- Email: [email protected]
Mitochondrial ATPase inhibitor factor 1, MjATPIF1, is beneficial for WSSV replication in kuruma shrimp (Marsupenaeus japonicus)
Fish and Shellfish Immunology 98 (2020) 245–254
Contents lists available at ScienceDirect
Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Mitochondrial ATPase inhibitor factor 1, MjATPIF1, is beneficial for WSSV replication in kuruma shrimp (Marsupenaeus japonicus)
T
Li-Jie Huo1, Ming-Chong Yang1, Jin-Xing Wang, Xiu-Zhen Shi∗ Shandong Provincial Key Laboratory of Animal Cells and Developmental Biology, School of Life Sciences, Shandong University, Qingdao, Shandong, 266237, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Shrimp ATPase inhibitor factor 1 WSSV Dorsal NF-κB
ATPase Inhibitory Factor 1 (IF1) is a mitochondrial protein that functions as a physiological inhibitor of F1F0ATP synthase. In the present study, a mitochondrial ATPase inhibitor factor 1 (MjATPIF1) was identified from kuruma shrimp (Marsupenaeus japonicus), which was demonstrated to participate in the viral immune reaction of white spot syndrome virus (WSSV). MjATPIF1 contained a mitochondrial ATPase inhibitor (IATP) domain, and was widely distributed in hemocytes, heart, hepatopancreas, gills, stomach, and intestine of shrimp. MjATPIF1 transcription was upregulated in hemocytes and intestines by WSSV. WSSV replication decreased after MjATPIF1 knockdown by RNA interference and increased following recombinant MjATPIF1 protein injection. Further study found that MjATPIF1 promoted the production of superoxide and activated the transcription factor nuclear factor kappa B (NF-κB, Dorsal) to induce the transcription of WSSV RNAs. These results demonstrate that MjATPIF1 benefits WSSV replication in kuruma shrimp by inducing superoxide production and NF-κB activation.
1. Introduction Mitochondria are important for the survival of all eukaryotic organisms and function as the cell's power plant, as most of the cellular energy required for various activities is produced by mitochondria [1]. Cellular energy, mitochondrial adenosine triphosphate (ATP), is synthesized by oxidative phosphorylation (OXPHOS) [1]. During the whole process of OXPHOS, F1F0-ATP synthase is the only protein with ATP synthesis ability, and it is crucial to mitochondria and cells. This ATP synthase produces ATP by exploiting the proton electrochemical gradient generated by the respiratory chain [2]. F1F0-ATP synthase is a protein complex and is divided into two main functional domains, F1 and F0, which are both constituted by multiple subunits [3,4]. When mitochondria are damaged, F1F0-ATP synthase expends ATP to maintain mitochondrial membrane potential [5]. This process can be inhibited by ATPase inhibitory factor 1 (ATPIF1) [6]. ATPIF1 was first purified from beef heart mitochondria and functions as a natural inhibitor of mitochondrial Adenosine Triphosphatase (ATPase) [7]. ATPIF1 is a small and highly conserved mitochondrial protein, and also functions as the physiological inhibitor of F1F0-ATP synthase (F1F0) [2,8]. ATPIF1 inhibits ATP hydrolysis by binding to the F1 domain of F1F0-ATP synthase [9]. ATPIF1 has been studied in yeast [10,11], nematodes [12], shrimp [9], and mammals [13]. Human
ATPIF1 is encoded by the nuclear ATPIF1 gene as a precursor protein. During the process of import into mitochondria, the mature ATPIF1 is produced by cleavage of the N-terminal 25-residue pre-sequence, and this mature protein contains the N-terminal inhibitory domain and a Cterminal dimerization domain [1,2]. Functional studies of ATPIF1 mainly used cell lines. Some studies reported that ATPIF1 could inhibit both the ATP synthase and hydrolase activities of ATP synthase [1]. In certain human cancer cells, the expression of ATPIF1 is upregulated, and ATPIF1 could interact with nuclear factor kappa B (NF-κB) to activate the canonical cellular adaptive responses [14–17]. In certain tumor cells, ATPIF1 functions in energy metabolism as the molecular switch of the metabolic shift that inhibits oxidative phosphorylation and promotes aerobic glycolysis, resulting in mitochondrial hyperpolarization [8,18]. In breast, colon, lung, and ovarian cancer cells, ATPIF1 mediates the activation of a reactive oxygen species (ROS) signals and aerobic glycolysis to promote cell survival and proliferation [18]. Mild amounts of ROS stimulate the activity of the NF-κB pathway [17,18], which activates a downstream anti-apoptotic gene, thus benefiting the survival of cancer cells. In addition, mitochondrial cristae density and ATP synthase dimerization could be regulated by ATPIF1 [19]. In Caenorhabditis elegans, an in vivo study found that one inhibitor protein of F1F0-ATPase, MAI-2 (mitochondrial ATPase inhibitor),
∗
Corresponding author. School of Life Sciences, Shandong University, Qingdao, Shandong, 266237, China. E-mail address: [email protected] (X.-Z. Shi). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.fsi.2020.01.019 Received 20 September 2019; Received in revised form 5 January 2020; Accepted 12 January 2020 Available online 13 January 2020 1050-4648/ © 2020 Elsevier Ltd. All rights reserved.
Fish and Shellfish Immunology 98 (2020) 245–254
L.-J. Huo, et al.
functioned in the conservation of mitochondrial membrane potential and stress-induced germ cell apoptosis [20]. MAI-2 plays a vital role in apoptosis by regulating the mitochondrial membrane potential [20]. ATPIF1 only functions in C. elegans under stress conditions rather than in normal physiological conditions [20]. Two variants of ATPIF1 were already reported in Litopenaeus vannamei, IF1_Lv1 and IF1_Lv2, and the expression of IF1_Lv1 could be affected by hypoxia and re-oxygenation [9]. The shrimp aquaculture industry is economically important in certain countries. However, shrimp are easily infected by white spot syndrome virus (WSSV), which causes great economic losses and has a social impact on the global crustacean aquaculture. To understand the antiviral mechanisms and disease control, the kuruma shrimp (Marsupenaeus japonicus), was used as a model to study innate immunity. There has been no report about ATPIF1 in the antiviral immunity of kuruma shrimp (M. japonicus). Therefore, the present study aimed to determine whether ATPIF1 is involved in the antiviral immunity of shrimp (M. japonicus). We identified and characterized a mitochondrial ATPase inhibitor factor 1 (MjATPIF1). The tissue distribution and time course expression pattern of MjATPIF1 were analyzed at the transcriptional level using quantitative real-time polymerase chain reaction (qPCR). RNA inference and a recombinant protein were used to detect the possible role of MjATPIF1 in vivo. The potential mechanism of MjATPIF1's participation in the viral immune reaction of shrimp was explored.
Table 1 Primers used in this study. Primer
Sequence (5′–3′)
OligoanchorR S-tag T7 Ter β-actin-RTF β-actin-RTR GFPi-F GFPi-R IE1-RTF IE1-RTR VP28-RTF VP28-RTR MjATPIF1-ExF MjATPIF1-ExR MjATPIF1-RNAiF MjATPIF1-RNAiR MjATPIF1-RTF MjATPIF1-RTR MjDorsal-RNAiF MjDorsal-RNAiR MjDorsal-RTF MjDorsal-RTR
gaccacgcgtatcgatgtcgact16 (a/c/g) cgaacgccagcacatggaca tgctagttattgctcagcgg cagccttccttcctgggtatgg gagggagcgagggcagtgatt gcgtaatacgactcactataggtggtcccaattctcgtggaac gcgtaatacgactcactataggcttgaagttgaccttgatgcc gactctacaaatctctttgcca ctacctttgcaccaattgctag agctccaacacctcctccttca ttactcggtctcagtgccaga tacgaattcatggctctgcggcagacagct tacctcgagttacttcagctcctgtagacg gcgtaatacgactcactataggagcatgggaaagggtgag gcgtaatacgactcactataggttgatagcctctttgtggg aaagggtgagccaggtgc ttgatagcctctttgtggg gcgtaatacgactcactataggccatagagctagata gcgtaatacgactcactataggtcagtacccaagtgt gcaatgctggtaacctggcta ctatgggattttggtcaatacac
reverse transcription to produce first-strand cDNAs, which were diluted 20-fold and used as the templates for the tissue distribution analysis. For the viral challenge, each shrimp was injected with 50 μl of WSSV (2 × 105 copies) [21,22]. For the control group, shrimp were injected with 50 μl PBS (phosphate-buffered saline; 10 mM Na2HPO4, 2.7 mM KCl, 2 mM KH2PO4, 137 mM NaCl, pH 7.4). At 6, 12, 24, 36, and 48 h post infection, hemocytes and intestines were collected from at least three shrimp to extract total RNAs. Primers MjATPIF1-RTF and MjATPIF1-RTR (Table 1) were designed to analyze the tissue distribution and expression pattern of MjATPIF1 using quantitative real-time PCR (qPCR). The qPCR program was as follows: 95 °C for 10 min; 40 cycles of 15 s at 95 °C, 1 min at 60 °C and 2 s at 76 °C; and a melting curve analysis from 65 °C to 95 °C. β-actin was amplified as the internal control using primers β-actin-RTF and βactin-RTR (Table 1). The qPCR results were analyzed using the 2−ΔΔCT method [23] and GraphPad Prism 5 software (GraphPad Software, Inc., La Jolla, CA, USA).
2. Materials and methods 2.1. Sequence analysis The sequence of MjATPIF1 was obtained from transcriptome sequencing of M. japonicus. The BLASTX program in National Center for Biotechnology Information server (https://blast.ncbi.nlm.nih.gov/ Blast.cgi) was used to study the gene homology. The translate tool in ExPASy (https://web.expasy.org) was used to analyze the translated amino acid sequence of MjATPIF1. The compute pI/Mw tool in ExPASy was used predict the isoelectric point (pI) and molecular weight (Mw) of MjATPIF1. The phylogenetic tree was constructed using the MEGA 5.2 software (https://www.megasoftware.net/home). The functional domains of MjATPIF1 were predicted using simple module architecture research tool (SMART, http://smart.embl-heidelberg.de/). 2.2. Animals
2.4. RNA interference (RNAi)
Kuruma shrimp (each shrimp weighed about 10 g) were purchased from a seafood market in Jinan, or from a shrimp farm in Qingdao, Shandong Province, China, and cultured in laboratory tanks filled with aerated natural seawater. To assure the shrimp healthy status, shrimp with symptoms like slow swimming and reaction time were not used in our experiment. To check whether they were infected by WSSV, the shrimp were randomly selected and their genomic DNA was extracted from muscle using a genomic DNA extraction kit (Toyobo, Osaka, Japan). PCR was performed using the genomic DNA as the template and primers VP28-RTF and VP28-RTR (Table 1), and the results were checked via electrophoresis on a 1% agarose gel. If no bands were amplified, the shrimp was regarded as WSSV-free and was cultured in the laboratory for subsequent experiments. Shrimp were acclimated at room temperature for at least two days before immune challenge and sample collection.
A partial nucleotide fragment of MjATPIF1 (221 bp) was amplified using primers MjATPIF1-RNAiF and MjATPIF1-RNAiR (Table 1), as the template for MjATPIF1 double-stranded RNA (dsRNA) synthesis. The dsRNA was synthesized using T7 RNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA), and extracted using chloroform. After the dsRNA was purified, diethylpyrocarbonate (DEPC)-treated water was added to adjust the concentration to 1 μg/μl. In the RNAi assay, a green fluorescent protein (GFP) dsRNA was used as the control [22], which was synthesized following the same method as the synthesis of MjATPIF1 dsRNA, with the DNA template being amplified using primers GFPi-F and GFPi-R (Table 1). Shrimp were injected with 30 μg of dsMjATPIF1 or dsGFP per shrimp. One day later, another 30 μg dsRNA was injected. At 24 h after the second dsRNA injection, total RNAs were extracted from the hemocytes and intestines of three shrimp in each group to detect the RNAi efficiency. To detect the influence of MjATPIF1 on WSSV replication, 50 μl WSSV (2 × 105 copies) was injected into the remaining dsRNA-treated shrimp. At 48 h after WSSV injection, hemocytes and intestines of three shrimp were collected from at least three shrimp to extract total RNAs, which were reverse transcribed into first strand cDNAs and then subjected to qPCR to check the relative expression of WSSV immediate early gene IE1 and the envelope protein VP28. In the qPCR assay,
2.3. Tissue distribution and expression pattern analysis Total RNA was extracted from different tissues (hemocytes, heart, hepatopancreas, gills, stomach, and intestines) of at least three normal shrimp using RNAiso Plus (Takara, Dalian, China). Then, primer oligoanchorR (Table 1) was mixed with the total RNAs (5 μg) for 246
Fish and Shellfish Immunology 98 (2020) 245–254
L.-J. Huo, et al.
Fig. 1. Sequence analysis of MjATPIF1. (A) The nucleotide and the deduced amino acid sequence of MjATPIF1 (GenBank accession number MN627000). (B) The functional domain of MjATPIF1 is the mitochondrial ATPase inhibitor (IATP) domain. (C) The amino acid sequence alignment of ATPIF1 from humans (Homo sapiens), house mouse (Mus musculus), Pacific white shrimp (Penaeus vannamei), and kuruma shrimp (Marsupenaeus japonicus). The minimum suppression sequence of MjATPIF1 is underlined.
Fig. 2. Phylogenetic tree of ATPIF1 proteins from different species, including kuruma shrimp (Marsupenaeus japonicus), Penaeus vannamei (Pacific white shrimp), Procambarus clarkii (red swamp crayfish), Armadillidium vulgare (common pillbug), Hyalella azteca (amphipod crustacean), Pomacea canaliculata (mollusc), Aplysia californica (California sea hare), Monomorium pharaonis (pharaoh ant), Orussus abietinus, Athalia rosae (coleseed sawfly), Cyphomyrmex costatus, Wasmannia auropunctata (little fire ant), Bombus impatiens (common eastern bumble bee), Pediculus humanus corporis (human body louse), Tribolium castaneum (red flour beetle), Bombyx mori (domestic silkworm), Strongylocentrotus purpuratus (purple sea urchin), and Hydra vulgaris (coelenterata). The protein sequences were collected from GenBank. The neighbor-joining tree was constructed using the MEGA 5.2 software, using 1000 bootstraps to check the repeatability. MjATPIF1 was labeled with a solid triangle. The scale bar was 0.05.
2.5. Survival rate assay
primers IE1-RTF and IE1-RTR (Table 1) were used to analyze the expression of IE1, and primers VP28-RTF and VP28-RTR (Table 1) were used to analyze the expression of VP28. At the same time, the expression of MjDorsal was also analyzed using qPCR, with primers MjDorsal-RTF and MjDorsal-RTR (Table 1).
For the survival rate assay, the shrimp were divided into two groups, the dsGFP-injected shrimp and the dsMjATPIF1-injected shrimp. Each group contained at least 30 shrimp. At 24 h after the second dsRNA injection, WSSV (2 × 105 copies) were injected into the shrimp. 247
Fish and Shellfish Immunology 98 (2020) 245–254
L.-J. Huo, et al.
Fig. 3. MjATPIF1 was upregulated in shrimp after challenge by WSSV. (A) The tissue distribution of MjATPIF1 was examined using qPCR in different tissues of normal shrimp, including hemocytes, heart, hepatopancreas, gills, stomach, and intestine. (B–C) Expression patterns of MjATPIF1 in hemocytes (B) and intestine (C) of WSSV-challenged shrimp at different time points, as detected using qPCR analysis. Each column represents the mean of three replicates ± SEM. Figures were constructed using GraphPad Prism 5 software. Significance was compared between the PBS group and the WSSV-infected group at the same time point using Student's t-test (*p < 0.05, **p < 0.01). Fig. 4. WSSV replication increased in MjATPIF1-knockdown shrimp infected by WSSV. (A) and (B) The RNAi efficiency of MjATPIF1 in hemocytes and intestines. (C–F) The expression of WSSV IE1 (C and D) and VP28 (E and F) in hemocytes and intestine of MjATPIF1-knockdown shrimp after WSSV challenge. The relative expression levels were detected using qPCR. Each column represents the mean of three replicates ± SEM. The data were analyzed using GraphPad Prism 5 software, and the significant differences between dsMjATPIF1 group and dsGFP group were analyzed using Student's t-test and determined by *p < 0.05, **p < 0.01. (G) The survival rate of MjATP1F1 knockdown shrimp infected with WSSV. WSSV was injected into shrimp at 24 h after the second dsRNA injection. The number of surviving shrimp was recorded every 12 h. The dsGFP injection was used as the control. The survival rate was calculated and analyzed using GraphPad Prism 5 software, and the survival curve was constructed using the Kaplan–Meier method. The statistical analysis was performed using the GehanBreslow-Wilcoxon Test (**p < 0.01).
with restriction enzymes EcoR I and Xho I (both Thermo Fisher Scientific), the fragment was ligated into vector pET32a(+), which was transformed into the Escherichia coli DH5α competent cells. Colony PCR was carried out using the vector primers S-tag and T7 Ter (both Table 1) to screen the positive bacteria. The recombinant plasmid MjATPIF1pET32a(+) was extracted and verified by sequencing at the Beijing Genomics Institute (BGI, Beijing, China). The recombinant MjATPIF1pET32a(+)-Rosetta cells were shaken for about 3 h until the optical density (OD) reached about 0.8, and then 0.5 mM isopropyl-β-D-thiogalactopyranoside (IPTG) was added and incubation continued at 37 °C for 4 h to induce the expression of the recombinant MjATPIF1 protein (rMjATPIF1). rMjATPIF1 was observed to be expressed in inclusion
After WSSV injection, the number of surviving shrimp was recorded every 12 h, and the dead shrimp were removed from the tank. The shrimp that died within 3 h after WSSV injection were not included in the calculation because they were assumed to have died from causes other than WSSV infection. The survival rate was calculated as the ratio of live shrimp number to the total number of shrimp at each time points, and analyzed using GraphPad Prism 5 software. 2.6. Recombinant protein expression and purification Primers MjATPIF1-ExF and MjATPIF1-ExR (Table 1) were designed to amplify the full length coding sequence of MjATPIF1. After digestion 248
Fish and Shellfish Immunology 98 (2020) 245–254
L.-J. Huo, et al.
Fig. 5. WSSV replication declined significantly in the rMjATPIF1-injected shrimp challenged by WSSV. (A) Recombinant expression and purification of rMjATPIF1. Lane 1, total protein of recombinant E. coli Rosetta without IPTG induction; lane 2, total protein of recombinant E. coli Rosetta with IPTG induction; lane 3, the purified recombinant protein rMjATPIF1; lane M, unstained protein molecular weight marker. (B) Western blotting analysis of rMjATPIF1. Lane Marker, the prestained protein molecular weight marker; lane rMjATPIF1, rMjATPIF1 detected using a His-tag antibody. (C) Immunocytochemistry of shrimp hemocytes using the His-tag antibody to detect the entrance of rMjATPIF1 into hemocytes. The green fluorescence signal indicates the distribution of rMjATPIF1 in hemocytes, and the blue signal shows the hemocyte nucleus stained by DAPI. BSA was used as the negative control. (D–G) The relative expression of WSSV IE1 (D and E) and VP28 (F and G) in hemocytes and intestines of MjATPIF1 knockdown shrimp after WSSV infection. The expression levels of WSSV IE1 and VP28 were analyzed using qPCR. Each column represents the mean of three replicates ± SEM. Significant differences were analyzed using Student's t-test and accepted with *p < 0.05, **p < 0.01, and ***p < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Trx) was expressed in the supernatant, and purified by affinity chromatography directly after ultrasonication. Trx was used as the control protein to eliminate the effect of the tag protein in certain experiments. The purified protein was frozen at –20 °C until use.
bodies. After centrifugation and ultrasonication of the bacteria, the precipitate including the inclusion bodies was collected and washed with Buffer A (50 mM Tris-HCl, 5 mM EDTA, pH 8.0) twice and with Buffer B (2 M urea, 50 mM Tris-HCl, 5 mM EDTA, pH 8.0) twice. The precipitate was dissolved in 10 ml of Denaturing Buffer (8 M urea, 0.1 M Tris-HCl, 10 mM DL-Dithiothreitol, pH 8.0). Then, Ni-nitrilotriacetic acid (NTA) agarose resin (GE Healthcare, Little Chalfont, UK) was used to purify rMjATPIF1 protein. The eluted protein was collected and dialyzed against TBS buffer (150 mM NaCl, 50 mM Tris-HCl, pH 8.0). The purified protein was checked using electrophoresis using 12.5% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDSPAGE), and stored at –20 °C until use. Western blotting analysis was used to check whether rMjATPIF1 could be detected by the anti-His tag antibody. Mouse anti-His monoclonal antibody (ZSGB-Bio, Beijing, China) was used as the primary antibody and horseradish peroxidase (HRP)-conjugated goat anti-Mouse IgG(H + L) (ZSGB-Bio) was used as the secondary antibody. 4-chloro-1-naphthol (4-CN) and H2O2 were used to detect the immunoreactive protein bands. Empty pET32a (+) vector was transformed into E. coli Rosetta competent cells and induced by IPTG. The his-tagged peptide (named
2.7. rMjATPIF1 protein injection assay The purified rMjATPIF1 protein (10 μg) was mixed with 50 μl WSSV (2 × 105 copies) at 4 °C for 1 h. The mixed solution was then injected into shrimp. The control shrimp were injected with Trx and WSSV. One hour later, immunocytochemistry was performed to check whether the injected protein entered the shrimp hemocytes. Hemocytes were collected using a 5 ml syringe preloaded with 500 μl anticoagulant (10 mM EDTA, 450 mM NaCl, 10 mM KCl, 10 mM HEPES, pH 7.5) and 500 μl 4% paraformaldehyde. The obtained hemocytes were deposited onto glass slides for 2 h at room temperature. Hemocytes were then washed with PBS six times (5 min each time). The washed hemocytes were treated with 0.2% Triton X-100 at 37 °C for 5 min. After washing with PBS three times, the hemocytes were blocked with 3% bovine serum albumin (BSA) at 37 °C for 30 min. Mouse anti249
Fish and Shellfish Immunology 98 (2020) 245–254
L.-J. Huo, et al.
instrument (Thermo Fisher Scientific, USA). The blank control was the storage buffer. The amount of mitochondrial superoxide was calculated by the absorbance value of the samples after subtracting the value of the blank control. The amount of mitochondrial superoxide in GFP RNAi shrimp was normalized to 1.0, and the relative amount of MjATPIF1 RNAi shrimp was the ratio of the amount of superoxide in MjATPIF1 RNAi shrimp to the amount in GFP RNAi shrimp. GraphPad Prism 5 software was used to analyze the data and construct the figures. For the recombinant protein injection assay, mitochondria were extracted, and the relative amounts of mitochondrial superoxide were measured as described above. 2.9. MjDorsal nuclear translocation assay To analyze MjDorsal translocation into the nucleus, MjATPIF1 was knocked down or overexpressed (rMjATPIF1 injection), and then WSSV was injected. Three hours later, hemocytes were collected for immunocytochemistry following the method described in section 2.7. The primary antibody was anti-MjDorsal rabbit serum [24], and the secondary antibody was goat anti-rabbit IgG-Alexa Fluor 488. Image J software (http://imagej.net/mbf/installing_imagej.htm) was used to calculate the colocalization rate of Dorsal (green fluorescence) with nuclei stained with 2-(4-amidinophenyl)-1H-indole-6-carboxamidine (DAPI). After the pictures were merged, the blue and the green fluorescence were analyzed using ImageJ, with ‘Split channels in ImageColor’ selected. The red channels were closed, and only the green and blue channels were left for the subsequent analysis. After the colocalization analysis and the colocalization threshold, the Rcoloc value could be obtained, which represented the colocalization rate of Dorsal in nucleus [24]. To detect whether superoxide improved the NF-κB activity, the antioxidant N-Acetyl-L-cysteine (NAC) was injected to reduce the superoxide in shrimp, and then the localization of MjDorsal in the nucleus was checked. Shrimp were then injected with WSSV. After 24 h, 20 μg NAC was injected into shrimp. The control shrimp were injected with PBS. After 3 h, hemocytes were collected for immunocytochemistry. The nuclear translocation of MjDorsal was analyzed as stated above.
Fig. 6. Mitochondrial superoxide detection in MjATPIF1-knockdown and rMjATPIF1-injected shrimp challenged by WSSV. (A) The relative amount of mitochondrial superoxide in dsMjATPIF1-injected shrimp and dsGFP-injected shrimp after WSSV challenge. (B) The relative amount of mitochondrial superoxide in rMjATPIF1 with WSSV-injected shrimp and Trx with WSSV-injected shrimp. The relative level of superoxide was measured at OD450 and OD620. The results were analyzed using GraphPad Prism 5 software. The statistical analyses were carried out by Student's t-test with **p < 0.01.
His monoclonal antibody (1:500 in 3% BSA) was added and incubated at 4 °C overnight. After washing six times with PBS, the hemocytes were incubated with fluorescein isothiocyanate (FITC)-goat anti-mouse IgG in the dark (1:1000 in 3% BSA) at 37 °C for 2 h. After sufficient washing, the hemocytes were treated with 4′,6-diamidino-2-phenylindole (DAPI, 1:1000 in PBS) in the dark at room temperature for 10 min. An Olympus BX51 fluorescence microscope (Tokyo, Japan) was used to observe the fluorescence and capture images. At 24 h and 48 h after protein injection, total RNAs were extracted from the hemocytes and intestines of three shrimp to analyze the relative expression levels of IE1, VP28, and MjDorsal following the methods detailed in section 2.4.
2.10. The expression analysis of MjATPIF1 after MjDorsal knockdown MjDorsal RNAi assay was performed according the method shown in section 2.4. The MjDorsal dsRNA was synthesized from the DNA fragment template (512 bp) amplified using primers MjDorsal-RNAiF and MjDorsal-RNAiR (Table 1). After RNAi, the RNAi efficiency was checked using qPCR using primers MjDorsal-RTF and MjDorsal-RTR (Table 1). WSSV (2 × 105 copies) was injected into the remaining shrimp. At 12 h after WSSV injection, total RNAs were extracted from the hemocytes and intestines of the MjDorsal dsRNA-injected shrimp and the GFP dsRNA-injected shrimp. The RNAs were reverse transcribed into first strand cDNAs, diluted 20-fold, and used as templates for qPCR to check the expression of MjATPIF1. GraphPad Prism 5 software was used for the statistical analyses.
2.8. Mitochondrial superoxide detection analysis After knockdown of MjATPIF1 in shrimp, hemocytes were collected from at least three shrimp, and washed with PBS. Mitochondria were extracted from the hemocytes using a mitochondria extraction kit (Solarbio, Beijing, China) following the manufacturers’ instructions. Briefly, the hemocytes were lysed using 1 ml of pre-cooled lysis buffer on ice. The lysed hemocytes were centrifuged at 1000 × g at 4 °C for 5 min twice to collect the supernatant, which was centrifuged again at 4 °C and 12000 × g for 10 min to obtain the pellet. The pellet was washed with wash buffer by centrifugation at 1000 × g and 4 °C for 5 min to collect the supernatant, which was then centrifuged at 12000 × g and 4 °C for 10 min to obtain the mitochondria. The extracted mitochondria were mixed with storage buffer and their concentration was estimated using a differential spectrophotometer at A280. The concentrations of mitochondria in the MjATPIF1 RNAi group and the GFP RNAi group were set to consistency. The mitochondria superoxide concentration (amount) was analyzed using a superoxide detection kit (Beyotime, Shanghai, China). The obtained mitochondria (10 μl) in storage buffer were added into 212 μl of superoxide detection working buffer (200 μl superoxide detection buffer, 10 μl WST-1, 2 μl catalase) and incubated at 37 °C for 3 min in the dark. OD450 and OD620 were measured using a Multiskan FC
3. Results 3.1. Sequence analysis of MjATPIF1 The open reading frame of MjATPIF1 is 315 bp, encoding a putative protein of 104 amino acids (Fig. 1A). The predicted molecular mass of MjATPIF1 is 11.5 kDa and the predicted isoelectric point (pI) is 9.81. MjATPIF1 contains a mitochondrial ATPase inhibitor (IATP) domain (Fig. 1B), and a minimum suppression sequence (Fig. 1C). Amino acid sequence alignment of ATPIF1s from different species (M. japonicus, P. vannamei, Homo sapiens, and Mus musculus) showed that ATPIF1 is conserved from shrimp to mammals, especially in the minimum 250
Fish and Shellfish Immunology 98 (2020) 245–254
L.-J. Huo, et al.
Fig. 7. MjATPIF1 promoted MjDorsal translocation into the nucleus in shrimp challenged by WSSV. (A) MjDorsal translocation was detected after MjATPIF1 RNAi. (a) Statistic analysis of MjDorsal colocation with the nucleus after MjATPIF1 RNAi. (B) MjDorsal translocation detection after rMjATPIF1 protein injection. (b) Statistical analysis of MjDorsal translocation rate after rMjATPIF1 protein injection. (C) At 24 h after WSSV and NAC injection, MjDorsal translocation was detected. The control shrimp were injected with PBS. (c) Statistical analysis of the MjDorsal translocation rate after injection of NAC and WSSV. Each column represents the mean of three replicates ± SEM. The statistical analyses were performed using Student's t-test with *p < 0.05 and **p < 0.01.
3.2. MjATPIF1 was widely distributed in shrimp tissues and was upregulated by WSSV challenge
suppression sequence (Fig. 1C). A high level of identity (90.4%) was observed between MjATPIF1 and ATPIF1 from P. vannamei (Fig. 1C). The evolutionary relationship analysis of ATPIF1 showed that ATPIF1 proteins could be divided into two groups, MjATPIF1 was clustered with ATPIF1s from crustaceans, including P. vannamei (Pacific white shrimp), Procambarus clarkii (red swamp crayfish), Armadillidium vulgare (common pillbug), and Hyalella azteca (amphipod crustacean), and mollusks, including Pomacea canaliculata (mollusc) and Aplysia californica (California sea hare) (Fig. 2).
The results of the tissue distribution analysis showed that the transcript of MjATPIF1 was expressed in all tested tissues (hemocytes, heart, hepatopancreas, gills, stomach, and intestines), with high expression levels in heart, hepatopancreas, and intestines (Fig. 3A). Hemocytes and intestines are two important immune organs in shrimp, and are chosen for the gene expression analysis in shrimp post WSSV infection in the previous study [25,26]. It has been reported that
251
Fish and Shellfish Immunology 98 (2020) 245–254
L.-J. Huo, et al.
Fig. 9. Expression analysis of MjATPIF1 after MjDorsal RNAi. (A) and (B) The knockdown efficiency of MjDorsal in hemocytes (A) and intestines (B), as determined using qPCR. (C) and (D) The relative expression levels of MjATPIF1 were checked using qPCR after the MjDorsal RNAi in hemocytes (C) and intestines (D). Each column represents the mean of three replicates ± SEM. Significant differences were analyzed using Student's t-test with *p < 0.05. Fig. 8. MjDorsal expression analysis after MjATPIF1 RNAi and rMjATPIF1 protein injection. (A) and (B) Expression of MjDorsal in hemocytes and intestines after MjATPIF1 knockdown. (C) and (D) Expression of MjDorsal in hemocytes and intestine after rMjATPIF1 protein injection. The relative expression levels of MjDorsal were assessed using qPCR. Each column represents the mean of three replicates ± SEM. Significant differences were analyzed using Student's t-test with *p < 0.05 and **p < 0.01.
3.3. MjATPIF1 was beneficial for WSSV replication To investigate the possible function of MjATPIF1 in WSSV challenge, MjATPIF1 was knocked down using RNAi in hemocytes and intestines, which was particularly effective at 24 h after the second dsRNA injection (Fig. 4A and 4B). Then, the MjATP1F1 knockdown shrimp were infected with WSSV, and the expression levels of WSSV IE1 and VP28 (as indicators of WSSV replication) were detected in hemocytes and intestines. The results showed that the expression levels of IE1 and VP28 were both reduced in the hemocytes and intestines of MjATPIF1 knockdown shrimp compared with those in the control shrimp (Fig. 4C–F). The survival assay showed that the survival rate of MjATPIF1 knockdown shrimp was significantly higher than that of dsGFP-injected shrimp after WSSV infection (Fig. 4G). Fig. 5A showed that MjATPIF1 could be recombinantly expressed and purified, while Fig. 5B demonstrated that the purified rMjATPIF1 protein could be recognized by the anti-His tag antibody. The molecular mass of rMjATPIF1 was around 32 kDa (Fig.5A and 5B), which was similar to 31.3 kDa, the predicted molecular mass of rMjATPIF1. We detected the injected recombinant protein in hemocytes (Fig. 5C), which suggested that injection of the recombinant protein could be
WSSV infects hemocytes, and hemocytes carrying virions are distributed quickly in shrimp body to infect the target tissues including intestine [27,28]. Therefore, these two organs were selected for the time course pattern analysis and various gene expression assay. The results showed that in hemocytes, MjATPIF1 levels were upregulated by WSSV at 6, 24, and 36 h post-infection (Fig. 3B). While in the intestines, MjATPIF1 was upregulated by WSSV at 12 and 24 h (Fig. 3C). MjATPIF1 expression was downregulated in hemocytes at 12 h and in intestines at 6 h and 36 h. The downregulation of MjATPIF1 in these time points might be because of degradation of the mRNA after its fast translation into protein. The upregulation of MjATPIF1 after WSSV challenge indicated that MjATPIF1 might be involved in the immune response to WSSV infection. 252
Fish and Shellfish Immunology 98 (2020) 245–254
L.-J. Huo, et al.
smORF according to the statement of Chu et al. [32]. In recent years, smORFs have received increased research attention, with increasing numbers of studies concerning the prediction and functional analysis of smORFs [31,33]. Studies show that smORFs have a wide range of functions as positive or negative regulators in fundamental cytoplasmic processes, including metabolism, apoptosis, mitochondrial respiration, and development [32–34]. Our study of MjATPIF1 could add some novel function annotations for the smORFs family. In M. japonicus, MjATPIF1 was widely distributed in the tested tissues (Fig. 3A). A similar result was found for ATPIF1 in Litopenaeus vannamei. The two variants of Lv-IF1 were ubiquitously expressed in all the tested shrimp tissues, including eye stalk, gills, midgut gland, muscle, and pleopods [9]. The mRNA expression of MjATPIF1 was induced in hemocytes and intestines after WSSV challenge (Fig. 3B and 3C), implying that MjATPIF1 participated in the shrimp viral immune response. In L. vannamei, the mRNA levels of IF1-Lv1 responds to hypoxia and reoxygenation, because IF1-Lv1 is involved in ATP homeostasis via the control of ATP consumption and preservation of the energy [9]. When shrimp are infected with WSSV and the virus replicates, the aerobic glycolysis of the host metabolism is induced to produce the large amount of energy needed for the process of WSSV genome duplication and structural protein synthesis [35]. MjATPIF1 might participate in the energy homeostasis-related WSSV defense reaction of shrimp. RNAi and protein overexpression (recombinant injection) assays both supported the hypothesis that MjATPIF1 favored WSSV replication. In shrimp, MjATPIF1 could regulate the expression and activation of NF-κB (MjDorsal) and likewise, the expression of MjATPIF1 could be regulated by NF-κB (MjDorsal). The NF-κB pathway is exploited by WSSV for its replication. In shrimp (L. vannamei), NF-κB (LvDorsal and LvRelish) could bind to the promoter region of WSV069 (immediate early gene, ie1), suggesting that WSV069 could be activated by both LvDorsal and LvRelish [36–38]. WSSV utilizes the shrimp NF-κB pathway to promote its gene expression and favor its replication [36]. Similarly, WSSV is observed to induce the activation of LvDorsal and LvRelish to promote the expression of the ie1 gene [36–38]. LvDorsal shows a higher promoter binding activity to activate WSV069 (ie1) than LvRelish [38]. Therefore, MjDorsal was chosen for the NF-κB activity analysis in the present study. The activity of NF-κB was analyzed via the colocalization rate of MjDorsal in hemocyte nuclei. The results showed that MjATPIF1 enhanced the MjDorsal activation by translocating more MjDorsal into the nucleus. NF-κB is an evolutionarily conserved transcription factor that plays a vital role in innate immunity and inflammation [39]. In human, an NF-κB binding site exists in the promoter region of IF1, which means that IF1 could be transcribed directly after NF-κB binding. Meanwhile, IF1 participates in NF-κB activation [17]. Thus a positive feedback loop is formed between IF1 and NF-κB in hepatocellular carcinoma in which IF1 functions as a vital regulator in the development and metastasis [17]. ROS consists of hydrogen peroxide and superoxide [40]. Superoxide, as the major ROS, acts as messenger for transcription factor NFκB activation by enhancing H2O2 production [41]. MjATPIF1 facilitated the production of mitochondrial superoxide, which could induce the NF-κB activity of shrimp (Figs. 6–8). After WSSV challenge, MjATPIF1 induced superoxide production and activated MjDorsal, which subsequently promoted the transcription of the WSSV immediate early gene IE1 (Fig. 4C, 4D, 5D, and 5E). IE1 initiated the expression of WSSV early genes and late genes (VP28) (Fig. 4E, 4F, 5F, and 5G). Meanwhile, the high level of MjDorsal upregulated the expression of MjATPIF1 (Fig. 9). Finally, WSSV was assembled in shrimp after production of the viral genome and structural components. In summary, a smORF, MjATPIF1 was identified from kuruma shrimp (M. japonicus). MjATPIF1 could induce the production of ROS to activate the NF-κB signaling pathway. MjATPIF1 and MjDorsal promoted each other's expression. MjATPIF1 promoted WSSV replication in shrimp. This is the first study to report the function of ATPIF1 in
used as a surrogate for protein overexpression. At 48 h after the injection, the relative expression levels of WSSV IE1 and VP28 were detected by qPCR, which showed that their relative expression levels in hemocytes and intestine of rMjATPIF1 and WSSV-injected shrimp increased significantly compared with those in the Trx and WSSV-injected shrimp (Fig. 5D–G). Both the knockdown and protein overexpression results indicated that MjATPIF1 promoted WSSV replication in shrimp. 3.4. MjATPIF1 promoted the production of mitochondria superoxide The mitochondrial superoxide analysis showed a lower level of mitochondrial superoxide in the dsMjATPIF1-injected shrimp than in the dsGFP-injected shrimp post-WSSV infection (Fig. 6A). By contrast, the amount of mitochondrial superoxide in the rMjATPIF1-injected shrimp was much higher than that in the control shrimp (Fig. 6B). The results showed that MjATPIF1 promoted the production of mitochondrial superoxide after WSSV challenge. 3.5. MjATPIF1 triggered the activation of NF-κB by ROS The localization rate of MjDorsal (NF-κB) in the nucleus decreased after knockdown of MjATPIF1 compared with that in the control (Fig. 7A, and 7a). However, the localization rate of MjDorsal in the nucleus increased significantly after rMjATPIF1 protein and WSSV injection, (Fig. 7B and 7b). The results suggested that MjATPIF1 activated NF-κB when shrimp were challenged by WSSV. NAC is a direct antioxidant that neutralizes free radicals and scavenges ROS, and has antioxidant effects on total superoxide levels [29,30]. NAC was injected to decrease the ROS levels of shrimp. The results revealed that the nuclear localization rate of MjDorsal in NACinjected shrimp was lower than that in the control after WSSV challenge (Fig. 7C and 7c). This suggested that the activity of MjDorsal was much lower when ROS were cleared in shrimp, which in turn suggested that MjATPIF1 triggered the activation of NF-κB (MjDorsal) by inducing ROS production. 3.6. The expression of MjATPIF1 and MjDorsal promoted each other The relative expression of MjDorsal decreased significantly in hemocytes and intestines in the dsMjATPIF1-injected shrimp compared with that in the control shrimp (Fig. 8A and 8B). After recombinant protein injection, the expression of MjDorsal increased markedly in hemocytes and intestines of the shrimp compared with that in the control shrimp (Fig. 8C and 8D). This implied that MjATPIF1 participated in the regulation of MjDorsal expression. For the regulation analysis of MjATPIF1 by MjDorsal, Fig. 9A and 9B showed that MjDorsal could be knocked down markedly in the hemocytes and intestines. After RNAi, WSSV was injected into shrimp. The results showed that amount of MjATPIF1 transcript decreased in the hemocytes and intestines of the MjDorsal RNAi shrimp (Fig. 9C and 9D), which demonstrated that MjDorsal could regulate the expression of MjATPIF1. Thus, MjATPIF1 and MjDorsal regulated each other's expression. 4. Discussion In this study, we identified a mitochondrial ATPase inhibitor factor 1 from kuruma shrimp (M. japonicus), and analyzed its function in the viral immune response. The amino acid sequence of MjATPIF1 has 104 residues, and shows high sequence identity with the IF1-Lv1 (104 aa) from L. vannamei. Small Open Reading Frames (smORFs), encoding small proteins (SEP) of fewer than 100 amino acids, exist in all eukaryotic genomes [31]. However, Chu et al. [32] treats SEPs as generally fewer than 150 amino acids in length, because some SEPs of this length have not been annotated yet. Thus, in the present study, MjATPIF1 was considered as a new 253
Fish and Shellfish Immunology 98 (2020) 245–254
L.-J. Huo, et al.
WSSV infection of shrimp.
metastasis, Hepatology 60 (5) (2014) 1659–1673. [18] L. Formentini, M. Sanchez-Arago, L. Sanchez-Cenizo, J.M. Cuezva, The mitochondrial ATPase inhibitory factor 1 triggers a ROS-mediated retrograde prosurvival and proliferative response, Mol. Cell 45 (6) (2012) 731–742. [19] M. Campanella, E. Casswell, S. Chong, Z. Farah, M.R. Wieckowski, A.Y. Abramov, A. Tinker, M.R. Duchen, Regulation of mitochondrial structure and function by the F1Fo-ATPase inhibitor protein, IF1, Cell Metabol. 8 (1) (2008) 13–25. [20] L.P. Fernandez-Cardenas, E. Villanueva-Chimal, L.S. Salinas, C. Jose-Nunez, M. Tuena de Gomez Puyou, R.E. Navarro, Caenorhabditis elegans ATPase inhibitor factor 1 (IF1) MAI-2 preserves the mitochondrial membrane potential (Deltapsim) and is important to induce germ cell apoptosis, PLoS One 12 (8) (2017) e0181984. [21] J. Gao, J.X. Wang, X.W. Wang, MD-2 homologue recognizes the white spot syndrome virus lipid component and induces antiviral molecule expression in shrimp, J. Immunol. 203 (5) (2019) 1131–1141. [22] M.C. Yang, X.Z. Shi, H.T. Yang, J.J. Sun, L. Xu, X.W. Wang, X.F. Zhao, J.X. Wang, Scavenger receptor C mediates phagocytosis of white spot syndrome virus and restricts virus proliferation in shrimp, PLoS Pathog. 12 (12) (2016) e1006127. [23] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method, Methods 25 (4) (2001) 402–408. [24] J.J. Sun, S. Xu, Z.H. He, X.Z. Shi, X.F. Zhao, J.X. Wang, Activation of toll pathway is different between kuruma shrimp and Drosophila, Front. Immunol. 8 (2017) 1151. [25] A.S. Silveira, G.M. Matos, M. Falchetti, F.S. Ribeiro, A. Bressan, E. Bachère, L.M. Perazzolo, R.D. Rosa, An immune-related gene expression atlas of the shrimp digestive system in response to two major pathogens brings insights into the involvement of hemocytes in gut immunity, Dev. Comp. Immunol. 79 (2018) 44–50. [26] G.J. Niu, S. Wang, J.D. Xu, M.C. Yang, J.J. Sun, Z.H. He, X.F. Zhao, J.X. Wang, The polymeric immunoglobulin receptor-like protein from Marsupenaeus japonicus is a receptor for white spot syndrome virus infection, PLoS Pathog. 15 (2) (2019) e1007558. [27] V.A. Di Leonardo, V. Bonnichon, P. Roch, N. Parrinello, J.R. Bonami, Comparative WSSV infection routes in the shrimp genera Marsupenaeus and Palaemon, J. Fish Dis. 28 (9) (2005) 565–569. [28] C.M. Escobedo-Bonilla, V. Alday-Sanz, M. Wille, P. Sorgeloos, M.B. Pensaert, H.J. Nauwynck, A review on the morphology, molecular characterization, morphogenesis and pathogenesis of white spot syndrome virus, J. Fish Dis. 31 (1) (2008) 1–18. [29] I. Elbini Dhouib, M. Jallouli, A. Annabi, N. Gharbi, S. Elfazaa, M.M. Lasram, A minireview on N-acetylcysteine: an old drug with new approaches, Life Sci. 151 (2016) 359–363. [30] J. Martacic, M.K. Filipovic, S. Borozan, Z. Cvetkovic, T. Popovic, A. Arsic, M. Takic, V. Vucic, M. Glibetic, N-acetyl-L-cysteine protects dental tissue stem cells against oxidative stress in vitro, Clin. Oral Investig. 22 (8) (2018) 2897–2903. [31] J.L. Aspden, Y.C. Eyre-Walker, R.J. Phillips, U. Amin, M.A. Mumtaz, M. Brocard, J.P. Couso, Extensive translation of small open reading frames revealed by polyribo-seq, Elife 3 (2014) e03528. [32] Q. Chu, J. Ma, A. Saghatelian, Identification and characterization of sORF-encoded polypeptides, Crit. Rev. Biochem. Mol. Biol. 50 (2) (2015) 134–141. [33] A. Saghatelian, J.P. Couso, Discovery and characterization of smORF-encoded bioactive polypeptides, Nat. Chem. Biol. 11 (12) (2015) 909–916. [34] J.P. Couso, P. Patraquim, Classification and function of small open reading frames, Nat. Rev. Mol. Cell Biol. 18 (9) (2017) 575–589. [35] B. Verbruggen, L.K. Bickley, R. van Aerle, K.S. Bateman, G.D. Stentiford, E.M. Santos, C.R. Tyler, Molecular mechanisms of white spot syndrome virus infection and perspectives on treatments, Viruses 8 (1) (2016) 23. [36] X.D. Huang, L. Zhao, H.Q. Zhang, X.P. Xu, X.T. Jia, Y.H. Chen, P.H. Wang, S.P. Weng, X.Q. Yu, Z.X. Yin, J.G. He, Shrimp NF-kappaB binds to the immediateearly gene ie1 promoter of white spot syndrome virus and upregulates its activity, Virology 406 (2) (2010) 176–180. [37] P.H. Wang, Z.H. Gu, D.H. Wan, M.Y. Zhang, S.P. Weng, X.Q. Yu, J.G. He, The shrimp NF-kappaB pathway is activated by white spot syndrome virus (WSSV) 449 to facilitate the expression of WSSV069 (ie1), WSSV303 and WSSV371, PLoS One 6 (9) (2011) e24773. [38] W. Qiu, S. Zhang, Y.G. Chen, P.H. Wang, X.P. Xu, C.Z. Li, Y.H. Chen, W.Z. Fan, H. Yan, S.P. Weng, S. FrancisChan, J.G. He, Litopenaeus vannamei NF-kappaB is required for WSSV replication, Dev. Comp. Immunol. 45 (1) (2014) 156–162. [39] B. Hoesel, J.A. Schmid, The complexity of NF-kappaB signaling in inflammation and cancer, Mol. Cancer 12 (2013) 86. [40] Y. Chen, M.B. Azad, S.B. Gibson, Superoxide is the major reactive oxygen species regulating autophagy, Cell Death Differ. 16 (7) (2009) 1040–1052. [41] K.N. Schmidt, P. Amstad, P. Cerutti, P.A. Baeuerle, The roles of hydrogen peroxide and superoxide as messengers in the activation of transcription factor NF-kappa B, Chem. Biol. 2 (1) (1995) 13–22.
Acknowledgement This work was supported by grants from the National Key Research and Development Program of China (grant number 2018YFD0900502), the Natural Science Foundation of Shandong Province (Grant No ZR2018BCE050), and the China Postdoctoral Science Foundation (Grant No 2018M630781), and Shandong Provincial Key Laboratory of Animal Cell and Developmental Biology (SPKLACDB-2019015). References [1] P.B. Esparza-Molto, C. Nuevo-Tapioles, J.M. Cuezva, Regulation of the H(+)-ATP synthase by IF1: a role in mitohormesis, Cell. Mol. Life Sci. 74 (12) (2017) 2151–2166. [2] A. Garcia-Aguilar, J.M. Cuezva, A review of the inhibition of the mitochondrial ATP synthase by IF1 in vivo: reprogramming energy metabolism and inducing mitohormesis, Front. Physiol. 9 (2018) 1322. [3] J.R. Gledhill, J.E. Walker, Inhibitors of the catalytic domain of mitochondrial ATP synthase, Biochem Soc 34 (2006) 4. [4] N. Ichikawa, K. Nakabayashi, T. Hashimoto, A yeast mitochondrial ATPase inhibitor interacts with three proteins that are easy to dissociate from the mitochondrial inner membrane, J. Biochem. 132 (2002) 6. [5] C. Bornhovd, F. Vogel, W. Neupert, A.S. Reichert, Mitochondrial membrane potential is dependent on the oligomeric state of F1F0-ATP synthase supracomplexes, J. Biol. Chem. 281 (20) (2006) 13990–13998. [6] Y. Kawai, M. Kaidoh, Y. Yokoyama, T. Ohhashi, Cell surface F1/FO ATP synthase contributes to interstitial flow-mediated development of the acidic microenvironment in tumor tissues, Am. J. Physiol. Cell Physiol. 305 (11) (2013) C1139–C1150. [7] M.E. Pullman, G.C. Monroy, A naturally occurring inhibitor of mitochondrial adenosine Triphosphatase, J. Biol. Chem. 238 (1963) 3762–3769. [8] M. Fujikawa, H. Imamura, J. Nakamura, M. Yoshida, Assessing actual contribution of IF1, inhibitor of mitochondrial FoF1, to ATP homeostasis, cell growth, mitochondrial morphology, and cell viability, J. Biol. Chem. 287 (22) (2012) 18781–18787. [9] C. Chimeo, A.V. Fernandez-Gimenez, M. Campanella, O. Mendez-Romero, A. Muhlia-Almazan, The shrimp mitochondrial FoF1-ATPase inhibitory factor 1 (IF1), J. Bioenerg. Biomembr. 47 (5) (2015) 383–393. [10] H. Matsubara, K. Inoue, T. Hashimoto, Y. Yoshida, K. Tagawa, A stabilizing factor of yeast mitochondrial F1F0-ATPase-inhibitor complex: common amino acid sequence with yeast ATPase inhibitor and E. coli epsilon and bovine delta subunits, J. Biochem. 94 (1) (1983) 315–318. [11] T. Hashimoto, Y. Yoshida, K. Tagawa, Purification and properties of factors in yeast mitochondria stabilizing the F1F0-ATPase-inhibitor complex, J. Biochem. 95 (1) (1984) 131–136. [12] N. Ichikawa, C. Ando, M. Fumino, Caenorhabditis elegans MAI-1 protein, which is similar to mitochondrial ATPase inhibitor (IF1), can inhibit yeast F0F1-ATPase but cannot be transported to yeast mitochondria, J. Bioenerg. Biomembr. 38 (2) (2006) 93–99. [13] A. Genoux, V. Pons, C. Radojkovic, F. Roux-Dalvai, G. Combes, C. Rolland, N. Malet, B. Monsarrat, F. Lopez, J.B. Ruidavets, B. Perret, L.O. Martinez, Mitochondrial inhibitory factor 1 (IF1) is present in human serum and is positively correlated with HDL-cholesterol, PLoS One 6 (9) (2011) e23949. [14] D. Faccenda, J. Nakamura, G. Gorini, G.K. Dhoot, M. Piacentini, M. Yoshida, M. Campanella, Control of mitochondrial remodeling by the ATPase inhibitory factor 1 unveils a pro-survival relay via OPA1, Cell Rep. 18 (8) (2017) 1869–1883. [15] D. Faccenda, C.H. Tan, A. Seraphim, M.R. Duchen, M. Campanella, IF1 limits the apoptotic-signalling cascade by preventing mitochondrial remodelling, Cell Death Differ. 20 (5) (2013) 686–697. [16] M. Sanchez-Arago, L. Formentini, I. Martinez-Reyes, J. Garcia-Bermudez, F. Santacatterina, L. Sanchez-Cenizo, I.M. Willers, M. Aldea, L. Najera, A. Juarranz, E.C. Lopez, J. Clofent, C. Navarro, E. Espinosa, J.M. Cuezva, Expression, regulation and clinical relevance of the ATPase inhibitory factor 1 in human cancers, Oncogenesis 2 (2013) e46. [17] R. Song, H. Song, Y. Liang, D. Yin, H. Zhang, T. Zheng, J. Wang, Z. Lu, X. Song, T. Pei, Y. Qin, Y. Li, C. Xie, B. Sun, H. Shi, S. Li, X. Meng, G. Yang, S. Pan, J. Zhu, S. Qi, H. Jiang, Z. Zhang, L. Liu, Reciprocal activation between ATPase inhibitory factor 1 and NF-kappaB drives hepatocellular carcinoma angiogenesis and
254
Contents lists available at ScienceDirect
Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Mitochondrial ATPase inhibitor factor 1, MjATPIF1, is beneficial for WSSV replication in kuruma shrimp (Marsupenaeus japonicus)
T
Li-Jie Huo1, Ming-Chong Yang1, Jin-Xing Wang, Xiu-Zhen Shi∗ Shandong Provincial Key Laboratory of Animal Cells and Developmental Biology, School of Life Sciences, Shandong University, Qingdao, Shandong, 266237, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Shrimp ATPase inhibitor factor 1 WSSV Dorsal NF-κB
ATPase Inhibitory Factor 1 (IF1) is a mitochondrial protein that functions as a physiological inhibitor of F1F0ATP synthase. In the present study, a mitochondrial ATPase inhibitor factor 1 (MjATPIF1) was identified from kuruma shrimp (Marsupenaeus japonicus), which was demonstrated to participate in the viral immune reaction of white spot syndrome virus (WSSV). MjATPIF1 contained a mitochondrial ATPase inhibitor (IATP) domain, and was widely distributed in hemocytes, heart, hepatopancreas, gills, stomach, and intestine of shrimp. MjATPIF1 transcription was upregulated in hemocytes and intestines by WSSV. WSSV replication decreased after MjATPIF1 knockdown by RNA interference and increased following recombinant MjATPIF1 protein injection. Further study found that MjATPIF1 promoted the production of superoxide and activated the transcription factor nuclear factor kappa B (NF-κB, Dorsal) to induce the transcription of WSSV RNAs. These results demonstrate that MjATPIF1 benefits WSSV replication in kuruma shrimp by inducing superoxide production and NF-κB activation.
1. Introduction Mitochondria are important for the survival of all eukaryotic organisms and function as the cell's power plant, as most of the cellular energy required for various activities is produced by mitochondria [1]. Cellular energy, mitochondrial adenosine triphosphate (ATP), is synthesized by oxidative phosphorylation (OXPHOS) [1]. During the whole process of OXPHOS, F1F0-ATP synthase is the only protein with ATP synthesis ability, and it is crucial to mitochondria and cells. This ATP synthase produces ATP by exploiting the proton electrochemical gradient generated by the respiratory chain [2]. F1F0-ATP synthase is a protein complex and is divided into two main functional domains, F1 and F0, which are both constituted by multiple subunits [3,4]. When mitochondria are damaged, F1F0-ATP synthase expends ATP to maintain mitochondrial membrane potential [5]. This process can be inhibited by ATPase inhibitory factor 1 (ATPIF1) [6]. ATPIF1 was first purified from beef heart mitochondria and functions as a natural inhibitor of mitochondrial Adenosine Triphosphatase (ATPase) [7]. ATPIF1 is a small and highly conserved mitochondrial protein, and also functions as the physiological inhibitor of F1F0-ATP synthase (F1F0) [2,8]. ATPIF1 inhibits ATP hydrolysis by binding to the F1 domain of F1F0-ATP synthase [9]. ATPIF1 has been studied in yeast [10,11], nematodes [12], shrimp [9], and mammals [13]. Human
ATPIF1 is encoded by the nuclear ATPIF1 gene as a precursor protein. During the process of import into mitochondria, the mature ATPIF1 is produced by cleavage of the N-terminal 25-residue pre-sequence, and this mature protein contains the N-terminal inhibitory domain and a Cterminal dimerization domain [1,2]. Functional studies of ATPIF1 mainly used cell lines. Some studies reported that ATPIF1 could inhibit both the ATP synthase and hydrolase activities of ATP synthase [1]. In certain human cancer cells, the expression of ATPIF1 is upregulated, and ATPIF1 could interact with nuclear factor kappa B (NF-κB) to activate the canonical cellular adaptive responses [14–17]. In certain tumor cells, ATPIF1 functions in energy metabolism as the molecular switch of the metabolic shift that inhibits oxidative phosphorylation and promotes aerobic glycolysis, resulting in mitochondrial hyperpolarization [8,18]. In breast, colon, lung, and ovarian cancer cells, ATPIF1 mediates the activation of a reactive oxygen species (ROS) signals and aerobic glycolysis to promote cell survival and proliferation [18]. Mild amounts of ROS stimulate the activity of the NF-κB pathway [17,18], which activates a downstream anti-apoptotic gene, thus benefiting the survival of cancer cells. In addition, mitochondrial cristae density and ATP synthase dimerization could be regulated by ATPIF1 [19]. In Caenorhabditis elegans, an in vivo study found that one inhibitor protein of F1F0-ATPase, MAI-2 (mitochondrial ATPase inhibitor),
∗
Corresponding author. School of Life Sciences, Shandong University, Qingdao, Shandong, 266237, China. E-mail address: [email protected] (X.-Z. Shi). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.fsi.2020.01.019 Received 20 September 2019; Received in revised form 5 January 2020; Accepted 12 January 2020 Available online 13 January 2020 1050-4648/ © 2020 Elsevier Ltd. All rights reserved.
Fish and Shellfish Immunology 98 (2020) 245–254
L.-J. Huo, et al.
functioned in the conservation of mitochondrial membrane potential and stress-induced germ cell apoptosis [20]. MAI-2 plays a vital role in apoptosis by regulating the mitochondrial membrane potential [20]. ATPIF1 only functions in C. elegans under stress conditions rather than in normal physiological conditions [20]. Two variants of ATPIF1 were already reported in Litopenaeus vannamei, IF1_Lv1 and IF1_Lv2, and the expression of IF1_Lv1 could be affected by hypoxia and re-oxygenation [9]. The shrimp aquaculture industry is economically important in certain countries. However, shrimp are easily infected by white spot syndrome virus (WSSV), which causes great economic losses and has a social impact on the global crustacean aquaculture. To understand the antiviral mechanisms and disease control, the kuruma shrimp (Marsupenaeus japonicus), was used as a model to study innate immunity. There has been no report about ATPIF1 in the antiviral immunity of kuruma shrimp (M. japonicus). Therefore, the present study aimed to determine whether ATPIF1 is involved in the antiviral immunity of shrimp (M. japonicus). We identified and characterized a mitochondrial ATPase inhibitor factor 1 (MjATPIF1). The tissue distribution and time course expression pattern of MjATPIF1 were analyzed at the transcriptional level using quantitative real-time polymerase chain reaction (qPCR). RNA inference and a recombinant protein were used to detect the possible role of MjATPIF1 in vivo. The potential mechanism of MjATPIF1's participation in the viral immune reaction of shrimp was explored.
Table 1 Primers used in this study. Primer
Sequence (5′–3′)
OligoanchorR S-tag T7 Ter β-actin-RTF β-actin-RTR GFPi-F GFPi-R IE1-RTF IE1-RTR VP28-RTF VP28-RTR MjATPIF1-ExF MjATPIF1-ExR MjATPIF1-RNAiF MjATPIF1-RNAiR MjATPIF1-RTF MjATPIF1-RTR MjDorsal-RNAiF MjDorsal-RNAiR MjDorsal-RTF MjDorsal-RTR
gaccacgcgtatcgatgtcgact16 (a/c/g) cgaacgccagcacatggaca tgctagttattgctcagcgg cagccttccttcctgggtatgg gagggagcgagggcagtgatt gcgtaatacgactcactataggtggtcccaattctcgtggaac gcgtaatacgactcactataggcttgaagttgaccttgatgcc gactctacaaatctctttgcca ctacctttgcaccaattgctag agctccaacacctcctccttca ttactcggtctcagtgccaga tacgaattcatggctctgcggcagacagct tacctcgagttacttcagctcctgtagacg gcgtaatacgactcactataggagcatgggaaagggtgag gcgtaatacgactcactataggttgatagcctctttgtggg aaagggtgagccaggtgc ttgatagcctctttgtggg gcgtaatacgactcactataggccatagagctagata gcgtaatacgactcactataggtcagtacccaagtgt gcaatgctggtaacctggcta ctatgggattttggtcaatacac
reverse transcription to produce first-strand cDNAs, which were diluted 20-fold and used as the templates for the tissue distribution analysis. For the viral challenge, each shrimp was injected with 50 μl of WSSV (2 × 105 copies) [21,22]. For the control group, shrimp were injected with 50 μl PBS (phosphate-buffered saline; 10 mM Na2HPO4, 2.7 mM KCl, 2 mM KH2PO4, 137 mM NaCl, pH 7.4). At 6, 12, 24, 36, and 48 h post infection, hemocytes and intestines were collected from at least three shrimp to extract total RNAs. Primers MjATPIF1-RTF and MjATPIF1-RTR (Table 1) were designed to analyze the tissue distribution and expression pattern of MjATPIF1 using quantitative real-time PCR (qPCR). The qPCR program was as follows: 95 °C for 10 min; 40 cycles of 15 s at 95 °C, 1 min at 60 °C and 2 s at 76 °C; and a melting curve analysis from 65 °C to 95 °C. β-actin was amplified as the internal control using primers β-actin-RTF and βactin-RTR (Table 1). The qPCR results were analyzed using the 2−ΔΔCT method [23] and GraphPad Prism 5 software (GraphPad Software, Inc., La Jolla, CA, USA).
2. Materials and methods 2.1. Sequence analysis The sequence of MjATPIF1 was obtained from transcriptome sequencing of M. japonicus. The BLASTX program in National Center for Biotechnology Information server (https://blast.ncbi.nlm.nih.gov/ Blast.cgi) was used to study the gene homology. The translate tool in ExPASy (https://web.expasy.org) was used to analyze the translated amino acid sequence of MjATPIF1. The compute pI/Mw tool in ExPASy was used predict the isoelectric point (pI) and molecular weight (Mw) of MjATPIF1. The phylogenetic tree was constructed using the MEGA 5.2 software (https://www.megasoftware.net/home). The functional domains of MjATPIF1 were predicted using simple module architecture research tool (SMART, http://smart.embl-heidelberg.de/). 2.2. Animals
2.4. RNA interference (RNAi)
Kuruma shrimp (each shrimp weighed about 10 g) were purchased from a seafood market in Jinan, or from a shrimp farm in Qingdao, Shandong Province, China, and cultured in laboratory tanks filled with aerated natural seawater. To assure the shrimp healthy status, shrimp with symptoms like slow swimming and reaction time were not used in our experiment. To check whether they were infected by WSSV, the shrimp were randomly selected and their genomic DNA was extracted from muscle using a genomic DNA extraction kit (Toyobo, Osaka, Japan). PCR was performed using the genomic DNA as the template and primers VP28-RTF and VP28-RTR (Table 1), and the results were checked via electrophoresis on a 1% agarose gel. If no bands were amplified, the shrimp was regarded as WSSV-free and was cultured in the laboratory for subsequent experiments. Shrimp were acclimated at room temperature for at least two days before immune challenge and sample collection.
A partial nucleotide fragment of MjATPIF1 (221 bp) was amplified using primers MjATPIF1-RNAiF and MjATPIF1-RNAiR (Table 1), as the template for MjATPIF1 double-stranded RNA (dsRNA) synthesis. The dsRNA was synthesized using T7 RNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA), and extracted using chloroform. After the dsRNA was purified, diethylpyrocarbonate (DEPC)-treated water was added to adjust the concentration to 1 μg/μl. In the RNAi assay, a green fluorescent protein (GFP) dsRNA was used as the control [22], which was synthesized following the same method as the synthesis of MjATPIF1 dsRNA, with the DNA template being amplified using primers GFPi-F and GFPi-R (Table 1). Shrimp were injected with 30 μg of dsMjATPIF1 or dsGFP per shrimp. One day later, another 30 μg dsRNA was injected. At 24 h after the second dsRNA injection, total RNAs were extracted from the hemocytes and intestines of three shrimp in each group to detect the RNAi efficiency. To detect the influence of MjATPIF1 on WSSV replication, 50 μl WSSV (2 × 105 copies) was injected into the remaining dsRNA-treated shrimp. At 48 h after WSSV injection, hemocytes and intestines of three shrimp were collected from at least three shrimp to extract total RNAs, which were reverse transcribed into first strand cDNAs and then subjected to qPCR to check the relative expression of WSSV immediate early gene IE1 and the envelope protein VP28. In the qPCR assay,
2.3. Tissue distribution and expression pattern analysis Total RNA was extracted from different tissues (hemocytes, heart, hepatopancreas, gills, stomach, and intestines) of at least three normal shrimp using RNAiso Plus (Takara, Dalian, China). Then, primer oligoanchorR (Table 1) was mixed with the total RNAs (5 μg) for 246
Fish and Shellfish Immunology 98 (2020) 245–254
L.-J. Huo, et al.
Fig. 1. Sequence analysis of MjATPIF1. (A) The nucleotide and the deduced amino acid sequence of MjATPIF1 (GenBank accession number MN627000). (B) The functional domain of MjATPIF1 is the mitochondrial ATPase inhibitor (IATP) domain. (C) The amino acid sequence alignment of ATPIF1 from humans (Homo sapiens), house mouse (Mus musculus), Pacific white shrimp (Penaeus vannamei), and kuruma shrimp (Marsupenaeus japonicus). The minimum suppression sequence of MjATPIF1 is underlined.
Fig. 2. Phylogenetic tree of ATPIF1 proteins from different species, including kuruma shrimp (Marsupenaeus japonicus), Penaeus vannamei (Pacific white shrimp), Procambarus clarkii (red swamp crayfish), Armadillidium vulgare (common pillbug), Hyalella azteca (amphipod crustacean), Pomacea canaliculata (mollusc), Aplysia californica (California sea hare), Monomorium pharaonis (pharaoh ant), Orussus abietinus, Athalia rosae (coleseed sawfly), Cyphomyrmex costatus, Wasmannia auropunctata (little fire ant), Bombus impatiens (common eastern bumble bee), Pediculus humanus corporis (human body louse), Tribolium castaneum (red flour beetle), Bombyx mori (domestic silkworm), Strongylocentrotus purpuratus (purple sea urchin), and Hydra vulgaris (coelenterata). The protein sequences were collected from GenBank. The neighbor-joining tree was constructed using the MEGA 5.2 software, using 1000 bootstraps to check the repeatability. MjATPIF1 was labeled with a solid triangle. The scale bar was 0.05.
2.5. Survival rate assay
primers IE1-RTF and IE1-RTR (Table 1) were used to analyze the expression of IE1, and primers VP28-RTF and VP28-RTR (Table 1) were used to analyze the expression of VP28. At the same time, the expression of MjDorsal was also analyzed using qPCR, with primers MjDorsal-RTF and MjDorsal-RTR (Table 1).
For the survival rate assay, the shrimp were divided into two groups, the dsGFP-injected shrimp and the dsMjATPIF1-injected shrimp. Each group contained at least 30 shrimp. At 24 h after the second dsRNA injection, WSSV (2 × 105 copies) were injected into the shrimp. 247
Fish and Shellfish Immunology 98 (2020) 245–254
L.-J. Huo, et al.
Fig. 3. MjATPIF1 was upregulated in shrimp after challenge by WSSV. (A) The tissue distribution of MjATPIF1 was examined using qPCR in different tissues of normal shrimp, including hemocytes, heart, hepatopancreas, gills, stomach, and intestine. (B–C) Expression patterns of MjATPIF1 in hemocytes (B) and intestine (C) of WSSV-challenged shrimp at different time points, as detected using qPCR analysis. Each column represents the mean of three replicates ± SEM. Figures were constructed using GraphPad Prism 5 software. Significance was compared between the PBS group and the WSSV-infected group at the same time point using Student's t-test (*p < 0.05, **p < 0.01). Fig. 4. WSSV replication increased in MjATPIF1-knockdown shrimp infected by WSSV. (A) and (B) The RNAi efficiency of MjATPIF1 in hemocytes and intestines. (C–F) The expression of WSSV IE1 (C and D) and VP28 (E and F) in hemocytes and intestine of MjATPIF1-knockdown shrimp after WSSV challenge. The relative expression levels were detected using qPCR. Each column represents the mean of three replicates ± SEM. The data were analyzed using GraphPad Prism 5 software, and the significant differences between dsMjATPIF1 group and dsGFP group were analyzed using Student's t-test and determined by *p < 0.05, **p < 0.01. (G) The survival rate of MjATP1F1 knockdown shrimp infected with WSSV. WSSV was injected into shrimp at 24 h after the second dsRNA injection. The number of surviving shrimp was recorded every 12 h. The dsGFP injection was used as the control. The survival rate was calculated and analyzed using GraphPad Prism 5 software, and the survival curve was constructed using the Kaplan–Meier method. The statistical analysis was performed using the GehanBreslow-Wilcoxon Test (**p < 0.01).
with restriction enzymes EcoR I and Xho I (both Thermo Fisher Scientific), the fragment was ligated into vector pET32a(+), which was transformed into the Escherichia coli DH5α competent cells. Colony PCR was carried out using the vector primers S-tag and T7 Ter (both Table 1) to screen the positive bacteria. The recombinant plasmid MjATPIF1pET32a(+) was extracted and verified by sequencing at the Beijing Genomics Institute (BGI, Beijing, China). The recombinant MjATPIF1pET32a(+)-Rosetta cells were shaken for about 3 h until the optical density (OD) reached about 0.8, and then 0.5 mM isopropyl-β-D-thiogalactopyranoside (IPTG) was added and incubation continued at 37 °C for 4 h to induce the expression of the recombinant MjATPIF1 protein (rMjATPIF1). rMjATPIF1 was observed to be expressed in inclusion
After WSSV injection, the number of surviving shrimp was recorded every 12 h, and the dead shrimp were removed from the tank. The shrimp that died within 3 h after WSSV injection were not included in the calculation because they were assumed to have died from causes other than WSSV infection. The survival rate was calculated as the ratio of live shrimp number to the total number of shrimp at each time points, and analyzed using GraphPad Prism 5 software. 2.6. Recombinant protein expression and purification Primers MjATPIF1-ExF and MjATPIF1-ExR (Table 1) were designed to amplify the full length coding sequence of MjATPIF1. After digestion 248
Fish and Shellfish Immunology 98 (2020) 245–254
L.-J. Huo, et al.
Fig. 5. WSSV replication declined significantly in the rMjATPIF1-injected shrimp challenged by WSSV. (A) Recombinant expression and purification of rMjATPIF1. Lane 1, total protein of recombinant E. coli Rosetta without IPTG induction; lane 2, total protein of recombinant E. coli Rosetta with IPTG induction; lane 3, the purified recombinant protein rMjATPIF1; lane M, unstained protein molecular weight marker. (B) Western blotting analysis of rMjATPIF1. Lane Marker, the prestained protein molecular weight marker; lane rMjATPIF1, rMjATPIF1 detected using a His-tag antibody. (C) Immunocytochemistry of shrimp hemocytes using the His-tag antibody to detect the entrance of rMjATPIF1 into hemocytes. The green fluorescence signal indicates the distribution of rMjATPIF1 in hemocytes, and the blue signal shows the hemocyte nucleus stained by DAPI. BSA was used as the negative control. (D–G) The relative expression of WSSV IE1 (D and E) and VP28 (F and G) in hemocytes and intestines of MjATPIF1 knockdown shrimp after WSSV infection. The expression levels of WSSV IE1 and VP28 were analyzed using qPCR. Each column represents the mean of three replicates ± SEM. Significant differences were analyzed using Student's t-test and accepted with *p < 0.05, **p < 0.01, and ***p < 0.001. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
Trx) was expressed in the supernatant, and purified by affinity chromatography directly after ultrasonication. Trx was used as the control protein to eliminate the effect of the tag protein in certain experiments. The purified protein was frozen at –20 °C until use.
bodies. After centrifugation and ultrasonication of the bacteria, the precipitate including the inclusion bodies was collected and washed with Buffer A (50 mM Tris-HCl, 5 mM EDTA, pH 8.0) twice and with Buffer B (2 M urea, 50 mM Tris-HCl, 5 mM EDTA, pH 8.0) twice. The precipitate was dissolved in 10 ml of Denaturing Buffer (8 M urea, 0.1 M Tris-HCl, 10 mM DL-Dithiothreitol, pH 8.0). Then, Ni-nitrilotriacetic acid (NTA) agarose resin (GE Healthcare, Little Chalfont, UK) was used to purify rMjATPIF1 protein. The eluted protein was collected and dialyzed against TBS buffer (150 mM NaCl, 50 mM Tris-HCl, pH 8.0). The purified protein was checked using electrophoresis using 12.5% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDSPAGE), and stored at –20 °C until use. Western blotting analysis was used to check whether rMjATPIF1 could be detected by the anti-His tag antibody. Mouse anti-His monoclonal antibody (ZSGB-Bio, Beijing, China) was used as the primary antibody and horseradish peroxidase (HRP)-conjugated goat anti-Mouse IgG(H + L) (ZSGB-Bio) was used as the secondary antibody. 4-chloro-1-naphthol (4-CN) and H2O2 were used to detect the immunoreactive protein bands. Empty pET32a (+) vector was transformed into E. coli Rosetta competent cells and induced by IPTG. The his-tagged peptide (named
2.7. rMjATPIF1 protein injection assay The purified rMjATPIF1 protein (10 μg) was mixed with 50 μl WSSV (2 × 105 copies) at 4 °C for 1 h. The mixed solution was then injected into shrimp. The control shrimp were injected with Trx and WSSV. One hour later, immunocytochemistry was performed to check whether the injected protein entered the shrimp hemocytes. Hemocytes were collected using a 5 ml syringe preloaded with 500 μl anticoagulant (10 mM EDTA, 450 mM NaCl, 10 mM KCl, 10 mM HEPES, pH 7.5) and 500 μl 4% paraformaldehyde. The obtained hemocytes were deposited onto glass slides for 2 h at room temperature. Hemocytes were then washed with PBS six times (5 min each time). The washed hemocytes were treated with 0.2% Triton X-100 at 37 °C for 5 min. After washing with PBS three times, the hemocytes were blocked with 3% bovine serum albumin (BSA) at 37 °C for 30 min. Mouse anti249
Fish and Shellfish Immunology 98 (2020) 245–254
L.-J. Huo, et al.
instrument (Thermo Fisher Scientific, USA). The blank control was the storage buffer. The amount of mitochondrial superoxide was calculated by the absorbance value of the samples after subtracting the value of the blank control. The amount of mitochondrial superoxide in GFP RNAi shrimp was normalized to 1.0, and the relative amount of MjATPIF1 RNAi shrimp was the ratio of the amount of superoxide in MjATPIF1 RNAi shrimp to the amount in GFP RNAi shrimp. GraphPad Prism 5 software was used to analyze the data and construct the figures. For the recombinant protein injection assay, mitochondria were extracted, and the relative amounts of mitochondrial superoxide were measured as described above. 2.9. MjDorsal nuclear translocation assay To analyze MjDorsal translocation into the nucleus, MjATPIF1 was knocked down or overexpressed (rMjATPIF1 injection), and then WSSV was injected. Three hours later, hemocytes were collected for immunocytochemistry following the method described in section 2.7. The primary antibody was anti-MjDorsal rabbit serum [24], and the secondary antibody was goat anti-rabbit IgG-Alexa Fluor 488. Image J software (http://imagej.net/mbf/installing_imagej.htm) was used to calculate the colocalization rate of Dorsal (green fluorescence) with nuclei stained with 2-(4-amidinophenyl)-1H-indole-6-carboxamidine (DAPI). After the pictures were merged, the blue and the green fluorescence were analyzed using ImageJ, with ‘Split channels in ImageColor’ selected. The red channels were closed, and only the green and blue channels were left for the subsequent analysis. After the colocalization analysis and the colocalization threshold, the Rcoloc value could be obtained, which represented the colocalization rate of Dorsal in nucleus [24]. To detect whether superoxide improved the NF-κB activity, the antioxidant N-Acetyl-L-cysteine (NAC) was injected to reduce the superoxide in shrimp, and then the localization of MjDorsal in the nucleus was checked. Shrimp were then injected with WSSV. After 24 h, 20 μg NAC was injected into shrimp. The control shrimp were injected with PBS. After 3 h, hemocytes were collected for immunocytochemistry. The nuclear translocation of MjDorsal was analyzed as stated above.
Fig. 6. Mitochondrial superoxide detection in MjATPIF1-knockdown and rMjATPIF1-injected shrimp challenged by WSSV. (A) The relative amount of mitochondrial superoxide in dsMjATPIF1-injected shrimp and dsGFP-injected shrimp after WSSV challenge. (B) The relative amount of mitochondrial superoxide in rMjATPIF1 with WSSV-injected shrimp and Trx with WSSV-injected shrimp. The relative level of superoxide was measured at OD450 and OD620. The results were analyzed using GraphPad Prism 5 software. The statistical analyses were carried out by Student's t-test with **p < 0.01.
His monoclonal antibody (1:500 in 3% BSA) was added and incubated at 4 °C overnight. After washing six times with PBS, the hemocytes were incubated with fluorescein isothiocyanate (FITC)-goat anti-mouse IgG in the dark (1:1000 in 3% BSA) at 37 °C for 2 h. After sufficient washing, the hemocytes were treated with 4′,6-diamidino-2-phenylindole (DAPI, 1:1000 in PBS) in the dark at room temperature for 10 min. An Olympus BX51 fluorescence microscope (Tokyo, Japan) was used to observe the fluorescence and capture images. At 24 h and 48 h after protein injection, total RNAs were extracted from the hemocytes and intestines of three shrimp to analyze the relative expression levels of IE1, VP28, and MjDorsal following the methods detailed in section 2.4.
2.10. The expression analysis of MjATPIF1 after MjDorsal knockdown MjDorsal RNAi assay was performed according the method shown in section 2.4. The MjDorsal dsRNA was synthesized from the DNA fragment template (512 bp) amplified using primers MjDorsal-RNAiF and MjDorsal-RNAiR (Table 1). After RNAi, the RNAi efficiency was checked using qPCR using primers MjDorsal-RTF and MjDorsal-RTR (Table 1). WSSV (2 × 105 copies) was injected into the remaining shrimp. At 12 h after WSSV injection, total RNAs were extracted from the hemocytes and intestines of the MjDorsal dsRNA-injected shrimp and the GFP dsRNA-injected shrimp. The RNAs were reverse transcribed into first strand cDNAs, diluted 20-fold, and used as templates for qPCR to check the expression of MjATPIF1. GraphPad Prism 5 software was used for the statistical analyses.
2.8. Mitochondrial superoxide detection analysis After knockdown of MjATPIF1 in shrimp, hemocytes were collected from at least three shrimp, and washed with PBS. Mitochondria were extracted from the hemocytes using a mitochondria extraction kit (Solarbio, Beijing, China) following the manufacturers’ instructions. Briefly, the hemocytes were lysed using 1 ml of pre-cooled lysis buffer on ice. The lysed hemocytes were centrifuged at 1000 × g at 4 °C for 5 min twice to collect the supernatant, which was centrifuged again at 4 °C and 12000 × g for 10 min to obtain the pellet. The pellet was washed with wash buffer by centrifugation at 1000 × g and 4 °C for 5 min to collect the supernatant, which was then centrifuged at 12000 × g and 4 °C for 10 min to obtain the mitochondria. The extracted mitochondria were mixed with storage buffer and their concentration was estimated using a differential spectrophotometer at A280. The concentrations of mitochondria in the MjATPIF1 RNAi group and the GFP RNAi group were set to consistency. The mitochondria superoxide concentration (amount) was analyzed using a superoxide detection kit (Beyotime, Shanghai, China). The obtained mitochondria (10 μl) in storage buffer were added into 212 μl of superoxide detection working buffer (200 μl superoxide detection buffer, 10 μl WST-1, 2 μl catalase) and incubated at 37 °C for 3 min in the dark. OD450 and OD620 were measured using a Multiskan FC
3. Results 3.1. Sequence analysis of MjATPIF1 The open reading frame of MjATPIF1 is 315 bp, encoding a putative protein of 104 amino acids (Fig. 1A). The predicted molecular mass of MjATPIF1 is 11.5 kDa and the predicted isoelectric point (pI) is 9.81. MjATPIF1 contains a mitochondrial ATPase inhibitor (IATP) domain (Fig. 1B), and a minimum suppression sequence (Fig. 1C). Amino acid sequence alignment of ATPIF1s from different species (M. japonicus, P. vannamei, Homo sapiens, and Mus musculus) showed that ATPIF1 is conserved from shrimp to mammals, especially in the minimum 250
Fish and Shellfish Immunology 98 (2020) 245–254
L.-J. Huo, et al.
Fig. 7. MjATPIF1 promoted MjDorsal translocation into the nucleus in shrimp challenged by WSSV. (A) MjDorsal translocation was detected after MjATPIF1 RNAi. (a) Statistic analysis of MjDorsal colocation with the nucleus after MjATPIF1 RNAi. (B) MjDorsal translocation detection after rMjATPIF1 protein injection. (b) Statistical analysis of MjDorsal translocation rate after rMjATPIF1 protein injection. (C) At 24 h after WSSV and NAC injection, MjDorsal translocation was detected. The control shrimp were injected with PBS. (c) Statistical analysis of the MjDorsal translocation rate after injection of NAC and WSSV. Each column represents the mean of three replicates ± SEM. The statistical analyses were performed using Student's t-test with *p < 0.05 and **p < 0.01.
3.2. MjATPIF1 was widely distributed in shrimp tissues and was upregulated by WSSV challenge
suppression sequence (Fig. 1C). A high level of identity (90.4%) was observed between MjATPIF1 and ATPIF1 from P. vannamei (Fig. 1C). The evolutionary relationship analysis of ATPIF1 showed that ATPIF1 proteins could be divided into two groups, MjATPIF1 was clustered with ATPIF1s from crustaceans, including P. vannamei (Pacific white shrimp), Procambarus clarkii (red swamp crayfish), Armadillidium vulgare (common pillbug), and Hyalella azteca (amphipod crustacean), and mollusks, including Pomacea canaliculata (mollusc) and Aplysia californica (California sea hare) (Fig. 2).
The results of the tissue distribution analysis showed that the transcript of MjATPIF1 was expressed in all tested tissues (hemocytes, heart, hepatopancreas, gills, stomach, and intestines), with high expression levels in heart, hepatopancreas, and intestines (Fig. 3A). Hemocytes and intestines are two important immune organs in shrimp, and are chosen for the gene expression analysis in shrimp post WSSV infection in the previous study [25,26]. It has been reported that
251
Fish and Shellfish Immunology 98 (2020) 245–254
L.-J. Huo, et al.
Fig. 9. Expression analysis of MjATPIF1 after MjDorsal RNAi. (A) and (B) The knockdown efficiency of MjDorsal in hemocytes (A) and intestines (B), as determined using qPCR. (C) and (D) The relative expression levels of MjATPIF1 were checked using qPCR after the MjDorsal RNAi in hemocytes (C) and intestines (D). Each column represents the mean of three replicates ± SEM. Significant differences were analyzed using Student's t-test with *p < 0.05. Fig. 8. MjDorsal expression analysis after MjATPIF1 RNAi and rMjATPIF1 protein injection. (A) and (B) Expression of MjDorsal in hemocytes and intestines after MjATPIF1 knockdown. (C) and (D) Expression of MjDorsal in hemocytes and intestine after rMjATPIF1 protein injection. The relative expression levels of MjDorsal were assessed using qPCR. Each column represents the mean of three replicates ± SEM. Significant differences were analyzed using Student's t-test with *p < 0.05 and **p < 0.01.
3.3. MjATPIF1 was beneficial for WSSV replication To investigate the possible function of MjATPIF1 in WSSV challenge, MjATPIF1 was knocked down using RNAi in hemocytes and intestines, which was particularly effective at 24 h after the second dsRNA injection (Fig. 4A and 4B). Then, the MjATP1F1 knockdown shrimp were infected with WSSV, and the expression levels of WSSV IE1 and VP28 (as indicators of WSSV replication) were detected in hemocytes and intestines. The results showed that the expression levels of IE1 and VP28 were both reduced in the hemocytes and intestines of MjATPIF1 knockdown shrimp compared with those in the control shrimp (Fig. 4C–F). The survival assay showed that the survival rate of MjATPIF1 knockdown shrimp was significantly higher than that of dsGFP-injected shrimp after WSSV infection (Fig. 4G). Fig. 5A showed that MjATPIF1 could be recombinantly expressed and purified, while Fig. 5B demonstrated that the purified rMjATPIF1 protein could be recognized by the anti-His tag antibody. The molecular mass of rMjATPIF1 was around 32 kDa (Fig.5A and 5B), which was similar to 31.3 kDa, the predicted molecular mass of rMjATPIF1. We detected the injected recombinant protein in hemocytes (Fig. 5C), which suggested that injection of the recombinant protein could be
WSSV infects hemocytes, and hemocytes carrying virions are distributed quickly in shrimp body to infect the target tissues including intestine [27,28]. Therefore, these two organs were selected for the time course pattern analysis and various gene expression assay. The results showed that in hemocytes, MjATPIF1 levels were upregulated by WSSV at 6, 24, and 36 h post-infection (Fig. 3B). While in the intestines, MjATPIF1 was upregulated by WSSV at 12 and 24 h (Fig. 3C). MjATPIF1 expression was downregulated in hemocytes at 12 h and in intestines at 6 h and 36 h. The downregulation of MjATPIF1 in these time points might be because of degradation of the mRNA after its fast translation into protein. The upregulation of MjATPIF1 after WSSV challenge indicated that MjATPIF1 might be involved in the immune response to WSSV infection. 252
Fish and Shellfish Immunology 98 (2020) 245–254
L.-J. Huo, et al.
smORF according to the statement of Chu et al. [32]. In recent years, smORFs have received increased research attention, with increasing numbers of studies concerning the prediction and functional analysis of smORFs [31,33]. Studies show that smORFs have a wide range of functions as positive or negative regulators in fundamental cytoplasmic processes, including metabolism, apoptosis, mitochondrial respiration, and development [32–34]. Our study of MjATPIF1 could add some novel function annotations for the smORFs family. In M. japonicus, MjATPIF1 was widely distributed in the tested tissues (Fig. 3A). A similar result was found for ATPIF1 in Litopenaeus vannamei. The two variants of Lv-IF1 were ubiquitously expressed in all the tested shrimp tissues, including eye stalk, gills, midgut gland, muscle, and pleopods [9]. The mRNA expression of MjATPIF1 was induced in hemocytes and intestines after WSSV challenge (Fig. 3B and 3C), implying that MjATPIF1 participated in the shrimp viral immune response. In L. vannamei, the mRNA levels of IF1-Lv1 responds to hypoxia and reoxygenation, because IF1-Lv1 is involved in ATP homeostasis via the control of ATP consumption and preservation of the energy [9]. When shrimp are infected with WSSV and the virus replicates, the aerobic glycolysis of the host metabolism is induced to produce the large amount of energy needed for the process of WSSV genome duplication and structural protein synthesis [35]. MjATPIF1 might participate in the energy homeostasis-related WSSV defense reaction of shrimp. RNAi and protein overexpression (recombinant injection) assays both supported the hypothesis that MjATPIF1 favored WSSV replication. In shrimp, MjATPIF1 could regulate the expression and activation of NF-κB (MjDorsal) and likewise, the expression of MjATPIF1 could be regulated by NF-κB (MjDorsal). The NF-κB pathway is exploited by WSSV for its replication. In shrimp (L. vannamei), NF-κB (LvDorsal and LvRelish) could bind to the promoter region of WSV069 (immediate early gene, ie1), suggesting that WSV069 could be activated by both LvDorsal and LvRelish [36–38]. WSSV utilizes the shrimp NF-κB pathway to promote its gene expression and favor its replication [36]. Similarly, WSSV is observed to induce the activation of LvDorsal and LvRelish to promote the expression of the ie1 gene [36–38]. LvDorsal shows a higher promoter binding activity to activate WSV069 (ie1) than LvRelish [38]. Therefore, MjDorsal was chosen for the NF-κB activity analysis in the present study. The activity of NF-κB was analyzed via the colocalization rate of MjDorsal in hemocyte nuclei. The results showed that MjATPIF1 enhanced the MjDorsal activation by translocating more MjDorsal into the nucleus. NF-κB is an evolutionarily conserved transcription factor that plays a vital role in innate immunity and inflammation [39]. In human, an NF-κB binding site exists in the promoter region of IF1, which means that IF1 could be transcribed directly after NF-κB binding. Meanwhile, IF1 participates in NF-κB activation [17]. Thus a positive feedback loop is formed between IF1 and NF-κB in hepatocellular carcinoma in which IF1 functions as a vital regulator in the development and metastasis [17]. ROS consists of hydrogen peroxide and superoxide [40]. Superoxide, as the major ROS, acts as messenger for transcription factor NFκB activation by enhancing H2O2 production [41]. MjATPIF1 facilitated the production of mitochondrial superoxide, which could induce the NF-κB activity of shrimp (Figs. 6–8). After WSSV challenge, MjATPIF1 induced superoxide production and activated MjDorsal, which subsequently promoted the transcription of the WSSV immediate early gene IE1 (Fig. 4C, 4D, 5D, and 5E). IE1 initiated the expression of WSSV early genes and late genes (VP28) (Fig. 4E, 4F, 5F, and 5G). Meanwhile, the high level of MjDorsal upregulated the expression of MjATPIF1 (Fig. 9). Finally, WSSV was assembled in shrimp after production of the viral genome and structural components. In summary, a smORF, MjATPIF1 was identified from kuruma shrimp (M. japonicus). MjATPIF1 could induce the production of ROS to activate the NF-κB signaling pathway. MjATPIF1 and MjDorsal promoted each other's expression. MjATPIF1 promoted WSSV replication in shrimp. This is the first study to report the function of ATPIF1 in
used as a surrogate for protein overexpression. At 48 h after the injection, the relative expression levels of WSSV IE1 and VP28 were detected by qPCR, which showed that their relative expression levels in hemocytes and intestine of rMjATPIF1 and WSSV-injected shrimp increased significantly compared with those in the Trx and WSSV-injected shrimp (Fig. 5D–G). Both the knockdown and protein overexpression results indicated that MjATPIF1 promoted WSSV replication in shrimp. 3.4. MjATPIF1 promoted the production of mitochondria superoxide The mitochondrial superoxide analysis showed a lower level of mitochondrial superoxide in the dsMjATPIF1-injected shrimp than in the dsGFP-injected shrimp post-WSSV infection (Fig. 6A). By contrast, the amount of mitochondrial superoxide in the rMjATPIF1-injected shrimp was much higher than that in the control shrimp (Fig. 6B). The results showed that MjATPIF1 promoted the production of mitochondrial superoxide after WSSV challenge. 3.5. MjATPIF1 triggered the activation of NF-κB by ROS The localization rate of MjDorsal (NF-κB) in the nucleus decreased after knockdown of MjATPIF1 compared with that in the control (Fig. 7A, and 7a). However, the localization rate of MjDorsal in the nucleus increased significantly after rMjATPIF1 protein and WSSV injection, (Fig. 7B and 7b). The results suggested that MjATPIF1 activated NF-κB when shrimp were challenged by WSSV. NAC is a direct antioxidant that neutralizes free radicals and scavenges ROS, and has antioxidant effects on total superoxide levels [29,30]. NAC was injected to decrease the ROS levels of shrimp. The results revealed that the nuclear localization rate of MjDorsal in NACinjected shrimp was lower than that in the control after WSSV challenge (Fig. 7C and 7c). This suggested that the activity of MjDorsal was much lower when ROS were cleared in shrimp, which in turn suggested that MjATPIF1 triggered the activation of NF-κB (MjDorsal) by inducing ROS production. 3.6. The expression of MjATPIF1 and MjDorsal promoted each other The relative expression of MjDorsal decreased significantly in hemocytes and intestines in the dsMjATPIF1-injected shrimp compared with that in the control shrimp (Fig. 8A and 8B). After recombinant protein injection, the expression of MjDorsal increased markedly in hemocytes and intestines of the shrimp compared with that in the control shrimp (Fig. 8C and 8D). This implied that MjATPIF1 participated in the regulation of MjDorsal expression. For the regulation analysis of MjATPIF1 by MjDorsal, Fig. 9A and 9B showed that MjDorsal could be knocked down markedly in the hemocytes and intestines. After RNAi, WSSV was injected into shrimp. The results showed that amount of MjATPIF1 transcript decreased in the hemocytes and intestines of the MjDorsal RNAi shrimp (Fig. 9C and 9D), which demonstrated that MjDorsal could regulate the expression of MjATPIF1. Thus, MjATPIF1 and MjDorsal regulated each other's expression. 4. Discussion In this study, we identified a mitochondrial ATPase inhibitor factor 1 from kuruma shrimp (M. japonicus), and analyzed its function in the viral immune response. The amino acid sequence of MjATPIF1 has 104 residues, and shows high sequence identity with the IF1-Lv1 (104 aa) from L. vannamei. Small Open Reading Frames (smORFs), encoding small proteins (SEP) of fewer than 100 amino acids, exist in all eukaryotic genomes [31]. However, Chu et al. [32] treats SEPs as generally fewer than 150 amino acids in length, because some SEPs of this length have not been annotated yet. Thus, in the present study, MjATPIF1 was considered as a new 253
Fish and Shellfish Immunology 98 (2020) 245–254
L.-J. Huo, et al.
WSSV infection of shrimp.
metastasis, Hepatology 60 (5) (2014) 1659–1673. [18] L. Formentini, M. Sanchez-Arago, L. Sanchez-Cenizo, J.M. Cuezva, The mitochondrial ATPase inhibitory factor 1 triggers a ROS-mediated retrograde prosurvival and proliferative response, Mol. Cell 45 (6) (2012) 731–742. [19] M. Campanella, E. Casswell, S. Chong, Z. Farah, M.R. Wieckowski, A.Y. Abramov, A. Tinker, M.R. Duchen, Regulation of mitochondrial structure and function by the F1Fo-ATPase inhibitor protein, IF1, Cell Metabol. 8 (1) (2008) 13–25. [20] L.P. Fernandez-Cardenas, E. Villanueva-Chimal, L.S. Salinas, C. Jose-Nunez, M. Tuena de Gomez Puyou, R.E. Navarro, Caenorhabditis elegans ATPase inhibitor factor 1 (IF1) MAI-2 preserves the mitochondrial membrane potential (Deltapsim) and is important to induce germ cell apoptosis, PLoS One 12 (8) (2017) e0181984. [21] J. Gao, J.X. Wang, X.W. Wang, MD-2 homologue recognizes the white spot syndrome virus lipid component and induces antiviral molecule expression in shrimp, J. Immunol. 203 (5) (2019) 1131–1141. [22] M.C. Yang, X.Z. Shi, H.T. Yang, J.J. Sun, L. Xu, X.W. Wang, X.F. Zhao, J.X. Wang, Scavenger receptor C mediates phagocytosis of white spot syndrome virus and restricts virus proliferation in shrimp, PLoS Pathog. 12 (12) (2016) e1006127. [23] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method, Methods 25 (4) (2001) 402–408. [24] J.J. Sun, S. Xu, Z.H. He, X.Z. Shi, X.F. Zhao, J.X. Wang, Activation of toll pathway is different between kuruma shrimp and Drosophila, Front. Immunol. 8 (2017) 1151. [25] A.S. Silveira, G.M. Matos, M. Falchetti, F.S. Ribeiro, A. Bressan, E. Bachère, L.M. Perazzolo, R.D. Rosa, An immune-related gene expression atlas of the shrimp digestive system in response to two major pathogens brings insights into the involvement of hemocytes in gut immunity, Dev. Comp. Immunol. 79 (2018) 44–50. [26] G.J. Niu, S. Wang, J.D. Xu, M.C. Yang, J.J. Sun, Z.H. He, X.F. Zhao, J.X. Wang, The polymeric immunoglobulin receptor-like protein from Marsupenaeus japonicus is a receptor for white spot syndrome virus infection, PLoS Pathog. 15 (2) (2019) e1007558. [27] V.A. Di Leonardo, V. Bonnichon, P. Roch, N. Parrinello, J.R. Bonami, Comparative WSSV infection routes in the shrimp genera Marsupenaeus and Palaemon, J. Fish Dis. 28 (9) (2005) 565–569. [28] C.M. Escobedo-Bonilla, V. Alday-Sanz, M. Wille, P. Sorgeloos, M.B. Pensaert, H.J. Nauwynck, A review on the morphology, molecular characterization, morphogenesis and pathogenesis of white spot syndrome virus, J. Fish Dis. 31 (1) (2008) 1–18. [29] I. Elbini Dhouib, M. Jallouli, A. Annabi, N. Gharbi, S. Elfazaa, M.M. Lasram, A minireview on N-acetylcysteine: an old drug with new approaches, Life Sci. 151 (2016) 359–363. [30] J. Martacic, M.K. Filipovic, S. Borozan, Z. Cvetkovic, T. Popovic, A. Arsic, M. Takic, V. Vucic, M. Glibetic, N-acetyl-L-cysteine protects dental tissue stem cells against oxidative stress in vitro, Clin. Oral Investig. 22 (8) (2018) 2897–2903. [31] J.L. Aspden, Y.C. Eyre-Walker, R.J. Phillips, U. Amin, M.A. Mumtaz, M. Brocard, J.P. Couso, Extensive translation of small open reading frames revealed by polyribo-seq, Elife 3 (2014) e03528. [32] Q. Chu, J. Ma, A. Saghatelian, Identification and characterization of sORF-encoded polypeptides, Crit. Rev. Biochem. Mol. Biol. 50 (2) (2015) 134–141. [33] A. Saghatelian, J.P. Couso, Discovery and characterization of smORF-encoded bioactive polypeptides, Nat. Chem. Biol. 11 (12) (2015) 909–916. [34] J.P. Couso, P. Patraquim, Classification and function of small open reading frames, Nat. Rev. Mol. Cell Biol. 18 (9) (2017) 575–589. [35] B. Verbruggen, L.K. Bickley, R. van Aerle, K.S. Bateman, G.D. Stentiford, E.M. Santos, C.R. Tyler, Molecular mechanisms of white spot syndrome virus infection and perspectives on treatments, Viruses 8 (1) (2016) 23. [36] X.D. Huang, L. Zhao, H.Q. Zhang, X.P. Xu, X.T. Jia, Y.H. Chen, P.H. Wang, S.P. Weng, X.Q. Yu, Z.X. Yin, J.G. He, Shrimp NF-kappaB binds to the immediateearly gene ie1 promoter of white spot syndrome virus and upregulates its activity, Virology 406 (2) (2010) 176–180. [37] P.H. Wang, Z.H. Gu, D.H. Wan, M.Y. Zhang, S.P. Weng, X.Q. Yu, J.G. He, The shrimp NF-kappaB pathway is activated by white spot syndrome virus (WSSV) 449 to facilitate the expression of WSSV069 (ie1), WSSV303 and WSSV371, PLoS One 6 (9) (2011) e24773. [38] W. Qiu, S. Zhang, Y.G. Chen, P.H. Wang, X.P. Xu, C.Z. Li, Y.H. Chen, W.Z. Fan, H. Yan, S.P. Weng, S. FrancisChan, J.G. He, Litopenaeus vannamei NF-kappaB is required for WSSV replication, Dev. Comp. Immunol. 45 (1) (2014) 156–162. [39] B. Hoesel, J.A. Schmid, The complexity of NF-kappaB signaling in inflammation and cancer, Mol. Cancer 12 (2013) 86. [40] Y. Chen, M.B. Azad, S.B. Gibson, Superoxide is the major reactive oxygen species regulating autophagy, Cell Death Differ. 16 (7) (2009) 1040–1052. [41] K.N. Schmidt, P. Amstad, P. Cerutti, P.A. Baeuerle, The roles of hydrogen peroxide and superoxide as messengers in the activation of transcription factor NF-kappa B, Chem. Biol. 2 (1) (1995) 13–22.
Acknowledgement This work was supported by grants from the National Key Research and Development Program of China (grant number 2018YFD0900502), the Natural Science Foundation of Shandong Province (Grant No ZR2018BCE050), and the China Postdoctoral Science Foundation (Grant No 2018M630781), and Shandong Provincial Key Laboratory of Animal Cell and Developmental Biology (SPKLACDB-2019015). References [1] P.B. Esparza-Molto, C. Nuevo-Tapioles, J.M. Cuezva, Regulation of the H(+)-ATP synthase by IF1: a role in mitohormesis, Cell. Mol. Life Sci. 74 (12) (2017) 2151–2166. [2] A. Garcia-Aguilar, J.M. Cuezva, A review of the inhibition of the mitochondrial ATP synthase by IF1 in vivo: reprogramming energy metabolism and inducing mitohormesis, Front. Physiol. 9 (2018) 1322. [3] J.R. Gledhill, J.E. Walker, Inhibitors of the catalytic domain of mitochondrial ATP synthase, Biochem Soc 34 (2006) 4. [4] N. Ichikawa, K. Nakabayashi, T. Hashimoto, A yeast mitochondrial ATPase inhibitor interacts with three proteins that are easy to dissociate from the mitochondrial inner membrane, J. Biochem. 132 (2002) 6. [5] C. Bornhovd, F. Vogel, W. Neupert, A.S. Reichert, Mitochondrial membrane potential is dependent on the oligomeric state of F1F0-ATP synthase supracomplexes, J. Biol. Chem. 281 (20) (2006) 13990–13998. [6] Y. Kawai, M. Kaidoh, Y. Yokoyama, T. Ohhashi, Cell surface F1/FO ATP synthase contributes to interstitial flow-mediated development of the acidic microenvironment in tumor tissues, Am. J. Physiol. Cell Physiol. 305 (11) (2013) C1139–C1150. [7] M.E. Pullman, G.C. Monroy, A naturally occurring inhibitor of mitochondrial adenosine Triphosphatase, J. Biol. Chem. 238 (1963) 3762–3769. [8] M. Fujikawa, H. Imamura, J. Nakamura, M. Yoshida, Assessing actual contribution of IF1, inhibitor of mitochondrial FoF1, to ATP homeostasis, cell growth, mitochondrial morphology, and cell viability, J. Biol. Chem. 287 (22) (2012) 18781–18787. [9] C. Chimeo, A.V. Fernandez-Gimenez, M. Campanella, O. Mendez-Romero, A. Muhlia-Almazan, The shrimp mitochondrial FoF1-ATPase inhibitory factor 1 (IF1), J. Bioenerg. Biomembr. 47 (5) (2015) 383–393. [10] H. Matsubara, K. Inoue, T. Hashimoto, Y. Yoshida, K. Tagawa, A stabilizing factor of yeast mitochondrial F1F0-ATPase-inhibitor complex: common amino acid sequence with yeast ATPase inhibitor and E. coli epsilon and bovine delta subunits, J. Biochem. 94 (1) (1983) 315–318. [11] T. Hashimoto, Y. Yoshida, K. Tagawa, Purification and properties of factors in yeast mitochondria stabilizing the F1F0-ATPase-inhibitor complex, J. Biochem. 95 (1) (1984) 131–136. [12] N. Ichikawa, C. Ando, M. Fumino, Caenorhabditis elegans MAI-1 protein, which is similar to mitochondrial ATPase inhibitor (IF1), can inhibit yeast F0F1-ATPase but cannot be transported to yeast mitochondria, J. Bioenerg. Biomembr. 38 (2) (2006) 93–99. [13] A. Genoux, V. Pons, C. Radojkovic, F. Roux-Dalvai, G. Combes, C. Rolland, N. Malet, B. Monsarrat, F. Lopez, J.B. Ruidavets, B. Perret, L.O. Martinez, Mitochondrial inhibitory factor 1 (IF1) is present in human serum and is positively correlated with HDL-cholesterol, PLoS One 6 (9) (2011) e23949. [14] D. Faccenda, J. Nakamura, G. Gorini, G.K. Dhoot, M. Piacentini, M. Yoshida, M. Campanella, Control of mitochondrial remodeling by the ATPase inhibitory factor 1 unveils a pro-survival relay via OPA1, Cell Rep. 18 (8) (2017) 1869–1883. [15] D. Faccenda, C.H. Tan, A. Seraphim, M.R. Duchen, M. Campanella, IF1 limits the apoptotic-signalling cascade by preventing mitochondrial remodelling, Cell Death Differ. 20 (5) (2013) 686–697. [16] M. Sanchez-Arago, L. Formentini, I. Martinez-Reyes, J. Garcia-Bermudez, F. Santacatterina, L. Sanchez-Cenizo, I.M. Willers, M. Aldea, L. Najera, A. Juarranz, E.C. Lopez, J. Clofent, C. Navarro, E. Espinosa, J.M. Cuezva, Expression, regulation and clinical relevance of the ATPase inhibitory factor 1 in human cancers, Oncogenesis 2 (2013) e46. [17] R. Song, H. Song, Y. Liang, D. Yin, H. Zhang, T. Zheng, J. Wang, Z. Lu, X. Song, T. Pei, Y. Qin, Y. Li, C. Xie, B. Sun, H. Shi, S. Li, X. Meng, G. Yang, S. Pan, J. Zhu, S. Qi, H. Jiang, Z. Zhang, L. Liu, Reciprocal activation between ATPase inhibitory factor 1 and NF-kappaB drives hepatocellular carcinoma angiogenesis and
254