria which caused disease in shrimp [4], while Fc-hsL and FcLec4 were identified in F. chinensis with high antimicrobial activities [5,6]. LvLec was identified in Litopenaeus vannamei, and displayed aggregation activity toward Escherichia coli JM109 [8]. PmLT, as a PRR, enhanced hemocyte encapsulation in Penaeus monodon [10]. Simultaneously, it has become apparent that CTLs are involved in protecting shrimps from WSSV virus infection. It has been reported that the expression profiles of three lectins, including PmLT (P. monodon), Fclectin (F. chinensis), and LvLT (L. vannamei), were affected by the
* Corresponding author. E-mail address: [email protected] (X. Xu). 1050-4648/$ e see front matter Ó 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2009.12.015
WSSV virus infection [12e14]. Recently, FcLec3 was also identified in F. chinensis, and could interact with VP28 of WSSV [15]. Also, a mannose-binding C-type lectin (LvCTL1), binding to envelope proteins of WSSV, was found to possess direct anti-WSSV activity in shrimp L. vannamei [16]. However, to date, only one CTL has been reported in Marsupenaeus japonicus [17]. Little is known about the roles of lectins in M. japonicus. M. japonicus is a commercially important species. The opportunistic diseases caused mainly by microorganisms and virus such as white-spot syndrome virus (WSSV) brought a huge commercial loss to the farming of M. japonicus [18,19]. Therefore, there is an urgent need to study the antivirus mechanism in shrimp. In this study, three MjLecs recognizing the envelope proteins of WSSV were identified. The characteristics of the MjLecs, which acted as PRRs and recognized microorganisms and WSSV, were intensively studied. Our results suggest that the three MjLecs are invoked to recognize and differentiate bacteria and viruses, thus fulfilling the requirements of the innate immunity against a wide spectrum of pathogens. 2. Materials and methods 2.1. Microorganisms Aeromomas hydrophilic, Vibrio alginolyticus, Vibrio parahaemolyticus, Bacillus subtilis, Micrococcus lysodeikticus, and Staphylococcus aureus were obtained from key laboratory of marine
K.-K. Song et al. / Fish & Shellfish Immunology 28 (2010) 596e603
597
biogenetic resources. Pichia pastoris and E. coli (DH5a) were preserved in our laboratory.
[22]. One thousand bootstraps were performed for the Neighbour Joining (NJ) trees to evaluate the reproducibility of the results.
2.2. Shrimp and collection of hemocytes
2.6. Total RNA isolation and RT-PCR
Healthy wild shrimp M. japonicus weighting about 15 g and crayfish Procambarus clarkii weighting about 20e30 g were purchased from a supermarket in Xiamen, Fujian, China, and cultured temporarily in laboratory tanks (40 L) filled with airpumped sea water. Hemolymph was obtained from the ventral sinus using a 2 ml sterile syringe preloaded with 1 ml of anticoagulant (0.8% sodium citrate, 0.05% citric acid, 1.87% glucose, 0.42% NaCl, pH 6.0). The hemolymph was centrifuged immediately at 750g for 5 min (4 C) to isolate the hemocytes.
Total RNA was isolated from a variety of tissues (heart, muscle, hemocyte, hepatopancreas, gill, and gastrointestine) of healthy shrimps using TRIzol reagent (Invitrogen). The transcriptional levels of MjLecA, MjLecB, and MjLecC in different tissues were tested by RT-PCR using primers listed in Table 1, respectively. PCR reactions were performed as follow: 94 C (4 min), 30 cycles of 94 C (30 s), 58 C (45 s), 72 C (45 s), and 72 C(10 min) for final extension. b-Actin was used to normalize PCR reactions.
2.3. Construction of T7 phage display library of M. japonicus
2.7. Preparation of recombinant MjLecA, MjLecB, MjLecC and corresponding antisera
The hemocytes and hepatopancreas of M. japonicus were sampled and homogenized together. mRNA was directly isolated using a PolyATtractÒ System 1000 (Promega) according to the manufacturer's instructions. T7 Phage display library of M. japonicus was constructed by the using of T7SelectÒ Phage Display System (Novagen) including OrientExpressÔ Oligo(dT) cDNA Synthesis Kit and T7Select10-3 OrientExpress cDNA Cloning System, Oligo(dT). Briefly, cDNA synthesis, linker ligation, enzyme digestion and size fractionation were performed using OrientExpressÔ Oligo(dT) cDNA Synthesis Kit. Then, the purified cDNA was ligated into the vector and packaged in vitro using T7Select10-3 OrientExpress cDNA Cloning System, Oligo(dT). 2.4. Panning the shrimp cDNA phage display library against WSSV envelope proteins VP26 and VP28, the envelope proteins of WSSV, were cloned into pGEX 4T-2, expressed in E. coli BL21. Soluble GST-VP26 and GST-VP28 were purified by glutathione-agarose beads according to the recommended protocol (Amersham). GST was expressed and purified in the same manner. VP281 was cloned into pET-His, expressed in E. coli BL21. Soluble His-VP281 was purified by nickel affinity chromatography according to the manufacturer's instructions (Qiagen). Biopanning using VP26, VP28, and VP281 was carried out on plastic 96-well ELISA plates (Pierce Chemicals, Rockford, IL) according to the instructions of the system. To eliminate the interference of GST in recombinant viral proteins, GST was used as baits to screen the phage display library as control. Each well was coated overnight at 4 C with the bait proteins (15 ng) or PBS, respectively. The wells were washed three times with TBS. Nonspecific sites were blocked with 10% non-fat dry milk for 1.5 h at room temperature (RT). The wells were washed five times with TBS. Then, 100 ml of diluted recombinant phage library (over 1010 pfu) was added to each well and was incubated for 1 h at RT. Unbound phages were removed by washing the wells 20 times with TBST (TBS containing 0.1% Tween 20). The bound phages were eluted by adding competent TG1 cells, shaking at 37 C until lysis was observed. The lysis solution was centrifuged at 8000g for 10 min, and the supernatant was stored for next round of biopanning. Six rounds of screening were performed and the final eluted plaques were plated at low density. Plagues were isolated and selected for PCR amplification. The cDNA inserts in these plaques were sequenced by Shanghai Invitrogen Biotechnology Co., Ltd. 2.5. Phylogenetic analysis of MjLecs MEGA Version 4 was applied to conduct phylogenetic analysis based on amino acid sequences of CRD from different C-type lectins
Total RNA was extracted from the hepatopancreas of shrimp. The cDNAs of mature MjLecs containing the EcoRI and BamHI sites were separately amplified with the three pairs of selected primers. Next, the cDNAs were inserted into the pET-His plasmids. The recombinant plasmids were transformed into competent E. coli, BL21-DE3 strain. The recombinant proteins were expressed as inclusion body and were purified according to methods described [20]. The inclusion bodies collected from the lysated cells were washed twice successively with 20 ml of buffer A (50 mM TriseHCl, 5 mM EDTA, pH 8.0) and 20 ml of buffer B (50 mM TriseHCl, 5 mM EDTA, 2 M urea, pH 8.0), and then were dissolved in 20 ml of buffer C (0.1 M TriseHCl, 10 mM DTT, 8 M urea, pH 8.0). The solutions were centrifuged at 12,000g for 10 min to eliminate the precipitated proteins, and were purified by nickel affinity chromatography according to the manufacturer's instructions (Qiagen) under denaturing condition. Refoldings of the MjLecs were achieved by dialyzing the solution against refolding buffer (0.1 M TriseHCl, 5 mM EDTA, 5 mM DTT, pH 8.0) containing urea 8, 6, 3, 1.5, 0.75, 0.5, 0.1, and 0 M in turn, and each dialysis step was performed for at least 4 h at 4 C. The refolded MjLecs were dialyzed against TBS for next use. The purities of MjLecs were determined using SDS-PAGE. Antiserum production was performed as described [21]. The purified recombinant MjLecs were injected into female mice with Complete Freund's adjuvant, and a booster injection containing recombinant proteins with Incomplete Freund's adjuvant was given one week later and one time per week for four weeks. 2.8. Agglutination assays Blood was collected from rabbit, mouse, or human (A-type, B-type and O-type) with sterile anticoagulant (0.8% sodium citrate, 0.05% citric acid, 1.87% glucose, 0.42% NaCl, pH 6.0). The erythrocytes were collected by centrifugation at 800g for 5 min. Erythrocytes were then washed for four times with TBS and were resuspended in TBS. Hemagglutinating activities of MjLecA, MjLecB,
Table 1 Sequences of the primers used in this study. Primer
Sequence (50 e30 )
MjLecA-F MjLecA-R MjLecB-F MjLecB-R MjLecC-F MjLecC-R Actin F Actin R
CGCGGATCCGAGATCGGATGGGTAGACCTGGA CCGGAATTCTTAGAGCATCATGCAGAGCGGAT CGCGGATCCACAGGTCCCAGGAAGGAGG CCGGAATTCTTACATGTTGAACTCGCAAATGAG CGCGGATCCCAAGTCAATCCTTGTCCGAATG CCGGAATTCTTAAATCTGACAGATAGCATAGATCTTCC GACGGTCAGGTGATCACCAT CGATTGATGGTCCAGACTCG
598
K.-K. Song et al. / Fish & Shellfish Immunology 28 (2010) 596e603
and MjLecC were assayed by incubating erythrocytes (25 ml) in TBS with different concentrations of MjLecs (25 ml) in the presence or absence of 10 mM CaCl2, using TBS as a negative control. And the effects of divalent cations on the hemagglutinating activities of MjLecs on rabbit erythrocytes were determined in the presence or absence of 10 mM CaCl2 and EDTA. After 1 h of incubation at RT, hemagglutinations were observed by microscopy. Gram-positive bacteria (B. subtilis, M. lysodeikticus and S. aureus) and Gram-negative bacteria (A. hydrophilic, V. alginolyticus, V. parahaemolyticus and E. coli) were used for bacterial agglutination assays. Bacteria in mid-logarithmic phase were collected by centrifugation at 5000g for 5 min and resuspended at 2.5 109 pfu ml1 in TBS in the presence or absence of 10 mM CaCl2. 25 ml of bacteria were added to 25 ml of TBS containing different concentrations of MjLecs and 10 mM CaCl2. The mixture was incubated at RT for 1 h. Bacterial cells were then observed by microscopy. 2.9. Carbohydrate binding specificity Carbohydrate binding specificities of recombinant MjLecs were determined by inhibitory agglutination assay [17]. Recombinant MjLecs (12.5 ml) were placed in 96 U-bottomed well microtitre plate and were incubated with different concentrations of carbohydrates (12.5 ml) for 1 h. Subsequently, rabbit erythrocytes (25 ml) were added, and the agglutinations of rabbit erythrocytes were determined. Inhibitory capacities were presented as the minimum concentration of the carbohydrates that can obviously inhibit agglutination. 2.10. Far-Western experiment WSSV isolated originally from infected M. japonicus was proliferated in crayfish P. clarkii. Intact WSSV virions were purified as described previously [23]. WSSV virions (over 108 pfu ml1) were lysed in SDS-PAGE loading buffer by boiling for 5 min. The viral proteins were separated by SDS-PAGE, transferred to a PVDF membrane, and renatured gradually at 4 C overnight in HEPES buffer (20 mM HEPES, 100 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.1% Tween 20, 10% glycerol, pH 7.5) containing 5% non-fat milk. The blot was washed with TBS, and incubated with 20 mg of BSA, MjLecA, MjLecB, or MjLecC in 2 ml of HEPES buffer containing 1% non-fat milk for 4 h at 4 C, respectively. After three times of washing, the blot was incubated with the antisera against MjLecA, MjLecB, or MjLecC (1:500 dilution) for 2 h, respectively. The washed membrane was incubated in peroxidase-conjugated rabbit antimouse IgG (1:3000 dilution, Santa cruz) for 1 h, and then the signals were visualized using ECL detection system (Pierce). 2.11. Infection-blocking assays in vitro Intact WSSV was labeled with fluorescein isothiocyanate (FITC) according to the procedure as described previously [23]. Labeled virions (107 pfu ml1) were resuspended in PBS and were used for infection-blocking assays in vitro. Infection-blocking assays in vitro were carried out with hemocytes from shrimp. Hemocytes suspension was dropped into coated 12-Well cell culture plates containing treated rounded-glass slice and were incubated at RT for 45e60 min. Unbound cells were washed out with PBS. Simultaneously, WSSV virions labeled with FITC (107 pfu) were mixed with BSA, FAK (Focal adhesion kinase, the protein from shrimp expressed with pET-His vector [24]), and MjLecs, respectively (final concentrations were 5 mg ml1), and incubated for 1 h at 4 C. Then, 1 ml of virions treated with BSA, FAK, or MjLecs was added to each well and was incubated at RT for 3 h. The treated rounded-glass slices were washed with PBS three times, and blocked with 4%
paraformaldehyde for 20 min. The slices were incubated with 2 mg ml1 trypan blue for 10 min, and then washed with PBS three times. After treating with 0.2% Triton X-100 for 10 min, 4, 6-Diamidino-2-phenylindole (DAPI) was added to 0.5 mg ml1 for additional 1 min incubation. Subsequently, the mixtures were removed, and the slices were washed with PBS for five times. The treated cells were observed under fluorescent microscope (Olympus). Hemocytes (at least 200/slice) were counted at 400 magnification. 3. Results 3.1. T7 phage display library of M. japonicus A T7 phage display library was constructed from M. japonicus. The cDNA library initial titer was 1.4 106 pfu (plaque forming units) and the titer of the amplified library was 5.4 108 pfu ml1. The average length of the inserted cDNA fragments is 1.0 kbp, ranging from 0.5 to 3 kbp by PCR amplification. 3.2. Molecular characteristics and phylogenetic analysis of three novel MjLecs The sequences of three novel lectins (MjLecA, MjLecB, and MjLecC) were obtained by screening a phage display library of M. japonicus with WSSV envelope proteins (VP26, VP28, and VP281) (Table 2). Multiple sequence alignment indicated that the three MjLecs shared little similarity with each other (Fig. 1). There was one CRD in each deduced amino acid sequence. Four conserved disulphide-bonded cysteine residues existed in the CRD of MjLecA and MjLecB (indicated with asterisk in Fig. 1). However, only three of these cysteine residues existed in MjLecC. In addition, only one conserved Ca2þ-binding site was found in these MjLecs (Fig. 1). Analysis of glycosylation sites using the webpage server (http://hits. isb-sib.ch/cgi-bin/PFSCAN) showed that only MjLecA possessed one N-linked glycosylation site. Phylogenetic analysis of the three MjLecs and other eleven lectins from vertebrates and invertebrates classified these lectins into two big clusters: lectins with dual CRDs from prawn (Fenneropenaeus merguiensis and Penaeus semisulcatus) and shrimp (F. chinensis, L. vannamei, and F. chinensis) and lectins with single CRD including MjLecA, MjLecB, LvLT, and PMAV formed one large cluster, while lectins with single CRD domain such as MjLecC and lectins from sea squirt (Ciona intestinalis), clam (Venerupis philippinarum), and fish (Branchiostoma belcheri, Salmo salar, Anguilla japonica, and Perca flavescens) formed another group (Fig. 2). The different cluster distributions of the identified MjLecs suggested that MjLecA shared a much closer evolutionary relationship with MjLecB than MjLecC. 3.3. Tissue-specific expression of MjLecA, MjLecB, and MjLecC To determine the distributions of these three MjLecs, RT-PCR was further carried out on different tissues including heart, muscle, hemocyte, hepatopancreas, gill, and gastrointestine. As Fig. 3
Table 2 Candidate C-type lectins screening from the cDNA library of M. japonicus using the structural proteins of WSSV virus. Baits
Lectin
Homology
Vp26
MjLecA
PMAV (33%)
VP28
MjLecA MjLecC
PMAV (33%) C-type lectin
VP281
MjLecB
PMAV (46%)
K.-K. Song et al. / Fish & Shellfish Immunology 28 (2010) 596e603
599
Fig. 1. Multiple amino acid sequence alignments of the CRD of MjLecs with other C-type lectins. The GenBank accession numbers of these lectins are from NCBI: MjLecA of M. japonicus, GQ354220; MjLecB of M. japonicus, GQ354214; MjLecC of M. japonicus, GQ354211; AjLT1 of Anguilla japonica, BAC54022; LvLT CRD1 and CRD2 of L. vannamei, ABI97374; PmLT CRD1 and CRD2 of P. monodon, ABI97373; PsLT CRD1 and CRD2 of Penaeus semisulcatus, ABI97372; FmLT CRD1 and CRD2 of Fenneropenaeus merguiensis, ACR56805; FcLT5 CRD1 and CRD2 of F. chinensis, ACJ06428; PMAV of P. monodon, AAQ75589; PfLT13 of P. flavescens, ACO82046; PfLT5 of P. flavescens, ACO82038; CiMBL of Ciona intestinalis, NP_001161179; SsLT2 of Salmo salar, NP_001117194; CfLTD1-CRD1 of Chlamys farreri, ABB71675. Conserved cysteine residues that exist in the CRD are indicated with asterisk, while conserved Ca2þ-binding site is marked with ;. Gaps inserted during alignment are indicated by dashes.
showed, the signals of all these MjLecs were strongly detected in hepatopancreas. In hemocytes, MjLecA and MjLecB had median expression levels, while little MjLecC was detected. Meanwhile, all these MjLecs were marginally detectable in muscle and gastrointestine, while no signal was detected in heart and gill. 3.4. Preparation of recombinant MjLecA, MjLecB, and MjLecC Recombinant mature MjLecs, MjLecB, and MjLecC (without a signal peptide) were expressed as inclusion bodies and were
purified under denaturing condition, then renatured by dialysis. The renatured MjLecA, MjLecB, and MjLecC were mainly resolved as single bands in SDS-PAGE gels, and had molecular weights (MWs) of 19 kDa, 20 kDa, and 17 kDa, respectively (Fig. 4, lane 1, 2, and 3). These MWs are a little larger than their theoretical MWs, which are 16.7 kDa, 16.8 kDa, and 16.0 kDa, respectively. It might result from the His-tag at the N-terminus of each protein. Except for these bands, another band with an MW of 21 kDa was also detected in MjLecA (Fig. 4, lane 1). This might be some modified isoform of MjLecA.
600
K.-K. Song et al. / Fish & Shellfish Immunology 28 (2010) 596e603 72 55 96 98 77
FmLT-CRD2 FcLT5-CRD2 PmLT-CRD2 PsLT-CRD2 LvLT-CRD2
72 74 100 86 76
LvLT LvLT-CRD1 PsLT-CRD1 FmLT-CRD1 PmLT-CRD1 FcLT5-CRD1
MjLecA MjLecB
30
PMAV
88
MjLecC CiMBL VpLT BbLT2
48 13 34 86
AjLT1 SsLT2
54 97 83
PfLT13 PfLT5
0.1
Fig. 2. Phylogenetic analysis of the CRD sequences of C-type lectins. The phylogenetic tree was constructed by the neighbour-joining method, based on the amino acid alignment (Clustal W) of individual CRD sequences from selected lectins. The GenBank accession numbers of these lectins are from NCBI: FmLT CRD1 and CRD2 of F. merguiensis, ACR56805; FcLT5 CRD1 and CRD2 of F. chinensis, ACJ06428; PmLT CRD1 and CRD2 of P. monodon, ABI97373; PsLT CRD1 and CRD2 of P. semisulcatus, ABI97372; LvLT CRD1 and CRD2 of L. vannamei, ABI97374; LvLT of L. vannamei, ABU62825; PMAV of P. monodon, AAQ75589; CiMBL of C. intestinalis, NP_001161179; VpLT of V. philippinarum, ACU83213; BbLT2 of B. belcheri, ABY54815; AjLT1 of A. japonica, BAC54022; SsLT2 of S. salar, NP_001117194; PfLT5 of P. flavescens, ACO82038; PfLT13 of P. flavescens, ACO82046. The MjLecs from M. japonicus are underlined.
3.5. Agglutinating activity of recombinant MjLecA, MjLecB, and MjLecC To define the agglutinating activity of the identified MjLecs toward mammalian erythrocytes and microorganisms, agglutination assay was further performed on different erythrocytes (including rabbit, mouse, human A, B and O-type erythrocytes) and microorganisms including typical microorganisms (E. coli, B. subtilis, S. aureus, and P. pastoris) and some common pathogens of aquaculture (A. hydrophilic, V. alginolyticus, V. parahaemolyticus, and M. lysodeikticus). The agglutinating activity was revealed using the minimal agglutinating concentrations of each MjLecs, and was summarized in Tables 3 and 4. All recombinant MjLecs could agglutinate rabbit and mouse erythrocytes, but exhibited quite diverse agglutinating activities for different human erythrocytes (Table 3). For example, MjLecA and MjLecC could agglutinate human A, B-type erythrocytes,
Fig. 4. SDS-PAGE analysis of the purified recombinant MjLecs expressed in E. coli BL21 (DE3). The loading amounts are 0.7, 1.1, and 2.1 mg/lane for MjLecA, MjLecB, and MjLecC, respectively. Lane 1, MjLecA; lane 2, MjLecB; lane 3, MjLecC.
while MjLecB couldn't agglutinate any human erythrocytes. And in whole, these MjLecs showed a tendency in agglutinating activity toward different kinds of erythrocytes following as: rabbit > mouse > human B > human A > human O-type erythrocytes. In terms of microorganisms, all the three MjLecs exhibited no agglutinating activities toward A. hydrophilic, B. subtilis, and P. pastoris (Table 4), but could agglutinate some other bacteria and showed obvious diversities. Furthermore, when the Ca2þ was included in the assay systems, some of agglutinating activities could be promoted obviously. But the agglutination happened in cases of rabbit erythrocytes or S. aureus without Ca2þ suggested
Table 3 Hemagglutinating activities of MjLecs on mammalian erythrocytes. Erythrocytes
MjLecs Minimum hemagglutinating concentration (mg/ml)
Rabbit (Caþ) Rabbit (Ca) Mouse (Caþ) Mouse (Ca) Human group Human group Human group Human group Human group Human group Fig. 3. Tissue distribution of MjLecA, MjLecB, and MjLecC transcript revealed by RT-PCR. b-actin was amplified as an internal control.
A (Caþ) A (Ca) B (Caþ) B (Ca) O (Caþ) O (Ca)
MjLecA
MjLecB
MjLecC
2.1 4.2 17.5 17.5 70 NA 35 70 NA NA
3.5 14 7 7 NA NA NA NA NA NA
2.19 4.375 17.5 NA 8.75 NA 8.75 35 NA NA
The hemagglutinating activity was demonstrated using the minimal hemagglutinating concentration. NA e No agglutination within the concentration tested; (Caþ) with 10 mM Ca2þ; (Ca) without Ca2þ.
K.-K. Song et al. / Fish & Shellfish Immunology 28 (2010) 596e603 Table 4 Agglutinating activities of MjLecs on various microorganisms. Microorganisms
MjLecs Minimal agglutinating concentration (mg/ml)
G
Gþ
MjLecA
MjLecB
MjLecC
NA ()
Aeromomas hydrophilic Vibrio alginolyticus
8.8(þ) 8.8 () NA () NA ()
Vibrio parahaemolyticus
NA ()
0.75 (þ) 0.75 () NA () 2.19 (þ) NA () 4.38 (þ) 17.5 ()
Bacillus subtilis Micrococcus lysodeikticus
NA () 17.5 (þ) 17.5 () 4.38 (þ) 17.5 ()
1.75 (þ) 14 ()
NA () 35 (þ) 35 () 35 (þ) 35 ()
NA ()
NA ()
NA ()
Escherichia coli
Staphylococcus aureus Yeast
Pichia pastoris
NA () 1.75 (þ) NA () 28 (þ) NA () NA () NA ()
The agglutinating activity was demonstrated using the minimal agglutinating concentration. (G) Gram-negative bacteria, (Gþ) Gram-positive bacteria; NA e no agglutination within the concentration tested; (þ) with 10 mM Ca2þ, () without Ca2þ.
that MjLecs exerted agglutinating activity in a calcium independent manner.
601
WSSV as bait proteins (Table 2). To further confirm the interactions between these MjLecs and WSSV proteins, Far-Western was performed. As Fig. 5 revealed, VP19, VP24, V26, VP28, and several other WSSV envelope protein bands were detected in SDS-PAGE gel (lane 1). MjLecC could bind to three of these bands (VP28 and another two bands with MWs of about 90 kDa and 100 kDa, respectively; Fig. 5, lane 4). MjLecA exhibited similar capacity but also could bind to VP26. MjLecB could interact with VP28, the band with an MW of about 72 kDa, and another band with an MW of about 90 kDa. The results suggested that MjLecA, MjLecB, and MjLecC might bind to different structural proteins of WSSV particles, which might be related to their diverse effects for WSSV virus. 3.8. Infection-blocking assays in vitro To explore the roles of recombinant MjLecs in mediating the infection of WSSV, infection-blocking assay was carried out on hemocytes of M. japonicus in vitro. The results observed by fluorescence spectroscopy showed that MjLecA and MjLecB could inhibit the infection of WSSV in vitro (Fig. 6(I)). When defining the infection rate of WSSV treated with 5 mg/ml BSA as 100%, the infection rates of WSSV in the presence of 5 mg ml1 MjLecA or MjLecB were 47.2% and 73.0% (Fig. 6(II)), respectively. However, MjLecC exhibited little blocking activity. 4. Discussion
3.6. Carbohydrate binding specificities of MjLecA, MjLecB, and MjLecC The recognizing specificities of recombinant MjLecA, MjLecB, and MjLecC for different sugars and PAMPs were investigated by performing hemagglutination inhibition assay. The hemagglutinating activity of all the three MjLecs could be completely inhibited by GlcNAc and LPS (Table 5). Other carbohydrates tested couldn't inhibit the hemagglutinating activity of MjLecA. However, the hemagglutinating activity of MjLecB was obviously inhibited by maltose and mannose. The hemagglutinating activity of MjLecC could be inhibited by GalNAc and cellobiose. These results suggested that the three MjLecs exhibited different ligand-binding specificities.
VP26, VP28, and VP281 are the most important envelope proteins of WSSV, and have been proved to be involved in the WSSV infection of shrimp [25]. Further studies indicated that VP28 and VP281 can bind to receptors on the surface of the shrimp cells and thus may help the virus enter the cytoplasm [21,26e28]. We obtained three novel lectins (MjLecA, MjLecB, and MjLecC) by screening the phage display library of M. japonicus with VP26, VP28, and VP281. In accordance with the previous studies, our results presented by Far-Western blot suggested that MjLecA,
3.7. MjLecA, MjLecB, and MjLecC showed diverse WSSV virions binding capacities The sequences of MjLecA, MjLecB, and MjLecC were obtained by screening the cDNA library of shrimp using envelope proteins of Table 5 Inhibitory effects of carbohydrates on the hemagglutinating activity of MjLecs toward the rabbit erythrocytes. Saccharides
1-Maltose 2-D-glucose 3-D-mannose 4-D-fructose 5-sucrose 6-D(þ)-galactose 8-D(þ)-cellobiose 9-L-(þ)-rhamnose 10-D-xylose 11-N-acetyl-D-galactosamine 12-Dextran-10 13 a,a-trehalose 14 N-acetyl-D-glucosamine 15 LPS
MjLecs MjLecA
MjLecB
MjLecC
e e e e e e e e e e e e 12.5 mg/ml 0.125 mg/ml
100 mM e 100 mM e e e e e e e e e 50 mg/ml 0.125 mg/ml
e e e e e e 100 mM e e 100 mM e e 100 mg/ml 0.125 mg/ml
(e) Not obviously inhibit the hemagglutination within the concentration tested.
Fig. 5. Far-Western assays of WSSV proteins that interacted with recombinant MjLecs. Lane 1: the WSSV proteins separated on SDS-PAGE were stained with silver nitrate; Lane 2, 3, and 4: The membrane was probed with recombinant MjLecA, MjLecB, or MjLecC, and detected with mouse polyclonal antibody specific to MjLecA, MjLecB, or MjLecC, respectively. Lane 5: BSA was used as a control.
602
K.-K. Song et al. / Fish & Shellfish Immunology 28 (2010) 596e603
Fig. 6. WSSV infection-blocking assay with MjLecs using FITC-labeled WSSV. Hemocytes were incubated with FITC-labeled WSSV (green) and control (A, BSA; B, FAK, a shrimp protein also expressed with pET-His vector), MjLecA(C), MjLecB (D), or MjLecC (E), at RT for 3 h. Subsequently, cell nuclei were stained with DAPI (blue). Nonadherent virus and DAPI were removed. (I) Cells were observed under fluorescence microscopy. Scale bar ¼ 50 mm. (II) The WSSV infection-blocking activities of MjLecs were calculated and demonstrated with histograms. The blocking activity of BSA was defined as 100%. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
MjLecB, and MjLecC acted as PRRs and interacted with envelope proteins of WSSV particles. To further ascertain the roles of the three MjLecs in WSSV infection, infection-blocking assays with FITC-labled WSSV particles infecting shrimp hemocytes were performed in vitro. The results showed that MjLecA and MjLecB were novel CTLs with direct anti-WSSV activities. Before the present study, two CTLs had been reported to interact with envelope proteins of WSSV [15,16], and one of them was proved to possess the capacity of prolonging the survival of WSSV-infected shrimp [16]. It would be intriguing to investigate the potential roles of the three MjLecs in protecting shrimp from WSSV infection in vivo. The three MjLecs all belonged to group VII C-type lectins, consisting of a single CRD. However, the BLASTP results indicated that they shared little similarity in protein sequence, and might imply diverse functions. This diversity was obviously observed in our
results: First, the three MjLecs could specifically agglutinate different mammalian erythrocytes. And, they could recognize a wide range of microorganisms but to varying extents. Second, the affinities of the three MjLecs for carbohydrates were remarkably different. It could be that the overall structures of the three MjLecs might vary a lot due to the different amino acid sequences, and might result in the different affinities for carbohydrates. Meanwhile, the differences in the orientation and configuration of the substrate glucose moiety contribute to the specificities of the MjLecs for carbohydrates. Third, MjLecA and MjLecB exhibited direct anti-WSSV capacities but with different activities while MjLecC had little impact on the infection of WSSV. This diversity is also suggested by their phylogenetic tree which indicated that MjLecC might originate from a more distant ancestor than MjLecA and MjLecB.
K.-K. Song et al. / Fish & Shellfish Immunology 28 (2010) 596e603
Most CTLs were reported to be calcium dependent. Only several lectins were demonstrated to be calcium independent, eg., PjLec from M. japonicus [17], immulectin family from Manduca sexta [29], and CfLec-2 from C. farreri [30]. Similarly, the three MjLecs all displayed agglutinating activity with or without Ca2þ in some cases, and exhibited calcium independent feature. The relationship between the agglutinating activities of C-type lectins and calcium had been well illustrated in the study on mannose-binding lectin (MBL) [31]. Two conserved calcium binding sites were proved to be involved in calcium binding [30]. However, only two amino acids (Asp and Glu; Fig. 1), which might form the calcium binding site 1 of MjLecs, were conserved. Other amino acids which function in calcium binding were not found. This might contribute to the calcium independent agglutinating activity of MjLecs. The mechanism underlining the calcium independent agglutinating activity needs further investigation. V. parahaemolyticus, V. alginolyticus, and M. lysodeikticus are very common pathogens of aquaculture. MjLecs could interact with carbohydrates in these pathogens, and caused rapid agglutination of these pathogens. The agglutination of bacteria may further cause the sensitization of the host immune system to these bacteria. So, MjLecs may affect the immune response of shrimp and be beneficial for aquaculture to prevent pathogen invasion. In summary, with the number of lectin pools isolated from shrimp rapidly increasing, the understanding of their roles in innate immunity such as pathogen recognition and antivirus activity is more important for preventing aquaculture disease outbreaks. This study presented that three novel C-type lectins recognized WSSV existing in the shrimp M. japonicus, but exhibited obvious diversities in terms of protein sequence, agglutinating activity, virions binding capacity, and antiviral activity. Our experiments demonstrated that the three MjLecs can recognize WSSV, and may act as pattern recognition proteins. However, how the MjLecs affect the WSSV infection still requires further researches. Acknowledgements The work was supported by the Key Program of National 501 Natural Science Foundation of China (30830084), the National Basic Research Program of China (973 Program 2006CB101804). And it was also supported by the earmarked fund for Modern Agroindustry Technology Research System. References [1] Loker ES, Adema CM, Zhang SM, Kepler TB. Invertebrate immune systems-not homogeneous, not simple, not well understood. Immunol Rev 2004;198: 10e24. [2] Sharon N, Lis H. History of lectins: from hemagglutinins to biological recognition molecules. Glycobiology 2004;14(11):53Re62R. [3] Marques MRF, Barracco MA. Lectins, as non-self-recognition factors, in crustaceans. Aquaculture 2000;191:23e44. [4] Sun J, Wang L, Wang B, Guo Z, Liu M, Jiang K, et al. Purification and characterization of a natural lectin from the plasma of the shrimp Fenneropenaeus chinensis. Fish Shellfish Immunol 2008;25(3):290e7. [5] Sun YD, Fu LD, Jia YP, Du XJ, Wang Q, Wang YH, et al. A hepatopancreasspecific C-type lectin from the Chinese shrimp Fenneropenaeus chinensis exhibits antimicrobial activity. Mol Immunol 2008;45(2):348e61.
603
[6] Wang XW, Zhang XW, Xu WT, Zhao XF, Wang JX. A novel C-type lectin (FcLec4) facilitates the clearance of Vibrio anguillarum in vivo in Chinese white shrimp. Dev Comp Immunol 2009;33(9):1039e47. [7] Zhang XW, Xu WT, Wang XW, Mu Y, Zhao XF, Yu XQ, et al. A novel C-type lectin with two CRD domains from Chinese shrimp Fenneropenaeus chinensis functions as a pattern recognition protein. Mol Immunol 2009;46(8e9): 1626e37. [8] Sun J, Wang L, Wang B, Guo Z, Liu M, Jiang K, et al. Purification and characterisation of a natural lectin from the serum of the shrimp Litopenaeus vannamei. Fish Shellfish Immunol 2007;23(2):292e9. [9] Zhang Y, Qiu L, Song L, Zhang H, Zhao J, Wang L, et al. Cloning and characterization of a novel C-type lectin gene from shrimp Litopenaeus vannamei. Fish Shellfish Immunol 2009;26(1):183e92. [10] Luo T, Yang H, Li F, Zhang X, Xu X. Purification, characterization and cDNA cloning of a novel lipopolysaccharide-binding lectin from the shrimp Penaeus monodon. Dev Comp Immunol 2006;30(7):607e17. [11] Ma TH, Benzie JA, He JG, Chan SM. PmLT, a C-type lectin specific to hepatopancreas is involved in the innate defense of the shrimp Penaeus monodon. J Invert Pathol 2008;99(3):332e41. [12] Liu YC, Li FH, Dong B, Wang B, Luan W, Zhang XJ, et al. Molecular cloning, characterization and expression analysis of a putative C-type lectin (Fclectin) gene in Chinese shrimp Fenneropenaeus chinensis. Mol Immunol 2007;44 (4):598e607. [13] Ma TH, Tiu SH, He JG, Chan SM. Molecular cloning of a C-type lectin (LvLT) from the shrimp Litopenaeus vannamei: early gene down-regulation after WSSV infection. Fish Shellfish Immunol 2007;23(2):430e7. [14] Luo T, Zhang X, Shao Z, Xu X. PmAV, a novel gene involved in virus resistance of shrimp Penaeus monodon. FEBS Lett 2003;551(1e3):53e7. [15] Wang XW, Xu WT, Zhang XW, Zhao XF, Yu XQ, Wang JX. A C-type lectin is involved in the innate immune response of Chinese white shrimp. Fish Shellfish Immunol 2009;27(4):556e62. [16] Zhao ZY, Yin ZX, Xu XP, Weng SP, Rao XY, Dai ZX, et al. A novel C-type lectin from the shrimp Litopenaeus vannamei possesses anti-white spot syndrome virus activity. J Virol 2009;83(1):347e56. [17] Yang H, Luo T, Li F, Li S, Xu X. Purification and characterisation of a calciumindependent lectin (MjLec) from the haemolymph of the shrimp Penaeus japonicus. Fish Shellfish Immunol 2007;22(1e2):88e97. [18] Lighner DV, Redman RM. Shrimp diseases and current diagnostic methods. Aquaculture 1998;164(1e4):201e20. [19] Takahashi Y, Itami T, Maeda M, Kondo M. Bacterial and viral diseases of kuruma shrimp (Penaeus japonicus) in Japan. Fish Pathol 1998;33:357e64. [20] Yu XQ, Tracy ME, Ling Erjun, Scholz FR, Trenczek T. A novel C-type immulectin-3 from Manduca sexta is translocated from hemolymph into the cytoplasm of hemocytes. Insect Biochem Mol Biol 2005;35:285e95. [21] Li DF, Zhang MC, Yang HJ, Zhu YB, Xu Xun. b-integrin mediates WSSV infection. Virology 2007;368:122e32. [22] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 2007;24(8):1596e9. [23] Xie XX, Li HY, Xu LM, Yang F. A simple and efficient method for purification of intact white spot syndrome virus (WSSV) viral particles. Virus Res 2005; 108:63e7. [24] Zhang M, Wang H, Li D, Xu X. A novel focal adhesion kinase from Marsupenaeus japonicus and its response to WSSV infection. Dev Comp Immunol 2009;33(4):533e9. [25] Sánchez-Martínez JG, Aguirre-Guzmán G, Mejía-Ruíz H. White spot syndrome virus in cultured shrimp: a review. Aquacult Res 2007;38:1339e54. [26] Tsai JM, Wang HC, Leu JH, Wang AH, Zhuang Y, Walker PJ, et al. Identification of the nucleocapsid, tegument, and envelope proteins of the shrimp white spot syndrome virus virion. J Virol 2006;80:3021e9. [27] van Hulten MCW, Witteveldt J, Snippe M, Vlak JM. White spot syndrome virus envelope protein VP28 is involved in the systemic infection of shrimp. Virology 2001;285:228e33. [28] Yi GH, Wang ZM, Qi YP, Yao LG, Qian J, Hu LB. Vp28 of shrimp white spot syndrome virus is involved in the attachment and penetration into shrimp cells. J Biochem Mol Biol 2004;37:726e34. [29] Yu XQ, Ma YK. Calcium is not required for immulectin-2 binding, but protects the protein from proteinase digestion. Insect Biochem Mol Biol 2006;36: 505e16. [30] Zheng P, Wang H, Zhao J, Song L, Qiu L, Dong C, et al. A lectin (CfLec-2) aggregating Staphylococcus haemolyticus from scallop Chlamys farreri. Fish Shellfish Immunol 2008;24(3):286e93. [31] Weis WI, Drickamer K, Hendrickson WA. Structure of a C-type mannosebinding protein complexed with an oligosaccharide. Nature 1992;360:127e34.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Cloning and characterization of three novel WSSV recognizing lectins from shrimp Marsupenaeus japonicus Kang-Kang Song, Deng-Feng Li, Ming-Chang Zhang, Hai-Jie Yang, Ling-Wei Ruan, Xun Xu* Key Laboratory of Marine Biogenetic Resources, Third Institute of Oceanography, State Oceanic Administration (SOA), 184# DaXue Road, Xiamen 361005, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 27 August 2009 Received in revised form 14 December 2009 Accepted 15 December 2009 Available online 1 January 2010
C-type lectins (CTLs) acting as pattern recognition receptors play essential roles in shrimp innate immune responses. Using WSSV envelope proteins (VP26, VP28, and VP281) to screen a phage display library of Marsupenaeus japonicus, three lectins (termed as MjLecA, MjLecB, and MjLecC) were found to interact with WSSV. Sequence analysis revealed that these MjLecs shared low similarities with each other. Phylogenetic analysis indicated MjLecA and MjLecB are likely to belong to the same lectin subfamily, while MjLecC belongs to another sub-family. These MjLecs showed broad, unique carbohydrate binding spectra. Also, the three MjLecs could interact with several envelope proteins of WSSV and could recognize a wide range of microorganisms. Moreover, binding of MjLecA or MjLecB to WSSV reduced the viral infection rate in vitro. These results suggest that various kinds of CTLs with structural and functional diversities may constitute a recognizing network against invading pathogens such as bacteria and virus, and play essential roles in the defence system of shrimp. Ó 2009 Elsevier Ltd. All rights reserved.
Keywords: Marsupenaeus japonicus C-type lectins Pattern recognition receptor WSSV
1. Introduction Invertebrate lacks adaptive immunity and must completely rely on non-self-recognition molecules to discriminate and clear invading pathogens [1]. Hence, a family of germ-line encoded pattern recognition receptors (PRRs) in the innate immune system is indispensable for invertebrates. Lectins are important PRRs in the innate immune system, and are glycoproteins capable of binding sugar moieties through specific interactions with single or multiple carbohydrate recognition domains (CRD) [2,3]. There are diversiform lectins among which C-type lectins (CTLs) have been well studied in penaeid shrimp [4e16]. For example, FC-L, a purified plasma lectin from Fenneropenaeus chinensis, had binding activity to some Gram-negative bacteria which caused disease in shrimp [4], while Fc-hsL and FcLec4 were identified in F. chinensis with high antimicrobial activities [5,6]. LvLec was identified in Litopenaeus vannamei, and displayed aggregation activity toward Escherichia coli JM109 [8]. PmLT, as a PRR, enhanced hemocyte encapsulation in Penaeus monodon [10]. Simultaneously, it has become apparent that CTLs are involved in protecting shrimps from WSSV virus infection. It has been reported that the expression profiles of three lectins, including PmLT (P. monodon), Fclectin (F. chinensis), and LvLT (L. vannamei), were affected by the
* Corresponding author. E-mail address: [email protected] (X. Xu). 1050-4648/$ e see front matter Ó 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2009.12.015
WSSV virus infection [12e14]. Recently, FcLec3 was also identified in F. chinensis, and could interact with VP28 of WSSV [15]. Also, a mannose-binding C-type lectin (LvCTL1), binding to envelope proteins of WSSV, was found to possess direct anti-WSSV activity in shrimp L. vannamei [16]. However, to date, only one CTL has been reported in Marsupenaeus japonicus [17]. Little is known about the roles of lectins in M. japonicus. M. japonicus is a commercially important species. The opportunistic diseases caused mainly by microorganisms and virus such as white-spot syndrome virus (WSSV) brought a huge commercial loss to the farming of M. japonicus [18,19]. Therefore, there is an urgent need to study the antivirus mechanism in shrimp. In this study, three MjLecs recognizing the envelope proteins of WSSV were identified. The characteristics of the MjLecs, which acted as PRRs and recognized microorganisms and WSSV, were intensively studied. Our results suggest that the three MjLecs are invoked to recognize and differentiate bacteria and viruses, thus fulfilling the requirements of the innate immunity against a wide spectrum of pathogens. 2. Materials and methods 2.1. Microorganisms Aeromomas hydrophilic, Vibrio alginolyticus, Vibrio parahaemolyticus, Bacillus subtilis, Micrococcus lysodeikticus, and Staphylococcus aureus were obtained from key laboratory of marine
K.-K. Song et al. / Fish & Shellfish Immunology 28 (2010) 596e603
597
biogenetic resources. Pichia pastoris and E. coli (DH5a) were preserved in our laboratory.
[22]. One thousand bootstraps were performed for the Neighbour Joining (NJ) trees to evaluate the reproducibility of the results.
2.2. Shrimp and collection of hemocytes
2.6. Total RNA isolation and RT-PCR
Healthy wild shrimp M. japonicus weighting about 15 g and crayfish Procambarus clarkii weighting about 20e30 g were purchased from a supermarket in Xiamen, Fujian, China, and cultured temporarily in laboratory tanks (40 L) filled with airpumped sea water. Hemolymph was obtained from the ventral sinus using a 2 ml sterile syringe preloaded with 1 ml of anticoagulant (0.8% sodium citrate, 0.05% citric acid, 1.87% glucose, 0.42% NaCl, pH 6.0). The hemolymph was centrifuged immediately at 750g for 5 min (4 C) to isolate the hemocytes.
Total RNA was isolated from a variety of tissues (heart, muscle, hemocyte, hepatopancreas, gill, and gastrointestine) of healthy shrimps using TRIzol reagent (Invitrogen). The transcriptional levels of MjLecA, MjLecB, and MjLecC in different tissues were tested by RT-PCR using primers listed in Table 1, respectively. PCR reactions were performed as follow: 94 C (4 min), 30 cycles of 94 C (30 s), 58 C (45 s), 72 C (45 s), and 72 C(10 min) for final extension. b-Actin was used to normalize PCR reactions.
2.3. Construction of T7 phage display library of M. japonicus
2.7. Preparation of recombinant MjLecA, MjLecB, MjLecC and corresponding antisera
The hemocytes and hepatopancreas of M. japonicus were sampled and homogenized together. mRNA was directly isolated using a PolyATtractÒ System 1000 (Promega) according to the manufacturer's instructions. T7 Phage display library of M. japonicus was constructed by the using of T7SelectÒ Phage Display System (Novagen) including OrientExpressÔ Oligo(dT) cDNA Synthesis Kit and T7Select10-3 OrientExpress cDNA Cloning System, Oligo(dT). Briefly, cDNA synthesis, linker ligation, enzyme digestion and size fractionation were performed using OrientExpressÔ Oligo(dT) cDNA Synthesis Kit. Then, the purified cDNA was ligated into the vector and packaged in vitro using T7Select10-3 OrientExpress cDNA Cloning System, Oligo(dT). 2.4. Panning the shrimp cDNA phage display library against WSSV envelope proteins VP26 and VP28, the envelope proteins of WSSV, were cloned into pGEX 4T-2, expressed in E. coli BL21. Soluble GST-VP26 and GST-VP28 were purified by glutathione-agarose beads according to the recommended protocol (Amersham). GST was expressed and purified in the same manner. VP281 was cloned into pET-His, expressed in E. coli BL21. Soluble His-VP281 was purified by nickel affinity chromatography according to the manufacturer's instructions (Qiagen). Biopanning using VP26, VP28, and VP281 was carried out on plastic 96-well ELISA plates (Pierce Chemicals, Rockford, IL) according to the instructions of the system. To eliminate the interference of GST in recombinant viral proteins, GST was used as baits to screen the phage display library as control. Each well was coated overnight at 4 C with the bait proteins (15 ng) or PBS, respectively. The wells were washed three times with TBS. Nonspecific sites were blocked with 10% non-fat dry milk for 1.5 h at room temperature (RT). The wells were washed five times with TBS. Then, 100 ml of diluted recombinant phage library (over 1010 pfu) was added to each well and was incubated for 1 h at RT. Unbound phages were removed by washing the wells 20 times with TBST (TBS containing 0.1% Tween 20). The bound phages were eluted by adding competent TG1 cells, shaking at 37 C until lysis was observed. The lysis solution was centrifuged at 8000g for 10 min, and the supernatant was stored for next round of biopanning. Six rounds of screening were performed and the final eluted plaques were plated at low density. Plagues were isolated and selected for PCR amplification. The cDNA inserts in these plaques were sequenced by Shanghai Invitrogen Biotechnology Co., Ltd. 2.5. Phylogenetic analysis of MjLecs MEGA Version 4 was applied to conduct phylogenetic analysis based on amino acid sequences of CRD from different C-type lectins
Total RNA was extracted from the hepatopancreas of shrimp. The cDNAs of mature MjLecs containing the EcoRI and BamHI sites were separately amplified with the three pairs of selected primers. Next, the cDNAs were inserted into the pET-His plasmids. The recombinant plasmids were transformed into competent E. coli, BL21-DE3 strain. The recombinant proteins were expressed as inclusion body and were purified according to methods described [20]. The inclusion bodies collected from the lysated cells were washed twice successively with 20 ml of buffer A (50 mM TriseHCl, 5 mM EDTA, pH 8.0) and 20 ml of buffer B (50 mM TriseHCl, 5 mM EDTA, 2 M urea, pH 8.0), and then were dissolved in 20 ml of buffer C (0.1 M TriseHCl, 10 mM DTT, 8 M urea, pH 8.0). The solutions were centrifuged at 12,000g for 10 min to eliminate the precipitated proteins, and were purified by nickel affinity chromatography according to the manufacturer's instructions (Qiagen) under denaturing condition. Refoldings of the MjLecs were achieved by dialyzing the solution against refolding buffer (0.1 M TriseHCl, 5 mM EDTA, 5 mM DTT, pH 8.0) containing urea 8, 6, 3, 1.5, 0.75, 0.5, 0.1, and 0 M in turn, and each dialysis step was performed for at least 4 h at 4 C. The refolded MjLecs were dialyzed against TBS for next use. The purities of MjLecs were determined using SDS-PAGE. Antiserum production was performed as described [21]. The purified recombinant MjLecs were injected into female mice with Complete Freund's adjuvant, and a booster injection containing recombinant proteins with Incomplete Freund's adjuvant was given one week later and one time per week for four weeks. 2.8. Agglutination assays Blood was collected from rabbit, mouse, or human (A-type, B-type and O-type) with sterile anticoagulant (0.8% sodium citrate, 0.05% citric acid, 1.87% glucose, 0.42% NaCl, pH 6.0). The erythrocytes were collected by centrifugation at 800g for 5 min. Erythrocytes were then washed for four times with TBS and were resuspended in TBS. Hemagglutinating activities of MjLecA, MjLecB,
Table 1 Sequences of the primers used in this study. Primer
Sequence (50 e30 )
MjLecA-F MjLecA-R MjLecB-F MjLecB-R MjLecC-F MjLecC-R Actin F Actin R
CGCGGATCCGAGATCGGATGGGTAGACCTGGA CCGGAATTCTTAGAGCATCATGCAGAGCGGAT CGCGGATCCACAGGTCCCAGGAAGGAGG CCGGAATTCTTACATGTTGAACTCGCAAATGAG CGCGGATCCCAAGTCAATCCTTGTCCGAATG CCGGAATTCTTAAATCTGACAGATAGCATAGATCTTCC GACGGTCAGGTGATCACCAT CGATTGATGGTCCAGACTCG
598
K.-K. Song et al. / Fish & Shellfish Immunology 28 (2010) 596e603
and MjLecC were assayed by incubating erythrocytes (25 ml) in TBS with different concentrations of MjLecs (25 ml) in the presence or absence of 10 mM CaCl2, using TBS as a negative control. And the effects of divalent cations on the hemagglutinating activities of MjLecs on rabbit erythrocytes were determined in the presence or absence of 10 mM CaCl2 and EDTA. After 1 h of incubation at RT, hemagglutinations were observed by microscopy. Gram-positive bacteria (B. subtilis, M. lysodeikticus and S. aureus) and Gram-negative bacteria (A. hydrophilic, V. alginolyticus, V. parahaemolyticus and E. coli) were used for bacterial agglutination assays. Bacteria in mid-logarithmic phase were collected by centrifugation at 5000g for 5 min and resuspended at 2.5 109 pfu ml1 in TBS in the presence or absence of 10 mM CaCl2. 25 ml of bacteria were added to 25 ml of TBS containing different concentrations of MjLecs and 10 mM CaCl2. The mixture was incubated at RT for 1 h. Bacterial cells were then observed by microscopy. 2.9. Carbohydrate binding specificity Carbohydrate binding specificities of recombinant MjLecs were determined by inhibitory agglutination assay [17]. Recombinant MjLecs (12.5 ml) were placed in 96 U-bottomed well microtitre plate and were incubated with different concentrations of carbohydrates (12.5 ml) for 1 h. Subsequently, rabbit erythrocytes (25 ml) were added, and the agglutinations of rabbit erythrocytes were determined. Inhibitory capacities were presented as the minimum concentration of the carbohydrates that can obviously inhibit agglutination. 2.10. Far-Western experiment WSSV isolated originally from infected M. japonicus was proliferated in crayfish P. clarkii. Intact WSSV virions were purified as described previously [23]. WSSV virions (over 108 pfu ml1) were lysed in SDS-PAGE loading buffer by boiling for 5 min. The viral proteins were separated by SDS-PAGE, transferred to a PVDF membrane, and renatured gradually at 4 C overnight in HEPES buffer (20 mM HEPES, 100 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.1% Tween 20, 10% glycerol, pH 7.5) containing 5% non-fat milk. The blot was washed with TBS, and incubated with 20 mg of BSA, MjLecA, MjLecB, or MjLecC in 2 ml of HEPES buffer containing 1% non-fat milk for 4 h at 4 C, respectively. After three times of washing, the blot was incubated with the antisera against MjLecA, MjLecB, or MjLecC (1:500 dilution) for 2 h, respectively. The washed membrane was incubated in peroxidase-conjugated rabbit antimouse IgG (1:3000 dilution, Santa cruz) for 1 h, and then the signals were visualized using ECL detection system (Pierce). 2.11. Infection-blocking assays in vitro Intact WSSV was labeled with fluorescein isothiocyanate (FITC) according to the procedure as described previously [23]. Labeled virions (107 pfu ml1) were resuspended in PBS and were used for infection-blocking assays in vitro. Infection-blocking assays in vitro were carried out with hemocytes from shrimp. Hemocytes suspension was dropped into coated 12-Well cell culture plates containing treated rounded-glass slice and were incubated at RT for 45e60 min. Unbound cells were washed out with PBS. Simultaneously, WSSV virions labeled with FITC (107 pfu) were mixed with BSA, FAK (Focal adhesion kinase, the protein from shrimp expressed with pET-His vector [24]), and MjLecs, respectively (final concentrations were 5 mg ml1), and incubated for 1 h at 4 C. Then, 1 ml of virions treated with BSA, FAK, or MjLecs was added to each well and was incubated at RT for 3 h. The treated rounded-glass slices were washed with PBS three times, and blocked with 4%
paraformaldehyde for 20 min. The slices were incubated with 2 mg ml1 trypan blue for 10 min, and then washed with PBS three times. After treating with 0.2% Triton X-100 for 10 min, 4, 6-Diamidino-2-phenylindole (DAPI) was added to 0.5 mg ml1 for additional 1 min incubation. Subsequently, the mixtures were removed, and the slices were washed with PBS for five times. The treated cells were observed under fluorescent microscope (Olympus). Hemocytes (at least 200/slice) were counted at 400 magnification. 3. Results 3.1. T7 phage display library of M. japonicus A T7 phage display library was constructed from M. japonicus. The cDNA library initial titer was 1.4 106 pfu (plaque forming units) and the titer of the amplified library was 5.4 108 pfu ml1. The average length of the inserted cDNA fragments is 1.0 kbp, ranging from 0.5 to 3 kbp by PCR amplification. 3.2. Molecular characteristics and phylogenetic analysis of three novel MjLecs The sequences of three novel lectins (MjLecA, MjLecB, and MjLecC) were obtained by screening a phage display library of M. japonicus with WSSV envelope proteins (VP26, VP28, and VP281) (Table 2). Multiple sequence alignment indicated that the three MjLecs shared little similarity with each other (Fig. 1). There was one CRD in each deduced amino acid sequence. Four conserved disulphide-bonded cysteine residues existed in the CRD of MjLecA and MjLecB (indicated with asterisk in Fig. 1). However, only three of these cysteine residues existed in MjLecC. In addition, only one conserved Ca2þ-binding site was found in these MjLecs (Fig. 1). Analysis of glycosylation sites using the webpage server (http://hits. isb-sib.ch/cgi-bin/PFSCAN) showed that only MjLecA possessed one N-linked glycosylation site. Phylogenetic analysis of the three MjLecs and other eleven lectins from vertebrates and invertebrates classified these lectins into two big clusters: lectins with dual CRDs from prawn (Fenneropenaeus merguiensis and Penaeus semisulcatus) and shrimp (F. chinensis, L. vannamei, and F. chinensis) and lectins with single CRD including MjLecA, MjLecB, LvLT, and PMAV formed one large cluster, while lectins with single CRD domain such as MjLecC and lectins from sea squirt (Ciona intestinalis), clam (Venerupis philippinarum), and fish (Branchiostoma belcheri, Salmo salar, Anguilla japonica, and Perca flavescens) formed another group (Fig. 2). The different cluster distributions of the identified MjLecs suggested that MjLecA shared a much closer evolutionary relationship with MjLecB than MjLecC. 3.3. Tissue-specific expression of MjLecA, MjLecB, and MjLecC To determine the distributions of these three MjLecs, RT-PCR was further carried out on different tissues including heart, muscle, hemocyte, hepatopancreas, gill, and gastrointestine. As Fig. 3
Table 2 Candidate C-type lectins screening from the cDNA library of M. japonicus using the structural proteins of WSSV virus. Baits
Lectin
Homology
Vp26
MjLecA
PMAV (33%)
VP28
MjLecA MjLecC
PMAV (33%) C-type lectin
VP281
MjLecB
PMAV (46%)
K.-K. Song et al. / Fish & Shellfish Immunology 28 (2010) 596e603
599
Fig. 1. Multiple amino acid sequence alignments of the CRD of MjLecs with other C-type lectins. The GenBank accession numbers of these lectins are from NCBI: MjLecA of M. japonicus, GQ354220; MjLecB of M. japonicus, GQ354214; MjLecC of M. japonicus, GQ354211; AjLT1 of Anguilla japonica, BAC54022; LvLT CRD1 and CRD2 of L. vannamei, ABI97374; PmLT CRD1 and CRD2 of P. monodon, ABI97373; PsLT CRD1 and CRD2 of Penaeus semisulcatus, ABI97372; FmLT CRD1 and CRD2 of Fenneropenaeus merguiensis, ACR56805; FcLT5 CRD1 and CRD2 of F. chinensis, ACJ06428; PMAV of P. monodon, AAQ75589; PfLT13 of P. flavescens, ACO82046; PfLT5 of P. flavescens, ACO82038; CiMBL of Ciona intestinalis, NP_001161179; SsLT2 of Salmo salar, NP_001117194; CfLTD1-CRD1 of Chlamys farreri, ABB71675. Conserved cysteine residues that exist in the CRD are indicated with asterisk, while conserved Ca2þ-binding site is marked with ;. Gaps inserted during alignment are indicated by dashes.
showed, the signals of all these MjLecs were strongly detected in hepatopancreas. In hemocytes, MjLecA and MjLecB had median expression levels, while little MjLecC was detected. Meanwhile, all these MjLecs were marginally detectable in muscle and gastrointestine, while no signal was detected in heart and gill. 3.4. Preparation of recombinant MjLecA, MjLecB, and MjLecC Recombinant mature MjLecs, MjLecB, and MjLecC (without a signal peptide) were expressed as inclusion bodies and were
purified under denaturing condition, then renatured by dialysis. The renatured MjLecA, MjLecB, and MjLecC were mainly resolved as single bands in SDS-PAGE gels, and had molecular weights (MWs) of 19 kDa, 20 kDa, and 17 kDa, respectively (Fig. 4, lane 1, 2, and 3). These MWs are a little larger than their theoretical MWs, which are 16.7 kDa, 16.8 kDa, and 16.0 kDa, respectively. It might result from the His-tag at the N-terminus of each protein. Except for these bands, another band with an MW of 21 kDa was also detected in MjLecA (Fig. 4, lane 1). This might be some modified isoform of MjLecA.
600
K.-K. Song et al. / Fish & Shellfish Immunology 28 (2010) 596e603 72 55 96 98 77
FmLT-CRD2 FcLT5-CRD2 PmLT-CRD2 PsLT-CRD2 LvLT-CRD2
72 74 100 86 76
LvLT LvLT-CRD1 PsLT-CRD1 FmLT-CRD1 PmLT-CRD1 FcLT5-CRD1
MjLecA MjLecB
30
PMAV
88
MjLecC CiMBL VpLT BbLT2
48 13 34 86
AjLT1 SsLT2
54 97 83
PfLT13 PfLT5
0.1
Fig. 2. Phylogenetic analysis of the CRD sequences of C-type lectins. The phylogenetic tree was constructed by the neighbour-joining method, based on the amino acid alignment (Clustal W) of individual CRD sequences from selected lectins. The GenBank accession numbers of these lectins are from NCBI: FmLT CRD1 and CRD2 of F. merguiensis, ACR56805; FcLT5 CRD1 and CRD2 of F. chinensis, ACJ06428; PmLT CRD1 and CRD2 of P. monodon, ABI97373; PsLT CRD1 and CRD2 of P. semisulcatus, ABI97372; LvLT CRD1 and CRD2 of L. vannamei, ABI97374; LvLT of L. vannamei, ABU62825; PMAV of P. monodon, AAQ75589; CiMBL of C. intestinalis, NP_001161179; VpLT of V. philippinarum, ACU83213; BbLT2 of B. belcheri, ABY54815; AjLT1 of A. japonica, BAC54022; SsLT2 of S. salar, NP_001117194; PfLT5 of P. flavescens, ACO82038; PfLT13 of P. flavescens, ACO82046. The MjLecs from M. japonicus are underlined.
3.5. Agglutinating activity of recombinant MjLecA, MjLecB, and MjLecC To define the agglutinating activity of the identified MjLecs toward mammalian erythrocytes and microorganisms, agglutination assay was further performed on different erythrocytes (including rabbit, mouse, human A, B and O-type erythrocytes) and microorganisms including typical microorganisms (E. coli, B. subtilis, S. aureus, and P. pastoris) and some common pathogens of aquaculture (A. hydrophilic, V. alginolyticus, V. parahaemolyticus, and M. lysodeikticus). The agglutinating activity was revealed using the minimal agglutinating concentrations of each MjLecs, and was summarized in Tables 3 and 4. All recombinant MjLecs could agglutinate rabbit and mouse erythrocytes, but exhibited quite diverse agglutinating activities for different human erythrocytes (Table 3). For example, MjLecA and MjLecC could agglutinate human A, B-type erythrocytes,
Fig. 4. SDS-PAGE analysis of the purified recombinant MjLecs expressed in E. coli BL21 (DE3). The loading amounts are 0.7, 1.1, and 2.1 mg/lane for MjLecA, MjLecB, and MjLecC, respectively. Lane 1, MjLecA; lane 2, MjLecB; lane 3, MjLecC.
while MjLecB couldn't agglutinate any human erythrocytes. And in whole, these MjLecs showed a tendency in agglutinating activity toward different kinds of erythrocytes following as: rabbit > mouse > human B > human A > human O-type erythrocytes. In terms of microorganisms, all the three MjLecs exhibited no agglutinating activities toward A. hydrophilic, B. subtilis, and P. pastoris (Table 4), but could agglutinate some other bacteria and showed obvious diversities. Furthermore, when the Ca2þ was included in the assay systems, some of agglutinating activities could be promoted obviously. But the agglutination happened in cases of rabbit erythrocytes or S. aureus without Ca2þ suggested
Table 3 Hemagglutinating activities of MjLecs on mammalian erythrocytes. Erythrocytes
MjLecs Minimum hemagglutinating concentration (mg/ml)
Rabbit (Caþ) Rabbit (Ca) Mouse (Caþ) Mouse (Ca) Human group Human group Human group Human group Human group Human group Fig. 3. Tissue distribution of MjLecA, MjLecB, and MjLecC transcript revealed by RT-PCR. b-actin was amplified as an internal control.
A (Caþ) A (Ca) B (Caþ) B (Ca) O (Caþ) O (Ca)
MjLecA
MjLecB
MjLecC
2.1 4.2 17.5 17.5 70 NA 35 70 NA NA
3.5 14 7 7 NA NA NA NA NA NA
2.19 4.375 17.5 NA 8.75 NA 8.75 35 NA NA
The hemagglutinating activity was demonstrated using the minimal hemagglutinating concentration. NA e No agglutination within the concentration tested; (Caþ) with 10 mM Ca2þ; (Ca) without Ca2þ.
K.-K. Song et al. / Fish & Shellfish Immunology 28 (2010) 596e603 Table 4 Agglutinating activities of MjLecs on various microorganisms. Microorganisms
MjLecs Minimal agglutinating concentration (mg/ml)
G
Gþ
MjLecA
MjLecB
MjLecC
NA ()
Aeromomas hydrophilic Vibrio alginolyticus
8.8(þ) 8.8 () NA () NA ()
Vibrio parahaemolyticus
NA ()
0.75 (þ) 0.75 () NA () 2.19 (þ) NA () 4.38 (þ) 17.5 ()
Bacillus subtilis Micrococcus lysodeikticus
NA () 17.5 (þ) 17.5 () 4.38 (þ) 17.5 ()
1.75 (þ) 14 ()
NA () 35 (þ) 35 () 35 (þ) 35 ()
NA ()
NA ()
NA ()
Escherichia coli
Staphylococcus aureus Yeast
Pichia pastoris
NA () 1.75 (þ) NA () 28 (þ) NA () NA () NA ()
The agglutinating activity was demonstrated using the minimal agglutinating concentration. (G) Gram-negative bacteria, (Gþ) Gram-positive bacteria; NA e no agglutination within the concentration tested; (þ) with 10 mM Ca2þ, () without Ca2þ.
that MjLecs exerted agglutinating activity in a calcium independent manner.
601
WSSV as bait proteins (Table 2). To further confirm the interactions between these MjLecs and WSSV proteins, Far-Western was performed. As Fig. 5 revealed, VP19, VP24, V26, VP28, and several other WSSV envelope protein bands were detected in SDS-PAGE gel (lane 1). MjLecC could bind to three of these bands (VP28 and another two bands with MWs of about 90 kDa and 100 kDa, respectively; Fig. 5, lane 4). MjLecA exhibited similar capacity but also could bind to VP26. MjLecB could interact with VP28, the band with an MW of about 72 kDa, and another band with an MW of about 90 kDa. The results suggested that MjLecA, MjLecB, and MjLecC might bind to different structural proteins of WSSV particles, which might be related to their diverse effects for WSSV virus. 3.8. Infection-blocking assays in vitro To explore the roles of recombinant MjLecs in mediating the infection of WSSV, infection-blocking assay was carried out on hemocytes of M. japonicus in vitro. The results observed by fluorescence spectroscopy showed that MjLecA and MjLecB could inhibit the infection of WSSV in vitro (Fig. 6(I)). When defining the infection rate of WSSV treated with 5 mg/ml BSA as 100%, the infection rates of WSSV in the presence of 5 mg ml1 MjLecA or MjLecB were 47.2% and 73.0% (Fig. 6(II)), respectively. However, MjLecC exhibited little blocking activity. 4. Discussion
3.6. Carbohydrate binding specificities of MjLecA, MjLecB, and MjLecC The recognizing specificities of recombinant MjLecA, MjLecB, and MjLecC for different sugars and PAMPs were investigated by performing hemagglutination inhibition assay. The hemagglutinating activity of all the three MjLecs could be completely inhibited by GlcNAc and LPS (Table 5). Other carbohydrates tested couldn't inhibit the hemagglutinating activity of MjLecA. However, the hemagglutinating activity of MjLecB was obviously inhibited by maltose and mannose. The hemagglutinating activity of MjLecC could be inhibited by GalNAc and cellobiose. These results suggested that the three MjLecs exhibited different ligand-binding specificities.
VP26, VP28, and VP281 are the most important envelope proteins of WSSV, and have been proved to be involved in the WSSV infection of shrimp [25]. Further studies indicated that VP28 and VP281 can bind to receptors on the surface of the shrimp cells and thus may help the virus enter the cytoplasm [21,26e28]. We obtained three novel lectins (MjLecA, MjLecB, and MjLecC) by screening the phage display library of M. japonicus with VP26, VP28, and VP281. In accordance with the previous studies, our results presented by Far-Western blot suggested that MjLecA,
3.7. MjLecA, MjLecB, and MjLecC showed diverse WSSV virions binding capacities The sequences of MjLecA, MjLecB, and MjLecC were obtained by screening the cDNA library of shrimp using envelope proteins of Table 5 Inhibitory effects of carbohydrates on the hemagglutinating activity of MjLecs toward the rabbit erythrocytes. Saccharides
1-Maltose 2-D-glucose 3-D-mannose 4-D-fructose 5-sucrose 6-D(þ)-galactose 8-D(þ)-cellobiose 9-L-(þ)-rhamnose 10-D-xylose 11-N-acetyl-D-galactosamine 12-Dextran-10 13 a,a-trehalose 14 N-acetyl-D-glucosamine 15 LPS
MjLecs MjLecA
MjLecB
MjLecC
e e e e e e e e e e e e 12.5 mg/ml 0.125 mg/ml
100 mM e 100 mM e e e e e e e e e 50 mg/ml 0.125 mg/ml
e e e e e e 100 mM e e 100 mM e e 100 mg/ml 0.125 mg/ml
(e) Not obviously inhibit the hemagglutination within the concentration tested.
Fig. 5. Far-Western assays of WSSV proteins that interacted with recombinant MjLecs. Lane 1: the WSSV proteins separated on SDS-PAGE were stained with silver nitrate; Lane 2, 3, and 4: The membrane was probed with recombinant MjLecA, MjLecB, or MjLecC, and detected with mouse polyclonal antibody specific to MjLecA, MjLecB, or MjLecC, respectively. Lane 5: BSA was used as a control.
602
K.-K. Song et al. / Fish & Shellfish Immunology 28 (2010) 596e603
Fig. 6. WSSV infection-blocking assay with MjLecs using FITC-labeled WSSV. Hemocytes were incubated with FITC-labeled WSSV (green) and control (A, BSA; B, FAK, a shrimp protein also expressed with pET-His vector), MjLecA(C), MjLecB (D), or MjLecC (E), at RT for 3 h. Subsequently, cell nuclei were stained with DAPI (blue). Nonadherent virus and DAPI were removed. (I) Cells were observed under fluorescence microscopy. Scale bar ¼ 50 mm. (II) The WSSV infection-blocking activities of MjLecs were calculated and demonstrated with histograms. The blocking activity of BSA was defined as 100%. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
MjLecB, and MjLecC acted as PRRs and interacted with envelope proteins of WSSV particles. To further ascertain the roles of the three MjLecs in WSSV infection, infection-blocking assays with FITC-labled WSSV particles infecting shrimp hemocytes were performed in vitro. The results showed that MjLecA and MjLecB were novel CTLs with direct anti-WSSV activities. Before the present study, two CTLs had been reported to interact with envelope proteins of WSSV [15,16], and one of them was proved to possess the capacity of prolonging the survival of WSSV-infected shrimp [16]. It would be intriguing to investigate the potential roles of the three MjLecs in protecting shrimp from WSSV infection in vivo. The three MjLecs all belonged to group VII C-type lectins, consisting of a single CRD. However, the BLASTP results indicated that they shared little similarity in protein sequence, and might imply diverse functions. This diversity was obviously observed in our
results: First, the three MjLecs could specifically agglutinate different mammalian erythrocytes. And, they could recognize a wide range of microorganisms but to varying extents. Second, the affinities of the three MjLecs for carbohydrates were remarkably different. It could be that the overall structures of the three MjLecs might vary a lot due to the different amino acid sequences, and might result in the different affinities for carbohydrates. Meanwhile, the differences in the orientation and configuration of the substrate glucose moiety contribute to the specificities of the MjLecs for carbohydrates. Third, MjLecA and MjLecB exhibited direct anti-WSSV capacities but with different activities while MjLecC had little impact on the infection of WSSV. This diversity is also suggested by their phylogenetic tree which indicated that MjLecC might originate from a more distant ancestor than MjLecA and MjLecB.
K.-K. Song et al. / Fish & Shellfish Immunology 28 (2010) 596e603
Most CTLs were reported to be calcium dependent. Only several lectins were demonstrated to be calcium independent, eg., PjLec from M. japonicus [17], immulectin family from Manduca sexta [29], and CfLec-2 from C. farreri [30]. Similarly, the three MjLecs all displayed agglutinating activity with or without Ca2þ in some cases, and exhibited calcium independent feature. The relationship between the agglutinating activities of C-type lectins and calcium had been well illustrated in the study on mannose-binding lectin (MBL) [31]. Two conserved calcium binding sites were proved to be involved in calcium binding [30]. However, only two amino acids (Asp and Glu; Fig. 1), which might form the calcium binding site 1 of MjLecs, were conserved. Other amino acids which function in calcium binding were not found. This might contribute to the calcium independent agglutinating activity of MjLecs. The mechanism underlining the calcium independent agglutinating activity needs further investigation. V. parahaemolyticus, V. alginolyticus, and M. lysodeikticus are very common pathogens of aquaculture. MjLecs could interact with carbohydrates in these pathogens, and caused rapid agglutination of these pathogens. The agglutination of bacteria may further cause the sensitization of the host immune system to these bacteria. So, MjLecs may affect the immune response of shrimp and be beneficial for aquaculture to prevent pathogen invasion. In summary, with the number of lectin pools isolated from shrimp rapidly increasing, the understanding of their roles in innate immunity such as pathogen recognition and antivirus activity is more important for preventing aquaculture disease outbreaks. This study presented that three novel C-type lectins recognized WSSV existing in the shrimp M. japonicus, but exhibited obvious diversities in terms of protein sequence, agglutinating activity, virions binding capacity, and antiviral activity. Our experiments demonstrated that the three MjLecs can recognize WSSV, and may act as pattern recognition proteins. However, how the MjLecs affect the WSSV infection still requires further researches. Acknowledgements The work was supported by the Key Program of National 501 Natural Science Foundation of China (30830084), the National Basic Research Program of China (973 Program 2006CB101804). And it was also supported by the earmarked fund for Modern Agroindustry Technology Research System. References [1] Loker ES, Adema CM, Zhang SM, Kepler TB. Invertebrate immune systems-not homogeneous, not simple, not well understood. Immunol Rev 2004;198: 10e24. [2] Sharon N, Lis H. History of lectins: from hemagglutinins to biological recognition molecules. Glycobiology 2004;14(11):53Re62R. [3] Marques MRF, Barracco MA. Lectins, as non-self-recognition factors, in crustaceans. Aquaculture 2000;191:23e44. [4] Sun J, Wang L, Wang B, Guo Z, Liu M, Jiang K, et al. Purification and characterization of a natural lectin from the plasma of the shrimp Fenneropenaeus chinensis. Fish Shellfish Immunol 2008;25(3):290e7. [5] Sun YD, Fu LD, Jia YP, Du XJ, Wang Q, Wang YH, et al. A hepatopancreasspecific C-type lectin from the Chinese shrimp Fenneropenaeus chinensis exhibits antimicrobial activity. Mol Immunol 2008;45(2):348e61.
603
[6] Wang XW, Zhang XW, Xu WT, Zhao XF, Wang JX. A novel C-type lectin (FcLec4) facilitates the clearance of Vibrio anguillarum in vivo in Chinese white shrimp. Dev Comp Immunol 2009;33(9):1039e47. [7] Zhang XW, Xu WT, Wang XW, Mu Y, Zhao XF, Yu XQ, et al. A novel C-type lectin with two CRD domains from Chinese shrimp Fenneropenaeus chinensis functions as a pattern recognition protein. Mol Immunol 2009;46(8e9): 1626e37. [8] Sun J, Wang L, Wang B, Guo Z, Liu M, Jiang K, et al. Purification and characterisation of a natural lectin from the serum of the shrimp Litopenaeus vannamei. Fish Shellfish Immunol 2007;23(2):292e9. [9] Zhang Y, Qiu L, Song L, Zhang H, Zhao J, Wang L, et al. Cloning and characterization of a novel C-type lectin gene from shrimp Litopenaeus vannamei. Fish Shellfish Immunol 2009;26(1):183e92. [10] Luo T, Yang H, Li F, Zhang X, Xu X. Purification, characterization and cDNA cloning of a novel lipopolysaccharide-binding lectin from the shrimp Penaeus monodon. Dev Comp Immunol 2006;30(7):607e17. [11] Ma TH, Benzie JA, He JG, Chan SM. PmLT, a C-type lectin specific to hepatopancreas is involved in the innate defense of the shrimp Penaeus monodon. J Invert Pathol 2008;99(3):332e41. [12] Liu YC, Li FH, Dong B, Wang B, Luan W, Zhang XJ, et al. Molecular cloning, characterization and expression analysis of a putative C-type lectin (Fclectin) gene in Chinese shrimp Fenneropenaeus chinensis. Mol Immunol 2007;44 (4):598e607. [13] Ma TH, Tiu SH, He JG, Chan SM. Molecular cloning of a C-type lectin (LvLT) from the shrimp Litopenaeus vannamei: early gene down-regulation after WSSV infection. Fish Shellfish Immunol 2007;23(2):430e7. [14] Luo T, Zhang X, Shao Z, Xu X. PmAV, a novel gene involved in virus resistance of shrimp Penaeus monodon. FEBS Lett 2003;551(1e3):53e7. [15] Wang XW, Xu WT, Zhang XW, Zhao XF, Yu XQ, Wang JX. A C-type lectin is involved in the innate immune response of Chinese white shrimp. Fish Shellfish Immunol 2009;27(4):556e62. [16] Zhao ZY, Yin ZX, Xu XP, Weng SP, Rao XY, Dai ZX, et al. A novel C-type lectin from the shrimp Litopenaeus vannamei possesses anti-white spot syndrome virus activity. J Virol 2009;83(1):347e56. [17] Yang H, Luo T, Li F, Li S, Xu X. Purification and characterisation of a calciumindependent lectin (MjLec) from the haemolymph of the shrimp Penaeus japonicus. Fish Shellfish Immunol 2007;22(1e2):88e97. [18] Lighner DV, Redman RM. Shrimp diseases and current diagnostic methods. Aquaculture 1998;164(1e4):201e20. [19] Takahashi Y, Itami T, Maeda M, Kondo M. Bacterial and viral diseases of kuruma shrimp (Penaeus japonicus) in Japan. Fish Pathol 1998;33:357e64. [20] Yu XQ, Tracy ME, Ling Erjun, Scholz FR, Trenczek T. A novel C-type immulectin-3 from Manduca sexta is translocated from hemolymph into the cytoplasm of hemocytes. Insect Biochem Mol Biol 2005;35:285e95. [21] Li DF, Zhang MC, Yang HJ, Zhu YB, Xu Xun. b-integrin mediates WSSV infection. Virology 2007;368:122e32. [22] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 2007;24(8):1596e9. [23] Xie XX, Li HY, Xu LM, Yang F. A simple and efficient method for purification of intact white spot syndrome virus (WSSV) viral particles. Virus Res 2005; 108:63e7. [24] Zhang M, Wang H, Li D, Xu X. A novel focal adhesion kinase from Marsupenaeus japonicus and its response to WSSV infection. Dev Comp Immunol 2009;33(4):533e9. [25] Sánchez-Martínez JG, Aguirre-Guzmán G, Mejía-Ruíz H. White spot syndrome virus in cultured shrimp: a review. Aquacult Res 2007;38:1339e54. [26] Tsai JM, Wang HC, Leu JH, Wang AH, Zhuang Y, Walker PJ, et al. Identification of the nucleocapsid, tegument, and envelope proteins of the shrimp white spot syndrome virus virion. J Virol 2006;80:3021e9. [27] van Hulten MCW, Witteveldt J, Snippe M, Vlak JM. White spot syndrome virus envelope protein VP28 is involved in the systemic infection of shrimp. Virology 2001;285:228e33. [28] Yi GH, Wang ZM, Qi YP, Yao LG, Qian J, Hu LB. Vp28 of shrimp white spot syndrome virus is involved in the attachment and penetration into shrimp cells. J Biochem Mol Biol 2004;37:726e34. [29] Yu XQ, Ma YK. Calcium is not required for immulectin-2 binding, but protects the protein from proteinase digestion. Insect Biochem Mol Biol 2006;36: 505e16. [30] Zheng P, Wang H, Zhao J, Song L, Qiu L, Dong C, et al. A lectin (CfLec-2) aggregating Staphylococcus haemolyticus from scallop Chlamys farreri. Fish Shellfish Immunol 2008;24(3):286e93. [31] Weis WI, Drickamer K, Hendrickson WA. Structure of a C-type mannosebinding protein complexed with an oligosaccharide. Nature 1992;360:127e34.