Chemosensitization of Human Renal Cell Cancer Using Antisense Oligonucleotides Targeting the Antiapoptotic Gene Clusterin

RESEARCH ARTICLE

Neoplasia . Vol. 3, No. 4, 2001, pp. 360 – 367

360

www.nature.com/neo

Chemosensitization of Human Renal Cell Cancer Using Antisense Oligonucleotides Targeting the Antiapoptotic Gene Clusterin1 Tobias Zellweger* y, Hideaki Miyake* y, Laura V. July* y, Majid Akbari* y, Satoshi Kiyama* y and Martin E. Gleave* y *The Prostate Centre, Vancouver General Hospital, Vancouver, British Columbia, Canada V6H 3Z6 and yDivision of Urology, University of British Columbia, Vancouver, British Columbia, Canada V5Z 3J5

Abstract BACKGROUND: Renal cell cancer ( RCC ) is a chemoresistant disease with no active chemotherapeutic agent achieving objective response rates higher than 15%. Clusterin is a cell survival gene that increases in human renal tubular epithelial cells after various states of injury and disease. Downregulation of clusterin, using antisense oligonucleotides ( ASO ) , has recently been shown to increase chemosensitivity in several prostate cancer models. The objectives in this study were to evaluate clusterin expression levels in human RCC and normal kidney tissue, and to test whether clusterin ASO could also enhance chemosensitivity in human RCC Caki - 2 cells both in vitro and in vivo. METHODS: Immunohistochemical staining was used to characterize clusterin expression in 67 RCC and normal kidney tissues obtained from radical nephrectomy specimens. Northern blot analysis was used to assess changes in clusterin mRNA expression after ASO and paclitaxel treatment. The effects of combined clusterin ASO and paclitaxel treatment on Caki - 2 cell growth was examined using an MTT assay. Athymic mice bearing Caki - 2 tumors were treated with clusterin ASO alone, clusterin ASO plus paclitaxel, and mismatch control oligonucleotides plus paclitaxel, over a period of 28 days with measurement of tumor volumes once weekly over 8 weeks. RESULTS: Immunohistochemistry of normal and malignant kidney tissue sections of 67 patients demonstrated positive clusterin staining for almost all RCC ( 98% ) and an overexpression, compared to normal tissue, in a majority of RCC ( 69% ) . Clusterin ASO, but not mismatch control oligonucleotides, decreased clusterin mRNA expression in Caki - 2 cells in a dose dependent and sequence - specific manner. Pretreatment of Caki - 2 cells with clusterin ASO significantly enhanced chemosensitivity to paclitaxel in vitro. Characteristic apoptotic DNA laddering was observed after combined treatment with ASO plus paclitaxel, but not with either agent alone. In vivo administration of clusterin ASO plus paclitaxel acted synergistically to increase apoptosis and significantly delay Caki - 2 tumor growth, compared to mismatch control oligonucleotide plus paclitaxel. In addition, TUNEL staining revealed increased apoptotic cells in tumors treated with clusterin ASO plus paclitaxel compared to treatment with either clusterin ASO or paclitaxel alone. CONCLUSION: These

findings confirm that the use of clusterin ASO may be a feasible strategy to enhance chemosensitivity for patients with advanced RCC. Neoplasia ( 2001 ) 3, 360 – 367. Keywords: renal cell cancer, Caki - 2, antisense clusterin oligonucleotides, paclitaxel.

Introduction Renal cell cancers ( RCCs ) account for approximately 2% of adult carcinomas with over 30,000 new cases per year in the United States and an associated 12,000 deaths [ 1 ] . Estimates of annual new diagnoses of RCC have been increasing steadily [ 1,2 ] . Despite extensive evaluation of many different treatment modalities, advanced metastatic RCC remains highly resistant to systemic therapy. To date, no chemotherapy is established for the treatment of advanced kidney cancer with objective response rates higher than 15% that justifies its use as a single agent [ 3 ] . Combinations of chemotherapy plus hormonal agents have been studied but likewise are ineffective and result in additive toxicity. Nearly half of all patients with RCC die within 5 years of diagnosis and 5 - year survival for those with metastatic disease is 5% to 10% [ 4 ] . Therefore, to make a significant impact on survival, preclinical and clinical evaluation of new agents and treatment programs to identify improved antitumor activity are priorities in this refractory disease. Advances in the field of nucleic acid chemistry offers one attractive strategy to design antisense oligonucleotide ( ASO ) - based therapeutic agents that specifically hybridize with complementary mRNA regions of a target gene and thereby inhibit gene expression by forming RNA / DNA duplexes [ 5 ] . Several ASO targeted against specific genes involved in neoplastic progression have been evaluated as potential therapeutic agents [ 6 – 9 ] . Collectively, these findings identify ASO as a novel class of antineoplastic agents when designed for appropriate molecular targets. Address all correspondence to: Martin E. Gleave, MD, Division of Urology, University of British Columbia, D - 9, 2733 Heather Street, Vancouver, British Columbia, Canada V5Z 3J5. E-mail: [email protected] 1 This work was supported in part by grant 009002 from the National Cancer Institute of Canada, and the Hudson Fund at the Vancouver General Hospital. Tobias Zellweger was supported by the Swiss National Science Foundation, Krebsliga Basel, Lichtenstein Stiftung and Freiwillige Akademische Gesellschaft of the University of Basel, Switzerland. Received 13 March 2001; Accepted 3 May 2001. Copyright # 2001 Nature Publishing Group All rights reserved 1522-8002/01/$17.00

RCC Chemosensitization Using Clusterin Antisense Oligonucleotides Zellweger et al.

However, because numerous genes are involved in tumor progression, inhibition of a single target gene will likely be insufficient to inhibit tumor progression in a meaningful way. In fact, combined use of ASO with other compounds, such as chemotherapeutic agents, have been demonstrated to produce more potent antineoplastic effects in several tumor models [ 10 – 13 ] . Clusterin, also known as testosterone - repressed prostate message - 2 ( TRPM - 2 ) or sulfated glycoprotein - 2, was first described in 1983 as a major secretory glycoprotein produced by ram Sertoli cells [ 14 ] . It is associated with a wide variety of physiologic and pathologic processes, including tissue remodeling, lipid transport, membrane protection, complement defense, and apoptotic cell death [ 15 ] . Increased expression of clusterin is seen in a variety of renal diseases such as renal dysplasia, membranous glomerulonephritis, inherited polycystic renal diseases, and RCC [ 16,17 ] . It is also induced following ureteric obstruction, ischemia / reperfusion injury, and in nephrotoxic injuries such as gentamicin nephrotoxicity and myoglobinuric failure [ 18 ] . More recent observations suggest that clusterin acts in a chaperone - like manner similar to that of small heat shock proteins. It potently inhibits stress - induced protein precipitation in vitro and appears to be associated with cell survival in vivo [ 19 ] . Inactivation of this gene could therefore impair cellular repair mechanisms in response to external cell death signals such as chemotherapy. Paclitaxel is one of the most important anticancer drugs developed in the past two decades and has shown significant activity against a variety of adenocarcinomas [ 20 ] . Polymeric micellar paclitaxel used in this study offers a safe and convenient formulation for animal studies with no significant toxicity [ 21 ] . We recently reported that clusterin overexpression confers chemoresistance to paclitaxel in the human prostate LNCaP tumor model [ 22 ] . In the present study, we demonstrate for the first time that downregulation of a specific gene ( clusterin ) , using sequence - specific ASO, enhances the response of human RCC to paclitaxel chemotherapy both in vitro and in vivo.

Materials and Methods Tumor Cell Line Caki - 2 is derived from a human clear cell carcinoma of the kidney. It was purchased from the American Type Culture Collection ( Rockville, MD ) . Cells were maintained in Mc Coy’s 5a medium ( Life Technologies, Gaithersburg, MD ) supplemented with 10% heat - inactivated fetal calf serum. Chemotherapeutic Agents Paclitaxel was purchased from Sigma ( St. Louis, MO ) . Stock solutions of paclitaxel were prepared with dimethyl sulfoxide ( DMSO ) , and diluted with PBS to the required concentrations before each in vitro experiment. Polymeric micellar paclitaxel used in these in vivo studies was generously supplied by Dr. Helen M. Burt ( Faculty of

Neoplasia . Vol. 3, No. 4, 2001

361

Pharmaceutical Sciences, University of British Columbia, Vancouver, Canada ) . Antisense Clusterin Oligonucleotides ( Clusterin ASO ) Phosphorothioate oligonucleotides used in this study were purchased from La Jolla Pharmaceuticals ( La Jolla, CA ) . The sequence of clusterin ASO corresponding to the human clusterin translation initiation site was 50 - CAGCAGCAGAGTCTTCATCAT - 30. A two - base clusterin mismatch oligonucleotide ( 50 - CAGCAGCAGAGTATTTATCAT - 30 ) was used as control. Treatment of Cells with Oligonucleotides Lipofectin, a cationic lipid ( Life Technologies ) was used to increase oligonucleotide uptake of cells. Caki - 2 cells were treated with various oligonucleotide concentrations after preincubation for 20 minutes with 20 g / ml lipofectin in serum free OPTI - MEM ( Life Technologies ) . Four hours after the beginning of the incubation, the medium containing oligonucleotides and lipofectin was replaced with standard culture medium described above. Northern Blot Analysis Total RNA was isolated from cultured Caki - 2 cells and Caki - 2 tumor tissues using the acid – guanidium thiocyanate – phenol – chloroform method. Electrophoresis, hybridization, and washing conditions were carried out as previously reported [ 9 ] . Human clusterin and GAPDH cDNA probes were generated by reverse transcription – PCR from total RNA of human kidney using primers 50 AAGGAAATTCAAAATGCTGTCAA - 30 ( sense ) and 50 ACAGACAAGATCTCCCGGCACTT - 30 ( antisense ) for clusterin, and 50-TGCTTTTAACTCTGGTAAAGT-30 ( sense ) and 50 - ATATTTGGCAGGTTTTTCTGA - 30 ( antisense ) for GAPDH. Density of bands for clusterin was normalized against that of GAPDH by densitometric analysis. MTT Assay The in vitro growth inhibitory effects of clusterin ASO plus paclitaxel on Caki - 2 cells were assessed using the MTT assay as described previously [ 23 ] . Briefly, 1104 cells were seeded in each well of 96 - well microtiter plates and allowed to attach overnight. Cells were then treated once daily with 500 nM ASO for 2 days. Following ASO treatment, cells were treated with various concentrations of paclitaxel. After 48 hours of incubation, 20 l of 5 mg / ml MTT ( Sigma ) in PBS was added to each well, followed by incubation for 4 hours at 378C. The formazan crystals were dissolved in DMSO. The optical density was determined with a microculture plate reader ( Becton Dickinson Labware, Lincoln Park, NJ ) at 540 nm. Absorbance values were normalized to the values obtained for the vehicle treated cells to determine the percentage of survival. Each assay was performed in triplicate. DNA Fragmentation Analysis The nucleosomal DNA degradation was analyzed as described previously with a minor modification [ 23 ] . Briefly,

362

RCC Chemosensitization Using Clusterin Antisense Oligonucleotides

1105 Caki - 2 cells were seeded in 10 - cm culture dishes and allowed to adhere overnight. After treatment with ASO plus paclitaxel using the same schedule as described above, cells were harvested and then lysed in a solution containing 100 mM NaCl, 10 mM Tris pH 7.4, 25 mM EDTA and 0.5% SDS. After centrifugation, supernatants were incubated with 300 g / ml proteinase K for 5 hours at 658C and extracted with phenol – chloroform. The aqueous layer was treated with 0.1 volume of 3 M sodium acetate, and the DNA was precipitated with 2.5 volumes of 95% ethanol. Following treatment with 100 g / ml RNAse A for 1 hour at 378C, the sample was electrophoresed on a 2% agarose gel and stained with ethidium bromide. Immunohistochemical Staining Sections from formaldehyde - fixed, paraffin - embedded tissue from radical nephrectomy specimens for RCC were deparaffinized by passing slides through 5 - minute washes of xylene ( 2 ) , 100% EtOH, 95% EtOH, and 70% EtOH, successively. Endogenous peroxidase was blocked with 3% hydrogen peroxide in absolute methanol. Slides were autoclaved for 15 minutes in DAKO target retrieval solution ( Dako, Carpinteria, CA ) , and blocked with 1% bovine serum albumin for 1 hour at room temperature. After an overnight incubation at 48C with 1:50 antihuman clusterin goat polyclonal IgG ( Santa Cruz Biotechnology, Santa Cruz, CA ) , sections were covered with 1:200 HRP - conjugated antigoat IgG ( Santa Cruz Biotechnology ) . Peroxidase activity on sections was detected by immersion in freshly mixed 3 - 30 diaminobenzidine tetrachloride ( 0.6 mg / ml ) ( Sigma ) and 0.003% hydrogen peroxide for 5 minutes. The sections were then counterstained with hematoxylin, dehydrated and cleared, and placed under a coverslip. Each specimen was read independently by a pathologist ( M. A. ) and a urologist ( T. Z. ) . Clusterin - staining intensity was scored from 0 ( no staining at all ) , + 1 ( weak ) , + 2

Zellweger et al.

( medium ) , + 3 ( strong ) to + 4 ( very strong staining ) and the percentage of stained tissue per section was assessed. For each patient ( n = 67 ) , normal kidney tissue was compared with corresponding RCC tissue. Assessment of In Vivo Tumor Growth Approximately 1106 of Caki - 2 cells were inoculated subcutaneously with 0.1 ml of Matrigel ( Becton Dickinson Labware, Bedford, MA ) in the flank region of 6 - to 8 - week old male athymic mice ( BALB / c strain; Harlan Sprague – Dawley, Indianapolis, IN ) under halothane anesthesia ( 5% induction and 1.5% maintenance concentration ) . When Caki - 2 tumors grew to 1 cm in diameter, usually 8 to 10 weeks after injection, mice were randomly selected for treatment with clusterin ASO alone, clusterin ASO plus paclitaxel, or mismatch control oligonucleotides plus paclitaxel. Each experimental group consisted of eight mice. After randomization, 12.5 mg / kg clusterin ASO or mismatch control oligonucleotide was injected intraperitoneally once daily into each mouse for 28 days. From day 10 to 14, and from day 24 to 28, 0.5 mg polymeric micellar paclitaxel was administered once daily by intravenous injection. Tumor volume was measured once weekly and calculated by the formula lengthwidthdepth0.5236 [ 24 ] . Data points were reported as mean tumor volumes ± standard deviation. All animal procedures were performed according to the guidelines of the Canadian Council on Animal Care and with appropriate institutional certification. TUNEL Staining A modified TUNEL technique [ 25 ] was used to detect apoptotic cells in Caki - 2 tumors using the ApopTag in situ apoptosis detection system ( Oncor, Gaithersburg, MD ) . Briefly, sections from formaldehyde - fixed, paraffin - embedded Caki - 2 tumors were deparaffinized and endogenous peroxidase was blocked as described above for immunohis-

Figure 1. Enhanced expression of clusterin in human RCC. Expression of clusterin in benign ( left ) and malignant ( right ) human kidney tissue ( renal cell carcinoma, clear cell type, Fuhrmann grade III – IV ) . Deparaffinized tissue sections were labeled with antihuman clusterin goat polyclonal antibodies using the immunoperoxidase technique. RCC shows strong clusterin staining ( dark reaction product ) , whereas no clusterin expression can be seen in normal kidney tissue.

Neoplasia . Vol. 3, No. 4, 2001

RCC Chemosensitization Using Clusterin Antisense Oligonucleotides Zellweger et al.

363

tochemical staining. After pretreatment with proteinase K ( 10 g / ml ) , slides were labeled with biotinylated poly dU, introduced by terminal deoxy - transferase, and then stained using antidigoxigenin - peroxidase according to manufacture’s protocol. Peroxidase activity on sections was detected by immersion in freshly mixed 3 - 30 diaminobenzidine tetrachloride ( 0.6 mg / ml ) ( Sigma ) and 0.003% hydrogen peroxide for 5 minutes. The sections were then counterstained with hematoxylin, dehydrated and cleared, and placed under a coverslip. The number of positively stained cells / high power field ( hpf ) in five random fields was counted and averaged. Statistical Analysis The in vitro cytotoxic effects of antisense or mismatch oligonucleotide and paclitaxel were analyzed with the use of a repeated - measure analysis of variance ( ANOVA ) model. Synergy between clusterin ASO and paclitaxel was analyzed by calculation of the fractional product parameter according to the fractional product method as previously described [ 26 ] . The other data were analyzed by Student’s t test. The levels of statistical significance were set at P < .05 ( two sided ) , and all statistical calculations were done by use of the Statview 5.0 software ( Abacus Concepts, Berkeley, CA ) .

Figure 2. Sequence - specific and dose - dependent inhibition of clusterin expression by clusterin ASO in Caki - 2 cells. Caki - 2 cells were treated daily with various concentrations of clusterin ASO or a two - base clusterin mismatch oligonucleotide as a control for 2 days, total RNA was extracted from culture cells, clusterin and GAPDH mRNA levels were analyzed by Northern blotting. No Tx indicates untreated cells ( control ) . Clusterin mRNA levels were quantified ( after normalization to GAPDH mRNA levels ) by laser densitometry. Each column represents the mean value of triplicate analysis with standard deviation. Numbers on the Y axis symbolize arbitrary densitometric units. ** and *, differ from control ( P < .01 and P < .05, respectively ) by Student’s t test.

normal tissue, was observed in a majority ( 69% ) of RCC. Fifty - three percent of normal kidney tissue samples ( distant from RCC ) showed no or only weak staining for clusterin, compared to only 15% of RCC ( Figure 1, Table 1 ) .

Results Enhanced Expression of Clusterin in Human RCC Clusterin immunostaining was performed in normal kidney and RCC tissue of 67 patients. Histologic classification of RCC revealed clear cell patterns in 56 cases ( 84.5% ) , the rest of sections showing either granular cell ( 6% ) or papillary cell patterns ( 9% ) . Staining of cytoplasmic clusterin was heterogenous both in normal and malignant tissues. Positive clusterin staining was found in almost all RCC ( 97% ) and clusterin overexpression, compared to

Table 1. Results of Clusterin Immunostaining in Normal Kidney and RCC Paraffin - Embedded Tissue Sections from 67 Patients. Normal tissue

RCC tissue

Intensity of clusterin immunostaining* 0

11 ( 16% )

+1

25 ( 37% )

2 ( 3% ) 8 ( 12% )

+2

25 ( 37% )

33 ( 49% )

+3

6 ( 16% )

15 ( 22% )

+4

0 ( 0% )

9 ( 13% )

Percentage of clusterin - stained tissue 0 – 25%

33 ( 49% )

14 ( 21% )

25 – 50%

19 ( 28% )

18 ( 27% )

50 – 75%

13 ( 19% )

20 ( 30% )

75 – 100%

2 ( 3% )

15 ( 22% )

*Intensity and positivity of clusterin immunostaining were assessed by an immunoscore ( 0 to + 4 ) comparing normal and malignant tissue in each patient.

Neoplasia . Vol. 3, No. 4, 2001

Figure 3. Effect of paclitaxel treatment on clusterin expression of Caki - 2 cells in vitro. Cells were treated with various concentrations of paclitaxel for 48 hours, mRNA was then extracted and analyzed for clusterin levels by Northern blotting. Clusterin mRNA levels increased in a dose - dependent manner by paclitaxel treatment at concentrations up to 100 nM. Quantitative analysis of clusterin mRNA levels ( after normalization to GAPDH mRNA levels ) was performed by laser densitometry. Each column represents the mean value of triplicate analysis with standard deviation. Numbers on the Y axis symbolize arbitrary densitometric units.

364

RCC Chemosensitization Using Clusterin Antisense Oligonucleotides

Zellweger et al.

Downregulation of Clusterin Expression by Clusterin ASO in Caki - 2 Tumors To determine whether ASO treatment inhibits clusterin expression in Caki - 2 tumors in vivo, tumor - bearing nude mice were given 12.5 mg / kg clusterin ASO or mismatch control oligonucleotides intraperitoneally once daily over 28 days with tumors harvested for mRNA extraction 1 day later. Treatment with clusterin ASO resulted in a 51% reduction in clusterin mRNA levels in Caki - 2 tumors

Figure 4. Effects of single and combined treatment with either clusterin ASO, mismatch control oligonucleotide or micellar paclitaxel on clusterin expression of Caki - 2 tumors in vivo. For that purpose, six athymic mice bearing Caki - 2 tumors were randomly selected as control ( no treatment ) ( Lane 1 ) , treatment with either clusterin ASO ( Lane 2 ) , mismatch control oligonucleotide ( Lane 3 ) , or micellar paclitaxel alone ( Lane 4 ) , clusterin ASO plus micellar paclitaxel ( Lane 5 ) or mismatch control oligonucleotides plus micellar paclitaxel ( Lane 6 ) . After randomization, 12.5 mg / kg clusterin ASO or mismatch control oligonucleotides were injected intraperitoneally once daily for 28 days. From day 10 to 14, and from day 24 to 28, 0.5 mg polymeric micellar paclitaxel was administered once daily by intravenous injection. Tumors of all mice were harvested on day 29 for mRNA extraction. Compared to control, clusterin ASO treatment decreased clusterin mRNA levels by 51%, whereas paclitaxel increased clusterin mRNA levels by 15%. Combined treatment with clusterin ASO and paclitaxel decreased clusterin mRNA levels by 28%. Quantitative analysis of clusterin mRNA levels ( after normalization to GAPDH mRNA levels ) was performed by laser densitometry. Each column represents the mean value of triplicate analysis with standard deviation.

Sequence - Specific and Dose - Dependent Inhibition of Clusterin Expression by Clusterin ASO in Caki - 2 Cells Northern blot analysis was used to determine the effect of treatment with clusterin ASO on clusterin mRNA expression in Caki - 2 cells. As shown in Figure 2, daily treatment of Caki - 2 cells with clusterin ASO ( 50, 100, 500, or 1000 nM ) for 2 days reduced clusterin mRNA levels by 42%, 58%, 61%, and 64%, respectively, whereas clusterin mRNA expression was not affected by mismatch control oligonucleotides at any of the employed concentrations. Effects of Paclitaxel Treatment on Clusterin mRNA Expression in Caki - 2 Cells and Tumors Northern blot analysis was used to determine the effects of paclitaxel treatment on clusterin mRNA expression in Caki - 2 cells in vitro and tumors in vivo, respectively. As shown in Figure 3, clusterin mRNA induction increased in a dose - dependent manner after paclitaxel treatment in vitro up to 73% at concentrations of 100 nM. To determine whether paclitaxel changes clusterin mRNA expression in Caki - 2 tumors in vivo, 0.5 mg polymeric micellar paclitaxel was administered intravenously once daily over 10 days with harvest of tumors for mRNA extraction 1 day later. In nude mice bearing Caki - 2 tumors, clusterin mRNA levels increased by 15% after treatment with paclitaxel compared to untreated control ( Figure 4 ) .

Figure 5. Effect of combined treatment with clusterin ASO and paclitaxel on Caki - 2 cell growth and apoptosis. ( A ) Caki - 2 cells were treated daily with either 500 nM clusterin ASO or mismatch control oligonucleotides once daily for 2 days. Following oligonucleotide treatment, the medium was replaced with medium containing various concentrations of paclitaxel. After 48 hours of incubation, cell viability was determined by the MTT assay. Each data point represents the mean of triplicate analysis with standard deviation. Clusterin ASO treatment significantly enhanced chemosensitivity of paclitaxel in a dose - dependent manner ( two - sided, P = .022, ANOVA ) , reducing the IC50 ( i.e., the concentration that reduces cell viability by 50% ) of paclitaxel by 80% ( 320 nM to 65 nM ) , whereas mismatch control oligonucleotides had no effect. The combined effects between clusterin ASO and paclitaxel were synergistic ( P < .05 ) , as determined by an analysis that utilized the fractional product method [ 26 ] . ( B ) DNA fragmentation assay was performed to compare induction of apoptosis after combined treatment with 500 nM clusterin ASO and paclitaxel ( 7.5 nM ) . After the same treatment schedule described above, characteristic DNA laddering was observed only after combined treatment with clusterin ASO and paclitaxel.

Neoplasia . Vol. 3, No. 4, 2001

RCC Chemosensitization Using Clusterin Antisense Oligonucleotides Zellweger et al.

compared to mismatch control oligonucleotide - treated tumors ( Figure 4 ) . Enhanced Chemosensitivity of Caki - 2 Cells In Vitro After Clusterin ASO Treatment To determine whether treatment with clusterin ASO enhances the cytotoxic effects of paclitaxel, Caki - 2 cells were treated with 500 nM clusterin ASO or mismatch control oligonucleotides once daily for 2 days and then incubated with medium containing various concentrations of paclitaxel for 2 days. The MTT assay was then performed to determine cell viability. As shown in Figure 5A, clusterin ASO treatment significantly enhanced chemosensitivity of paclitaxel in a

365

dose - dependent manner ( two - sided, P = .022, ANOVA ) , reducing the IC50 ( i.e., the concentration that reduces cell viability by 50% ) of paclitaxel by 80% ( 320 nM to 65 nM ) , whereas mismatch control oligonucleotides had no effect. The combined effects between clusterin ASO and paclitaxel were synergistic ( P < .05 ) , as determined by an analysis that utilized the fractional product method [ 26 ] . DNA fragmentation assay was performed to compare induction of apoptosis after combined treatment with 500 nM clusterin ASO and 10 nM paclitaxel. After the same treatment schedule described above, characteristic apoptotic DNA laddering was observed only after combined treatment with clusterin ASO and paclitaxel ( Figure 5B ) .

Figure 6. Effect of combined treatment with clusterin ASO plus micellar paclitaxel in Caki - 2 tumor growth. ( A ) Mice bearing Caki - 2 tumors were randomly selected for treatment with clusterin ASO plus micellar paclitaxel, mismatch control oligonucleotides plus micellar paclitaxel or clusterin ASO alone. When Caki - 2 tumors became approximately 1 cm in diameter, 12.5 mg / kg clusterin ASO or mismatch control oligonucleotide was injected intraperitoneally for 28 days. From day 10 to day 14 and from day 24 to 28, 0.5 mg micellar paclitaxel was daily administered by intravenous injection. Tumor volume was measured once weekly and calculated by the formula, lengthwidthdepth0.5236. Each point represents the mean tumor volume in each experimental group containing eight mice with standard deviation. *Differ from control ( P < .05 ) by two - sided Student’s t test. ( B ) , ( C ) , and ( D ) After completion of the same treatment schedule described ( A ) , Caki - 2 tumors were harvested from each treatment group for detection of apoptosis using TUNEL staining. Sections of paraffin - embedded Caki - 2 tumors were stained with digoxigenin - dUTP antibody to identify apoptotic cells. ( B ) Caki - 2 tumor after treatment with clusterin ASO and micellar paclitaxel ( mean number of apoptotic cells / high power field: 11.6 ) . ( C ) Caki - 2 tumor after treatment with mismatch control oligonucleotides and micellar paclitaxel ( mean number of apoptotic cells / high power field: 4.1 ) . ( D ) Caki - 2 tumor after treatment with clusterin ASO alone ( mean number of apoptotic cells / high power field: 2.3 ) .

Neoplasia . Vol. 3, No. 4, 2001

366

RCC Chemosensitization Using Clusterin Antisense Oligonucleotides

Enhanced Chemosensitivity of Caki - 2 Tumors In Vivo After Clusterin ASO Treatment Male athymic mice bearing Caki - 2 tumors approximately 1 cm in diameter were randomly selected for treatment with clusterin ASO plus paclitaxel, mismatch control oligonucleotides plus paclitaxel, or clusterin ASO alone. Mean tumor volume was similar at the beginning of treatment in each of these groups ( 365 to 375 mm3 ) . After randomization, 12.5 mg / kg clusterin ASO or mismatch control oligonucleotides were injected intraperitoneally once daily for 28 days. From day 10 to 14, and from day 24 to 28, 0.5 mg polymeric micellar paclitaxel was administered once daily by intravenous injection. As shown in Figure 6A, clusterin ASO enhanced micellar paclitaxel chemosensitivity in Caki - 2 tumors, causing a 50% reduction in mean tumor volume 7 weeks after initiation of treatment, compared to treatment with mismatch control oligonucleotides and paclitaxel ( two sided, P < .05 ) . In vivo, the combined effects between clusterin ASO and paclitaxel were also synergistic ( P < .05 ) , as analyzed by the fractional product method [ 26 ] . In addition, TUNEL staining detected a three - fold increase in the numbers of apoptotic cells in Caki - 2 tumors treated with clusterin ASO plus micellar paclitaxel ( mean number of apoptotic cells / high power field: 11.6 ) , compared to those treated with mismatch control oligonucleotides plus micellar paclitaxel ( mean number of apoptotic cells / high power field: 4.1 ) , or clusterin ASO alone ( mean number of apoptotic cells / high power field: 2.3 ) ( Figure 6B  D ) . Under the experimental conditions used in the above in vivo experiments, no side effects associated with ASO treatment and / or chemotherapy were observed ( except one animal developing ascites, 3 weeks after clusterin ASO treatment was finished ) .

Discussion Numerous systemic therapies have been studied to assess their activity in advanced, metastatic RCC. From 1990 through October 1998, 33 chemotherapeutic agents were studied in 51 phase II trials comprising 1347 patients [ 4 ] . No chemotherapeutic agent produced response rates that would justify its use as a single - agent therapy. Hormonal therapy with medroxyprogesterone produces infrequent responses ( < 10% ) and had no effect on survival [ 27 ] . Only a few patients exhibit complete or partial responses to immunologic agents like interferon and / or interleukin - 2 but most do not respond, and there are few long - term survivors [ 1,28,29 ] . Despite extensive evaluation of many different treatment modalities, advanced RCC remains highly resistant to systemic therapy. Therefore, novel therapeutic strategies targeting molecular mechanisms mediating chemoresistance are required. Recent preclinical studies have provided proof of principle evidence that targeting antiapoptotic genes using ASO enhances apoptosis induced by conventional cytotoxic chemotherapy [ 10 – 12 ] . Clusterin is one of many antiapoptotic genes involved in cancer progression and the development of chemoresistance. Acting in a chaperone - like

Zellweger et al.

manner similar to small heat shock proteins, it helps prevent apoptosis induced by external stimuli such as chemotherapeutic agents [ 19 ] . We recently demonstrated for several prostate cancer models that the efficacy of chemotherapeutic agents can be improved by combination with clusterin ASO [ 21,30 ] . In the kidney, increased expression of clusterin is observed in a number of acute and chronic states of renal injury and disease. However, little is known about changes of clusterin expression levels in kidney cancer. Based on the analysis of only four patients, Parczyk et al. [ 17 ] reported a three - fold overexpression of clusterin in human RCC compared to normal kidney tissue. In our study, we compared normal and malignant kidney tissues of 67 patients using clusterin immunostaining. Positive clusterin staining ( + 1 to + 4 ) was observed in almost all RCC ( 97% ) and increased clusterin expression compared to normal tissue in a majority of RCC ( 69% ) . Fifty - three percent of normal kidney tissue samples distant from RCC showed no or only weak staining for clusterin ( 0 to + 1 ) consistent with findings of other investigators [ 17,31 ] . To clarify the functional role of increased clusterin expression in RCC, we then tested the effects of clusterin ASO on human Caki - 2 RCC cell growth and whether clusterin ASO could enhance the cytotoxic effects of paclitaxel in this model system. Phosphorothioate clusterin ASO used in this study significantly inhibited expression of clusterin mRNA in Caki - 2 cells both in vitro and in vivo. Sequence specificity was confirmed using a two - base clusterin mismatch oligonucleotide, which had no effects on clusterin expression in Caki - 2 cells. When used alone, antisense or mismatch oligonucleotide treatment had no effect on Caki - 2 cell growth. However, when administered in combination with other cell death stimuli, like cytotoxic chemotherapy, clusterin ASO enhanced Caki - 2 cell apoptosis both in vitro and in vivo. Pretreatment of Caki - 2 cells with clusterin ASO reduced the IC50 of paclitaxel by 80%, thereby enhancing apoptosis induced by these agents. Consistent with these in vitro results, synergistic effects of combined use of clusterin ASO plus paclitaxel was also observed in vivo. Systemic administration of clusterin ASO plus polymeric micellar paclitaxel suppressed the Caki - 2 tumor growth by 50%, compared to treatment with mismatch control oligonucleotides plus paclitaxel. Detection of increased apoptotic cells after combined ASO and chemotherapy by TUNEL staining in Caki - 2 tumors suggest that decrease in tumor progression rates after combined clusterin ASO plus paclitaxel resulted from enhanced chemotherapy - induced apoptosis rather than decreased cell proliferation. The results in the present study suggest that increased clusterin helps mediate RCC progression by inhibiting apoptotic cell death induced by several kinds of therapies, including cytotoxic chemotherapy. Decreasing clusterin mediated chemoresistance by clusterin ASO may provide a feasible and safe strategy to enhance chemosensitivity in advanced RCC. The preclinical data presented here provide proof of principle support for designing clinical studies employing combined clusterin ASO plus paclitaxel therapy for patients with advanced RCC.

Neoplasia . Vol. 3, No. 4, 2001

RCC Chemosensitization Using Clusterin Antisense Oligonucleotides Zellweger et al.

Acknowledgements We thank Mary Bowden and Howard Tearle for their excellent technical assistance.

References [1] Motzer RJ, Bander NH, and Nanus DM ( 1996 ) . Renal cell carcinoma. N Engl J Med 335, 865 – 75. [2] McLaughlin JK, and Lipworth L ( 2000 ) . Epidemiologic aspects of renal cell cancer. Semin Oncol 27, 115 – 23. [3] Yagoda A, Abi - Rached B, and Petrylak D ( 1995 ) . Chemotherapy for advanced renal - cell carcinoma: 1983 – 1993. Semin Oncol 22, 42 – 60. [4] Motzer RJ, and Russo P ( 2000 ) . Systemic therapy for renal cell carcinoma. J Urol 163, 408 – 17. [5] Crooke ST ( 1992 ) . Therapeutic applications of oligonucleotides. Annu Rev Pharmacol Toxicol 32, 329 – 76. [6] Monia BP, Johnston JF, Geiger T, Muller M, and Fabbro D ( 1996 ) . Antitumor activity of a phosphorothioate antisense oligodeoxynucleotide targeted against c - raf kinase. Nat Med 2, 668 – 75. [7] Cucco C, and Calabretta B ( 1996 ) . In vitro and in vivo reversal of multidrug resistance in a human leukemia - resistant cell line by mdr1 antisense oligodeoxy - nucleotides. Cancer Res 56, 4332 – 7. [8] Ziegler A, Luedke GH, Fabbro D, Altman KH, Stahel RA, and Zangemeister - Wittke U ( 1997 ) . Induction of apoptosis in small - cell lung cancer cells by an antisense oligodeoxynucleotide targeting the Bcl - 2 coding sequence. J Natl Cancer Inst 89, 1027 – 36. [9] Miyake H, Tolcher A, and Gleave ME ( 1999 ) . Antisense Bcl - 2 oligodeoxynucleotides inhibit progression to androgen - independence after castration in the Shionogi tumor model. Cancer Res 59, 4030 – 4. [10] Geiger T, Muller M, Monia BP, and Fabbro D ( 1997 ) . Antitumor activity of a C - raf antisense oligodeoxynucleotide in combination with standard chemotherapeutic agents against various human tumors transplanted subcutaneously into nude mice. Clin Cancer Res 3, 1179 – 85. [11] Jansen B, Schlagbauer - Wadl H, Brown BD, Bryan RN, van Elisas A, Muller M, Wolff K, Eichler HG, and Pehamberger H ( 1998 ) . Bcl - 2 antisense therapy chemosensitizes human melanoma in SCID mice. Nat Med 4, 232 – 4. [12] Campbell MJ, Dawson M, and Koeffler HP ( 1998 ) . Growth inhibition of DU - 145 prostate cancer cells by a Bcl - 2 antisense oligodeoxynucleotide is enhanced by N - ( 2 - hydroxyphenyl ) all - trans retinamide. Br J Cancer 77, 739 – 44. [13] Miyake H, Tolcher A, and Gleave ME ( 2000 ) . Chemosensitization and delayed androgen - independent recurrence of prostate cancer with the use of antisense Bcl - 2 oligodeoxynucleotides. J Natl Cancer Inst 92, 34 – 41. [14] Blaschuk O, Burdzy K, and Fritz IB ( 1983 ) . Purification and characterization of a cell - aggregating factor ( clusterin ) , the major glycoprotein in ram rete testis fluid. J Biol Chem 258, 7714 – 20. [15] Rosenberg ME, and Silkensen J ( 1995 ) . Clusterin: physiologic and pathophysiologic considerations. Int J Biochem Cell Biol 27, 633 – 45.

Neoplasia . Vol. 3, No. 4, 2001

367

[16] Rosenberg ME, and Silkensen J ( 1995 ) . Clusterin and the kidney. Exp Nephrol 3, 9 – 14. [17] Parczyk K, Pilarsky C, Rachel U, and Koch - Brandt C ( 1994 ) . Gp80 ( clusterin; TRPM - 2 ) mRNA level is enhanced in human renal clear cell carcinomas. J Cancer Res Clin Oncol 120, 186 – 8. [18] Rosenberg ME, Dvergsten J, and Correa - Rotter R ( 1993 ) . Clusterin: an enigmatic protein recruited by diverse stimuli. J Lab Clin Med 121, 205 – 14. [19] Humphreys DT, Carver JA, Easterbrook - Smith SB, and Wilson MR ( 1999 ) . Clusterin has chaperone - like activity similar to that of small heat shock proteins. J Biol Chem 274, 6875 – 81. [20] Rowinsky EK, and Donehower RC ( 1995 ) . Paclitaxel ( Taxol ) . N Engl J Med 332, 1004 – 14. [21] Miyake H, Nelson C, Rennie PS, and Gleave ME ( 2000 ) . Acquisition of chemoresistant phenotype by overexpression of the antiapoptotic gene testosterone - repressed prostate message - 2 in prostate cancer xenograft models. Cancer Res 60, 2547 – 54. [22] Leung SY, Jackson J, Miyake H, Burt H, and Gleave ME ( 2000 ) . Polymeric micellar paclitaxel induces tumor regression in androgen independent prostate cancer in the LNCaP tumor model. Prostate 44, 156 – 63. [23] Miyake H, Hanada N, Nakamura H, Kagawa S, Fujiwara T, Hara I, Eto H, Gohji K, Arakawa S, Kamidono S, and Saya H ( 1998 ) . Overexpression of Bcl - 2 in bladder cancer cells inhibits apoptosis induced by cisplatin and adenoviral - mediated p53 gene transfer. Oncogene 16, 933 – 43. [24] Gleave ME, Hsieh JT, Gao CA, von Eschenbach AC, and Chung LW ( 1991 ) . Acceleration of human prostate carcinoma growth in vivo by factors produced by prostate and bone fibroblasts. Cancer Res 51, 3753 – 61. [25] Gavrieli Y, Sherman Y, and Ben - Sasson SA ( 1992 ) . Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J Cell Biol 119, 493 – 501. [26] Duska LR, Hamblin MR, Miller JL, and Hasan T ( 1999 ) . Combination photoimmunotherapy and ciplatin: effects on human ovarian cancer ex vivo. J Natl Cancer Inst 91, 1557 – 63. [27] Harris DT ( 1983 ) . Hormonal and chemotherapy of renal cell carcinoma. Semin Urol 10, 422 – 30. [28] Wirth MP ( 1993 ) . Immunotherapy for metastatic renal cell carcinoma. Urol Clin North Am 20, 283 – 95. [29] Gleave ME, Elhilali M, Fradet Y, Davis I, Venner P, Saad F, Klotz LH, Moore MJ, Paton V, and Bajamonde A ( 1998 ) . Interferon gamma - 1b compared with placebo in metastatic renal cell carcinoma. Canadian Urologic Oncology Group. N Engl J Med 338, 1265 – 71. [30] Miyake H, Chi KN, and Gleave ME ( 2000 ) . Antisense testosterone repressed prostate message - 2 oligodeoxynucleotides chemosensitize human androgen - independent PC - 3 prostate cancer cells both in vitro and in vivo. Clin Cancer Res 6, 1655 – 63. [31] Dvergsten J, Manivel JC, Correa - Rotter R, and Rosenberg ME ( 1994 ) . Expression of clusterin in human renal diseases. Kidney Int 45, 828 – 35.