Characterizations and expression analyses of NF-κB and Rel genes in the Yesso scallop (Patinopecten yessoensis) suggest specific response patterns against Gram-negative infection in bivalves

Fish & Shellfish Immunology 44 (2015) 611e621

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Characterizations and expression analyses of NF-kB and Rel genes in the Yesso scallop (Patinopecten yessoensis) suggest specific response patterns against Gram-negative infection in bivalves Ruojiao Li 1, Ru Zhang 1, Lu Zhang, Jiajun Zou, Qiang Xing, Huaiqian Dou, Xiaoli Hu, Lingling Zhang*, Ruijia Wang*, Zhenmin Bao Key Laboratory of Marine Genetics and Breeding, College of Marine Life Sciences, Ocean University of China, 5 Yushan Road, Qingdao 266003, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 13 January 2015 Received in revised form 20 March 2015 Accepted 25 March 2015 Available online 1 April 2015

Rel/NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) genes are evolutionarily conserved and play a pivotal role in several physiological events. They have been extensively studied from various species, including both vertebrates and invertebrates. However, the Rel/NF-kB genes have not been systematically characterized in bivalves. In this study, we identified and characterized PyNF-kB and PyRel in the Yesso scallop (Patinopecten yessoensis). Phylogenetic and protein structural analyses were conducted to determine the identities and evolutionary relationships of Rel/NF-kB genes in Yesso scallop. Compared with the Rel/NF-kB genes from vertebrate species, the PyNF-kB and PyRel are relatively conserved in their structural features, but there were no paralogs found in P. yessoensis or other invertebrates. To gain insights into the roles of Rel/NF-kB genes during the innate immune response in scallop, quantitative real-time PCR was used to investigate the expression profiles of these genes at different developmental stages, in healthy adult tissues and in the hemolymph after bacterial infection with Micrococcus luteus and Vibrio anguillarum. The real-time PCR results indicated the abundance of PyNF-kB in the first four embryonic stages, including oocytes, fertilized eggs, morulae and blastulae. By contrast, PyRel was abundantly expressed in blastulae, trochophores and D-shaped larvae. In adult scallops, PyNF-kB and PyRel were ubiquitously expressed in most healthy tissues and highly expressed in most of the immune related tissues. Both genes were significantly up-regulated during the acute phase (3 h) after infection with Gram-positive (M. luteus) and negative (V. anguillarum) bacteria, while the much higher expression level of PyNF-kB suggested the involvement of the extra immune deficiency (IMD)-like pathway against the Gram-negative bacterial infection. The complex pattern of Rel/NF-kB induced expression suggested that PyNF-kB and PyRel both have specific and cooperative roles in the acute immune responses to bacterial infection. © 2015 Elsevier Ltd. All rights reserved.

Keywords: Rel/NF-kB Patinopecten yessoensis Innate immune response Gram-positive and gram-negative infection IMD

1. Introduction The innate immune system appeared early in evolution and functions as the first line of defense against invading pathogens [1]. In invertebrates such as bivalves, the innate immunity is especially important in defensive responses, as the absence of an adaptive immune system makes the innate immune system far more important to the survival of the organism [2]. During the innate immune response, the invasion of a large spectrum of chemically

* Corresponding authors. Tel./fax: þ86 532 82031969. E-mail addresses: [email protected] (L. Zhang), (R. Wang). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.fsi.2015.03.036 1050-4648/© 2015 Elsevier Ltd. All rights reserved.

[email protected]

diverse agents and pathogens can lead to the rapid activation of the nuclear factor kB (NF-kB) system through the degradation of its inhibitors and the subsequent liberation of NF-kB dimers. This phylogenetically conserved signaling mechanism of activating the NF-kB system plays a key role in the control of several cellular and organismal processes, including inflammatory responses, cellular growth, apoptosis, and providing an immediate cellular reaction at the heart of this first-line immune defense. NF-kappa B (NF-kB) proteins comprise a family of structurally related eukaryotic transcription factors that are ubiquitous and conserved in most animals ranging from invertebrates to vertebrates. These proteins were first described as regulators controlling the expression of the kappa-light-chain gene in murine B lymphocytes [3]. To date, up to 5 unique Rel/NF-kB genes have been

612

R. Li et al. / Fish & Shellfish Immunology 44 (2015) 611e621

found from various species. In mammals and other vertebrates, the NF-kB transcription factor family consists of five proteins, p65 (RelA), RelB, c-Rel, p105/p50 (NF-kB1) and p100/52 (NF-kB2), which associate with each other to form distinct, transcriptionally active homo- and heterodimeric complexes. In invertebrates, their counterparts are fewer and possess their own nomenclature [4,5]. However, the mechanisms that regulate NF-kB in invertebrates such as Drosophila melanogaster [5] are very similar to the regulatory mechanisms identified in mammals, which points to a common ancestry between these immune mechanisms. All the NF-kB family members contain one highly conserved Rel homology domain (RHD), which facilitates DNA binding, dimerization and interaction with the regulatory proteins. Based on the sequences of their C-terminal regions, Rel/NF-kB proteins can be divided into two classes: class I and II. The class I proteins contain one death domain (DEATH) and multiple copies of ankyrin (ANK) repeats, which have trans-repression activities. The class II proteins, also known as the Rel class proteins (RelA, RelB and c-Rel in mammals; Dorsal and Dif in Drosophila; and Gambif in Anopheles), possess one C-terminal transcription activation domain (TAD) that displays a high sequence similarity between vertebrates but is not conserved at the sequence level across invertebrate species. Unlike the Rel/NF-kB studies in vertebrates and insects, systematic analyses of the NF-kB families have not been conducted in mollusk species, although isolated studies have been conducted in Chlamys farreri [6], Crassostrea gigas [4], Haliotis diversicolor supertexta [7], Haliotis discus discus [8], and Biomphalaria glabrata [9]. In a number of mollusk studies, individual Rel or NF-kB genes have been reported to be involved in the innate immune responses. For instance, Rel/NF-kB mRNA displayed significantly differential patterns of expression during bacterial infection of the hemolymph in C. farreri, C. gigas and H. d. supertexta. In C. farreri, the abundance of CfRel mRNA transcripts increased distinctly in both the peptidoglycan (PGN, from Staphylococcus aureus) and lipopolysaccharide (LPS) stimulating groups. In C. gigas, either the injection of Grampositive bacteria (Micrococcus luteus) or Gram-negative bacteria (Escherichia coli D31) induced an accumulation of CgRel transcripts at 9 h post treatment. In H. d. supertexta, AbRel transcripts were increased by lipopolysaccharides (LPS) infection. Yesso scallop (Patinopecten yessoensis) have contributed tremendously to the aquaculture industry of northern China since this species was introduced from Japan in 1982 [10]. In recent years, severe causes of mortality in scallops have been reported, which have led to great pecuniary losses mainly due to the large-scale breakouts of bacterial diseases [11,12]. To improve the health of the scallop industry, genes with potentially important involvement in disease and stress resistance have been identified and functionally characterized in recent years [13e15]. However, the knowledge regarding the breadth and function of the NF-kB family in Yesso scallop is still limited. Hence, in this study, our goal was to characterize Yesso scallop Rel/NF-kB genes and their expression profiles after infections with Gram-positive and Gram-negative bacteria, respectively. Here, we identified the PyNF-kB and PyRel genes and explored their expression profiles during different developmental stages, in healthy scallop tissues, and in the hemolymph after infection with M. luteus or Vibrio anguillarum, aiming to provide mechanistic insights into the innate immune response of scallop. 2. Materials and methods 2.1. Database mining, gene identification and sequence analysis To identify the Rel/NF-kB genes, the transcriptome [16] and whole genome sequence databases of Yesso scallop (unpublished data) were searched using all Rel/NF-kB protein sequences available in the

databases of NCBI (http://www.ncbi.nlm.nih.gov), Ensembl (http:// useast.ensembl.org) and Echinobase (http://www.echinobase.org/ Echinobase/). The Rel/NF-kB sequences from the invertebrates Ciona intestinalis, Lytechinus variegates, Strongylocentrotus purpuratus, Amphimedon queenslandica, D. melanogaster, H. diversicolor supertexta, H. discus discus, B. glabrata, C. gigas, Mytilus galloprovincialis, Pinctada fucata, and C. farreri and the vertebrates Homo sapiens, Mus musculus, Gallus gallus, Xenopus tropicalis and Danio rerio were used as queries against the TBLASTN transcriptome database for Yesso scallop with an e-value of 1e-5. The scallop cDNA sequences with blast hits were selected. Next, BLASTN was performed to confirm the existence of those cDNA sequences by mapping them to the whole genome assembly. The ORF (open reading frame) finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) and DNAstar (version 7.1) were employed to predict the amino acid sequences. The predicted amino acid sequences were then confirmed using BLASTP against the NCBI non-redundant protein sequence database. After these multiple confirmation steps were performed, the coding sequences of the candidate Rel/NF-kB genes were obtained and 50 UTR sequences, 30 UTR sequences, and lengths were identified from their corresponding transcriptome contigs. The transcriptome databases were constructed from the RNA-seq data obtained from different tissues of Yesso scallop with decent coverage (>20 million reads per tissue). Through the analysis of candidate PyNF-kB and PyRel transcriptome contigs, we found that the UTR regions of these two genes in different tissues were consistent. These results were further confirmed by the genome sequences. Finally, full length cDNA was obtained for the Rel/NF-kB genes. The conserved domains were identified by using the simple modular architecture research tool (SMART) (http://smart.embl.de/). The putative isoelectric points and molecular weights were computed using the Compute pl/Mw tool (http://web.expasy.org/compute_pi/). The secondary structures of the Yesso scallop Rel/NF-kB proteins were predicted using Geneious 7.0.6 (http://www.geneious.com/). 2.2. Phylogenetic analysis The Rel/NF-kB proteins from other vertebrates and invertebrates, including H. sapiens, M. musculus, G. gallus, X. tropicalis, D. rerio, C. intestinalis, L. variegates, S. purpuratus, A. queenslandica, D. melanogaster, H. d. supertexta, H. d. discus, B. glabrata, C. gigas, M. galloprovincialis, P. fucata and C. farreri, were chosen for phylogenetic analysis of the Yesso scallop Rel/NF-kB proteins. The Rel/NF-kB amino acid sequences from these species were retrieved from the NCBI, Ensembl Genome Browser and Echinobase databases. Multiple Rel/NF-kB protein sequences were aligned using the ClustalW2 program [17]. The phylogenetic tree was constructed using the neighbor-joining method in MEGA 6 [18]. Bootstrapping with 1000 replications was conducted to evaluate the phylogenetic tree. 2.3. Bacterial challenge and scallop collection A total of 200 two-year-old P. yessoensis specimens were obtained in January 2014 from the Dalian Zhangzidao Fishery Group Corporation (Liaoning Province, China). After collection, the scallops were used in the M. luteus and V. anguillarum challenge experiments described by Cong et al. [19]. All the procedures that involved the handling and treatment of scallops during this study were approved by the Ocean University of China Institutional Animal Care and Use Committee (OUC-IACUC) prior to the initiation of the study. Briefly, M. luteus and V. anguillarum were cultured (Tryptone 5 gL1, yeast extract 1 gL1, C6H5Fe$5H2O 0.1 gL1, pH ¼ 7.6) at 28  C to OD600 ¼ 0.2 and centrifuged at 2000 g for 5 min to harvest the bacteria. For the bacterial infection, the

R. Li et al. / Fish & Shellfish Immunology 44 (2015) 611e621

scallops were randomly divided into three groups with 60 scallops per group. One group was employed as the control, and the other two treatment groups received immersion infections of M. luteus (2  107 CFUmL1) and V. anguillarum (1  107 CFUmL1) in seawater. At each time point of 0 h, 3 h, 6 h, 12 h and 24 h post infection, 10 individuals were collected from each of the three groups. Samples were collected from the mantle, gill, gonad, kidney, hepatopancreas, smooth muscle, striated muscle, foot, eye and hemolymph, flash-frozen in liquid nitrogen, and stored at 80  C until RNA extraction. To obtain samples representing the different developmental stages, cultures were conducted at spawning, fertilization and larval stages following previously detailed protocols [20]. Briefly, to induce spawning, sexually mature scallops were exposed to the air in darkness for 1 h, and then were thermally stimulated by raising the seawater temperature from 9  C to 12  C. After fertilization, the embryos were incubated at 12e13  C until they developed into juvenile mollusks. Samples including the oocytes, fertilized eggs, morulae, blastulae, gastrulae, trochophores, D-shaped larvae, umbo larvae, eyespots larvae and juvenile mollusks were collected, preserved in RNAlater® (SigmaeAldrich, MO, USA) and stored at 80  C until use. 2.4. RNA extraction and quantitative real-time PCR analysis Total RNA was isolated following the method described by Hu et al. [14], and then digested with DNase I (TaKaRa, Shiga, Japan). The RNA concentration and purity were determined using a Nanovue Plus spectrophotometer (GE Healthcare, NJ, USA). The RNA integrity was determined by agarose gel electrophoresis. First strand cDNA was synthesized using Moloney murine leukemia virus (MMLV) reverse transcriptase (Thermo, USA) following the manufacturer's protocol. All of the cDNA products were then diluted to 5 ng/ml for use in real-time PCR. Real-time PCR was conducted using the SsoFast™ EvaGreen® Supermix on a Light Cycler 480 Real-time PCR System (Roche Diagnostics, Mannheim, Germany). The running program was as follows: 50  C for 2 min, 94  C for 10 min, followed by 40 cycles of 94  C for 15 s and 62  C for 1 min. Cytochrome B (CB), DEAD-box RNA helicase (HELI) and b-actin were separately designated as internal reference genes for the normalization of gene expressions in the embryonic tissues, healthy adult and test subjects during the real-time PCR experiments [21]. The specificity of the primers were assessed by alignment with the P. yessoensis transcriptome and a draft genome assembly (unpublished data) using BLASTN with an e-value of 1e10. The melting curve analysis was also performed to verify that each primer set amplified a single product. All the primers used in real-time PCR were designed by Primer Premier 5.0 and are listed in Table 1. The data from the real-time PCR were analyzed using the Relative Expression Software Tool (REST) version 2009 [22]. In the analyses of gene expressions during different developmental stages and in healthy tissues, the group with the lowest overall Ct value was selected as the control group in REST. The relative expression levels of all other groups were then calculated based on the control group. The statistical analysis of the data was performed with SPSS (version 16.0) software using the Independent-Samples T-Test. Differences were considered significant if P < 0.05. 3. Results 3.1. Gene identification and sequence analysis Two Rel/NF-kB genes were identified in P. yessoensis and were named as PyNF-kB and PyRel according to the nomenclature of the

613

Table 1 Sequences of all primers used in quantitative RT-PCR. Gene name

Primer sequence (50 e30 )

Amplicon length (bp)

b-actin

F:CCAAAGCCAACAGGGAAAAG R:TAGATGGGGACGGTGTGAGTG F:CCAGGAGCAGAGGGAGTTCG R:GTCTTACCAGCCCGTCCAGTTC F:CCTCTCCACCCTTTCTAGTCCTTG R:CTCCTGGTTCTTCGTCTTTCTCC F:TGCCCGTGTTGTGGTAACCTTGG R:CGTGAGAGAGTTTTGTCCGCCCTT F:CGAGATTGTGAGGGTGAGGC R:GTTACGAATGCGAGGGACGAT

163

HELI CB NF-kB Rel

186 170 130 168

C. gigas Rel/NF-kB genes [4]. The open reading frames (ORF) of PyNFkB and PyRel were 3465 and 1920 bp, respectively, which encoded 1154 amino acids (PyNF-kB) and 639 amino acids (PyRel). The 50 UTR and 30 UTR sequences and lengths of the PyNF-kB and PyRel genes were identified from their corresponding transcriptome contigs and further confirmed by genome sequences. The full length cDNA were obtained after the combination of the UTR and ORF regions. The cDNA sequences of these two genes were submitted to GenBank with the accession numbers of KP408145 for PyNF-kB and KP408146 for PyRel. The complete DNA sequences were 21,850 bp for PyNF-kB and 12,255 bp for PyRel. The structures of the NF-kB family sequences were constructed in Fig. 1 based on their previously screened gDNA and mRNA sequences. The GT-AG rule was used to distinguish the intron-exon boundaries [22,23]. The PyNFkB gene was organized into 21 exons with lengths ranging from 54 bp to 774 bp, whereas PyRel contained 12 exons with lengths ranging from 72 bp to 660 bp. The deduced secondary structures of the PyNF-kB and PyRel proteins are shown in Table 2. These data indicated that the PyNF-kB protein contained 43 alpha helixes, 76 beta strands, 94 coils and 90 turns, while the PyRel protein contained 16 alpha helixes, 41 beta strands, 56 coils and 54 turns. The predicted molecular weights of PyNF-kB and PyRel were 127.54 and 70.69 kDa, respectively, whereas the isoelectric points (pI) were 5.95 for PyNF-kB and 5.74 for PyRel. When PyNF-kB was compared between P. yessoensis and other mollusks, the sequence showed 66% identity with NF-kB from B. glabrata and 56% identity with NFkB from M. galloprovincialis. When PyNF-kB was compared to the vertebrate NF-kB paralogs, the similarity was still between 43% and 51% (Supplementary Table 1). PyRel showed 90%, 64% and 64% identity with its paralogs in C. farreri, P. fucata, and C. gigas, respectively. Meanwhile, it was shown that PyRel displayed 51e52% identity to RelA, 41e46% to RelB and 46e51% to c-Rel in vertebrates (Supplementary Table 2). According to the results from the SMART analysis, several functional domains were recognized in the NF-kB proteins (Fig. 1). Like most of the vertebrate and invertebrate Rel/NF-kBs [4,6e9,24e26], each P. yessoensis Rel/NF-kB protein contained an RHD domain containing its representative signature sequence (F-R-Y-X-C-E-G) and an IPT (Ig-like, plexins, transcription factor) domain. These domains are evolutionarily conserved among various species from vertebrates to invertebrates (Fig. 2). In addition to these conserved functional domains, two conserved motifs, the DNA-binding motif (R-X-X-R-X-RX-X-C) and the nuclear localization signal (NLS) (KeK/R-X-K/R), were also identified in both PyNF-kB and PyRel. Similarly to the other invertebrate NF-kB proteins, PyNF-kB also contained 6 ANK domains and a specific DEATH domain, which consisted of 88 amino acids extending from Gly 1033 to Asp 1120. As expected, the TAD domain in PyRel could not be predicted due to its high sequence variation, but the location of this domain was estimated according to its sequence similarity with the Rel protein from Pacific oyster [4] and the data from previous studies [27,28].

614

R. Li et al. / Fish & Shellfish Immunology 44 (2015) 611e621

Fig. 1. NF-kB (A) and Rel (B) sequences from P. yessoensis. The light blue boxes indicate the 30 UTRs and 50 UTRs. The blue boxes indicate the exons. The white horizontal lines indicate the introns. The sequences are exhibited according to the lengths (bp) of their gDNA and mRNA sequences, which were obtained from the genome databases and the transcriptome of P. yessoensis. The white boxes represent the amino acid sequences without their predicted functional domains, while the colored boxes represent the regions with successfully predicted functions. Annotated domains: RHD, Rel homology domain (purple); IPT, Ig-like, plexins, transcription factors (light purple); ANK, ankyrin repeats (light pink); DEATH, death domain (pink); TAD, transcription activation domain (yellow). The protein domains are shown relative to their lengths and positions in the amino acid sequences. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

3.2. Phylogenetic analysis of Rel/NF-kB Phylogenetic analyses were conducted for the Rel/NF-kB proteins of P. yessoensis and other species. As clearly shown in Fig. 3, all Rel/NF-kB proteins were divided into two large clades: one clade consisted of class I Rel/NF-kB proteins and included the longerlength proteins p105 and p100 from vertebrates and NF-kB from invertebrates; the other clade consisted of class II Rel/NF-kB proteins and included the three paralogs of vertebrate Rel, RelA, RelB and c-Rel as well as invertebrate Rel. Based on the phylogenetic analyses of both clades, it was apparent that P. yessoensis Rel/NF-kB was first clustered together with bivalves and gastropods and then clustered with arthropods and echinoderms. Such a relationship is consistent with the phylogeny of these invertebrates. For instance, P. yessoensis is phylogenetically closer to the other mollusks, such as C. farreri and C. gigas, than to arthropods and echinoderms. The

Table 2 Summary of sequence features of P. yessoensis NF-kBs.

cDNA length (bp) ORF length (bp) 50 UTR length (bp) 30 UTR length (bp) Mature peptide AA length Molecular weight (kDa) Isoelectric point Number of alpha helixes Number of beta strands Number of coils Number of turns Predicted signal peptide

PyNF-kB

PyRel

3882 3465 167 250 1154 127.54 5.95 43 76 94 90 No

2097 1920 146 31 639 70.69 5.74 16 41 56 54 No

same is true for the Rel/NF-kB proteins. In the clade containing the Rel proteins, the proteins from protostomes and deuterostomes were clearly separated into two major clusters. The deuterostome cluster contained the paralogs of Rel from mammals, birds, amphibians, fishes, notochords and echinoderms, whereas the corresponding Rels from other lower invertebrates were observed in the protostome cluster. However, even though the homologs of NF-kB from deuterostomes were clustered together, no similar pattern was observed for the Rel proteins from protostome. This phylogenetic result confirmed the identities of PyNF-kB and PyRel genes in Yesso scallop.

3.3. Spatiotemporal expressions of PyRel and PyNF-kB Quantitative real-time PCR was used to analyze the expressions of PyNF-kB and PyRel during the ten developmental stages of Yesso scallop. As shown in Fig. 4, PyNF-kB and PyRel displayed distinctive distribution patterns during all developmental stages. The expression level of PyNF-kB was significantly higher in the first four stages (oocytes, fertilized eggs, morulae and blastulae) than in the other stages. Its expression reached the highest level in blastulae and then gradually declined until umbo larvae. After the umbo larvae stage, the expression of PyNF-kB was notably increased to levels similar to those of the gastrulae stage. Compared to PyNF-kB, the expression level of PyRel was initially low in oocytes, fertilized eggs and morulae, then gradually increased from blastulae until it reached its maximum expression level at the D-shaped larvae stage. In umbo larvae, the abundance of PyRel dramatically dropped 6.6 times and started to gradually increase until it returned to its initial intermediate level by the juvenile stage.

R. Li et al. / Fish & Shellfish Immunology 44 (2015) 611e621

615

Fig. 2. Multiple alignments of the PyNF-kB (A) and PyRel (B) amino acid sequence fragments with homologous sequences from other species, which were downloaded from the NCBI, Ensembl Genome Browser and Echinobase databases. Conserved amino acid residues are shaded in black. The grey shaded regions represent the similar amino acid residues. Gaps are represented by dashes to improve the alignment. The regions marked with vertical lines and arrows separately represent the RHD, IPT, ANK and DEATH domains. The DNAbinding motif (R-X-X-R-X-R-X-X-C) and the nuclear localization signal (NLS) (KeK/R-X-K/R) are indicated by red boxes. The red triangles represent the signature sequence of the RHD domain. The accession numbers of Rel/NF-kB in other species are included in Supplementary Table 3.

The expression profiles of the PyNF-kB and PyRel genes were then studied in the mantle, gill, gonad, kidney, hepatopancreas, smooth muscle, striated muscle, foot, eye and hemolymph tissues from healthy adult scallops. As shown in Fig. 5, PyNF-kB was

expressed lowed by fold). Its including

at the highest level in the hemolymph (4.3-fold), folthe gill (3.7-fold), kidney (3.5-fold) and mantle (3.2expression was low (3-fold) in all other tissues, the foot, smooth muscle, striated muscle, eye,

616

R. Li et al. / Fish & Shellfish Immunology 44 (2015) 611e621

Fig. 2. (continued).

hepatopancreas and gonad. Similar to PyNF-kB, the expression of PyRel was predominantly detected in gill (10.0-fold) followed by the hemolymph, kidney, mantle, striated muscle and smooth muscle with fold changes ranging from 4.2 to 9.6. The expression of PyRel was also low or barely detectable in the foot, eye, gonad and hepatopancreas.

3.4. Temporal expressions of PyRel and PyNF-kB after bacterial challenge Yesso scallops were challenged with M. luteus and V. anguillarum to further examine the expression patterns of PyNF-kB and PyRel in response to bacterial invasion. The induction levels of PyNF-kB and

R. Li et al. / Fish & Shellfish Immunology 44 (2015) 611e621

617

Fig. 3. A phylogenetic tree of the NF-kB family constructed using MAGA version 6. The numbers show the bootstrap percentages (1000 replicates) obtained using the neighborjoining (NJ) method. The black rhombuses indicate PyNF-kB and PyRel. The black dashed boxes indicate the vertebrate paralogues of the NF-kB (p105, p100) and Rel (RelA, RelB, c-Rel) proteins. The accession numbers of Rel/NF-kB in other species are included in Supplementary Table 3.

PyRel were analyzed in the hemolymph at several time points postechallenge (3, 6, 12 and 24 h) due to the critical roles of the hemolymph in the innate immune responses reported in bivalves [29,30]. As shown in Fig. 6, the overall expression patterns of PyNF-

kB and PyRel were similar. The expressions of both these genes were most significantly induced at 3 h after infection with M. luteus, but the level of PyNF-kB was slightly higher than the level of PyRel, as PyNF-kB was up-regulated by 6.7-fold while PyRel was up-regulated

618

R. Li et al. / Fish & Shellfish Immunology 44 (2015) 611e621

Fig. 4. Relative spatiotemporal expression levels of PyNF-kB (A) and PyRel (B) during the developmental stages. The vertical bars represent the means ± S.E. (N ¼ 3). Values that lack a single conserved letter differ significantly from each other if P < 0.05.

Fig. 5. The relative trends in the spatiotemporal expressions of PyNF-kB (A) and PyRel (B) in adult tissues. The vertical bars represent the means ± S.E. (N ¼ 3). Values that lack a single conserved letter differ significantly from each other if P < 0.05.

by 5.8-fold. The up-regulation of PyNF-kB and PyRel expression continued by 6 h and 12 h, during which their relative expressions were still higher (1.8e2.6-fold) than their expression levels in the control groups. After V. anguillarum infection, the expression levels of PyNF-kB and PyRel were also promptly elevated, reaching their highest levels within 3 h. These levels declined gradually after the acute increases, but did not return to their normal values until 12 h postechallenge. Interestingly, at 24 h, both PyNF-kB and PyRel displayed another notable elevation that was comparable to the heightened expression level at 3 h. This second elevation did not occur when the scallops were challenged with M. luteus. Although the expression trends of PyNF-kB and PyRel were similar, the amount of fluctuation in the PyNF-kB lever was much more dramatic (2.2e58.0-fold) compared to the fluctuations in PyRel expression (1.4e13.3-fold). It was also noteworthy that the PyNF-kB and PyRel genes in Yesso scallops exhibited higher expression and response levels against the invasion of Gram-negative bacteria (V. anguillarum) compared to infection with Gram-positive bacteria.

signaling cascades that protect the host [30e32]. As the most important component in the Rel/NF-kB signal transduction pathway, Rel/NF-kB has been extensively studied in various species, including the vertebrates H. sapiens, M. musculus and D. rerio [24,33e35] as well as invertebrates such as D. melanogaster [36]. In mollusks, the Rel/NF-kB homolog was first characterized in the oyster [4]. Several Rel/NF-kB homologs in other bivalves have since been reported to play fundamental roles in the immune response [6e9]. In C. farreri, the transcriptional activity of NF-kB decreased evidently after the co-expression of the CfIkB protein. In H. d. supertexta, the DNA binding capacity of NF-kB increased under LPS induction. Despite these findings, a systematic analysis of the whole Rel/NF-kB gene family in bivalves was still limited. In the present study, we identified all Rel/NF-kB genes in the Yesso scallop, conducted the phylogenetic analysis and expression profiling of these genes during different developmental stages and in normal tissues, and assessed their expression in the hemolymph after bacterial infection to gain insights into their gene identities, orthologs, expression, and involvement in early development and immune responses against bacterial invasion. After extensive data mining using a full length transcriptome database [16] and a preliminary genome assembly (unpublished), PyNF-kB and PyRel were identified in the Yesso scallop. Like other Rel/NF-kB proteins from vertebrates and invertebrates, both PyNFkB and PyRel contained one conserved RHD domain and an IPT domain. For the class-specific domains, although a DEATH domain and several ANK domains were found in PyNF-kB, the TAD domain that functions as activator of kB element-driven reporters [26] was not recognized in the corresponding region of the PyRel protein due to its poor sequence conservation between species. Despite the lack

4. Discussion The innate immune system is the first line of defense for most organisms against the invasion of pathogens. The Rel/NF-kB signal transduction pathway plays the most important role in the innate immune system, interacting with pattern recognition receptors such as Toll-like receptors (TLRs), nucleotide-binding domain leucine-rich repeat containing receptors (NLRs), and the Retinoic acid-inducible gene I (RIG-I) to trigger a variety of immune

R. Li et al. / Fish & Shellfish Immunology 44 (2015) 611e621

Fig. 6. Temporal expression patterns of PyNF-kB and PyRel exposed to Gram-positive (M. luteus) (A) and Gram-negative (V. anguillarum) (B) bacteria. The vertical bars represent the means ± S.E. (N ¼ 10, the male and female cannot be discriminated). “*” indicates differences that are statistically significant when P < 0.05; “**” indicates extremely significant differences when P < 0.01.

of an accurate position of the TAD domain, the critical functional and evolutionary roles of PyRel have been reported in shellfish and should not be neglected. For instance, CgRel (C. gigas) has been shown to trigger the overexpression of a Rel-controlled reporter gene based on the integrity of its C-terminal TAD [4]. In Paralichthys olivaceus, the distinct selective pressures acting on the RHD and TAD domains were believed to be the major factors behind the faster molecular evolution and poor conservation levels of the TAD regions in Rel proteins [26,37]. Considering the importance of the TAD domain, we predicted the location of TAD in PyRel (Fig. 1) according to its sequence similarity with the Pacific oyster [4] and the results from previous studies [27,28]. Although the TAD domain was not accurately recognized in PyRel, the identities of PyNF-kB and PyRel were still verified through phylogenetic analyses (Fig. 3). The phylogenetic position of PyRel was consistent with the positions of Rel from several other invertebrates, such as C. intestinalis, S. purpuratus, L. variegates, B. glabrata and M. galloprovincialis, in which only two Rel/NF-kBs were identified (including one Rel and one NF-kB). In addition, the phylogenetic tree also indicated the orthologous relationship between the protostome NF-kBs and the deuterostome p105 and p100 proteins. By contrast, the invertebrate Rels were likely orthologous to the vertebrate RelA, RelB and c-Rel proteins. The greater number of vertebrate Rel/NF-kB paralogues may have been due to gene duplication and the relevance of Rel/NFkB to the emergence of an adaptive immune system [38]. The distinct fluctuations in the expression patterns of PyNF-kB and PyRel over all ten developmental stages indicated the different roles of these genes during embryonic and larval development. PyNF-kB and PyRel were expressed in most developmental stages, which is consistent with the role of the Rel/NF-kB signal transduction pathway in cell growth and embryonic morphogenesis that

619

has been reported in other species [24,25,39]. However, the expression of PyNF-kB peaked much earlier than the expression of PyRel during development, suggesting that NF-kB could be involved in embryonic polarization and morphogenesis, which has been reported in zebrafish [24]. By contrast, Rel might be involved in the declining rates of apoptosis during the gastrulae stage [40]. Nevertheless, the expression levels of both PyNF-kB and PyRel significantly decreased after their peak stages before generally increasing during the juvenile stage. A similar phenomenon has also been found in D. rerio and S. purpuratus [24,41], which suggests the consumption and recovery of these genes during embryonic development. To provide insights into the function of Rel/NF-kB in the innate immune response of scallop, the expression analyses were performed after infection with Gram-positive (M. luteus) and Gramnegative (V. anguillarum) bacteria. Previous studies have shown that the hemolymph is one of the major immune tissues in mollusks and that the recognition and elimination of bacterial pathogens occurs in this tissue [29,30]. The expression pattern of PyNF-kB and PyRel was consistent with their activation by interleukin 1 (IL1), Toll-like microbial pattern recognition receptors (TLRs), Peptidoglycan Recognition Proteins (PGRP) and tumor necrosis factor a (TNFa) through their corresponding signaling pathways, which have been wildly reported in humans, ewes, Pacific oysters and Mediterranean mussels [11,42e44]. The consistent expression time points between the PyNF-kB/Rel and TLR/IL-1R signaling pathway confirmed the important regulatory roles of the Rel/NF-kB genes in the innate immune response of bivalves [44]. Not coincidentally, the much stronger expression levels of both PyNF-kB and PyRel after infection with V. anguillarum compared to infection with M. luteus were correlated with the different response levels of the shellfish TLR signaling pathway in combating infections by Gram-positive and Gram-negative bacteria. For instance, in the Pacific oyster, the infection of Gram-negative bacteria such as L. monocytogenes and Vibrio parahaemolyticus has been shown to induce significantly higher expression levels of multiple CgTLRs and CgMyD88 genes than all the other Gram-positive bacteria [44]. A similar pattern has also been found in the Mediterranean mussel [43]. Interestingly, another strong response of the PyNF-kB and PyRel genes at 24 h postechallenge was observed in the Yesso scallop, which has also been reported in CfRel [6]. This specific expression pattern in Yesso scallop also suggests that PyNF-kB and PyRel have potential novel features and functions during the innate immune response against bacteria invasion. Although the expression levels of PyNF-kB and PyRel were both significantly increased at 3 h, 6 h and 24 h postechallenge with V. anguillarum, the fold changes of PyNF-kB were much higher than those of PyRel (Fig. 6). For instance, PyNF-kB was highly induced by over 50-fold at 3 h after infection with V. anguillarum, which was 44.6-fold higher than the differential expression level of PyRel. Even at other time points, the expression of PyNF-kB was still at least 0.7fold higher than the expression of PyRel. The distinct expression level of PyNF-kB during infection with V. anguillarum indicated the possible involvement of an extra antibacterial immune response or signaling pathway in the activation of NF-kB genes to protect scallops against invasion by Gram-negative bacteria. In Drosophila, this specific pathway has been reported as the immune deficiency (IMD) pathway. The IMD pathway is triggered by an interaction between the transmembrane receptor PGRP (peptidoglycan recognition protein)-LC and the peptidoglycan of Gram-negative bacteria, followed by an interaction with dFADD (Fas-associated death domain-containing protein), which then binds to the apical caspase Dredd (Drosophila caspase-8 orthologue Death-related ced-3/Nedd2-like protein). Dredd maintains an association with the NF-kB ortholog Relish which is phosphorylated by the IKK

620

R. Li et al. / Fish & Shellfish Immunology 44 (2015) 611e621

signaling complex. After Relish is cleaved, its RHD domain is translocated to the nucleus while its inhibitory domains remain stable in the cytoplasm [5]. In mollusks, a pathway similar to the Drosophila IMD pathway has also been reported in Litopenaeus vannamei and B. glabrata [45,46]. However, the existence of an IMD or IMD-like pathway has not yet been reported in bivalves [47]. By comparing the differential expression levels of PyNF-kB and PyRel after bacterial infections in Yesso scallops, our results provide clues of the possible involvement of the IMD pathway in responding to infection with Gram-negative bacteria. Further studies at both the transcriptome and protein levels, which should utilize RNA-seq, western blot and protein sequencing techniques, are warranted to identify the core regulatory genes in this pathway, determine the particular correlation with PyNF-kB, and understand the detailed mechanisms of the antibacterial immune responses following Gram-negative bacterial infection in scallops. Acknowledgments We thank Dalian Zhangzidao Fishery Group Corporation (Liaoning Province, China) for providing scallop materials. Financial support for this work was provided by the National High-Tech R&D Program (863 Program, 2012AA10A402), National Key Technology R&D Program of China (2011BAD13B06), and the earmarked fund for Modern Agro-industry Technology Research System (CARS-48). The authors also wish to thank Xiaohua Zhang for providing bacteria strains and technical assistance in bacterial challenge experiments. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2015.03.036. Abbreviations NF-kB Rel RHD IPT ANK DEATH TAD ORF NLS PGN LPS CB HELI TLRs NLRs RIG-I IL-1 PGRP TNFa IMD dFADD Dredd IKK NCBI BLAST SMART

nuclear factor kappa-light-chain-enhancer of activated B cells v-rel avian reticuloendotheliosis viral oncogene homolog Rel homology domain Ig-like, plexins, transcription factor domain ankyrin domain death domain transcription activation domain open reading frame nuclear localization signal peptidoglycan lipopolysaccharide Cytochrome B DEAD-box RNA helicase Toll-like microbial pattern recognition receptors nucleotide-binding domain leucine-rich repeat containing receptors Retinoic acid-inducible gene I interleukin 1 peptidoglycan recognition protein tumor necrosis factor a immune deficiency pathway Fas-associated death domain-containing protein Drosophila caspase-8 orthologue Death-related ced-3/ Nedd2-like protein IkB kinase National Center for Biotechnology Information Basic Local Alignment Search Tool Simple Modular Architecture Research Tool

MEGA REST SPSS

Molecular Evolutionary Genetics Analysis Relative Expression Software Tool Statistical Product and Service Solutions

References [1] J.A. Hoffmann, F.C. Kafatos, C.A. Janeway, R. Ezekowitz, Phylogenetic perspectives in innate immunity, Science 284 (1999) 1313e1318. [2] C. Hauton, V.J. Smith, Adaptive immunity in invertebrates: a straw house without a mechanistic foundation, Bioessays 29 (2007) 1138e1146. [3] R. Sen, D. Baltimore, Multiple nuclear factors interact with the immunoglobulin enhancer sequences, Cell 46 (1986) 705e716. [4] C. Montagnani, C. Kappler, J. Reichhart, J. Escoubas, Cg-Rel, the first Rel/NF-kB homolog characterized in a mollusk, the Pacific oyster Crassostrea gigas, FEBS Lett. 561 (2004) 75e82. [5] B. Lemaitre, J. Hoffmann, The host defense of Drosophila melanogaster, Annu. Rev. Immunol. 25 (2007) 697e743. [6] Z. Zhou, M. Wang, J. Zhao, L. Wang, Y. Gao, H. Zhang, et al., The increased transcriptional response and translocation of a Rel/NF-kB homologue in scallop Chlamys farreri during the immune stimulation, Fish Shellfish Immunol. 34 (2013) 1209e1215. [7] Y. Jiang, X. Wu, Characterization of a Rel\ NF-kB homologue in a gastropod abalone, Haliotis diversicolor supertexta, Dev. Comp. Immunol. 31 (2007) 121e131. [8] M. De Zoysa, C. Nikapitiya, C. Oh, I. Whang, J.-S. Lee, S.-J. Jung, et al., Molecular evidence for the existence of lipopolysaccharide-induced TNF-a factor (LITAF) and Rel/NF-kB pathways in disk abalone (Haliotis discus discus), Fish Shellfish Immunol. 28 (2010) 754e763. [9] S.-M. Zhang, K.A. Coultas, Identification and characterization of five transcription factors that are associated with evolutionarily conserved immune signaling pathways in the schistosome-transmitting snail Biomphalaria glabrata, Mol. Immunol. 48 (2011) 1868e1881. [10] Q. Wang, Introduction of Japanese scallop and prospect of culture it in northern China, Fish Sci 3 (1984) 24e27. [11] S. Liu, X. Jiang, X. Hu, J. Gong, H. Hwang, K. Mai, Effects of temperature on nonspecific immune parameters in two scallop species: Argopecten irradians (Lamarck 1819) and Chlamys farreri (Jones & Preston 1904), Aquac. Res. 35 (2004) 678e682. [12] J. Xiao, S.E. Ford, H. Yang, G. Zhang, F. Zhang, X. Guo, Studies on mass summer mortality of cultured zhikong scallops (Chlamys farreri Jones et Preston) in China, Aquaculture 250 (2005) 602e615. [13] Y. Sun, Y. Zhang, X. Fu, R. Zhang, J. Zou, S. Wang, et al., Identification of two secreted ferritin subunits involved in immune defense of Yesso scallop Patinopecten yessoensis, Fish Shellfish Immunol 37 (2014) 53e59. [14] X. Hu, Z. Bao, J. Hu, M. Shao, L. Zhang, K. Bi, et al., Cloning and characterization of tryptophan 2, 3-dioxygenase gene of Zhikong scallop Chlamys farreri (Jones and Preston 1904), Aquac. Res. 37 (2006) 1187e1194. [15] Y. Zhang, R. Zhang, J. Zou, X. Hu, S. Wang, L. Zhang, et al., Identification and characterization of four ferritin subunits involved in immune defense of the Yesso scallop (Patinopecten yessoensis), Fish Shellfish Immunol 34 (2013) 1178e1187. [16] R. Hou, Z. Bao, S. Wang, H. Su, Y. Li, H. Du, et al., Transcriptome sequencing and de novo analysis for Yesso scallop (Patinopecten yessoensis) using 454 GS FLX, PloS One 6 (2011) e21560. [17] M.A. Larkin, G. Blackshields, N. Brown, R. Chenna, P.A. McGettigan, H. McWilliam, et al., Clustal W and Clustal X version 2.0, Bioinformatics 23 (2007) 2947e2948. [18] K. Tamura, D. Peterson, N. Peterson, G. Stecher, M. Nei, S. Kumar, MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods, Mol. Biol. Evol. 28 (2011) 2731e2739. [19] M. Cong, L. Song, L. Wang, J. Zhao, L. Qiu, L. Li, et al., The enhanced immune protection of Zhikong scallop Chlamys farreri on the secondary encounter with Listonella anguillarum, Comp. Biochem. Physiol. Part B: Biochem. Mol. Biol. 151 (2008) 191e196. [20] R. Wang, Z. Wang, J. Zhang, Science of Marine Shellfish Culture, Ocean University of China Press, China, 2008, pp. 277e283. [21] L. Feng, Q. Yu, X. Li, X. Ning, J. Wang, J. Zou, et al., Identification of reference genes for qRT-PCR analysis in Yesso Scallop Patinopecten yessoensis, PloS One 8 (2013) e75609. [22] M.W. Pfaffl, G.W. Horgan, L. Dempfle, Relative expression software tool (REST©) for group-wise comparison and statistical analysis of relative expression results in real-time PCR, Nucleic Acids Res. 30 (2002) e36-e. [23] P.A. Sharp, Speculations on RNA splicing, Cell 23 (1981) 643e646. [24] R.G. Correa, V. Tergaonkar, J.K. Ng, I. Dubova, J.C. Izpisua-Belmonte, I.M. Verma, Characterization of NF-kВ/IkВ proteins in zebra fish and their involvement in notochord development, Mol. Cell Biol. 24 (2004) 5257e5268. [25] M. Gauthier, B.M. Degnan, The transcription factor NF-kB in the demosponge Amphimedon queenslandica: insights on the evolutionary origin of the Rel homology domain, Dev. Genes Evol. 218 (2008) 23e32. [26] H.J. Kong, J.-H. Moon, J.-Y. Moon, J.-M. Kim, B.-H. Nam, Y.-O. Kim, et al., Cloning and functional characterization of the p65 subunit of NF-kB from olive flounder (Paralichthys olivaceus), Fish Shellfish Immunol. 30 (2011) 406e411.

R. Li et al. / Fish & Shellfish Immunology 44 (2015) 611e621 [27] S. Vallabhapurapu, M. Karin, Regulation and function of NF-kB transcription factors in the immune system, Annu. Rev. Immunol. 27 (2009) 693e733. [28] S. Beinke, S. Ley, Functions of NF-kappaB1 and NF-kappaB2 in immune cell biology, Biochem. J. 382 (2004) 393e409. [29] E. Wootton, E. Dyrynda, N. Ratcliffe, Bivalve immunity: comparisons between the marine mussel (Mytilus edulis), the edible cockle (Cerastoderma edule) and the razor-shell (Ensis siliqua), Fish Shellfish Immunol. 15 (2003) 195e210. re, Y. Gueguen, M. Gonzalez, J. De Lorgeril, J. Garnier, B. Romestand, [30] E. Bache Insights into the anti-microbial defense of marine invertebrates: the penaeid shrimps and the oyster Crassostrea gigas, Immunol. Rev. 198 (2004) 149e168. [31] J. Royet, D. Gupta, R. Dziarski, Peptidoglycan recognition proteins: modulators of the microbiome and inflammation, Nat. Rev. Immunol. 11 (2011) 837e851. [32] O. Takeuchi, S. Akira, Pattern recognition receptors and inflammation, Cell 140 (2010) 805e820. [33] D.J. King, S.E. Bassett, X. Li, S.A. Fennewald, N.K. Herzog, B.A. Luxon, et al., Combinatorial selection and binding of phosphorothioate aptamers targeting human NF-kB RelA (p65) and p50, Biochemistry 41 (2002) 9696e9706. [34] B. Krljanac, D. Weih, I.D. Jacobsen, D. Hu, I. Koliesnik, K. Reppe, et al., NF-kB2/ p100 deficiency impairs immune responses to T-cell-independent type 2 antigens, Eur. J. Immunol. 44 (2014) 662e672. [35] J. Satriano, D. Schlondorff, Activation and attenuation of transcription factor NF-kB in mouse glomerular mesangial cells in response to tumor necrosis factor-alpha, immunoglobulin G, and adenosine 30 : 50 -cyclic monophosphate. Evidence for involvement of reactive oxygen species, J. Clin. Investigation 94 (1994) 1629. [36] S. Ganesan, K. Aggarwal, N. Paquette, N. Silverman, NF-kB/Rel Proteins and the Humoral Immune Responses of Drosophila melanogaster. NF-kB in Health and Disease, Springer, 2011, pp. 25e60. [37] M. Doleschall, B. Mayer, J. Cervenak, L. Cervenak, I. Kacskovics, Cloning, expression and characterization of the bovine p65 subunit of NFkB, Dev. Comp. Immunol. 31 (2007) 945e961.

621

[38] T.D. Gilmore, F.S. Wolenski, NF-kB: where did it come from and why? Immunol. Rev. 246 (2012) 14e35. [39] M.S. Hayden, S. Ghosh, Signaling to NF-kB, Genes Dev. 18 (2004) 2195e2224. [40] X. Liu, S. Huang, J. Ma, C. Li, Y. Zhang, L. Luo, NF-kB and Snail1a coordinate the cell cycle with gastrulation, J. Cell Biol. 184 (2009) 805e815. [41] C. Arenas-Mena, P. Martinez, R.A. Cameron, E.H. Davidson, Expression of the Hox gene complex in the indirect development of a sea urchin, Proc. Natl. Acad. Sci. 95 (1998) 13062e13067. [42] A. Herman, A. Herman, K. Haziak, D. Tomaszewska-Zaremba, Immune stress up regulates TLR4 and Tollip gene expression in the hypothalamus of ewe, J. Animal Feed Sci. 22 (2013) 13e18. [43] M. Toubiana, M. Gerdol, U. Rosani, A. Pallavicini, P. Venier, P. Roch, Toll-like receptors and MyD88 adaptors in Mytilus: complete cds and gene expression levels, Dev. Comp. Immunol. 40 (2013) 158e166. [44] Y. Zhang, X. He, F. Yu, Z. Xiang, J. Li, K.L. Thorpe, et al., Characteristic and functional analysis of Toll-like receptors (TLRs) in the lophotrocozoan, Crassostrea gigas, reveals ancient origin of TLR-mediated innate immunity, PloS One 8 (2013) e76464. [45] P.-H. Wang, Z.-H. Gu, X.-D. Huang, B.-D. Liu, X-x Deng, H.-S. Ai, et al., An immune deficiency homolog from the white shrimp, Litopenaeus vannamei, activates antimicrobial peptide genes, Mol. Immunol. 46 (2009) 1897e1904. [46] S.-M. Zhang, Y. Zeng, E.S. Loker, Characterization of immune genes from the schistosome host snail Biomphalaria glabrata that encode peptidoglycan recognition proteins and gram-negative bacteria binding protein, Immunogenetics 59 (2007) 883e898. [47] M. Toubiana, U. Rosani, S. Giambelluca, M. Cammarata, M. Gerdol, A. Pallavicini, et al., Toll signal transduction pathway in bivalves: complete cds of intermediate elements and related gene transcription levels in hemocytes of immune stimulated Mytilus galloprovincialis, Dev. Comp. Immunol. 45 (2014) 300e312.