Chicken dendritic cells are susceptible to highly pathogenic avian influenza viruses which induce strong cytokine responses

Developmental and Comparative Immunology 39 (2013) 198–206

Contents lists available at SciVerse ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

Chicken dendritic cells are susceptible to highly pathogenic avian influenza viruses which induce strong cytokine responses Lonneke Vervelde a,⇑, Sylvia S. Reemers a,1, Daphne A. van Haarlem a, Jacob Post b, Erwin Claassen b, Johanna M.J. Rebel b, Christine A. Jansen a a b

Department of Infectious Diseases and Immunology, Faculty Veterinary Medicine, Utrecht University, Yalelaan 1, 3584 CL Utrecht, The Netherlands Central Veterinary Institute, Wageningen UR, P.O. Box 65, 8200 AB Lelystad, The Netherlands

a r t i c l e

i n f o

Article history: Received 27 September 2012 Revised 30 October 2012 Accepted 31 October 2012 Available online 23 November 2012 Keywords: Influenza A virus Dendritic cell Innate immunity Pathogenicity Cytokine

a b s t r a c t Infection with highly pathogenic avian influenza (HPAI) in birds and mammals is associated with severe pathology and increased mortality. We hypothesize that in contrast to low pathogenicity avian influenza (LPAI) infection, HPAI infection of chicken dendritic cells (DC) induces a cytokine deregulation which may contribute to their highly pathogenic nature. Infection of DC with LPAI H7N1 and H5N2 resulted in viral RNA and NP expression without increase in time, in contrast to HPAI H7N1 and H5N2 mRNA expression. No increase in IFN mRNA was detected after infection with LPAI, but after LPAI H5N2, and not LPAI H7N1, infection the level of bioactive IFNa/b significantly increased. After HPAI H7N1 and H5N2 infection, significant increases in IL-8, IFN-a, IFN-c mRNA expression and in TLR1, 3, and 21 mRNA were observed. This enhanced activation of DC after HPAI infection may trigger deregulation of the immune response as seen during HPAI infection in chickens. Ó 2012 Elsevier Ltd. All rights reserved.

1. Introduction Avian influenza viruses are considered to be of either low pathogenicity or highly pathogenic, based on the ability to induce clinical disease and/or death in chickens (Swayne and Suarez, 2000). Infection with LPAI virus usually results in mild clinical signs while infection with HPAI viruses induces systemic infection and eventually death of the host within 36–48 h (Pantin-Jackwood and Swayne, 2009; Swayne, 2007). In general, HPAI mutated from a H5 or H7 LPAI virus subtype that circulate in chickens or turkeys (Alexander, 2007). Infection with HPAI in birds and mammals is associated with severe pathology and increased mortality. The tissue damage found in H5N1 infected human lung as well as in other organs is believed to be due to a virus-induced cytokine deregulation or a ‘‘cytokine storm’’ characterized by the presence of elevated levels of pro-inflammatory cytokines and interferon’s (IFN) (De Jong et al., 2006; Beigel et al., 2005). Cytokine storms in other species

Abbreviations: LPAI, low pathogenicity avian influenza virus; HPAI, high pathogenic avian influenza virus. ⇑ Corresponding author. Tel.: +44 (0) 131 651 9213; fax: +44 (0) 131 651 9105. E-mail addresses: [email protected] (L. Vervelde), [email protected] (S.S. Reemers), [email protected] (D.A. van Haarlem), [email protected] (J. Post), [email protected] (E. Claassen), [email protected] (J.M.J. Rebel), [email protected] (C.A. Jansen). 1 Present address: The Roslin Institute and R(D)SVS, University Edinburgh, Easter Bush, Midlothian, EH25 9RG, UK. 0145-305X/$ - see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.dci.2012.10.011

are less obvious. Strong induction of cytokines such as IL-6 and IL-12 and IFNs are also found in lung and spleen in the chicken after infection with HPAI H5N1, but the levels seem dependent on the virus strain (Rebel et al., 2011; Karpala et al., 2011). Clinical signs, pathology, and production of pro-inflammatory cytokines and acute phase proteins of swine influenza infected pigs are similar to humans, but show a transient increase suggesting a milder cytokine deregulation compared to humans (Barbé et al., 2011; Murata and Otsuki, 2011). In mammals in the respiratory tract, dendritic cells (DC) and macrophages are situated in immediate proximity to the respiratory epithelial cells, where they form an elaborate network that rapidly reacts to foreign antigens and inflammatory stimuli, including respiratory viruses (Von Garnier et al., 2005). Although the avian respiratory tract differs significantly from the mammalian in morphology and airflow (reviewed by Reese et al., 2006), avian species also have a network of macrophages and DC in the respiratory tract (Reese et al., 2006; De Geus et al., 2012) that are involved in uptake of foreign antigens (De Geus et al., 2012). This suggests that also in chickens DC may rapidly react to respiratory virus infections. Since DC are essential in controlling the innate and adaptive immune responses against influenza virus infection various groups have studied their contribution to pathology, but also their role in shaping the adaptive immune responses in the mouse lung (McGill et al., 2008; Aldridge et al., 2009; Geurts van Kessel et al., 2008; Legge and Braciale, 2003). More recently, the

L. Vervelde et al. / Developmental and Comparative Immunology 39 (2013) 198–206

role of DC during influenza virus infection in natural hosts, pigs and horses, has been investigated. In vitro cultured porcine bone marrow derived DC (BM-DC) and plasmacytoid DC (pDC), and equine blood derived DC can be successfully infected with influenza virus although limited replication was detected (Mussá et al., 2011; Bel et al., 2011; Boliar and Chambers, 2010). Both horse DC and swine pDC produced type I IFN upon infection (Bel et al., 2011; Boliar and Chambers, 2010). The host relies on early antiviral response mechanisms upon entry of a virus especially with viruses such as HPAI that can cause a detrimental outcome within 48 h after infection. Sensing of the virus is likely to be a key determinant in host-pathogen outcome. Different receptor families have been identified to be involved in recognition of influenza virus, such as the Toll-like, NOD-like and RIG-I like receptor family. Sensing of AIV by these receptors up regulates the transcription of genes involved in inflammatory responses, especially pro-inflammatory cytokines and type I IFNs. Although the host is well equipped with sensing the influenza A virus, the virus in its turn has developed ways to evade the host’s immune responses. For example, the non-structural protein NS1 carries multiple functions including the ability to inhibit the host cell antiviral responses by preventing type I IFN release (Wang et al., 2000; Talon et al., 2000; Mibayashi et al., 2007) and the inhibition of adaptive immunity by attenuating human primary DC maturation (Fernandez-Sesma et al., 2006). In this study we hypothesized that in contrast to LPAI infection HPAI infection of chicken DC induces a virus-induced cytokine deregulation, which may contribute to the highly pathogenic nature of these HPAI viruses. Therefore we conducted a comprehensive analysis of chicken DC activation after infection with related highly and low pathogenic avian H7 and H5 influenza virus by FACS analysis and qRT-PCR using a panel of markers and genes associated with DC activation and maturation.

199

penicillin, 100 lg/ml streptomycin (DC medium, Gibco BRL) and optimally diluted concentrations of recombinant chicken IL-4 and chicken GM-CSF (plasmids kindly provided by P. Kaiser and. L. Rothwell, Institute for Animal Health, Compton, UK). Medium was replaced with fresh medium containing recIL-4 and recGMCSF at day 3 and fresh medium containing recIL-4 and recGMCSF was added at day 6. At day 7 of culture BM-DC were infected with AIV. Cells were cultured at 41 °C, 5% CO2. 2.4. Infection of BM-DC with avian influenza virus BM from each chicken was used for control cultures, LPAI infection and HPAI infection to enable within animal comparisons. Control cultures and HPAI infections were performed in duplicate, LPAI infections were performed in triplicate per bird per condition. BMDC were infected with the LPAI (n = 6 birds) or HPAI H7N1 (n = 4 birds) or with the LPAI (n = 4 birds) or HPAI H5N2 (n = 4 birds). Cells were infected with 1 ml 105 EID50/ml of LPAI virus or with 104 EID50/ml HPAI virus in serum free DC medium. Cells were incubated for 1 h at 41 °C, 5% CO2. Next, cells were washed twice with PBS and resuspended in 5 ml serum free DC medium containing 1 lg/ml trypsin (Worthington) and incubated at 41 °C, 5% CO2. LPAI infected BM-DC and mock infected BM-DC were harvested at 4, 16 or 24 h post infection (hpi), used for flow cytometry and cell lysates were made in 1 ml Trizol Reagent (Invitrogen). The supernatant was used for type I IFN reporter assays. Cell lysates and supernatants were stored at 80 °C until use. Experiments that involved working with HPAI strains were performed in the high containment (BSL3) laboratories of the CVI (Wageningen UR, Lelystad, the Netherlands). HPAI infected BM-DC and mock infected BM-DC were harvested at 4, 16 or 24 hpi and cell lysates were made in 1 ml Trizol Reagent. 2.5. RNA isolation

2. Materials and methods 2.1. Animals One-day-old Lohmann Brown chickens were obtained from a commercial breeder (Verbeeks Broederij, the Netherlands). Chickens were housed in groups and fed ad libitum on commercial feed. In compliance with Dutch law, all experiments were approved by the Animal Experimental Committee of the Faculty of Veterinary Medicine of Utrecht University, the Netherlands, in accordance with the Dutch regulation on experimental animals. 2.2. Virus strains Avian influenza virus (AIV) strains HPAI H7N1 A/turkey/Italy/ 4580/99 and H7N1 LPAI A/chicken/Italy/1067/99 were kindly provided by Dr. W. Dundon (Istituto Zooprofilattico Sperimentale delle Venezie, Italy) and HPAI H5N2 A/chicken/Pennsylvania/1370 and LPAI H5N2 A/chicken/Pennsylvania/21525/83 were kindly provided by Dr. G. Koch (Central Veterinary Institute (CVI), Wageningen UR, the Netherlands). The viruses were produced in eggs according to routine procedures. 2.3. Bone marrow derived DC (BM-DC) isolation and culture At the age of 3 weeks, chickens were euthanized and bone marrow (BM) was collected for isolation of mononuclear cells. BM was isolated and cultured as previously described (Wu et al., 2010). Briefly, BM cells were seeded at a concentration of 3  106 cells/ ml in T25 flasks in 5 ml RPMI-1640 complete medium supplemented with 5% chicken serum, 2 mM Glutamax-I, 100 U/ml

Cell lysates of infected BM-DC were made and total RNA was isolated according to the manufacturer’s instructions (Invitrogen), followed by a DNAse treatment (RNase-Free DNase set, Qiagen Benelux). Purified RNA was eluted in 30 ll RNase-free water and stored at 80 °C. All RNA samples were checked for quantity and quality using a spectrophotometer, ND-1000 (Isogen Life Sciences). 2.6. Real-time quantitative reverse transcription-PCR (qRT-PCR) Real-time qRT-PCR was performed to analyse the RNA levels of influenza virus matrix 1 protein (M1), and mRNA levels of chemokines, cytokines and Toll-like receptors (TLR). Primers (Invitrogen) and probes (AB) were designed according to previously published sequences (Sijben et al., 2003; Eldaghayes et al., 2006; van der Goot et al., 2008; MacKinnon et al., 2009) and shown in Table 1.cDNA was generated from 500 ng RNA using iScript cDNA Synthesis Kit (Biorad Laboratories). For detection of M1 RNA specific primers were used at 600 nM and probe at 100 nM concentrations according to the following cycle profile: one cycle of 95 °C for 10 min, 45 cycles of 95 °C for 5 s, 57 °C for 10 s and 72 °C for 20 s. An M1 containing plasmid was made to generate standard curves and used to generate log10 dilution series regression lines. TLR1LA, TLR3 and TLR7 qRT-PCR was performed using iQ SYBR green supermix (Biorad Laboratories) with 400 nM primers and using the following cycle profile: one cycle of 95 °C for 5 min, 40 cycles of 92 °C for 10 s, 59 °C for 10 s and 72 °C for 30 s. TLR21 and 28S qRT-PCR was performed using the TaqMan Universal PCR Master Mix (Applied Biosystems) and probes and primers were used according to concentrations and the cycle profile described by Ariaans et al. (2008).

200

L. Vervelde et al. / Developmental and Comparative Immunology 39 (2013) 198–206

Table 1 Real-time quantitative RT-PCR primers and probes.

a b

Target

Probe or primera

Sequence (50 –30 )

Accession No.b

28S

F R Probe

GGCGAAGCCAGAGGAAACT GACGACCGATTTGCACGTC (FAM)-AGGACCGCTACGGACCTCCACCA-(TAMRA)

X59733

IL-1b

F R Probe

GCTCTACATGTCGTGTGTGATGAG TGTCGATGTCCCGCATGA (FAM)-CCACACTGCAGCTGGAGGAAGCC-(TAMRA)

AJ245728

IL-6

F R Probe

GCTCGCCGGCTTCGA GGTAGGTCTGAAAGGCGAACAG (FAM)-AGGAGAAATGCCTGACGAAGCTCTCCA-(TAMRA)

AJ309540

IL-8 [CXCli2]

F R Probe

GCCCTCCTCCTGGTTTCA TGGCACCGCAGCTCATT (FAM)-TCTTTACCAGCGTCCTACCTTGCGACA-(TAMRA)

AJ009800

IL-18

F R Probe

AGGTGAAATCTGGCAGTGGAAT ACCTGGACGCTGAATGCAA (FAM)-CCGCGCCTTCAGCAGGGATG-(TAMRA)

AJ276026

IFN-a

F R Probe

GACAGCCAACGCCAAAGC GTCGCTGCTGTCCAAGCATT (FAM)-CTCAACCGGATCCACCGCTACACC-(TAMRA)

U07868

IFN-b

F R Probe

CCTCCAACACCTCTTCAACATG TGGCGTGCGGTCAAT (FAM)-TTAGCAGCCCACACACTCCAAAACACTG-(TAMRA)

X92479

IFN-c

F R Probe

GTGAAGAAGGTGAAAGATATCATGGA GCTTTGCGCTGGATTCTCA (FAM)-TGGCCAAGCTCCCGATGAACGA-(TAMRA)

Y07922

TLR1LA

F R

GCTTGACTTTAGTGCCTTCATGTTT GCAAGCAATTGGCAGTAAGCT

NM_001007488

TLR3

F R

GCAACACTTCATTGAATAGCCTTGAT TTCAGTATAAGGCCAAACAGATTTCCA

NM_001011691

TLR7

F R

TCAGAGGTGGCTGCACAC CAACAGTGCATTTGACGTCCTT

NM_001011688

TLR21

F R

GATGATGGAGACAGCGGAGAAG GCAGCAGCAGCCAGAGT

NM_001030558

F, forward; R, reverse. Genomic DNA sequence.

To generate standard curves, RNA from LPS stimulated HD11 cells was used for TLR1LA, TLR7 and TLR21, and RNA from ConA stimulated splenocytes was used for standard curves for the cytokines, interferons, TLR3 and 28S. Chicken ribosomal 28S was used as a reference gene and corrections for variation in RNA preparation and sampling were performed according to Eldaghayes et al. (2006). Mean threshold cycle values (Ct) were determined based on triplicates.

2.7. Flow cytometry Flow cytometry was performed to analyse the effect of AIV on DC activation markers using mouse anti-chicken CD40 (clone AV79, IgG2a, AbD Serotec), mouse-anti-chicken CD80 (clone IAH:F864DC7, IgG2a, AbD Serotec), mouse-anti-chicken MHCII (clone Cla-I, IgM, Southern Biotech) and mouse hybridoma supernatant to MHCI (clone F21-21, IgG1, Skjødt et al., 1986). Cells were stained for 20 min at 4 °C, washed with PBA (PBS, 0.5% BSA, and 0.0001% sodium azide) followed by incubation with a goat-antimouse-Ig secondary Ab or isotype-specific Ab for 20 min at 4 °C. To determine the percentage of cell death, DC were incubated with the live/dead marker 7AAD (BD Biosciences) for 5 min at RT. Next, cells were washed with PBS and fixed using 2% paraformaldehyde in PBS (Merck) for 10 min at room temperature. The cells were then washed once in PBA and analysed. At least 10,000 events were acquired using a FACS Calibur flowcytometer (BD Biosciences) and data were analysed using the software program FlowJO (Threestar Inc.). Flow cytometry was only performed on LPAI and mock

infected cells, because of the lack of FACS facilities within the high containment laboratory. 2.8. Immunocytochemistry Replicating AIV was visualized in BM-DC cultures by staining for viral nucleoprotein (NP). Cells were fixed with 2% paraformaldehyde in PBS for 30 min at 4 °C and washed twice with PBS. Cells were permeabilized with 0.3% Triton-X 100 in PBS for 10 min at room temperature and subsequently incubated with mouse-antiinfluenza NP (clone HB65; EVL Laboratories, The Netherlands) for 1 h at RT. Cells were washed three times with PBS/0.05% Tween20. The Vectastain Elite ABC Kit (Mouse IgG) was used to reveal NP positive cells according to manufacturer’s instructions (Vector Laboratories, Inc.) with true blueTM peroxidase as substrate (KPL, USA). The reaction was stopped by washing the plate twice with distilled water. 2.9. Bioassay for chicken IFN-a/b IFN-a/b activity was analyzed in supernatants from LPAI infected DC as previously described (Schwarz et al., 2004). Briefly, CEC-32 reporter cells (kindly provided by Dr. S. Härtle, University Munich, Germany), containing a luciferase gene under the chicken Mx promoter, were incubated in 96-well plates with recombinant IFN produced from Escherichia coli (Schultz et al., 1995) as standard or supernatant of DC cultures. Cells were incubated for 6 h at 37 °C and lysed with 20 ll cell culture lysis reagent (Promega).

201

L. Vervelde et al. / Developmental and Comparative Immunology 39 (2013) 198–206

Luciferase activity was measure using firefly luciferase substrate (Promega). 2.10. Statistical analysis Non-parametric statistical tests were used when the assumption of normally distributed data was not met. To determine the statistical significance between mock infected, LPAI and HPAI groups or between H5N2 and H7N1 groups Kruskal–Wallis and Mann–Whitney U tests were used. Differences over time were analyzed using Wilcoxon tests. Correlations between M1, cytokine and TLR levels were determined using Spearman’s rho correlation tests. A p-value < 0.05 was considered significant. All statistical analyses were performed using the software program SPSS 16.0 (SPSS Inc., Illinois). 3. Results 3.1. LPAI and HPAI virus infect BM-DC but produce limited progeny after infection with LPAI In order to determine the ability of the different AIV to infect chicken BM-DC, we analyzed the viral nucleoprotein (NP) of the LPAI using immunocytochemistry and performed qRT-PCR at 4, 16 and 24 hpi to detect the matrix gene (M1) of all four virus strains. Staining of BM-DC infected with LPAI resulted in a vacuolar and nuclear NP staining (data not shown). Infection of BM-DC with the LPAI strains did not result in increased cell death compared to the mock infected BM-DC (data not shown). Quantification of viral RNA using qRT-PCR indicated that all viruses were readily detected at 4 hpi (Fig. 1). After infection with both LPAI H7N1 and H5N2, the viral RNA levels did not increase at 16 and 24 hpi. In contrast, infection of BM-DC with HPAI H7N1 and H5N2 resulted in an increase in viral RNA levels in time. 3.2. Activation of BM-DC after infection with LPAI is limited To determine whether LPAI infection affects DC activation and maturation we analyzed surface expression of CD40, CD80, MHCI and MHCII at 4, 16 and 24 hpi using flowcytometry. After infection with H7N1 and with H5N2 only small, but no significant differences in expression of CD40, CD80, MHCI and MHCII were detected compared to the within bird mock infected control at all time points (Supplement 1). The ability of LPAI to induce pro-inflammatory cytokines and interferons was examined using qRT-PCR, IFN-a/b reporter assays and IFN-c Elisa. BM-DC of each bird were examined for mRNA

LPAI HPAI

*

*

30

*

20

The highly pathogenic AIV of subtypes H5 and H7 cause lethal systemic infection in birds. To investigate if HPAI H5N2 and H7N1 induce an aberrant response in BM-DC we used HPAI viruses that were related to the LPAI viruses described above (Bean et al., 1985; Banks et al., 2001). The ability of HPAI to induce pro-inflammatory cytokines and IFNs was examined using qRT-PCR. After infection with HPAI H5N2, IL-1b mRNA expression did not significantly change, but after infection with HPAI H7N1 the mRNA level was significantly lower at 16 and 24 hpi compared to the LPAI H7N1 (Fig. 3A). The expression of chicken IL-8 (CXCLi2) mRNA after both HPAI H7N1 and H5N2 infection was elevated at 24 hpi compared to the LPAI H7N1 and H5N2 infection respectively (Fig. 3B). At the other time points IL-8 mRNA levels tended to be

B

H7N1 40

3.3. Differential responses of BM-DC to HPAI and LPAI infection

10

viral RNA levels (45-Ct)

viral RNA levels (45-Ct)

A

expression of the pro-inflammatory cytokines IL-1b, IL-8 and IL18 and compared between LPAI H7N1, LPAI H5N2, and mock infected BM-DC. The expression of these cytokines in mock infected BM-DC was at least corrected 40-Ct of 10 and only small, non-significant changes in mRNA were found over time (data not shown). After infection, both LPAI virus strains did not alter the expression of IL-1b, IL-8 (CXCLi2) or IL-18 mRNA within 24 h (data not shown). Changes in IL-6, IL-12a, IL-12b, IL-10, and iNOS mRNA after infection of DC with LPAI were small and again not significantly different (data not shown). After infection, both LPAI virus strains did not significantly alter the expression of IFN-a and IFN-c mRNA (Fig. 2A and B). Protein levels of IFN-a/b in the supernatants of the BM-DC cultures were quantified using a luciferase reporter assay specific for chicken IFN-a/b. In contrast to the lack of changes in mRNA expression, LPAI H5N2 induced a significant increase in IFN-a/b protein (Fig. 2C) unlike LPAI H7N1. Changes in IFN-c at protein level, measured by Elisa, were not detected (Fig. 2D) for both LPAI viruses which corresponded with the lack of changes at mRNA level. Since the reporter assay is sensitive to both IFN-a and IFN-b, we used qRT-PCR to measure these interferons in LPAI H5N2 infected BMDC. Surprisingly the mRNA and protein data did not coincide as no differences in IFN-a and IFN-b mRNA were measured compared to the mock infected BM-DC (Fig. 2E and F). Sensing of the virus is likely to be a key determinant in hostpathogen outcome. Viral RNA is sensed intracellularly by TLR3 and TLR7, DNA is sensed by TLR21, whereas TLR1 can sense viral glycoproteins on the surface of the DC. After infection of BM-DC with either LPAI H5N2 or LPAI H7N1 no significant changes in mRNA expression of TLR1, TLR3, TLR7 and TLR21 were detected within 24 hpi compared to mock infected BM-DC (data not shown).

H5N2 40

LPAI HPAI

30

*

*

20 10 0

0 4

16

hours post inf ection

24

4

16

24

hours post inf ection

Fig. 1. Viral RNA is expressed in BM-DC infected with LPAI and HPAI H7N1 and H5N2. (A) Viral M1 RNA expression measured by qRT-PCR at 4, 16 and 24 hpi after LPAI and HPAI H7N1 inoculation. (B) Viral M1 RNA expression at 4, 16 and 24 hpi after LPAI and HPAI H5N2 inoculation. Graphs represent mean + SEM of 6 birds for LPAI H7N1 and 4 birds for HPAI H7N1, LPAI H5N2 and HPAI H5N1. ⁄ Indicates a significant difference in M1 RNA levels between LPAI and HPAI (p < 0.05).

202

L. Vervelde et al. / Developmental and Comparative Immunology 39 (2013) 198–206

A

B

IFN-α 40

IFN-γ 40

30

Corrected 40-Ct

Corrected 40-Ct

uninfected LPAI H7N1 LPAI H5N2

20 10 0

16

LPAI H5N2

20 10

24

4

hours post inf ection

C

IFN-α/β

*

6

24

IFN-γ 0.5

RLU

LPAI H5N2

*

*

OD 450-620 nm

uninfected

*

1.0×10 6

0.4

LPAI H7N1 LPAI H5N2

0.3 0.2 0.1 0.0

0

4

16

24

4

E

F

IFN-α 40

16

24

hours post inf ection

hours post inf ection

IFN-β 40

uninfected

uninfected LPAI H5N2

Corrected 40-Ct

LPAI H5N2

Corrected 40-Ct

16

hours post inf ection

D

uninfected LPAI H7N1

2.0×10 6

LPAI H7N1

30

0

4

3.0×10

uninfected

30 20 10

30 20 10 0

0

4

16

24

hours post inf ection

4

16

24

hours post inf ection

Fig. 2. Interferon responses after infection of BM-DC with LPAI H7N1 or H5N2. mRNA expression of IFN-a (A) and IFN-c (B) at 4, 16 and 24 hpi. Bioactive protein levels for IFN-a/b were measured in the supernatant of BM-DC cultures infected with LPAI H7N1 and H5N2 after 4, 16 and 24 hpi using a reporter assay (C). The bioassay is based on a cell line that carries a luciferase gene that is controlled by the IFN-responsive chicken Mx promoter, measuring IFN-a and IFN-b. Protein levels for IFN-c were measured in the same supernatants using a commercial Elisa (D). To elucidate if IFN-b was produced by LPAI H5N2 infected BM-DC, IFN-a (E) and IFN-b mRNA expression (F) was measured by qRT-PCR. Graphs represent mean + SEM of 6 birds for LPAI H7N1 and 4 birds LPAI H5N2. ⁄ Indicates a significant difference compared to the mock infected controls (p < 0.05).

higher after HPAI infection, but this was not significant. Although the fold change of IL-18 mRNA after HPAI infection started to differ from expression after LPAI infection at 16 hpi, a significant difference was only detected at 24 hpi between LPAI and HPAI H7N1. The relative expression of IL-18 mRNA also tended to be higher upon HPAI compared to LPAI H5N2 infection (Fig. 3C) The fold change of IFN-a mRNA after HPAI infection was increased at all time points compared to LPAI infection (Fig. 4A). A significant increase was measured for HPAI H7N1 and H5N2 at 24 hpi. HPAI H7N1 infection resulted in a significantly higher expression of IFN-c mRNA compared to LPAI H7N1 infection at 4, 16 and 24 hpi. IFN-c mRNA expression after HPAI H5N2 infection started to increase later compared to HPAI H7N1 and although elevated at 16 hpi it was significantly increased at 24 hpi only (Fig. 4B). While LPAI did not significantly affect expression levels of TLR1, TLR3, TLR7, and TLR21 mRNA, HPAI infection of BM-DC resulted in significant changes in TLR mRNA expression compared to LPAI.

TLR1 mRNA expression was elevated after HPAI infection at all time points and significantly increased after HPAI H5N2 infection at 16 and 24 hpi (Fig. 5A) and for HPAI H7N1 at 24 hpi. The biggest differences in TLR mRNA expression between LPAI and HPAI infected BM-DC were found for TLR3. TLR3 mRNA expression was significantly increased after HPAI H7N1 infection at 4 and 16 hpi, whereas expression of TLR3 mRNA after HPAI H5N2 infection started to rise slightly later and was significantly increased compared to LPAI H5N2 at 24 hpi (Fig. 5B). Changes in TLR7 mRNA were much smaller and were only significantly increased at 4 hpi for both HPAI H5N2 and H7N1 (Fig. 5C). Changes in TLR21 mRNA were small but a significant increase was found for both HPAI H5N2 and H7N1 at 4, 16, and 24 hpi compared to LPAI H5N2 and H7N1 respectively (Fig. 5D). Within the individual birds, the significantly higher TLR3 and TLR21 mRNA expression in HPAI infected BM-DC compared to LPAI infected BM-DC correlated to the viral load. Higher viral load was correlated with higher expression of TLR3 and TLR21 mRNA

203

L. Vervelde et al. / Developmental and Comparative Immunology 39 (2013) 198–206

LPAI H7N1 HPAI H7N1 LPAI H5N2 HPAI H5N2

10 5

f old change

B

IL-1β 10 6 10 4 10

10 5

3

10 2 10 1

*

*

10 0

IL-8 10 6

f old change

A

10 4 10 3

LPAI H7N1 HPAI H7N1 LPAI H5N2 HPAI H5N2

*

10 1 10 0 10 -1

10 -1

10 -2

10 -2 4

16

4

24

24

IL-18 10 4

LPAI H7N1 HPAI H7N1 LPAI H5N2 HPAI H5N2

10 3

f old change

16

hours post inf ection

hours post inf ection

C

*

10 2

10 2

*

10 1 10 0 10 -1 10 -2 4

16

24

hours post inf ection Fig. 3. Comparison of IL-1b, IL-8 (CXCLi2), and IL-18 mRNA expression in BM-DC after HPAI and after LPAI H7N1 or H5N2 infection. mRNA expression of IL-1b (A), IL-8 (B) and IL-18 (C) was measured using qRT-PCR in BM-DC cultures at 4, 16 and 24 hpi. Graphs represent mean fold change in mRNA expression of LPAI and HPAI infected BM-DC compared to mock infected BM-DC within the experiment + SEM. For LPAI H7N1 infection 6 birds were tested and 4 birds were analyzed for infection with HPAI H7N1, LPAI H5N2 and HPAI H5N1. ⁄ Indicates a significant difference compared to the mock infected controls (p < 0.05).

IFN-α

107

fold change

106 10

B

8

5

LPAI H7N1 HPAI H7N1 LPAI H5N2 HPAI H5N2

*

104

IFN-γ 108 107 106

103

*

102

fold change

A 10

105

LPAI H7N1 HPAI H7N1 LPAI H5N2 HPAI H5N2

104 103 102

* *

*

*

101

101 100

100

10-1

10-1 10-2

10-2

4

16 hours post infection

24

4

16 hours post infection

24

Fig. 4. Comparison of IFN-a and IFN-c mRNA expression in BM-DC after HPAI and after LPAI H7N1 or H5N2 infection. mRNA expression of IFN-a (A) and IFN-c (B) was measured using qRT-PCR in BM-DC cultures at 4, 16 and 24 hpi. Graphs represent mean fold change in mRNA expression of LPAI and HPAI infected BM-DC compared to mock infected BM-DC within the experiment + SEM. For LPAI H7N1 infection 6 birds were tested and 4 birds were analyzed for infection with HPAI H7N1, LPAI H5N2 and HPAI H5N1. ⁄ Indicates a significant difference compared to the mock infected controls (p < 0.05).

(Spearmann’s rho correlation coefficient of 0.851 and 0.732 respectively, p < 0.05). A higher viral load was also positively correlated to higher IFN-a and IFN-c mRNA expression (rho 0.907 and 0.765 respectively, p < 0.05) after HPAI infection. The expression of TLR3 and TLR21 mRNA was correlated to IFN-a mRNA expression (rho 0.885 and 0.743 respectively, p < 0.05), and TLR3 mRNA expression was also correlated to IFN-c mRNA expression (rho 0.745, p < 0.05). 4. Discussion Innate defense mechanisms in response to acute viral infection consists of production of chemokines, pro-inflammatory cytokines

and type I IFNs by infected epithelial cells and macrophages and recruited DC, Natural Killer (NK) cells and granulocytes (Reemers et al., 2009). In this study we focused on the immature chicken DC and studied whether LPAI and HPAI could infect DC and if the difference in pathogenicity affects the DC maturation and activation in response to uptake of virus or infection. We hypothesized that in contrast to LPAI infection HPAI infection of chicken DC provokes a virus-induced cytokine deregulation which may contribute to the highly pathogenic nature of these HPAI viruses resulting in death of the chickens. After co-culture of BM-DC with LPAI H7N1 and H5N2, viral RNA and NP expression were detected, but the viral load did not increase over time suggesting that no or only limited progeny was achieved. In contrast, HPAI RNA expression

L. Vervelde et al. / Developmental and Comparative Immunology 39 (2013) 198–206

A

10 3

f old change

B

TLR1 10 4

10

2

10

1

LPAI H7N1 HPAI H7N1 LPAI H5N2 HPAI H5N2

TLR3

10 4

LPAI H7N1 HPAI H7N1 LPAI H5N2 HPAI H5N2

10 3

*

10 6 10 5

*

*

*

10 0

f old change

204

10

* *

2

10 1 10 0

10 -1

10 -1

10 -2

10 -2

C

TLR7 10 6 10 5

f old change

16 24 hours post inf ection

10 4 10 3 10 2

LPAI H7N1 HPAI H7N1 LPAI H5N2 HPAI H5N2

* *

10 1

4

D

16 24 hours post inf ection

TLR 21 10 4 10 3

f old change

4

10 2 10 1

LPAI H7N1 HPAI H7N1 LPAI H5N2 HPAI H5N2

*

*

* *

* *

10 0

10 0 10 -1

10 -1

10 -2

10 -2

4

16 24 hours post inf ection

4

16 24 hours post inf ection

Fig. 5. Comparison of TLR mRNA expression in BM-DC after HPAI and after LPAI H7N1 or H5N2 infection. mRNA expression was measured using qRT-PCR in BM-DC cultures at 4, 16 and 24 hpi for TLR1 (A), TLR3 (B), TLR7 (C) and TLR21 (D). Graphs represent mean fold change in mRNA expression of LPAI and HPAI infected BM-DC compared to mock infected BM-DC within the experiment + SEM. For LPAI H7N1 infection 6 birds were tested and 4 birds were analyzed for infection with HPAI H7N1, LPAI H5N2 and HPAI H5N1. ⁄ Indicates a significant difference compared to LPAI H7N1 or H5N2 infection (p < 0.05).

increased within 24 h. Subsequent activation of DC after LPAI infection based on marker expression was limited. No significant changes in surface expression of CD40, CD80, MHC I and MHC II were detected after infection with LPAI infected compared to mock infected DC. In vitro incubation of DC with higher infectious doses did not result in deregulation (data not shown). These results suggest that LPAI infection of immature DC either does not activate DC or hinders expression of surface antigens characteristic of DC differentiation (Wu et al., 2010; De Geus et al., 2012). Since chickens can clear LPAI infections effectively and even a high dose of virus (108 EID50 H9N2 intratracheal inoculation) does not result in clinical signs (data not shown), we hypothesized that the innate responses after LPAI infection are beneficial in contrast to the responses after HPAI infection. A similar response to LPAI was found in equine DC infected with H7N7, which resembles ‘‘seasonal flu’’ in human and causes mild disease in horses. Equine DC can be infected by H7N7, but limited progeny virus was produced and changes in expression of CD86, MHC I and MHC II were not significantly different from mock infected DC (Boliar and Chambers, 2010). Infection of human monocyte-derived DC with pandemic 2009 H1N1 and an H3N2 virus (Österlund et al., 2005, 2010) resulted in viral replication, but no or only small changes in the expression of CD80, CD83, CD86, and MHC class II were found (Österlund et al., 2005). In contrast, Ioannidis et al. (2012) showed that in mouse BM-derived DC the replication of mouse adapted influenza virus strains PR8 and X-31 is abortive, despite viral genome transcription and replication occurring for each gene segment and production of viral hemagglutinin and nucleoprotein. It was shown previously that HP and LP influenza A viruses induce differential responses in human DC. In a study by Thitithanyanont et al. (2007), infection of human monocyte-derived DC with avian HPAI H5N1 but not human LPAI H3N2 resulted in rapid cell death, production of IFN-a, but no or low levels of IFN-b, TNF-a, and IL-12p70 protein measured by Elisa. Plasmacytoid DC were resistant to infection with this avian H5N1 and produced high

levels of IFN-a. Blood CD14 + monocytes were resistant to virus replication and produced low levels of TNF-a and IL-6 (Thitithanyanont et al., 2007). In our study different strains of avian HPAI and LPAI viruses were co-cultured with avian BM-DC which circumvents species dependent susceptibility or entry issues. Our results imply that avian DC can represent a novel target for HPAI viruses, contributing to the dissemination of virus. Upon co-culture of HPAI H7N1 or H5N2 with DC for 24 h a significant increase in IL-8 (CXCLi2), IFN-a and IFN-c mRNA was found, whereas no such increases were detected after infection with LPAI at mRNA level. Surprisingly, bioactive IFN-a/b was significantly increased. Rapid induction of IFN-c mRNA after HPAI H5N1 infection was also found in vivo in chicken lung and spleen (Karpala et al., 2011) and in a lethal influenza infection murine model (Wong et al., 2009). Moreover, rapid production of IFN-c was also found after infection with infectious bronchitis virus (Ariaans et al., 2009) and might be typical reaction of the chicken linked to the existence of their unique TLRs (Higgs et al., 2006; Brownlie et al., 2009). DC express a variety of pathogen receptors on their cell surface, including TLR that recognize pathogen-associated molecular patterns resulting in activation of DC. TLR recognize single stranded and double stranded RNA during influenza virus replication and it has been shown that TLR ligation on human DC induced production of antiviral cytokines (Thitithanyanont et al., 2007). In mice activation of TLR3 was shown to have a detrimental impact on survival in influenza infected mice (Le Goffic et al., 2006) due to overexpression of cytokines such as IL-6 and TNF-a. We measured significant differences in the induction of especially TLR1, TLR3, and TLR21 mRNA expression (functionally analogue to TLR9; Brownlie et al., 2009) between LPAI and HPAI strains, which likely relate to the differences in cytokine responses between HPAI and LPAI virus. In the chicken the cells that express certain TLR are currently unknown, as is the location where the different TLR are expressed, intracellular or extracellular. If chicken DC subsets show heterogeneous, species dependent TLR distribution similar to

L. Vervelde et al. / Developmental and Comparative Immunology 39 (2013) 198–206

human and mouse DC subsets (Jarrossay et al., 2001; Edwards et al., 2003) remains to be elucidated. In this study we have shown that HPAI but not LPAI infection of BM-DC caused strong increased cytokine, IFN and TLR expression indicating enhanced activation of BM-DC. Based on the role of DC as central regulators of innate and adaptive immunity this enhanced activation may trigger over activation of the immune response as seen after HPAI infection. This is consistent with the idea that early HPAI induced pathogenesis is partly caused by inflammation, which would place DC at the basis of this deregulated immune response. Altogether, this study illustrates the possible involvement of DC in the deregulation of the immune response after HPAI infection. Subsequent in vivo studies should elucidate the role of DC during infection in the lung. Acknowledgements The authors thank Dr. W. Dundon for kindly providing LPAI and HPAI H7N1, Dr. G. Koch for kindly providing LPAI and HPAI H5N2, and Dr. S. Härtle for kindly providing the IFNa/b CEC reporter cells and the recombinant IFN standard. This work was supported by the Program ‘‘Impulse Veterinary Avian Influenza Research in the Netherlands‘‘ of the Dutch Ministry of Agriculture, Nature and Food Quality, by the EU sixth framework program Flupath (grant 04220), and by the Netherlands Organization for Scientific Research (NWO) Veni grant (016.096.049). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.dci.2012.10.011. References Ariaans, M.P., Matthijs, M.G., van Haarlem, D., van de Haar, P., van Eck, J.H., Hensen, E.J., Vervelde, L., 2008. The role of phagocytic cells in enhanced susceptibility of broilers to colibacillosis after Infectious Bronchitis Virus infection. Vet. Immunol. Immunopathol. 123, 240–250. Ariaans, M.P., van de Haar, P.M., Hensen, E.J., Vervelde, L., 2009. Infectious Bronchitis Virus induces acute interferon-gamma production through polyclonal stimulation of chicken leukocytes. Virology 385, 68–73. Aldridge Jr, J.R., Moseley, C.E., Boltz, D.A., Negovetich, N.J., Reynolds, C., Franks, J., Brown, S.A., Doherty, P.C., Webster, R.G., Thomas, P.G., 2009. TNF/iNOSproducing dendritic cells are the necessary evil of lethal influenza virus infection. Proc. Natl. Acad. Sci. USA 106, 5306–5311. Alexander, D.J., 2007. An overview of the epidemiology of avian influenza. Vaccine 25, 5637–5644. Banks, J., Speidel, E.S., Moore, E., Plowright, L., Piccirillo, A., Capua, I., Cordioli, P., Fioretti, A., Alexander, D.J., 2001. Changes in the haemagglutinin and the neuraminidase genes prior to the emergence of highly pathogenic H7N1 avian influenza viruses in Italy. Arch. Virol. 146, 963–973. Barbé, F., Atanasova, K., Van Reeth, K., 2011. Cytokines and acute phase proteins associated with acute swine influenza infection in pigs. Vet. J. 187, 48–53. Bean, W.J., Kawaoka, Y., Wood, J.M., Pearson, J.E., Webster, R.G., 1985. Characterization of virulent and avirulent A/chicken/Pennsylvania/83 influenza A viruses: potential role of defective interfering RNAs in nature. J. Virol. 54, 151–160. Beigel, J.H., Farrar, J., Han, A.M., Hayden, F.G., Hyer, R., de Jong, M.D., Lochindarat, S., Nguyen, T.K., Nguyen, T.H., Tran, T.H., et al., 2005. Avian influenza A (H5N1) infection in humans. N. Engl. J. Med. 353, 1374–1385. Bel, M., Ocaña-Macchi, M., Liniger, M., McCullough, K.C., Matrosovich, M., Summerfield, A., 2011. Efficient sensing of avian influenza viruses by porcine plasmacytoid dendritic cells. Viruses 3, 312–330. Boliar, S., Chambers, T.M., 2010. A new strategy of immune evasion by influenza A virus: inhibition of monocyte differentiation into dendritic cells. Vet. Immunol. Immunopathol. 136, 201–210. Brownlie, R., Zhu, J., Allan, B., Mutwiri, G.K., Babiuk, L.A., Potter, A., Griebel, P., 2009. Chicken TLR21 acts as a functional homologue to mammalian TLR9 in the recognition of CpG oligodeoxynucleotides. Mol. Immunol. 46, 3163–3170. De Geus, E.D., Jansen, C.A., Vervelde, L., 2012. Uptake of particulate antigens in a nonmammalian lung: phenotypic and functional characterization of avian respiratory phagocytes using bacterial or viral antigens. J. Immunol. 188, 4516– 4526. De Jong, M.D., Simmons, C.P., Thanh, T.T., Hien, V.M., Smith, G.J., Chau, T.N., Hoang, D.M., Chau, N.V., Khanh, T.H., Dong, V.C., Qui, P.T., Van Cam, B., Ha, D.Q., Guan,

205

Y., Peiris, J.S.M., Chinh, N.T., Hien, T.T., Farrar, J., 2006. Fatal outcome of human influenza A (H5N1) is associated with high viral load and hypercytokinemia. Nat. Med. 12, 1203–1207. Eldaghayes, I., Rothwell, L., Williams, A., Withers, D., Balu, S., Davison, F., Kaiser, P., 2006. Infectious bursal disease virus: strains that differ in virulence differentially modulate the innate immune response to infection in the chicken bursa. Viral Immunol. 19, 83–91. Edwards, A.D., Diebold, S.S., Slack, E.M., Tomizawa, H., Hemmi, H., Kaisho, T., Akira, S., Reis e Sousa, C., 2003. Toll-like receptor expression in murine DC subsets: lack of TLR7 expression by CD8 alpha+ DC correlates with unresponsiveness to imidazoquinolines. Eur. J. Immunol. 33, 827–833. Fernandez-Sesma, A., Marukian, S., Ebersole, B.J., Kaminski, D., Park, M.S., Yuen, T., Sealfon, S.C., García-Sastre, A., Moran, T.M., 2006. Influenza virus evades innate and adaptive immunity via the NS1 protein. J. Virol. 80, 6295–6304. Geurts van Kessel, C.H., Willart, M.A., van Rijt, L.S., Muskens, F., Kool, M., Baas, C., Thielemans, K., Bennett, C., Clausen, B.E., Hoogsteden, H.C., Osterhaus, A.D., Rimmelzwaan, G.F., Lambrecht, B.N., 2008. Clearance of influenza virus from the lung depends on migratory langerin+CD11b- but not plasmacytoid dendritic cells. J. Exp. Med. 205, 1621–1634. Higgs, R., Cormican, P., Cahalane, S., Allan, B., Lloyd, A.T., Meade, K., James, T., Lynn, D.J., Babiuk, L.A., O’farrelly, C., 2006. Induction of a novel chicken Toll-like receptor following Salmonella enterica serovar Typhimurium infection. Infect. Immun. 74, 1692–1698. Ioannidis, L.J., Verity, E.E., Crawford, S., Rockman, S.P., Brown, L.E., 2012. Abortive replication of influenza virus in mouse dendritic cells. J. Virol. 2012 (86), 5922– 5925. Jarrossay, D., Napolitani, G., Colonna, M., Sallusto, F., Lanzavecchia, A., 2001. Specialization and complementarity in microbial molecule recognition by human myeloid and plasmacytoid dendritic cells. Eur. J. Immunol. 31, 3388– 3393. Karpala, A.J., Bingham, J., Schat, K.A., Chen, L.M., Donis, R.O., Lowenthal, J.W., Bean, A.G., 2011. Highly pathogenic (H5N1) avian influenza induces an inflammatory T helper type 1 cytokine response in the chicken. J. Interferon Cytokine Res. 31, 393–400. Legge, K.L., Braciale, T.J., 2003. Accelerated migration of respiratory dendritic cells to the regional lymph nodes is limited to the early phase of pulmonary infection. Immunity 18, 265–277. Le Goffic, R., Balloy, V., Lagranderie, M., Alexopoulou, L., Escriou, N., Flavell, R., Chignard, M., Si-Tahar, M., 2006. Detrimental contribution of the Toll-like receptor (TLR)3 to influenza A virus-induced acute pneumonia. PLoS Pathog. 2 (6), e53. MacKinnon, K.M., He, H., Nerren, J.R., Swaggerty, C.L., Genovese, K.J., Kogut, M.H., 2009. Expression profile of toll-like receptors within the gastrointestinal tract of 2-day-old Salmonella enteriditis-infected broiler chickens. Vet. Microbiol. 137, 313–319. McGill, J., Van Rooijen, N., Legge, K.L., 2008. Protective influenza-specific CD8 T cell responses require interactions with dendritic cells in the lungs. J. Exp. Med. 2008 (205), 1635–1646. Mibayashi, M., Martínez-Sobrido, L., Loo, Y.M., Cárdenas, W.B., Gale Jr., M., GarcíaSastre, A., 2007. Inhibition of retinoic acid-inducible gene I-mediated induction of beta interferon by the NS1 protein of influenza A virus. J. Virol. 81, 514–524. Murata, H., Otsuki, K., 2011. Swine influenza and cytokines: less of a storm, more of a breeze. Vet. J. 187, 16–17. Mussá, T., Rodriguez-Cariño, C., Pujol, M., Córdoba, L., Busquets, N., Crisci, E., Dominguez, J., Fraile, L., Montoya, M., 2011. Interaction of porcine conventional dendritic cells with swine influenza virus. Virology 420, 125–134. Österlund, P., Veckman, V., Sirén, J., Klucher, K.M., Hiscott, J., Matikainen, S., Julkunen, I., 2005. Gene expression and antiviral activity of alpha/beta interferons and interleukin-29 in virus-infected human myeloid dendritic cells. J. Virol. 79, 9608–9617. Österlund, P., Pirhonen, J., Ikonen, N., Rönkkö, E., Strengell, M., Mäkelä, S.M., Broman, M., Hamming, O.J., Hartmann, R., Ziegler, T., Julkunen, I., 2010. Pandemic H1N1 2009 influenza A virus induces weak cytokine responses in human macrophages and dendritic cells and is highly sensitive to the antiviral actions of interferons. J. Virol. 84, 1414–1422. Pantin-Jackwood, M.J., Swayne, D.E., 2009. Pathogenesis and pathobiology of avian influenza virus infection in birds. Rev. Sci. Tech. 28, 113–136. Reemers, S.S., van Haarlem, D.A., Groot Koerkamp, M.J., Vervelde, L., 2009. Differential gene-expression and host-response profiles against avian influenza virus within the chicken lung due to anatomy and airflow. J. Gen. Virol. 90, 2134–2146. Reese, S., Dalamani, G., Kaspers, B., 2006. The avian lung-associated immune system: a review. Vet. Res., 37311–37324. Rebel, J.M., Peeters, B., Fijten, H., Post, J., Cornelissen, J., Vervelde, L., 2011. Highly pathogenic or low pathogenic avian influenza virus subtype H7N1 infection in chicken lungs: small differences in general acute responses. Vet. Res. 18 (42), 10–20. Schultz, U., Kaspers, B., Rinderle, C., Sekellick, M.J., Marcus, P.I., Staeheli, P., 1995. Recombinant chicken interferon: a potent antiviral agent that lacks intrinsic macrophage activating factor activity. Eur. J. Immunol. 25, 847–851. Schwarz, H., Harlin, O., Ohnemus, A., Kaspers, B., Staehili, P., 2004. Synthesis of IFN-b by virus-infected chicken embryo cells demonstrated with specific antisera and a new bioassay. J. Interferon Cytokine Res. 24, 179–184. Sijben, J.W., Klasing, K.C., Schrama, J.W., Parmentier, H.K., van der Poel, J.J., Savelkoul, H.F., Kaiser, P., 2003. Early in vivo cytokine genes expression in chickens after challenge with Salmonella typhimurium lipopolysaccharide and

206

L. Vervelde et al. / Developmental and Comparative Immunology 39 (2013) 198–206

modulation by dietary n–3 polyunsaturated fatty acids. Dev. Comp. Immunol. 27, 611–619. Skjødt, K., Welinder, K.G., Crone, M., Verland, S., Salomonsen, J., Simonsen, M., 1986. Isolation and characterization of chicken and turkey beta 2-microglobulin. Mol. Immunol. 23, 1301–1309. Swayne, D.E., 2007. Understanding the complex pathobiology of high pathogenicity avian influenza viruses in birds. Avian Dis. 51, 242–249. Swayne, D.E., Suarez, D.L., 2000. Highly pathogenic avian influenza. Rev. Sci. Tech. 19, 463–482. Talon, J., Horvath, C.M., Polley, R., Basler, C.F., Muster, T., Palese, P., García-Sastre, A., 2000. Activation of interferon regulatory factor 3 is inhibited by the influenza A virus NS1 protein. J. Virol. 74, 7989–7996. Thitithanyanont, A., Engering, A., Ekchariyawat, P., Wiboon-ut, S., Limsalakpetch, A., Yongvanitchit, K., Kum-Arb, U., Kanchongkittiphon, W., Utaisincharoen, P., Sirisinha, S., Puthavathana, P., Fukuda, M.M., Pichyangkul, S., 2007. High susceptibility of human dendritic cells to avian influenza H5N1 virus infection and protection by IFN-alpha and TLR ligands. J. Immunol. 179, 5220–5227.

Van der Goot, J.A., van Boven, M., Stegeman, A., van de Water, S.G., de Jong, M.C., Koch, G., 2008. Transmission of highly pathogenic avian influenza H5N1 virus in Pekin ducks is significantly reduced by a genetically distant H5N2 vaccine. Virology 382, 91–97. Von Garnier, C., Filgueira, L., Wikstrom, M., Smith, M., Thomas, J.A., Strickland, D.H., Holt, P.G., Stumbles, P.A., 2005. Anatomical location determines the distribution and function of dendritic cells and other APCs in the respiratory tract. J. Immunol. 175, 1609–1618. Wang, X., Li, M., Zheng, H., Muster, T., Palese, P., Beg, A.A., García-Sastre, A., 2000. Influenza A virus NS1 protein prevents activation of NF-kappaB and induction of alpha/beta interferon. J. Virol. 74, 11566–11573. Wong, J.P., Christopher, M.E., Viswanathan, S., Karpoff, N., Dai, X., Das, D., Sun, L.Q., Wang, M., Salazar, A.M., 2009. Activation of toll-like receptor signaling pathway for protection against influenza virus infection. Vaccine 27, 3481–3483. Wu, Z., Rothwell, L., Young, J.R., Kaufman, J., Butter, C., Kaiser, P., 2010. Generation and characterization of chicken bone marrow-derived dendritic cells. Immunology 129, 133–145.