- Email: [email protected]
Chondrogenic differentiation of human adipose-derived stem cells in polyglycolic acid mesh scaffolds under dynamic culture conditions
Biomaterials 31 (2010) 3858–3867
Contents lists available at ScienceDirect
Biomaterials journal homepage: www.elsevier.com/locate/biomaterials
Chondrogenic differentiation of human adipose-derived stem cells in polyglycolic acid mesh scaffolds under dynamic culture conditions Nastaran Mahmoudifar a, Pauline M. Doran b, * a b
School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney NSW 2052, Australia School of Biological Sciences and Department of Chemical Engineering, Monash University, VIC 3800, Australia
a r t i c l e i n f o
a b s t r a c t
Article history: Received 18 December 2009 Accepted 15 January 2010 Available online 11 February 2010
Chondrogenic differentiation of human adult adipose-derived stem cells was studied in vitro for the development of engineered cartilage tissue. Cells cultured under dynamic conditions in polyglycolic acid (PGA) scaffolds produced substantially higher glycosaminoglycan (GAG) and total collagen levels than cells in pellet cultures. This result reflects the importance of cell attachment and cell–scaffold interactions in stem cell differentiation and chondrogenesis. Although gene expression levels for both aggrecan and collagen type II were up-regulated significantly in PGA cultures treated with transforming growth factor b1 (TGF-b1), synthesis of GAG but not collagen type II was enhanced in tissue constructs when TGF-b1 was added to the medium. Bone morphogenetic protein-6 (BMP-6) in the presence of TGF-b1 was effective in improving GAG and total collagen production when the cells were pre-treated with fibroblast growth factor-2 (FGF-2) prior to scaffold seeding. Extending the culture duration from 2 to 5 weeks did not improve cartilage development in PGA scaffolds; loss of cells from the constructs suggested that the rate of scaffold degradation exceeded the rate of replacement by ECM during the 5-week period. Stem cells in PGA scaffolds were cultured in perfusion-type recirculation bioreactors operated with periodic medium flow reversal. The highest levels of GAG and collagen type II accumulation were achieved in the bioreactor cultures after the seeding cell density was increased from 2 107 to 4 107 cells per scaffold. Ó 2010 Elsevier Ltd. All rights reserved.
Keywords: Bioreactor Cartilage tissue engineering ECM (extracellular matrix) Growth factors Mesenchymal stem cell Polyglycolic acid
1. Introduction Adipose tissue contains stem cells that have the capacity to differentiate into cartilage, bone, muscle and adipose lineages in the presence of appropriate differentiation factors and culture conditions [1]. Adipose-derived stem cells maintain their multipotency in vitro over several culture passages [2] and have been shown to exhibit enhanced chondrogenic potential after extended passaging [3]. Compared with other sources of mesenchymal stem cells such as bone marrow, adipose tissue has the advantage of being readily available from patients in relatively large quantities using liposuction procedures. Accordingly, human adult adiposederived stem cells are a promising alternative to differentiated chondrocytes for tissue engineering and cell-based therapy of damaged articular cartilage. The critical issue for application of stem cells in tissue engineering is the initiation and control of cellular differentiation. Chondrogenesis in adipose-derived stem cells is known to be enhanced under three-dimensional culture conditions compared
* Corresponding author. Tel.: þ61 3 9905 1373; fax: þ61 3 9905 5613. E-mail address: [email protected] (P.M. Doran). 0142-9612/$ – see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.biomaterials.2010.01.090
with monolayer culture [4]. Typically, differentiation of stem cells is studied using high-density cell aggregates, also called pellet, spheroid or micromass cultures. The chondrogenic potential of adipose-derived stem cells in pellet culture has been reported to be lower than bone-marrow-derived mesenchymal stem cells cultured in the same way [5,6], in that additional and/or higher concentrations of growth factors were required for the adiposederived cells to match the chondrogenic capacity of bone-marrowderived cells [7,8]. However, there is increasing recognition that stem cell differentiation depends on a range of factors other than the exogenous biochemical mediators added to the culture medium. In particular, the culture conditions employed and the physical interactions that occur between the cells and extracellular matrix (ECM) or scaffold can exert a profound influence [9–12]. Environmental factors regulating the shape and alignment of cells, cell adhesion and migration, and the build-up of mechanical stresses in the cytoskeleton have been identified as important influences on the chondrogenic potential of stem cells. Accordingly, the use of scaffolds and the choice of scaffold material and structure are key elements in the investigation of stem cell differentiation and application. Many studies have shown that the culture conditions applied for in vitro cartilage synthesis have a significant effect on the quality of
N. Mahmoudifar, P.M. Doran / Biomaterials 31 (2010) 3858–3867
tissue produced. Fluid mixing is now well-recognised to enhance the development of tissues relative to static culture methods [13–15]. Good oxygen transfer and gas exchange are also beneficial for active synthesis of cartilage ECM [16,17]. Bioreactors offer important advantages compared with static plate, tissue flask or Petri dish culture systems, including better control over culture conditions, enhanced mass transfer, and the ability to provide mechanical forces influencing cell and tissue development. Various bioreactor systems including perfusion (flow-through) devices and rotating vessels have been applied for cartilage tissue engineering [18]. Irrespective of the type of cells cultured, appropriate dynamic and controllable cultivation techniques are required to induce and maintain chondrogenesis for the production of three-dimensional cartilage constructs. In this work, human adult adipose-derived stem cells were applied for chondrogenic differentiation and cartilage tissue engineering using porous polymer mesh scaffolds and dynamic cell culture conditions. Stem cells were isolated from liposuction tissue and characterised using flow cytometry and immunofluorescence assays. The effect on chondrogenesis of culturing stem cells in polyglycolic acid (PGA) scaffolds was assessed using quantitative real-time polymerase chain reaction (PCR) techniques and biochemical analysis of cartilage matrix components. Cartilaginous tissue development in PGA scaffolds was compared with that observed in pellet cultures. Combinations of transforming growth factor b1 (TGF-b1), bone morphogenetic protein-6 (BMP-6) and fibroblast growth factor-2 (FGF-2) were applied for induction of cartilage synthesis. The properties of scaffold-seeded cartilaginous constructs produced using stem cells cultured in recirculation bioreactors were also examined. 2. Materials and methods 2.1. Culture media Several different culture media were used as summarised in Table 1. 2.2. Isolation and culture of adipose-derived stem cells This work was carried out with approval from the University of New South Wales Human Research Ethics Committee. Subcutaneous adipose tissue (lipoaspirate) was obtained with consent from female and male patients of age 34–47 as a waste product from liposuction surgery. The lipoaspirate was processed using methods adapted from van Harmelen et al. [19]. Raw lipoaspirate was washed extensively using Dulbecco’s phosphate buffered saline (PBS: 0.2 g L1 KCl, 0.2 g L1 KH2PO4, 8 g L1 NaCl and 2.16 g L1 Na2HPO4.7H2O; pH 7.2) to remove blood. The adipose tissue was then dissected and digested with gentle mixing for 60–90 min at 37 C in PBS containing 0.065–0.12% (approx. 400 U mL1) collagenase type IA (Sigma), 1.5% bovine serum albumin (BSA: Sigma) and 1% antibiotic solution (Sigma) to give 100 U mL1 penicillin, 100 mg mL1 streptomycin and 0.25 mg mL1 amphotericin B. The cell suspension was centrifuged for 5 min at 1400 rpm and the pellet was washed using control medium containing 1% antibiotic solution. The pellet was re-suspended in lysis buffer (154 mM NH4Cl, 10 mM KHCO3 and 0.1 mM Na2EDTA; pH 7.4) and incubated at room temperature for 10 min to lyse red blood cells. The resulting cell suspension was filtered using a 150-mm nylon filter to remove cell debris. The cells in the filtrate were collected by centrifugation, washed, counted and cultured in T-flasks using an initial density of 20,000 viable cells per cm2. The medium was removed after 3 days, the monolayer was rinsed twice using PBS to
3859
remove non-adherent cells and fresh medium was added. The medium was changed every 3 days until the cells were confluent. Cells were harvested using trypsin–EDTA (0.25% w/v trypsin (Sigma) and 0.02% w/v Na2EDTA), frozen overnight at 80 C in control medium containing 80% v/v FBS and 10% v/v dimethylsulphoxide (DMSO), and stored in liquid nitrogen until needed. These cells were designated passage zero (P0) cells. 2.3. Characterisation of stem cells isolated from adipose tissue Cells harvested from T-flasks at P0 were characterised using flow cytometry and indirect immunofluorescence. Monoclonal mouse anti-human antibodies against vimentin (clone V9: Zymed Laboratories, USA), an intermediate filament protein expressed in mesenchymal cells, and CD90 (Thy-1) (clone F15-42-1: Biosource International, USA), a cell surface marker for mesenchymal cells and fibroblasts, were used to identify stem cells. Monoclonal mouse anti-human antibody against smooth muscle actin (clone IA4: Zymed Laboratories) was used to identify smooth muscle cells and pericytes; monoclonal mouse anti-human antibody against Factor VIII (clone Z002: Zymed Laboratories) was used to identify endothelial cells. For flow cytometry analysis, approximately 107 P0 cells were fixed in 2% paraformaldehyde in PBS on ice for 15 min and permeabilised using flow cytometry buffer (FCB: PBS containing 2% FBS and 0.2% w/v Tween-20). The cells were resuspended in PBS containing 2% FBS and 2% BSA, incubated on ice for 15 min to block non-specific sites, and then re-suspended in FCB. Aliquots of 1 mL containing 1 106 cells were incubated with primary monoclonal antibodies on ice for 40 min. Antibodies against vimentin and CD90 were diluted 1:100; antibody against smooth muscle actin was diluted 1:50; antibody against Factor VIII was used as diluted by the manufacturer. The cells were then incubated with a 1:100 dilution of rabbit antimouse FITC-conjugated IgG (H þ L) (Zymed Laboratories) on ice for 30–40 min. The cells were re-suspended in 1 mL of FCB, filtered on a 38-mm nylon filter and analysed using a Becton Dickinson flow cytometer. Unstained cells (not incubated with primary or secondary antibody) were used as a negative control. Fixed cells incubated with FITC-conjugated secondary antibody only were used to assess nonspecific binding. For immunofluorescence analysis, P0 cells were cultured in 8-well permanox (Nalge Nunc International, USA) chamber slides overnight using a cell density of 20,000–40,000 cells cm2. Attached cells were rinsed with Tris-buffered saline (TBS: 50 mM Tris buffer containing 8.5 g L1 NaCl; pH 7.6) and fixed in 10% neutral-buffered formalin at room temperature for 15 min. Non-specific sites were blocked using TBS containing 1% BSA, 10% FBS and 0.1% Triton X-100 at room temperature for 30 min. The cells were incubated with primary antibodies diluted in blocking buffer at room temperature for 1 h. Antibodies against vimentin and CD90 were diluted 1:200; antibody against smooth muscle actin was diluted 1:50; antibody against Factor VIII was used as diluted by the manufacturer. The cells were then incubated with rabbit anti-mouse FITC-conjugated IgG (H þ L) diluted 1:50 at room temperature for 1 h. The cells were mounted using a solution containing 40 ,6-diamidino-2phenylindole (DAPI) to stain cell nuclei (VectaShield, Vector Laboratories, USA), viewed under a fluorescence microscope and photographed. 2.4. Polymer scaffold Fibrous polyglycolic acid (PGA) mesh was purchased from Concordia Manufacturing (Coventry, USA) as sheets of thickness 2 and 5 mm and bulk density 45 and 57 mg cm3, respectively. The PGA was cut into discs of diameter 15 mm using a punch wad. The discs were sterilised using ethylene oxide, packaged under vacuum using nitrogen gas and stored at 4 C. 2.5. Chondrogenic differentiation using PGA scaffolds P0 cells were passaged twice using control medium in monolayer culture (P2) before seeding into 5-mm-thick PGA scaffolds. PGA discs were soaked in control medium for 48 h and then transferred to a 24-well culture dish (one disc per well). Each disc was seeded with 600 mL of cell suspension containing 2 107 cells by adding the suspension drop-wise from a pipette. The discs were placed in a CO2 incubator at 37 C and turned over every 15 min for the first 2 h to obtain a homogeneous cell distribution throughout the scaffold. After 2.5 h, each disc was
Table 1 Composition of culture media. Medium
Composition
Control medium
Dulbecco’s modified Eagle’s medium (DMEM: Sigma, USA) containing 4500 mg L1 glucose and 584 mg L1 glutamine þ 3.5 g L1 sodium hydrogen carbonate, 10 mM N-2-hydroxyethyl piperazine N0 -2-ethane sulphonic acid (HEPES), 10% (v/v) foetal bovine serum (FBS: Invitrogen, USA) and 0.5% antibiotic solution (Sigma). Control medium þ 0.4 mM proline, 0.1 mM non-essential amino acids (Sigma) and 100 mM L-ascorbate-2-phosphate (Sigma) Cartilage medium þ 10 ng mL1 TGF-b1 (Invitrogen) and 6.25 mg mL1 insulin (Sigma) Chondrogenic medium þ 10 ng mL1 BMP-6 (Sigma)
Cartilage medium Chondrogenic medium Chondrogenic medium with BMP-6
3860
N. Mahmoudifar, P.M. Doran / Biomaterials 31 (2010) 3858–3867
Table 2 Gene-specific primers used for real-time PCR amplification. Gene
Forward Primer
Reverse Primer
Size of Amplicon (bp)
Gene Bank Accession Number
Primer Bank ID
Aggrecan Collagen type II alpha 1 COMP GAPDH
CACTGGCGAGCACTGTAACAT ACACTGGGACTGTCCTCTG GTCCGCTGTATCAACACCAG TGTTGCCATCAATGACCCCTT
TCCACTGGTAGTCTTGGGCAT GTCCAGGGGCACCTTTTTCA GGAGTTGGGGACGCAGTTA CTCCACGACGTACTCAGCG
206 270 168 202
NM_013227 NM_001844 NM_000095 NM_002046
6995994a2 13435125a1 4557483a2 7669492a2
transferred to a well of a 6-well culture dish containing 3.5 mL of control medium and placed in a CO2 incubator overnight. The discs were then transferred to 20 mL of either control medium, cartilage medium, chondrogenic medium or chondrogenic medium with BMP-6 in 100-mL glass jars with Magenta B-cap vented filter closures (Magenta, USA) (one disc per jar). The jars were placed on an orbital shaker operated at 65 rpm in a CO2 incubator at 37 C. The medium was replaced every 3 days or twice per week and all discs were harvested after 2 weeks. Triplicate cultures were carried out for all treatments. 2.6. Chondrogenic differentiation using pellet culture Approximately 106 P2 cells were placed in each of triplicate 10-mL centrifuge tubes. After centrifuging, the spent medium was removed and 1 mL of chondrogenic medium was added to each tube. The tubes were then placed in a CO2 incubator at 37 C with the caps loosened for gas exchange. The medium was replaced every 3 days or twice per week and the pellets were harvested after 2 weeks. 2.7. Effect of extended culture time using PGA scaffolds PGA scaffolds (5 mm thick) were seeded with 600 mL of P2 cell suspension containing 2 107 cells and cultured in glass jars containing 20 mL of chondrogenic medium with BMP-6. The jars were placed on an orbital shaker operated at 65 rpm in a CO2 incubator at 37 C. The medium was replaced every 3 days or twice per week. Triplicate cultures were harvested after 2 and 5 weeks. 2.8. Effect of FGF-2 pre-treatment using PGA scaffolds P1 cells were passaged in monolayer using control medium with addition of 10 ng mL1 FGF-2 (Sigma). The cells were seeded into 5-mm-thick PGA discs and cultured in either chondrogenic medium or chondrogenic medium with BMP-6. Cells passaged twice without added FGF-2 were used as negative controls. The cultures were carried out using 20 mL of medium in glass jars as described above. Triplicate cultures were harvested after 2 weeks. 2.9. Bioreactor cultures P2 cells were seeded into 5-mm-thick PGA discs using 2 107 or 4 107 cells per disc. The discs were incubated in chondrogenic medium in glass jars for 2 weeks and then transferred to recirculation bioreactors and cultured in chondrogenic medium for a further 3 weeks. In addition, two 2-mm-thick PGA discs were seeded using 2 107 cells per disc, cultured in chondrogenic medium in jars for 1 week, sutured together to form a composite scaffold [20], and then cultured in chondrogenic medium in recirculation bioreactors for a further 4 weeks. The total cell culture time for all treatments was 5 weeks. The recirculation bioreactors have been described previously [20]. For the present work, two modifications were made to the equipment: the double-flange section in the middle of the bioreactor chambers was removed, and the volume of medium recirculated per bioreactor was reduced from 200 mL to 100 mL to minimise the cost of expensive growth factors. The medium flow rate was 0.2 mL min1 and the direction of flow was reversed every 3 days or twice per week after 50% v/v of medium was replaced with fresh medium. Triplicate bioreactor systems were used for each culture experiment. 2.10. Analyses After harvest from jars or bioreactors, each tissue construct was rinsed with PBS, weighed, and then divided into several sections for PCR, biochemical and histological analyses. A strip of tissue of width approximately 3 mm was cut through the centre along the diameter of each disc for histological assessment of the full tissue cross-section. One of the remaining half discs was used for determination of cell, glycosaminoglycan (GAG), and total collagen concentrations. The other half disc was cut into two sections and each section was used for PCR analysis or measurement of collagen type II concentration. 2.10.1. Quantitative real-time PCR Quantitative real-time PCR was performed to determine the relative expression of the chondrogenic genes, aggrecan, collagen type II and cartilage oligomeric matrix protein (COMP), in cells cultured for 2 weeks in PGA scaffolds in glass jars using either cartilage or chondrogenic medium. Tissue samples were placed in RNAlater
solution (Qiagen, USA), stored at 4 C overnight, and then stored at 20 C until needed. Approximately 100 mg of tissue was disrupted and homogenised in 1.2 mL of lysis buffer (Qiagen) using a TissueRuptor (Qiagen). Total RNA was isolated using 400 mL of homogenised tissue and an RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. The concentration and purity of RNA was determined in all samples using a Nanodrop spectrophotometer. RNA samples were stored at 80 C until needed. cDNA was synthesised from 600 ng of total RNA using an Invitrogen SuperScript III First-Strand cDNA Synthesis Kit according to the manufacturer’s instructions. cDNA samples were stored at 20 C until needed. Primers were chosen from the Primer Bank and purchased from Sigma (Table 2). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the reference gene and PCR was performed using a Platinum SYBR Green qPCR SuperMix-UDG kit (Invitrogen). PCRs were prepared in 50 mL containing 25 mL of SYBR Green SuperMix-UDG, 1 mL of 100 ng mL1 forward primer, 1 mL of 100 ng mL1 reverse primer, 10 mL of 10-timesdiluted cDNA, and 13 mL of diethyl pyrocarbonate (DEPC)-treated water. All samples were tested in duplicate and non-template samples (without cDNA) were used as negative controls. PCR amplification was performed using a Corbett Rotor-Gene 6000 (Qiagen). Samples were held at 50 C for 2 min and then 95 C for 2 min followed by 40 cycles of 95 C for 15 s (melting) and 60 C for 30 s (annealing and extension). The specificity of the PCR products was confirmed by melting curve analysis. The efficiency of all genes was determined using serially diluted pooled cDNA samples. The relative expression of each gene was determined according to Pfaffl’s method using Relative Expression Software Tool (REST 2005) software. 2.10.2. Cell, GAG, total collagen and collagen type II concentrations Cell, GAG and total collagen concentrations were determined using papaindigested tissue sections as described previously [20]. For calculation of cell numbers, the DNA content of adipose-derived stem cells was determined [21] as 15.4 pg DNA per cell. Collagen type II concentration was measured in proteinase K-digested tissue sections using an ELISA kit (Ibex Pharmaceuticals, Canada) as described previously [20]. 2.10.3. Histology Tissue sections were fixed in 10% neutral-buffered formalin for at least 24 h, embedded in paraffin, and cut into 8-mm-thick sections. The sections were then deparaffinised and stained with Weigert’s iron hematoxylin for 5 min, washed in tap water, stained with 0.02% fast green (Sigma) for 4 min, washed in 1% v/v acetic acid, and stained with 0.1% safranin-O (Sigma) for 3 min [22]. Cell nuclei stained black, GAG stained orange–red, and collagen stained blue–green. The stained sections were mounted in Depex (Merck, Germany), viewed under a light microscope and photographed. 2.10.4. Statistics Data from triplicate cultures are presented as averages standard errors. The Student’s t-test was used for comparing two groups of data at p < 0.05 and p < 0.01 levels of significance. One-way analysis of variance (ANOVA) in conjunction with Tukey’s test was used to compare multiple groups of data at p < 0.05 and p < 0.01 levels of significance.
3. Results 3.1. Yield and characterisation of isolated cells In this work, the yield of isolated stem cells was (5.7 1.6) 105 per mL of washed adipose tissue. This can be compared with yields of approximately 4.0 105 per mL of lipoaspirate reported in the literature as an average from several studies [2]. The results from flow cytometry showed that 96% of P0 cells were positive for CD90, a marker for stem cells and fibroblasts, and 85% were positive for vimentin, a marker for cells of mesenchymal origin. Only 4% of the P0 cells reacted positively with antibody against smooth muscle actin, a marker of smooth muscle cells, while staining with antibody against Factor VIII, a marker for endothelial cells, was negative. These results were confirmed by
N. Mahmoudifar, P.M. Doran / Biomaterials 31 (2010) 3858–3867
3861
Fig. 2. Gene expression levels in adipose-derived stem cells cultured for 2 weeks in PGA scaffolds in chondrogenic medium, relative to the levels observed in cells cultured in cartilage medium without added growth factors. Significant differences at the p < 0.01 level are identified **.
3.2. Chondrogenic differentiation in PGA scaffolds using different culture media
Fig. 1. Photomicrographs of P0 cells isolated from adipose tissue and immunostained for: (a) vimentin; (b) CD90; (c) smooth muscle actin; and (d) Factor VIII.
indirect immunofluorescence analysis (Fig. 1), which showed that the majority of cells reacted positively with antibodies against vimentin and CD90 (Fig. 1a, b). In contrast, very few cells stained for smooth muscle actin or Factor VIII (Fig. 1c, d).
As shown in Fig. 2, mRNA levels for both aggrecan and collagen type II were up-regulated significantly (p < 0.01) when chondrogenic medium containing TGF-b1 and insulin was used for culture of adipose-derived stem cells relative to cartilage medium. Expression of COMP was not significantly affected. Aggrecan expression was increased 7.0-fold and collagen type II expression was increased 530-fold as a result of growth factor treatment. Results for construct wet weight, cell number and levels of GAG, total collagen and collagen type II produced by cells in PGA scaffolds are shown in Fig. 3. The construct wet weight and number of cells obtained using cartilage medium, chondrogenic medium and chondrogenic medium with BMP-6 were significantly higher (p < 0.01) than the results for control medium (Fig. 3a, b). There was no statistically significant difference in construct wet weight or cell number between the cartilage medium, chondrogenic medium, and chondrogenic medium with BMP-6 groups. The water contents of the harvested constructs were similar at 86%, 89%, 85% and 87% w/w for the control medium, cartilage medium, chondrogenic medium and chondrogenic medium with BMP-6, respectively. The respective average final cell numbers in the different constructs at harvest were 25%, 88%, 70% and 93% of the number used for seeding. As shown in Fig. 3c, GAG synthesis in control medium was not significantly different from that in cartilage medium, chondrogenic medium, or chondrogenic medium with BMP-6. However, GAG levels in constructs produced using chondrogenic medium and chondrogenic medium with BMP-6 were 59% greater (p < 0.01) and 41% greater (p < 0.05), respectively, than in cartilage medium without added growth factors. Total collagen levels in cartilage medium, chondrogenic medium and chondrogenic medium with BMP-6 were 11–12-fold higher (p < 0.01) than in control medium (Fig. 3d). There was no statistically significant difference in either total collagen or collagen type II content between the cartilage medium, chondrogenic medium and chondrogenic medium with BMP-6 groups (Fig. 3d, e). The results in Fig. 3c indicate that the enhanced chondrogenic potential of stem cells in PGA scaffolds measured using PCR after culture in chondrogenic medium containing TGF-b1 and insulin (Fig. 2) was translated into enhanced GAG deposition in the tissue constructs. In contrast, collagen type II accumulation was not
3862
N. Mahmoudifar, P.M. Doran / Biomaterials 31 (2010) 3858–3867
Fig. 4. Histological appearance of tissue produced using adipose-derived stem cells cultured for 2 weeks in a PGA scaffold in chondrogenic medium. GAG is shown orange– red; collagen is shown blue–green; residual PGA fibres appear as red flecks. GAG accumulated mainly within the peripheral zone of the construct.
improved (Fig. 3e) even though gene expression for collagen type II was found to be up-regulated substantially (530-fold) in chondrogenic medium compared with cartilage medium (Fig. 2). Fig. 4 shows the results from histological analysis of constructs produced using chondrogenic medium. The cells were evenly distributed throughout the tissue. Whereas collagen (blue–green stain) was present at low levels throughout the constructs, GAG (orange–red staining) accumulated mainly in a thin layer at the periphery. Incomplete degradation of the scaffold is evident in Fig. 4, as many residual PGA fibres can be seen in the form of red flecks at all locations except within the outer peripheral zone. 3.3. Comparison between PGA and pellet cultures Pellet cultures were initiated using 106 cells mL1 of chondrogenic medium and were carried out under static culture conditions. The PGA cultures were also initiated using 106 cells mL1 of chondrogenic medium and were carried out under dynamic conditions. Results for construct wet weight, cell number, GAG and total collagen are shown in Fig. 5. Because the pellet and PGA cultures were performed using different volumes (1 and 20 mL, respectively), the data for construct wet weight and cell number are expressed per mL of culture liquid. The construct wet weight per mL in the PGA cultures was 13-fold higher (p < 0.01) than in the pellet cultures (Fig. 5a). However, the presence of residual polymer scaffold in the PGA constructs contributes to the wet weight measured for these cultures compared with the pellets containing cells and ECM only. Using a measured wet weight:dry weight ratio for the harvested PGA constructs of 6.8 0.074, the average dry weight of the tissues harvested from the PGA cultures was 76 3.2 mg. To assess the maximum possible contribution of the scaffold weight, this can be compared with the average dry weight of an unseeded PGA disc, 44 0.30 mg. The extent to which the scaffolds degraded during the 2-week culture period was not measured quantitatively. Control experiments using PGA discs
Fig. 3. Effect of medium composition and growth factors on the properties of tissue constructs produced using adipose-derived stem cells cultured in PGA scaffolds for 2 weeks: (a) construct wet weight; (b) number of cells; (c) GAG; (d) total collagen; and (e) collagen type II. The error bars represent standard errors from triplicate cultures. n.a. ¼ not analysed. Significant differences at the p < 0.01 level relative to the results for control medium are identified **. Significant differences in GAG content at the p < 0.05 and p < 0.01 levels between the groups indicated are identified y and yy, respectively.
N. Mahmoudifar, P.M. Doran / Biomaterials 31 (2010) 3858–3867
Fig. 5. Properties of tissues produced using adipose-derived stem cells in pellets and PGA scaffolds after 2 weeks of culture in chondrogenic medium. Both types of culture were initiated using 106 cells mL1. (a) Construct wet weight; (b) number of cells; (c) GAG; and (d) total collagen. The error bars represent standard errors from triplicate cultures. Significant differences at the p < 0.05 and p < 0.01 levels are identified * and **, respectively. GAG and total collagen accumulation was significantly greater in the PGA cultures than in pellets.
3863
Fig. 6. Effect of culture duration on the properties of tissue constructs produced using adipose-derived stem cells in PGA scaffolds: (a) construct wet weight; (b) number of cells; (c) GAG; (d) total collagen; and (e) collagen type II. The cells were cultured in chondrogenic medium with BMP-6 for either 2 or 5 weeks. The error bars represent standard errors from triplicate cultures. Significant differences at the p < 0.05 and p < 0.01 levels are identified * and **, respectively. Extending the culture period from 2 to 5 weeks did not improve cartilage tissue production.
3864
N. Mahmoudifar, P.M. Doran / Biomaterials 31 (2010) 3858–3867
incubated in chondrogenic medium showed that unseeded scaffolds were very fragile and only about one-third of their initial size after 2 weeks, while histological analysis (Fig. 4) indicated that a considerable amount of polymer fibre remained in the constructs at harvest. Depending on the degree of scaffold degradation, residual scaffold material may be considered to comprise a proportion 58% of the construct weight in the PGA cultures. Applying this result to the data in Fig. 5a, even when the scaffold weight is taken into account, the mass of tissue produced per mL in the PGA cultures was considerably greater than in the pellet cultures. As shown in Fig. 5b, the final cell number per mL was 1.4-fold higher (p < 0.05) in the PGA constructs than in the pellet cultures, representing 70% and 49% of the number of cells used to initiate the cultures, respectively. As indicated in Fig. 5c and d, GAG and total collagen production in the PGA cultures were 2.4- and 4.6-fold higher (p < 0.01), respectively, than those achieved in pellet culture. Collagen type II was not determined in this experiment because the pellet cultures provided insufficient sample material. 3.4. Effect of extended culture time using PGA scaffolds As shown in Fig. 6, extending the culture time from 2 weeks to 5 weeks did not improve the development of cartilaginous tissue by adipose-derived stem cells in PGA scaffolds. The wet weight of the harvested constructs was much lower (p < 0.01) after 5 weeks of culture than after 2 weeks (Fig. 6a). This result probably reflects continued degradation of the polymer scaffold during the longer culture period in the absence of an equal or higher rate of replacement by newly synthesised ECM. The results for cell number and GAG were also lower (p < 0.05) after 5 weeks of culture than after 2 weeks (Fig. 6b, c), but there was no significant difference in total collagen or collagen type II (Fig. 6d, e). 3.5. Effect of pre-treatment with FGF-2 combined with TGF-b1 and BMP-6 in PGA scaffolds Cells passaged with FGF-2 in monolayer culture adopted a more elongated, fibroblast-like morphology than cells passaged without FGF-2. After cell seeding into PGA scaffolds, the construct wet weight at harvest was increased significantly (p < 0.05) in cultures pre-treated with FGF-2 only when BMP-6 was added to the culture medium (Fig. 7a). The number of cells in the tissues was significantly higher (p < 0.05 or p < 0.01) when BMP-6 was used irrespective of whether the cultures were pre-treated with FGF-2 (Fig. 7b). Pre-treatment with FGF-2 had no significant effect on cell number in cultures receiving the same BMP-6 treatment (Fig. 7b). As shown in Fig. 7c and d, after FGF-2 pre-treatment, addition of BMP-6 increased GAG and total collagen levels 1.3-fold (p < 0.01) and 1.7-fold (p < 0.05), respectively, compared with cultures without BMP-6. This effect was not observed in cultures without FGF-2 pre-treatment (Fig. 7c, d). In the absence of BMP-6 in the culture medium, constructs produced using cells pre-treated with FGF-2 exhibited lower (p < 0.05 or p < 0.01) GAG and total collagen levels than those produced without FGF-2 treatment; this effect
Fig. 7. Properties of tissues produced by adipose-derived stem cells passaged with or without FGF-2 prior to seeding into PGA scaffolds and then cultured for 2 weeks in either chondrogenic medium or chondrogenic medium with BMP-6. (a) Construct wet weight, (b) number of cells, (c) GAG, (d) total collagen, and (e) collagen type II. The error bars represent standard errors from triplicate cultures. Significant differences at the p < 0.05 and p < 0.01 levels between corresponding cultures with and without BMP-6 are identified * and **, respectively. Significant differences at the p < 0.05 and p < 0.01 levels between corresponding cultures with and without FGF-2 pre-treatment are identified y and yy, respectively.
N. Mahmoudifar, P.M. Doran / Biomaterials 31 (2010) 3858–3867
3865
was not observed in the presence of BMP-6 (Fig. 7c, d). There was no statistically significant difference in collagen type II production between any of the treatment groups (Fig. 7e). 3.6. Bioreactor cultures The wet weight of constructs produced in bioreactors using composite scaffolds was significantly higher (p < 0.05) than that obtained using 5-mm PGA seeded using 4 107 cells, but not significantly different from that using 5-mm PGA and 2 107 cells (Fig. 8a). Cell numbers in the constructs at harvest were not significantly different between the treatment groups (Fig. 8b). GAG accumulation was 1.9-fold greater (p < 0.01) using composite scaffolds than in the cultures with single PGA discs (Fig. 8c). Total collagen production using composite scaffolds was 1.7-fold (p < 0.05) greater than with single PGA discs seeded using 4 107 cells, but not significantly different from that in cultures seeded with 2 107 cells (Fig. 8d). In contrast, collagen type II levels were significantly higher (p < 0.05 and p < 0.01) in the cultures with 5mm PGA seeded using 4 107 cells than in the other treatment groups (Fig. 8e). The bioreactor results in Fig. 8 for 5-mm PGA scaffolds seeded using 2 107 cells can be compared with those shown in Fig. 6 for 5-week jar cultures in chondrogenic medium with BMP-6 also using 5-mm PGA seeded with 2 107 cells. All construct parameters were generally similar between the bioreactor and jar cultures, suggesting that the hydrodynamic shear levels, dissolved oxygen gradients and other culture conditions associated with constant medium flow in the bioreactor environment were suitable for both chondrogenic differentiation and cartilage ECM synthesis. The bioreactor cultures containing either single or composite scaffolds seeded using 4 107 cells produced the highest levels of GAG and collagen type II observed in this work. 4. Discussion The ability of human adult adipose-derived stem cells to synthesise GAG as a key marker of chondrogenesis was substantially greater when the cells were cultured in PGA mesh scaffolds compared with pellet culture (Fig. 5). This result highlights the role of scaffold attachment and cell–matrix interactions in chondrogenic differentiation and cartilage production in stem cell cultures, and confirms the importance of scaffold biomaterials in guiding the development and commitment of stem cells towards tissue formation [11]. It also suggests that assessments of the differentiation potential or comparative differentiation potential of stem cells may be influenced significantly by the form of tissue culture used in the assessment procedures, so that the results obtained may not necessarily apply under all culture conditions. Even though gene expression levels for both aggrecan and collagen type II were strongly up-regulated by TGF-b1 (Fig. 2), adding TGF-b1 to the culture medium used in this work increased GAG but not collagen type II deposition by stem cells in PGA constructs (Fig. 3). This result highlights the potential gap between gene expression and actual ECM synthesis and accumulation in stem cell cultures. TGF-b1 is used as a chondrogenic factor in many stem cell studies and has been found to promote the production of
Fig. 8. Properties of tissues produced by adipose-derived stem cells cultured in PGA scaffolds in chondrogenic medium in recirculation bioreactors. (a) Construct wet weight, (b) number of cells, (c) GAG, (d) total collagen, and (e) collagen type II. The total cell culture time for all treatments was 5 weeks. The error bars represent standard errors from triplicate cultures. Significant differences at the p < 0.05 and p < 0.01 levels between the groups indicated are identified * and **, respectively.
3866
N. Mahmoudifar, P.M. Doran / Biomaterials 31 (2010) 3858–3867
extracellular matrix proteins in pellet cultures of adipose-derived stem cells [1]. TGF-b1 and TGF-b3 were shown in previous work to have a similar effect on cell proliferation, gene expression and cartilage biosynthetic activity in adipose-derived stem cells cultured in alginate beads [23]. Adding the supplementary growth factor, BMP-6, to the culture medium in the presence of TGF-b1 had a negligible effect on both GAG and collagen type II synthesis (Fig. 3). BMP-6 has been reported to increase the expression of cartilage-specific genes in alginate-cultured adipose-derived stem cells [23], and was found to enhance the chondrogenic response of cells in pellet culture to increasing concentrations of TGF-b3 by inducing the expression of TGF-b-receptor-1 protein [7]. In the current study, BMP-6 in the presence of TGF-b1 was found to enhance GAG accumulation significantly only after pre-treatment of the cells with FGF-2 prior to scaffold seeding (Fig. 7). This result is consistent with previous reports that FGF-2 potentiates chondrogenesis in adipose-derived stem cells cultured subsequently as aggregates in the presence of TGF-b1 [24]. In our previous studies of cartilage tissue engineering using human foetal chondrocytes, 5 weeks was used as the minimum effective culture duration for substantial ECM development [20,25]. Given the lower differentiation status of the stem cells used in the present work, cartilage formation was expected to be considerably slower than that observed with chondrocytes. However, extending the duration of stem cell cultures in PGA scaffolds from 2 to 5 weeks did not improve ECM accumulation (Fig. 6). Instead, there was a net loss of cells from the tissues and a substantial reduction in construct wet weight. These results suggest that cells in the constructs remained dependent on attachment to PGA fibres after 2 weeks of culture, so that continued degradation of the scaffold during the extended culture period resulted in an overall deterioration of tissue properties. Use of a less soluble scaffold material, such as polylactic acid (PLA) or a co-polymer of PLA and PGA, may overcome this problem and provide the opportunity for newly synthesised ECM to replace the scaffold before it disappears over longer culture periods. Recirculation bioreactors were used to culture adipose-derived stem cells for cartilage development. Bioreactors provide greater flexibility than static modes of tissue culture for control over the culture environment, particularly with regard to hydrodynamic forces, mixing and the regulation of dissolved oxygen tension. In the perfusion-type bioreactor applied in this work, culture medium was forced to flow continuously through the developing tissue construct. While this mode of operation offers several advantages, such as enhanced mass transfer by convective fluid flow and the ability to provide mechanical forces, it is also potentially damaging to nascent tissues. Nevertheless, the results from the bioreactor studies showed that stem cell differentiation and cartilage ECM synthesis were not detrimentally affected by bioreactor culture (Fig. 8). The highest levels of GAG and collagen type II measured in this work were produced in bioreactor cultures containing either single or composite scaffolds seeded using 4 107 cells. 5. Conclusions This work shows that human adult adipose-derived stem cells cultured under dynamic conditions in PGA scaffolds undergo chondrogenic differentiation and are suitable for the synthesis of cartilage components. Compared with pellet cultures, PGA cultures produced substantially higher GAG levels, demonstrating the ability of cell–matrix interactions to influence cartilage ECM production. Use of TGF-b1 to up-regulate aggrecan and collagen type II gene expression resulted in enhanced accumulation of GAG but not collagen type II in cultured tissues. BMP-6 in the presence of TGF-b1 improved GAG and total collagen production by cells pre-
treated with FGF-2 during monolayer expansion, but was not effective in control cultures without FGF-2 treatment. Recirculation bioreactors were demonstrated to support the cultivation and chondrogenic differentiation of adipose-derived stem cells for tissue engineering of cartilage. Acknowledgements This work was funded by the Australian Research Council (ARC). We thank staff of the School of Medical Sciences, University of New South Wales, for assistance with the histology, staff of the Sterilisation Department, Prince of Wales Hospital, Sydney, for sterilising the PGA scaffolds, Ruby Lin for assistance with the PCR, and Kim Nguyen for assistance with the flow cytometry. Appendix Figures with essential colour discrimination. Certain figures in this article, in particular Figs. 1 and 4, are difficult to interpret in black and white. The full colour images can be found in the on-line version, at doi:10.1016/j.biomaterials.2010.01.090. References [1] Zuk PA, Zhu M, Mizuno H, Huang J, Futrell JW, Katz AJ, et al. Multilineage cells from human adipose tissue: implications for cell-based therapies. Tissue Eng 2001;7:211–28. [2] Guilak F, Lott KE, Awad HA, Cao Q, Hicok KC, Fermor B, et al. Clonal analysis of the differentiation potential of human adipose-derived adult stem cells. J Cell Physiol 2006;206:229–37. [3] Estes BT, Wu AW, Storms RW, Guilak F. Extended passaging, but not aldehyde dehydrogenase activity, increases the chondrogenic potential of human adipose-derived adult stem cells. J Cell Physiol 2006;209:987–95. [4] Erickson GR, Gimble JM, Franklin DM, Rice HE, Awad H, Guilak F. Chondrogenic potential of adipose tissue-derived stromal cells in vitro and in vivo. Biochem Biophys Res Commun 2002;290:763–9. [5] Winter A, Breit S, Parsch D, Benz K, Steck E, Hauner H, et al. Cartilage-like gene expression in differentiated human stem cell spheroids: a comparison of bone marrow-derived and adipose tissue-derived stromal cells. Arthritis Rheum 2003;48:418–29. [6] Sakaguchi Y, Sekiya I, Yagishita K, Muneta T. Comparison of human stem cells derived from various mesenchymal tissues: superiority of synovium as a cell source. Arthritis Rheum 2005;52:2521–9. [7] Hennig T, Lorenz H, Thiel A, Goetzke K, Dickhut A, Geiger F, et al. Reduced chondrogenic potential of adipose tissue derived stromal cells correlates with an altered TGFb receptor and BMP profile and is overcome by BMP-6. J Cell Physiol 2007;211:682–91. [8] Kim H-J, Im G-I. Chondrogenic differentiation of adipose tissue-derived mesenchymal stem cells: greater doses of growth factor are necessary. J Orthop Res 2009;27:612–9. [9] Awad HA, Wickham MQ, Leddy HA, Gimble JM, Guilak F. Chondrogenic differentiation of adipose-derived adult stem cells in agarose, alginate, and gelatin scaffolds. Biomaterials 2004;25:3211–22. [10] Cheng N-C, Estes BT, Awad HA, Guilak F. Chondrogenic differentiation of adipose-derived adult stem cells by a porous scaffold derived from native articular cartilage extracellular matrix. Tissue Eng A 2009;15:231–41. [11] Guilak F, Cohen DM, Estes BT, Gimble JM, Liedtke W, Chen CS. Control of stem cell fate by physical interactions with the extracellular matrix. Cell Stem Cell 2009;5:17–26. [12] Wise JK, Yarin AL, Megaridis CM, Cho M. Chondrogenic differentiation of human mesenchymal stem cells on oriented nanofibrous scaffolds: engineering the superficial zone of articular cartilage. Tissue Eng A 2009;15:913–21. [13] Pazzano D, Mercier KA, Moran JM, Fong SS, DiBiasio DD, Rulfs JX, et al. Comparison of chondrogenesis in static and perfused bioreactor culture. Biotechnol Prog 2000;16:893–6. [14] Gooch KJ, Kwon JH, Blunk T, Langer R, Freed LE, Vunjak-Novakovic G. Effects of mixing intensity on tissue-engineered cartilage. Biotechnol Bioeng 2001;72:402–7. [15] Freyria A-M, Cortial D, Ronzie`re M-C, Guerret S, Herbage D. Influence of medium composition, static and stirred conditions on the proliferation of and matrix protein expression of bovine articular chondrocytes cultured in a 3-D collagen scaffold. Biomaterials 2004;25:687–97. [16] Obradovic B, Carrier RL, Vunjak-Novakovic G, Freed LE. Gas exchange is essential for bioreactor cultivation of tissue engineered cartilage. Biotechnol Bioeng 1999;63:197–205. [17] Malda J, Martens DE, Tramper J, van Blitterswijk CA, Riesle J. Cartilage tissue engineering: controversy in the effect of oxygen. Crit Rev Biotechnol 2003;23:175–94.
N. Mahmoudifar, P.M. Doran / Biomaterials 31 (2010) 3858–3867 [18] Darling EM, Athanasiou KA. Articular cartilage bioreactors and bioprocesses. Tissue Eng 2003;9:9–26. [19] van Harmelen V, Skurk T, Hauner H. Primary culture and differentiation of human adipocyte precursor cells. In: Picot J, editor. Methods in molecular medicine, vol. 107. Human cell culture protocols. 2nd ed. New Jersey: Humana Press; 2005. p. 125–35. [20] Mahmoudifar N, Doran PM. Tissue engineering of human cartilage in bioreactors using single and composite cell-seeded scaffolds. Biotechnol Bioeng 2005;91:338–55. [21] Kim Y-J, Sah RLY, Doong J-YH, Grodzinsky AJ. Fluorometric assay of DNA in cartilage explants using Hoechst 33258. Anal Biochem 1988;174:168–76.
3867
[22] Lillie RD. Histopathologic technic and practical histochemistry. 3rd ed. New York: McGraw-Hill; 1965. [23] Estes BT, Wu AW, Guilak F. Potent induction of chondrocytic differentiation of human adipose-derived adult stem cells by bone morphogenetic protein 6. Arthritis Rheum 2006;54:1222–32. [24] Chiou M, Xu Y, Longaker MT. Mitogenic and chondrogenic effects of fibroblast growth factor-2 in adipose-derived mesenchymal cells. Biochem Biophys Res Commun 2006;343:644–52. [25] Mahmoudifar N, Doran PM. Effect of seeding and bioreactor culture conditions on the development of human tissue-engineered cartilage. Tissue Eng 2006;12:1675–85.
Contents lists available at ScienceDirect
Biomaterials journal homepage: www.elsevier.com/locate/biomaterials
Chondrogenic differentiation of human adipose-derived stem cells in polyglycolic acid mesh scaffolds under dynamic culture conditions Nastaran Mahmoudifar a, Pauline M. Doran b, * a b
School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney NSW 2052, Australia School of Biological Sciences and Department of Chemical Engineering, Monash University, VIC 3800, Australia
a r t i c l e i n f o
a b s t r a c t
Article history: Received 18 December 2009 Accepted 15 January 2010 Available online 11 February 2010
Chondrogenic differentiation of human adult adipose-derived stem cells was studied in vitro for the development of engineered cartilage tissue. Cells cultured under dynamic conditions in polyglycolic acid (PGA) scaffolds produced substantially higher glycosaminoglycan (GAG) and total collagen levels than cells in pellet cultures. This result reflects the importance of cell attachment and cell–scaffold interactions in stem cell differentiation and chondrogenesis. Although gene expression levels for both aggrecan and collagen type II were up-regulated significantly in PGA cultures treated with transforming growth factor b1 (TGF-b1), synthesis of GAG but not collagen type II was enhanced in tissue constructs when TGF-b1 was added to the medium. Bone morphogenetic protein-6 (BMP-6) in the presence of TGF-b1 was effective in improving GAG and total collagen production when the cells were pre-treated with fibroblast growth factor-2 (FGF-2) prior to scaffold seeding. Extending the culture duration from 2 to 5 weeks did not improve cartilage development in PGA scaffolds; loss of cells from the constructs suggested that the rate of scaffold degradation exceeded the rate of replacement by ECM during the 5-week period. Stem cells in PGA scaffolds were cultured in perfusion-type recirculation bioreactors operated with periodic medium flow reversal. The highest levels of GAG and collagen type II accumulation were achieved in the bioreactor cultures after the seeding cell density was increased from 2 107 to 4 107 cells per scaffold. Ó 2010 Elsevier Ltd. All rights reserved.
Keywords: Bioreactor Cartilage tissue engineering ECM (extracellular matrix) Growth factors Mesenchymal stem cell Polyglycolic acid
1. Introduction Adipose tissue contains stem cells that have the capacity to differentiate into cartilage, bone, muscle and adipose lineages in the presence of appropriate differentiation factors and culture conditions [1]. Adipose-derived stem cells maintain their multipotency in vitro over several culture passages [2] and have been shown to exhibit enhanced chondrogenic potential after extended passaging [3]. Compared with other sources of mesenchymal stem cells such as bone marrow, adipose tissue has the advantage of being readily available from patients in relatively large quantities using liposuction procedures. Accordingly, human adult adiposederived stem cells are a promising alternative to differentiated chondrocytes for tissue engineering and cell-based therapy of damaged articular cartilage. The critical issue for application of stem cells in tissue engineering is the initiation and control of cellular differentiation. Chondrogenesis in adipose-derived stem cells is known to be enhanced under three-dimensional culture conditions compared
* Corresponding author. Tel.: þ61 3 9905 1373; fax: þ61 3 9905 5613. E-mail address: [email protected] (P.M. Doran). 0142-9612/$ – see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.biomaterials.2010.01.090
with monolayer culture [4]. Typically, differentiation of stem cells is studied using high-density cell aggregates, also called pellet, spheroid or micromass cultures. The chondrogenic potential of adipose-derived stem cells in pellet culture has been reported to be lower than bone-marrow-derived mesenchymal stem cells cultured in the same way [5,6], in that additional and/or higher concentrations of growth factors were required for the adiposederived cells to match the chondrogenic capacity of bone-marrowderived cells [7,8]. However, there is increasing recognition that stem cell differentiation depends on a range of factors other than the exogenous biochemical mediators added to the culture medium. In particular, the culture conditions employed and the physical interactions that occur between the cells and extracellular matrix (ECM) or scaffold can exert a profound influence [9–12]. Environmental factors regulating the shape and alignment of cells, cell adhesion and migration, and the build-up of mechanical stresses in the cytoskeleton have been identified as important influences on the chondrogenic potential of stem cells. Accordingly, the use of scaffolds and the choice of scaffold material and structure are key elements in the investigation of stem cell differentiation and application. Many studies have shown that the culture conditions applied for in vitro cartilage synthesis have a significant effect on the quality of
N. Mahmoudifar, P.M. Doran / Biomaterials 31 (2010) 3858–3867
tissue produced. Fluid mixing is now well-recognised to enhance the development of tissues relative to static culture methods [13–15]. Good oxygen transfer and gas exchange are also beneficial for active synthesis of cartilage ECM [16,17]. Bioreactors offer important advantages compared with static plate, tissue flask or Petri dish culture systems, including better control over culture conditions, enhanced mass transfer, and the ability to provide mechanical forces influencing cell and tissue development. Various bioreactor systems including perfusion (flow-through) devices and rotating vessels have been applied for cartilage tissue engineering [18]. Irrespective of the type of cells cultured, appropriate dynamic and controllable cultivation techniques are required to induce and maintain chondrogenesis for the production of three-dimensional cartilage constructs. In this work, human adult adipose-derived stem cells were applied for chondrogenic differentiation and cartilage tissue engineering using porous polymer mesh scaffolds and dynamic cell culture conditions. Stem cells were isolated from liposuction tissue and characterised using flow cytometry and immunofluorescence assays. The effect on chondrogenesis of culturing stem cells in polyglycolic acid (PGA) scaffolds was assessed using quantitative real-time polymerase chain reaction (PCR) techniques and biochemical analysis of cartilage matrix components. Cartilaginous tissue development in PGA scaffolds was compared with that observed in pellet cultures. Combinations of transforming growth factor b1 (TGF-b1), bone morphogenetic protein-6 (BMP-6) and fibroblast growth factor-2 (FGF-2) were applied for induction of cartilage synthesis. The properties of scaffold-seeded cartilaginous constructs produced using stem cells cultured in recirculation bioreactors were also examined. 2. Materials and methods 2.1. Culture media Several different culture media were used as summarised in Table 1. 2.2. Isolation and culture of adipose-derived stem cells This work was carried out with approval from the University of New South Wales Human Research Ethics Committee. Subcutaneous adipose tissue (lipoaspirate) was obtained with consent from female and male patients of age 34–47 as a waste product from liposuction surgery. The lipoaspirate was processed using methods adapted from van Harmelen et al. [19]. Raw lipoaspirate was washed extensively using Dulbecco’s phosphate buffered saline (PBS: 0.2 g L1 KCl, 0.2 g L1 KH2PO4, 8 g L1 NaCl and 2.16 g L1 Na2HPO4.7H2O; pH 7.2) to remove blood. The adipose tissue was then dissected and digested with gentle mixing for 60–90 min at 37 C in PBS containing 0.065–0.12% (approx. 400 U mL1) collagenase type IA (Sigma), 1.5% bovine serum albumin (BSA: Sigma) and 1% antibiotic solution (Sigma) to give 100 U mL1 penicillin, 100 mg mL1 streptomycin and 0.25 mg mL1 amphotericin B. The cell suspension was centrifuged for 5 min at 1400 rpm and the pellet was washed using control medium containing 1% antibiotic solution. The pellet was re-suspended in lysis buffer (154 mM NH4Cl, 10 mM KHCO3 and 0.1 mM Na2EDTA; pH 7.4) and incubated at room temperature for 10 min to lyse red blood cells. The resulting cell suspension was filtered using a 150-mm nylon filter to remove cell debris. The cells in the filtrate were collected by centrifugation, washed, counted and cultured in T-flasks using an initial density of 20,000 viable cells per cm2. The medium was removed after 3 days, the monolayer was rinsed twice using PBS to
3859
remove non-adherent cells and fresh medium was added. The medium was changed every 3 days until the cells were confluent. Cells were harvested using trypsin–EDTA (0.25% w/v trypsin (Sigma) and 0.02% w/v Na2EDTA), frozen overnight at 80 C in control medium containing 80% v/v FBS and 10% v/v dimethylsulphoxide (DMSO), and stored in liquid nitrogen until needed. These cells were designated passage zero (P0) cells. 2.3. Characterisation of stem cells isolated from adipose tissue Cells harvested from T-flasks at P0 were characterised using flow cytometry and indirect immunofluorescence. Monoclonal mouse anti-human antibodies against vimentin (clone V9: Zymed Laboratories, USA), an intermediate filament protein expressed in mesenchymal cells, and CD90 (Thy-1) (clone F15-42-1: Biosource International, USA), a cell surface marker for mesenchymal cells and fibroblasts, were used to identify stem cells. Monoclonal mouse anti-human antibody against smooth muscle actin (clone IA4: Zymed Laboratories) was used to identify smooth muscle cells and pericytes; monoclonal mouse anti-human antibody against Factor VIII (clone Z002: Zymed Laboratories) was used to identify endothelial cells. For flow cytometry analysis, approximately 107 P0 cells were fixed in 2% paraformaldehyde in PBS on ice for 15 min and permeabilised using flow cytometry buffer (FCB: PBS containing 2% FBS and 0.2% w/v Tween-20). The cells were resuspended in PBS containing 2% FBS and 2% BSA, incubated on ice for 15 min to block non-specific sites, and then re-suspended in FCB. Aliquots of 1 mL containing 1 106 cells were incubated with primary monoclonal antibodies on ice for 40 min. Antibodies against vimentin and CD90 were diluted 1:100; antibody against smooth muscle actin was diluted 1:50; antibody against Factor VIII was used as diluted by the manufacturer. The cells were then incubated with a 1:100 dilution of rabbit antimouse FITC-conjugated IgG (H þ L) (Zymed Laboratories) on ice for 30–40 min. The cells were re-suspended in 1 mL of FCB, filtered on a 38-mm nylon filter and analysed using a Becton Dickinson flow cytometer. Unstained cells (not incubated with primary or secondary antibody) were used as a negative control. Fixed cells incubated with FITC-conjugated secondary antibody only were used to assess nonspecific binding. For immunofluorescence analysis, P0 cells were cultured in 8-well permanox (Nalge Nunc International, USA) chamber slides overnight using a cell density of 20,000–40,000 cells cm2. Attached cells were rinsed with Tris-buffered saline (TBS: 50 mM Tris buffer containing 8.5 g L1 NaCl; pH 7.6) and fixed in 10% neutral-buffered formalin at room temperature for 15 min. Non-specific sites were blocked using TBS containing 1% BSA, 10% FBS and 0.1% Triton X-100 at room temperature for 30 min. The cells were incubated with primary antibodies diluted in blocking buffer at room temperature for 1 h. Antibodies against vimentin and CD90 were diluted 1:200; antibody against smooth muscle actin was diluted 1:50; antibody against Factor VIII was used as diluted by the manufacturer. The cells were then incubated with rabbit anti-mouse FITC-conjugated IgG (H þ L) diluted 1:50 at room temperature for 1 h. The cells were mounted using a solution containing 40 ,6-diamidino-2phenylindole (DAPI) to stain cell nuclei (VectaShield, Vector Laboratories, USA), viewed under a fluorescence microscope and photographed. 2.4. Polymer scaffold Fibrous polyglycolic acid (PGA) mesh was purchased from Concordia Manufacturing (Coventry, USA) as sheets of thickness 2 and 5 mm and bulk density 45 and 57 mg cm3, respectively. The PGA was cut into discs of diameter 15 mm using a punch wad. The discs were sterilised using ethylene oxide, packaged under vacuum using nitrogen gas and stored at 4 C. 2.5. Chondrogenic differentiation using PGA scaffolds P0 cells were passaged twice using control medium in monolayer culture (P2) before seeding into 5-mm-thick PGA scaffolds. PGA discs were soaked in control medium for 48 h and then transferred to a 24-well culture dish (one disc per well). Each disc was seeded with 600 mL of cell suspension containing 2 107 cells by adding the suspension drop-wise from a pipette. The discs were placed in a CO2 incubator at 37 C and turned over every 15 min for the first 2 h to obtain a homogeneous cell distribution throughout the scaffold. After 2.5 h, each disc was
Table 1 Composition of culture media. Medium
Composition
Control medium
Dulbecco’s modified Eagle’s medium (DMEM: Sigma, USA) containing 4500 mg L1 glucose and 584 mg L1 glutamine þ 3.5 g L1 sodium hydrogen carbonate, 10 mM N-2-hydroxyethyl piperazine N0 -2-ethane sulphonic acid (HEPES), 10% (v/v) foetal bovine serum (FBS: Invitrogen, USA) and 0.5% antibiotic solution (Sigma). Control medium þ 0.4 mM proline, 0.1 mM non-essential amino acids (Sigma) and 100 mM L-ascorbate-2-phosphate (Sigma) Cartilage medium þ 10 ng mL1 TGF-b1 (Invitrogen) and 6.25 mg mL1 insulin (Sigma) Chondrogenic medium þ 10 ng mL1 BMP-6 (Sigma)
Cartilage medium Chondrogenic medium Chondrogenic medium with BMP-6
3860
N. Mahmoudifar, P.M. Doran / Biomaterials 31 (2010) 3858–3867
Table 2 Gene-specific primers used for real-time PCR amplification. Gene
Forward Primer
Reverse Primer
Size of Amplicon (bp)
Gene Bank Accession Number
Primer Bank ID
Aggrecan Collagen type II alpha 1 COMP GAPDH
CACTGGCGAGCACTGTAACAT ACACTGGGACTGTCCTCTG GTCCGCTGTATCAACACCAG TGTTGCCATCAATGACCCCTT
TCCACTGGTAGTCTTGGGCAT GTCCAGGGGCACCTTTTTCA GGAGTTGGGGACGCAGTTA CTCCACGACGTACTCAGCG
206 270 168 202
NM_013227 NM_001844 NM_000095 NM_002046
6995994a2 13435125a1 4557483a2 7669492a2
transferred to a well of a 6-well culture dish containing 3.5 mL of control medium and placed in a CO2 incubator overnight. The discs were then transferred to 20 mL of either control medium, cartilage medium, chondrogenic medium or chondrogenic medium with BMP-6 in 100-mL glass jars with Magenta B-cap vented filter closures (Magenta, USA) (one disc per jar). The jars were placed on an orbital shaker operated at 65 rpm in a CO2 incubator at 37 C. The medium was replaced every 3 days or twice per week and all discs were harvested after 2 weeks. Triplicate cultures were carried out for all treatments. 2.6. Chondrogenic differentiation using pellet culture Approximately 106 P2 cells were placed in each of triplicate 10-mL centrifuge tubes. After centrifuging, the spent medium was removed and 1 mL of chondrogenic medium was added to each tube. The tubes were then placed in a CO2 incubator at 37 C with the caps loosened for gas exchange. The medium was replaced every 3 days or twice per week and the pellets were harvested after 2 weeks. 2.7. Effect of extended culture time using PGA scaffolds PGA scaffolds (5 mm thick) were seeded with 600 mL of P2 cell suspension containing 2 107 cells and cultured in glass jars containing 20 mL of chondrogenic medium with BMP-6. The jars were placed on an orbital shaker operated at 65 rpm in a CO2 incubator at 37 C. The medium was replaced every 3 days or twice per week. Triplicate cultures were harvested after 2 and 5 weeks. 2.8. Effect of FGF-2 pre-treatment using PGA scaffolds P1 cells were passaged in monolayer using control medium with addition of 10 ng mL1 FGF-2 (Sigma). The cells were seeded into 5-mm-thick PGA discs and cultured in either chondrogenic medium or chondrogenic medium with BMP-6. Cells passaged twice without added FGF-2 were used as negative controls. The cultures were carried out using 20 mL of medium in glass jars as described above. Triplicate cultures were harvested after 2 weeks. 2.9. Bioreactor cultures P2 cells were seeded into 5-mm-thick PGA discs using 2 107 or 4 107 cells per disc. The discs were incubated in chondrogenic medium in glass jars for 2 weeks and then transferred to recirculation bioreactors and cultured in chondrogenic medium for a further 3 weeks. In addition, two 2-mm-thick PGA discs were seeded using 2 107 cells per disc, cultured in chondrogenic medium in jars for 1 week, sutured together to form a composite scaffold [20], and then cultured in chondrogenic medium in recirculation bioreactors for a further 4 weeks. The total cell culture time for all treatments was 5 weeks. The recirculation bioreactors have been described previously [20]. For the present work, two modifications were made to the equipment: the double-flange section in the middle of the bioreactor chambers was removed, and the volume of medium recirculated per bioreactor was reduced from 200 mL to 100 mL to minimise the cost of expensive growth factors. The medium flow rate was 0.2 mL min1 and the direction of flow was reversed every 3 days or twice per week after 50% v/v of medium was replaced with fresh medium. Triplicate bioreactor systems were used for each culture experiment. 2.10. Analyses After harvest from jars or bioreactors, each tissue construct was rinsed with PBS, weighed, and then divided into several sections for PCR, biochemical and histological analyses. A strip of tissue of width approximately 3 mm was cut through the centre along the diameter of each disc for histological assessment of the full tissue cross-section. One of the remaining half discs was used for determination of cell, glycosaminoglycan (GAG), and total collagen concentrations. The other half disc was cut into two sections and each section was used for PCR analysis or measurement of collagen type II concentration. 2.10.1. Quantitative real-time PCR Quantitative real-time PCR was performed to determine the relative expression of the chondrogenic genes, aggrecan, collagen type II and cartilage oligomeric matrix protein (COMP), in cells cultured for 2 weeks in PGA scaffolds in glass jars using either cartilage or chondrogenic medium. Tissue samples were placed in RNAlater
solution (Qiagen, USA), stored at 4 C overnight, and then stored at 20 C until needed. Approximately 100 mg of tissue was disrupted and homogenised in 1.2 mL of lysis buffer (Qiagen) using a TissueRuptor (Qiagen). Total RNA was isolated using 400 mL of homogenised tissue and an RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. The concentration and purity of RNA was determined in all samples using a Nanodrop spectrophotometer. RNA samples were stored at 80 C until needed. cDNA was synthesised from 600 ng of total RNA using an Invitrogen SuperScript III First-Strand cDNA Synthesis Kit according to the manufacturer’s instructions. cDNA samples were stored at 20 C until needed. Primers were chosen from the Primer Bank and purchased from Sigma (Table 2). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the reference gene and PCR was performed using a Platinum SYBR Green qPCR SuperMix-UDG kit (Invitrogen). PCRs were prepared in 50 mL containing 25 mL of SYBR Green SuperMix-UDG, 1 mL of 100 ng mL1 forward primer, 1 mL of 100 ng mL1 reverse primer, 10 mL of 10-timesdiluted cDNA, and 13 mL of diethyl pyrocarbonate (DEPC)-treated water. All samples were tested in duplicate and non-template samples (without cDNA) were used as negative controls. PCR amplification was performed using a Corbett Rotor-Gene 6000 (Qiagen). Samples were held at 50 C for 2 min and then 95 C for 2 min followed by 40 cycles of 95 C for 15 s (melting) and 60 C for 30 s (annealing and extension). The specificity of the PCR products was confirmed by melting curve analysis. The efficiency of all genes was determined using serially diluted pooled cDNA samples. The relative expression of each gene was determined according to Pfaffl’s method using Relative Expression Software Tool (REST 2005) software. 2.10.2. Cell, GAG, total collagen and collagen type II concentrations Cell, GAG and total collagen concentrations were determined using papaindigested tissue sections as described previously [20]. For calculation of cell numbers, the DNA content of adipose-derived stem cells was determined [21] as 15.4 pg DNA per cell. Collagen type II concentration was measured in proteinase K-digested tissue sections using an ELISA kit (Ibex Pharmaceuticals, Canada) as described previously [20]. 2.10.3. Histology Tissue sections were fixed in 10% neutral-buffered formalin for at least 24 h, embedded in paraffin, and cut into 8-mm-thick sections. The sections were then deparaffinised and stained with Weigert’s iron hematoxylin for 5 min, washed in tap water, stained with 0.02% fast green (Sigma) for 4 min, washed in 1% v/v acetic acid, and stained with 0.1% safranin-O (Sigma) for 3 min [22]. Cell nuclei stained black, GAG stained orange–red, and collagen stained blue–green. The stained sections were mounted in Depex (Merck, Germany), viewed under a light microscope and photographed. 2.10.4. Statistics Data from triplicate cultures are presented as averages standard errors. The Student’s t-test was used for comparing two groups of data at p < 0.05 and p < 0.01 levels of significance. One-way analysis of variance (ANOVA) in conjunction with Tukey’s test was used to compare multiple groups of data at p < 0.05 and p < 0.01 levels of significance.
3. Results 3.1. Yield and characterisation of isolated cells In this work, the yield of isolated stem cells was (5.7 1.6) 105 per mL of washed adipose tissue. This can be compared with yields of approximately 4.0 105 per mL of lipoaspirate reported in the literature as an average from several studies [2]. The results from flow cytometry showed that 96% of P0 cells were positive for CD90, a marker for stem cells and fibroblasts, and 85% were positive for vimentin, a marker for cells of mesenchymal origin. Only 4% of the P0 cells reacted positively with antibody against smooth muscle actin, a marker of smooth muscle cells, while staining with antibody against Factor VIII, a marker for endothelial cells, was negative. These results were confirmed by
N. Mahmoudifar, P.M. Doran / Biomaterials 31 (2010) 3858–3867
3861
Fig. 2. Gene expression levels in adipose-derived stem cells cultured for 2 weeks in PGA scaffolds in chondrogenic medium, relative to the levels observed in cells cultured in cartilage medium without added growth factors. Significant differences at the p < 0.01 level are identified **.
3.2. Chondrogenic differentiation in PGA scaffolds using different culture media
Fig. 1. Photomicrographs of P0 cells isolated from adipose tissue and immunostained for: (a) vimentin; (b) CD90; (c) smooth muscle actin; and (d) Factor VIII.
indirect immunofluorescence analysis (Fig. 1), which showed that the majority of cells reacted positively with antibodies against vimentin and CD90 (Fig. 1a, b). In contrast, very few cells stained for smooth muscle actin or Factor VIII (Fig. 1c, d).
As shown in Fig. 2, mRNA levels for both aggrecan and collagen type II were up-regulated significantly (p < 0.01) when chondrogenic medium containing TGF-b1 and insulin was used for culture of adipose-derived stem cells relative to cartilage medium. Expression of COMP was not significantly affected. Aggrecan expression was increased 7.0-fold and collagen type II expression was increased 530-fold as a result of growth factor treatment. Results for construct wet weight, cell number and levels of GAG, total collagen and collagen type II produced by cells in PGA scaffolds are shown in Fig. 3. The construct wet weight and number of cells obtained using cartilage medium, chondrogenic medium and chondrogenic medium with BMP-6 were significantly higher (p < 0.01) than the results for control medium (Fig. 3a, b). There was no statistically significant difference in construct wet weight or cell number between the cartilage medium, chondrogenic medium, and chondrogenic medium with BMP-6 groups. The water contents of the harvested constructs were similar at 86%, 89%, 85% and 87% w/w for the control medium, cartilage medium, chondrogenic medium and chondrogenic medium with BMP-6, respectively. The respective average final cell numbers in the different constructs at harvest were 25%, 88%, 70% and 93% of the number used for seeding. As shown in Fig. 3c, GAG synthesis in control medium was not significantly different from that in cartilage medium, chondrogenic medium, or chondrogenic medium with BMP-6. However, GAG levels in constructs produced using chondrogenic medium and chondrogenic medium with BMP-6 were 59% greater (p < 0.01) and 41% greater (p < 0.05), respectively, than in cartilage medium without added growth factors. Total collagen levels in cartilage medium, chondrogenic medium and chondrogenic medium with BMP-6 were 11–12-fold higher (p < 0.01) than in control medium (Fig. 3d). There was no statistically significant difference in either total collagen or collagen type II content between the cartilage medium, chondrogenic medium and chondrogenic medium with BMP-6 groups (Fig. 3d, e). The results in Fig. 3c indicate that the enhanced chondrogenic potential of stem cells in PGA scaffolds measured using PCR after culture in chondrogenic medium containing TGF-b1 and insulin (Fig. 2) was translated into enhanced GAG deposition in the tissue constructs. In contrast, collagen type II accumulation was not
3862
N. Mahmoudifar, P.M. Doran / Biomaterials 31 (2010) 3858–3867
Fig. 4. Histological appearance of tissue produced using adipose-derived stem cells cultured for 2 weeks in a PGA scaffold in chondrogenic medium. GAG is shown orange– red; collagen is shown blue–green; residual PGA fibres appear as red flecks. GAG accumulated mainly within the peripheral zone of the construct.
improved (Fig. 3e) even though gene expression for collagen type II was found to be up-regulated substantially (530-fold) in chondrogenic medium compared with cartilage medium (Fig. 2). Fig. 4 shows the results from histological analysis of constructs produced using chondrogenic medium. The cells were evenly distributed throughout the tissue. Whereas collagen (blue–green stain) was present at low levels throughout the constructs, GAG (orange–red staining) accumulated mainly in a thin layer at the periphery. Incomplete degradation of the scaffold is evident in Fig. 4, as many residual PGA fibres can be seen in the form of red flecks at all locations except within the outer peripheral zone. 3.3. Comparison between PGA and pellet cultures Pellet cultures were initiated using 106 cells mL1 of chondrogenic medium and were carried out under static culture conditions. The PGA cultures were also initiated using 106 cells mL1 of chondrogenic medium and were carried out under dynamic conditions. Results for construct wet weight, cell number, GAG and total collagen are shown in Fig. 5. Because the pellet and PGA cultures were performed using different volumes (1 and 20 mL, respectively), the data for construct wet weight and cell number are expressed per mL of culture liquid. The construct wet weight per mL in the PGA cultures was 13-fold higher (p < 0.01) than in the pellet cultures (Fig. 5a). However, the presence of residual polymer scaffold in the PGA constructs contributes to the wet weight measured for these cultures compared with the pellets containing cells and ECM only. Using a measured wet weight:dry weight ratio for the harvested PGA constructs of 6.8 0.074, the average dry weight of the tissues harvested from the PGA cultures was 76 3.2 mg. To assess the maximum possible contribution of the scaffold weight, this can be compared with the average dry weight of an unseeded PGA disc, 44 0.30 mg. The extent to which the scaffolds degraded during the 2-week culture period was not measured quantitatively. Control experiments using PGA discs
Fig. 3. Effect of medium composition and growth factors on the properties of tissue constructs produced using adipose-derived stem cells cultured in PGA scaffolds for 2 weeks: (a) construct wet weight; (b) number of cells; (c) GAG; (d) total collagen; and (e) collagen type II. The error bars represent standard errors from triplicate cultures. n.a. ¼ not analysed. Significant differences at the p < 0.01 level relative to the results for control medium are identified **. Significant differences in GAG content at the p < 0.05 and p < 0.01 levels between the groups indicated are identified y and yy, respectively.
N. Mahmoudifar, P.M. Doran / Biomaterials 31 (2010) 3858–3867
Fig. 5. Properties of tissues produced using adipose-derived stem cells in pellets and PGA scaffolds after 2 weeks of culture in chondrogenic medium. Both types of culture were initiated using 106 cells mL1. (a) Construct wet weight; (b) number of cells; (c) GAG; and (d) total collagen. The error bars represent standard errors from triplicate cultures. Significant differences at the p < 0.05 and p < 0.01 levels are identified * and **, respectively. GAG and total collagen accumulation was significantly greater in the PGA cultures than in pellets.
3863
Fig. 6. Effect of culture duration on the properties of tissue constructs produced using adipose-derived stem cells in PGA scaffolds: (a) construct wet weight; (b) number of cells; (c) GAG; (d) total collagen; and (e) collagen type II. The cells were cultured in chondrogenic medium with BMP-6 for either 2 or 5 weeks. The error bars represent standard errors from triplicate cultures. Significant differences at the p < 0.05 and p < 0.01 levels are identified * and **, respectively. Extending the culture period from 2 to 5 weeks did not improve cartilage tissue production.
3864
N. Mahmoudifar, P.M. Doran / Biomaterials 31 (2010) 3858–3867
incubated in chondrogenic medium showed that unseeded scaffolds were very fragile and only about one-third of their initial size after 2 weeks, while histological analysis (Fig. 4) indicated that a considerable amount of polymer fibre remained in the constructs at harvest. Depending on the degree of scaffold degradation, residual scaffold material may be considered to comprise a proportion 58% of the construct weight in the PGA cultures. Applying this result to the data in Fig. 5a, even when the scaffold weight is taken into account, the mass of tissue produced per mL in the PGA cultures was considerably greater than in the pellet cultures. As shown in Fig. 5b, the final cell number per mL was 1.4-fold higher (p < 0.05) in the PGA constructs than in the pellet cultures, representing 70% and 49% of the number of cells used to initiate the cultures, respectively. As indicated in Fig. 5c and d, GAG and total collagen production in the PGA cultures were 2.4- and 4.6-fold higher (p < 0.01), respectively, than those achieved in pellet culture. Collagen type II was not determined in this experiment because the pellet cultures provided insufficient sample material. 3.4. Effect of extended culture time using PGA scaffolds As shown in Fig. 6, extending the culture time from 2 weeks to 5 weeks did not improve the development of cartilaginous tissue by adipose-derived stem cells in PGA scaffolds. The wet weight of the harvested constructs was much lower (p < 0.01) after 5 weeks of culture than after 2 weeks (Fig. 6a). This result probably reflects continued degradation of the polymer scaffold during the longer culture period in the absence of an equal or higher rate of replacement by newly synthesised ECM. The results for cell number and GAG were also lower (p < 0.05) after 5 weeks of culture than after 2 weeks (Fig. 6b, c), but there was no significant difference in total collagen or collagen type II (Fig. 6d, e). 3.5. Effect of pre-treatment with FGF-2 combined with TGF-b1 and BMP-6 in PGA scaffolds Cells passaged with FGF-2 in monolayer culture adopted a more elongated, fibroblast-like morphology than cells passaged without FGF-2. After cell seeding into PGA scaffolds, the construct wet weight at harvest was increased significantly (p < 0.05) in cultures pre-treated with FGF-2 only when BMP-6 was added to the culture medium (Fig. 7a). The number of cells in the tissues was significantly higher (p < 0.05 or p < 0.01) when BMP-6 was used irrespective of whether the cultures were pre-treated with FGF-2 (Fig. 7b). Pre-treatment with FGF-2 had no significant effect on cell number in cultures receiving the same BMP-6 treatment (Fig. 7b). As shown in Fig. 7c and d, after FGF-2 pre-treatment, addition of BMP-6 increased GAG and total collagen levels 1.3-fold (p < 0.01) and 1.7-fold (p < 0.05), respectively, compared with cultures without BMP-6. This effect was not observed in cultures without FGF-2 pre-treatment (Fig. 7c, d). In the absence of BMP-6 in the culture medium, constructs produced using cells pre-treated with FGF-2 exhibited lower (p < 0.05 or p < 0.01) GAG and total collagen levels than those produced without FGF-2 treatment; this effect
Fig. 7. Properties of tissues produced by adipose-derived stem cells passaged with or without FGF-2 prior to seeding into PGA scaffolds and then cultured for 2 weeks in either chondrogenic medium or chondrogenic medium with BMP-6. (a) Construct wet weight, (b) number of cells, (c) GAG, (d) total collagen, and (e) collagen type II. The error bars represent standard errors from triplicate cultures. Significant differences at the p < 0.05 and p < 0.01 levels between corresponding cultures with and without BMP-6 are identified * and **, respectively. Significant differences at the p < 0.05 and p < 0.01 levels between corresponding cultures with and without FGF-2 pre-treatment are identified y and yy, respectively.
N. Mahmoudifar, P.M. Doran / Biomaterials 31 (2010) 3858–3867
3865
was not observed in the presence of BMP-6 (Fig. 7c, d). There was no statistically significant difference in collagen type II production between any of the treatment groups (Fig. 7e). 3.6. Bioreactor cultures The wet weight of constructs produced in bioreactors using composite scaffolds was significantly higher (p < 0.05) than that obtained using 5-mm PGA seeded using 4 107 cells, but not significantly different from that using 5-mm PGA and 2 107 cells (Fig. 8a). Cell numbers in the constructs at harvest were not significantly different between the treatment groups (Fig. 8b). GAG accumulation was 1.9-fold greater (p < 0.01) using composite scaffolds than in the cultures with single PGA discs (Fig. 8c). Total collagen production using composite scaffolds was 1.7-fold (p < 0.05) greater than with single PGA discs seeded using 4 107 cells, but not significantly different from that in cultures seeded with 2 107 cells (Fig. 8d). In contrast, collagen type II levels were significantly higher (p < 0.05 and p < 0.01) in the cultures with 5mm PGA seeded using 4 107 cells than in the other treatment groups (Fig. 8e). The bioreactor results in Fig. 8 for 5-mm PGA scaffolds seeded using 2 107 cells can be compared with those shown in Fig. 6 for 5-week jar cultures in chondrogenic medium with BMP-6 also using 5-mm PGA seeded with 2 107 cells. All construct parameters were generally similar between the bioreactor and jar cultures, suggesting that the hydrodynamic shear levels, dissolved oxygen gradients and other culture conditions associated with constant medium flow in the bioreactor environment were suitable for both chondrogenic differentiation and cartilage ECM synthesis. The bioreactor cultures containing either single or composite scaffolds seeded using 4 107 cells produced the highest levels of GAG and collagen type II observed in this work. 4. Discussion The ability of human adult adipose-derived stem cells to synthesise GAG as a key marker of chondrogenesis was substantially greater when the cells were cultured in PGA mesh scaffolds compared with pellet culture (Fig. 5). This result highlights the role of scaffold attachment and cell–matrix interactions in chondrogenic differentiation and cartilage production in stem cell cultures, and confirms the importance of scaffold biomaterials in guiding the development and commitment of stem cells towards tissue formation [11]. It also suggests that assessments of the differentiation potential or comparative differentiation potential of stem cells may be influenced significantly by the form of tissue culture used in the assessment procedures, so that the results obtained may not necessarily apply under all culture conditions. Even though gene expression levels for both aggrecan and collagen type II were strongly up-regulated by TGF-b1 (Fig. 2), adding TGF-b1 to the culture medium used in this work increased GAG but not collagen type II deposition by stem cells in PGA constructs (Fig. 3). This result highlights the potential gap between gene expression and actual ECM synthesis and accumulation in stem cell cultures. TGF-b1 is used as a chondrogenic factor in many stem cell studies and has been found to promote the production of
Fig. 8. Properties of tissues produced by adipose-derived stem cells cultured in PGA scaffolds in chondrogenic medium in recirculation bioreactors. (a) Construct wet weight, (b) number of cells, (c) GAG, (d) total collagen, and (e) collagen type II. The total cell culture time for all treatments was 5 weeks. The error bars represent standard errors from triplicate cultures. Significant differences at the p < 0.05 and p < 0.01 levels between the groups indicated are identified * and **, respectively.
3866
N. Mahmoudifar, P.M. Doran / Biomaterials 31 (2010) 3858–3867
extracellular matrix proteins in pellet cultures of adipose-derived stem cells [1]. TGF-b1 and TGF-b3 were shown in previous work to have a similar effect on cell proliferation, gene expression and cartilage biosynthetic activity in adipose-derived stem cells cultured in alginate beads [23]. Adding the supplementary growth factor, BMP-6, to the culture medium in the presence of TGF-b1 had a negligible effect on both GAG and collagen type II synthesis (Fig. 3). BMP-6 has been reported to increase the expression of cartilage-specific genes in alginate-cultured adipose-derived stem cells [23], and was found to enhance the chondrogenic response of cells in pellet culture to increasing concentrations of TGF-b3 by inducing the expression of TGF-b-receptor-1 protein [7]. In the current study, BMP-6 in the presence of TGF-b1 was found to enhance GAG accumulation significantly only after pre-treatment of the cells with FGF-2 prior to scaffold seeding (Fig. 7). This result is consistent with previous reports that FGF-2 potentiates chondrogenesis in adipose-derived stem cells cultured subsequently as aggregates in the presence of TGF-b1 [24]. In our previous studies of cartilage tissue engineering using human foetal chondrocytes, 5 weeks was used as the minimum effective culture duration for substantial ECM development [20,25]. Given the lower differentiation status of the stem cells used in the present work, cartilage formation was expected to be considerably slower than that observed with chondrocytes. However, extending the duration of stem cell cultures in PGA scaffolds from 2 to 5 weeks did not improve ECM accumulation (Fig. 6). Instead, there was a net loss of cells from the tissues and a substantial reduction in construct wet weight. These results suggest that cells in the constructs remained dependent on attachment to PGA fibres after 2 weeks of culture, so that continued degradation of the scaffold during the extended culture period resulted in an overall deterioration of tissue properties. Use of a less soluble scaffold material, such as polylactic acid (PLA) or a co-polymer of PLA and PGA, may overcome this problem and provide the opportunity for newly synthesised ECM to replace the scaffold before it disappears over longer culture periods. Recirculation bioreactors were used to culture adipose-derived stem cells for cartilage development. Bioreactors provide greater flexibility than static modes of tissue culture for control over the culture environment, particularly with regard to hydrodynamic forces, mixing and the regulation of dissolved oxygen tension. In the perfusion-type bioreactor applied in this work, culture medium was forced to flow continuously through the developing tissue construct. While this mode of operation offers several advantages, such as enhanced mass transfer by convective fluid flow and the ability to provide mechanical forces, it is also potentially damaging to nascent tissues. Nevertheless, the results from the bioreactor studies showed that stem cell differentiation and cartilage ECM synthesis were not detrimentally affected by bioreactor culture (Fig. 8). The highest levels of GAG and collagen type II measured in this work were produced in bioreactor cultures containing either single or composite scaffolds seeded using 4 107 cells. 5. Conclusions This work shows that human adult adipose-derived stem cells cultured under dynamic conditions in PGA scaffolds undergo chondrogenic differentiation and are suitable for the synthesis of cartilage components. Compared with pellet cultures, PGA cultures produced substantially higher GAG levels, demonstrating the ability of cell–matrix interactions to influence cartilage ECM production. Use of TGF-b1 to up-regulate aggrecan and collagen type II gene expression resulted in enhanced accumulation of GAG but not collagen type II in cultured tissues. BMP-6 in the presence of TGF-b1 improved GAG and total collagen production by cells pre-
treated with FGF-2 during monolayer expansion, but was not effective in control cultures without FGF-2 treatment. Recirculation bioreactors were demonstrated to support the cultivation and chondrogenic differentiation of adipose-derived stem cells for tissue engineering of cartilage. Acknowledgements This work was funded by the Australian Research Council (ARC). We thank staff of the School of Medical Sciences, University of New South Wales, for assistance with the histology, staff of the Sterilisation Department, Prince of Wales Hospital, Sydney, for sterilising the PGA scaffolds, Ruby Lin for assistance with the PCR, and Kim Nguyen for assistance with the flow cytometry. Appendix Figures with essential colour discrimination. Certain figures in this article, in particular Figs. 1 and 4, are difficult to interpret in black and white. The full colour images can be found in the on-line version, at doi:10.1016/j.biomaterials.2010.01.090. References [1] Zuk PA, Zhu M, Mizuno H, Huang J, Futrell JW, Katz AJ, et al. Multilineage cells from human adipose tissue: implications for cell-based therapies. Tissue Eng 2001;7:211–28. [2] Guilak F, Lott KE, Awad HA, Cao Q, Hicok KC, Fermor B, et al. Clonal analysis of the differentiation potential of human adipose-derived adult stem cells. J Cell Physiol 2006;206:229–37. [3] Estes BT, Wu AW, Storms RW, Guilak F. Extended passaging, but not aldehyde dehydrogenase activity, increases the chondrogenic potential of human adipose-derived adult stem cells. J Cell Physiol 2006;209:987–95. [4] Erickson GR, Gimble JM, Franklin DM, Rice HE, Awad H, Guilak F. Chondrogenic potential of adipose tissue-derived stromal cells in vitro and in vivo. Biochem Biophys Res Commun 2002;290:763–9. [5] Winter A, Breit S, Parsch D, Benz K, Steck E, Hauner H, et al. Cartilage-like gene expression in differentiated human stem cell spheroids: a comparison of bone marrow-derived and adipose tissue-derived stromal cells. Arthritis Rheum 2003;48:418–29. [6] Sakaguchi Y, Sekiya I, Yagishita K, Muneta T. Comparison of human stem cells derived from various mesenchymal tissues: superiority of synovium as a cell source. Arthritis Rheum 2005;52:2521–9. [7] Hennig T, Lorenz H, Thiel A, Goetzke K, Dickhut A, Geiger F, et al. Reduced chondrogenic potential of adipose tissue derived stromal cells correlates with an altered TGFb receptor and BMP profile and is overcome by BMP-6. J Cell Physiol 2007;211:682–91. [8] Kim H-J, Im G-I. Chondrogenic differentiation of adipose tissue-derived mesenchymal stem cells: greater doses of growth factor are necessary. J Orthop Res 2009;27:612–9. [9] Awad HA, Wickham MQ, Leddy HA, Gimble JM, Guilak F. Chondrogenic differentiation of adipose-derived adult stem cells in agarose, alginate, and gelatin scaffolds. Biomaterials 2004;25:3211–22. [10] Cheng N-C, Estes BT, Awad HA, Guilak F. Chondrogenic differentiation of adipose-derived adult stem cells by a porous scaffold derived from native articular cartilage extracellular matrix. Tissue Eng A 2009;15:231–41. [11] Guilak F, Cohen DM, Estes BT, Gimble JM, Liedtke W, Chen CS. Control of stem cell fate by physical interactions with the extracellular matrix. Cell Stem Cell 2009;5:17–26. [12] Wise JK, Yarin AL, Megaridis CM, Cho M. Chondrogenic differentiation of human mesenchymal stem cells on oriented nanofibrous scaffolds: engineering the superficial zone of articular cartilage. Tissue Eng A 2009;15:913–21. [13] Pazzano D, Mercier KA, Moran JM, Fong SS, DiBiasio DD, Rulfs JX, et al. Comparison of chondrogenesis in static and perfused bioreactor culture. Biotechnol Prog 2000;16:893–6. [14] Gooch KJ, Kwon JH, Blunk T, Langer R, Freed LE, Vunjak-Novakovic G. Effects of mixing intensity on tissue-engineered cartilage. Biotechnol Bioeng 2001;72:402–7. [15] Freyria A-M, Cortial D, Ronzie`re M-C, Guerret S, Herbage D. Influence of medium composition, static and stirred conditions on the proliferation of and matrix protein expression of bovine articular chondrocytes cultured in a 3-D collagen scaffold. Biomaterials 2004;25:687–97. [16] Obradovic B, Carrier RL, Vunjak-Novakovic G, Freed LE. Gas exchange is essential for bioreactor cultivation of tissue engineered cartilage. Biotechnol Bioeng 1999;63:197–205. [17] Malda J, Martens DE, Tramper J, van Blitterswijk CA, Riesle J. Cartilage tissue engineering: controversy in the effect of oxygen. Crit Rev Biotechnol 2003;23:175–94.
N. Mahmoudifar, P.M. Doran / Biomaterials 31 (2010) 3858–3867 [18] Darling EM, Athanasiou KA. Articular cartilage bioreactors and bioprocesses. Tissue Eng 2003;9:9–26. [19] van Harmelen V, Skurk T, Hauner H. Primary culture and differentiation of human adipocyte precursor cells. In: Picot J, editor. Methods in molecular medicine, vol. 107. Human cell culture protocols. 2nd ed. New Jersey: Humana Press; 2005. p. 125–35. [20] Mahmoudifar N, Doran PM. Tissue engineering of human cartilage in bioreactors using single and composite cell-seeded scaffolds. Biotechnol Bioeng 2005;91:338–55. [21] Kim Y-J, Sah RLY, Doong J-YH, Grodzinsky AJ. Fluorometric assay of DNA in cartilage explants using Hoechst 33258. Anal Biochem 1988;174:168–76.
3867
[22] Lillie RD. Histopathologic technic and practical histochemistry. 3rd ed. New York: McGraw-Hill; 1965. [23] Estes BT, Wu AW, Guilak F. Potent induction of chondrocytic differentiation of human adipose-derived adult stem cells by bone morphogenetic protein 6. Arthritis Rheum 2006;54:1222–32. [24] Chiou M, Xu Y, Longaker MT. Mitogenic and chondrogenic effects of fibroblast growth factor-2 in adipose-derived mesenchymal cells. Biochem Biophys Res Commun 2006;343:644–52. [25] Mahmoudifar N, Doran PM. Effect of seeding and bioreactor culture conditions on the development of human tissue-engineered cartilage. Tissue Eng 2006;12:1675–85.