Classification of interspecific and intraspecific species by genome-wide SSR markers on Dendrobium

South African Journal of Botany 127 (2019) 136–146

Contents lists available at ScienceDirect

South African Journal of Botany journal homepage: www.elsevier.com/locate/sajb

Classification of interspecific and intraspecific species by genome-wide SSR markers on Dendrobium T.M. Zhao a,b, S.G. Zheng a,⁎, Y.D. Hu a, R.X. Zhao a, H.J. Li a,b, X.Q. Zhang a,b, Z. Chun a,c,⁎ a b c

Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, China University of Chinese Academy of Sciences, Beijing 100041, China The Innovative Academy of Seed Design, Chinese Academy of Sciences, Beijing 100101, China

a r t i c l e

i n f o

Article history: Received 21 March 2019 Received in revised form 16 July 2019 Accepted 29 August 2019 Available online xxxx Edited by P Bhattacharyya Keywords: Dendrobium SSR markers Genome-wide D. catenatum D. denneanum D. nobile

a b s t r a c t Dendrobium is a threatened and valuable genus in orchids. Many of them were common in medicinal and ornamental markets. In this study, a total of 198,990 simple sequence repeats (SSR) were identified from 3814 genomic scaffolds in D. catenatum (180 SSRs/Mb). Dinucleotide, trinucleotide and tetra-nucleotide covered about 0.2428%, 0.0544% and 0.0039% to the whole genome, separately. AT and TA, AAT and TGT, AAAT and TTTA were the corresponded dominant motifs. Total repetition of A and T was significantly greater than that of C and G. Moreover, 100 locus-specific primer pairs were randomly selected. And 73 of them produced polymorphic products in interspecific identification of 37 Dendrobium species. The interspecific effective polymorphic bands (EPBs), polymorphism information content (PIC), genetic diversity (Ht), genetic differentiation (Gst) and gene flow (Nm) of the novel SSR markers were 9.68, 0.528, 0.375, 0.499 and 0.753. The affinity of species and its varietas was confirmed in the phylogenetic tree. Additionally, 23, 25 and 12 SSR markers showed efficacy in intraspecific identification of 32 individuals in D. catenatum, 32 individuals in D. denneanum and 64 individuals in D. nobile, respectively. This confirmed the suitable transferability of SSR markers in cross-species. The intraspecific EPBs, PIC, Ht, Gst and Nm were 3.95, 0.554, 0.626, 0.226 and 2.305. The phylogenetic subgroups were significantly associated with plant height, epidermis and flower color. The electrophoretograms were clear for observation and suitable for auto-genotyping. The releasing of much more genome-wide SSR markers would be valuable for genetic studies and molecular breeding in Dendrobium. © 2019 SAAB. Published by Elsevier B.V. All rights reserved.

1. Introduction Dendrobium is one of the largest genus in Orchidaceae, with more than 1500 species (Teixeira Da Silva and Ng, 2017) widely distributed in Asia, Europe and Australia (Bhattacharyya et al., 2017). Most of them showed grateful values to human being. Colorful flowers, such as yellow (D. denneanum), yellow-white (D. catenatum), and purplewhite (D. nobile), and sweet smells made Dendrobium grateful in ornamental markets (Sawettalake et al., 2017). In India, China and some other countries, many species of Dendrobium have been used as medicinal herb for a thousand years (Cakova et al., 2017). Dendrobium officinale/catenatum, D. nobile, D. fimbriatum and D. chrysotoxum were listed as the traditional herbs in Chinese Pharmacopeia (State Pharmacopeia Committee of China, 2015). Many important pharmaceutical components, such as polysaccharides, dendrobine, gigantol, moscatilin, erianin, bibenzyl, phenanthrenes and sesquiterpenes, were reported in Dendrobium (Ng et al., 2012; Tang et al., 2017). They showed ⁎ Corresponding authors at: Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, China. E-mail addresses: [email protected] (S.G. Zheng), [email protected] (Z. Chun).

https://doi.org/10.1016/j.sajb.2019.08.051 0254-6299/© 2019 SAAB. Published by Elsevier B.V. All rights reserved.

benefits in anti-tumor, anti-angiogenesis, anti-inflammatory, antioxidation, anti-bacterial, anti-platelet aggregation, eye protection, neuroprotection, liver protection, diabetes improvement and immune enhancement (Cakova et al., 2017; Zheng et al., 2018). However, genetic studies were poorly reported on Dendrobium (Teixeira Da Silva et al., 2016). One of the important reasons was the lack of available markers (Zheng et al., 2018). Polymerase chain reaction (PCR) and sequencing-based molecular markers, such as ITS1, ITS2, matK, trnH-psbA and nad1, were widely used for classification and evolution analysis of Dendrobium (Teixeira Da Silva et al., 2016; Wang et al., 2018). But the restricted number and polymorphism limited their further application. More, the PCR and electrophoresis-based molecular markers, such as AFLP (amplified fragment length polymorphism), TRAP (target region amplification polymorphism), RAPD (random amplified polymorphic DNA), DAMD (directed amplification of minisatellite DNA) and SCoT (start codon targeted), have also been employed for identification of Dendrobium (Bhattacharyya et al., 2015; Bhattacharyya et al., 2017). But they still showed more or less of deficiencies in limited number of available markers, low rate of genome coverage, difficulty of polymorphism distinguishing and poor of repeatability (Zheng et al., 2018). Recently, with the development of

T.M. Zhao et al. / South African Journal of Botany 127 (2019) 136–146

next-generation sequencing technologies, the whole genomic sequences of D. catenatum were revealed and improved (Yan et al., 2015; Zhang et al. 2016). Development and application of SSR markers were also increased. SSR markers are multi-allelic, usually co-dominant, relatively abundant, widely distributed and easily scored. The previously reported SSR molecular markers were mostly developed from expressed sequence tags (ESTs). Total of 320 EST–SSRs were reported from D. nobile and D. officinale, successively (Lu et al., 2012; Lu et al., 2013; Lu et al., 2014; Kang et al., 2015). This might be the most reported number of EST–SSRs at present. Few of them were also developed from transcriptomic sequences and mitochondria or chloroplast sequences. There were 9 chloroplast–SSR markers (Xu et al., 2011) and 17 transcriptome–SSR markers (Xu et al., 2017) developed from D. officinale. SSR markers were also developed from DNA library. There were 10 and 11 dinucleotide library–SSR markers developed from a microsatellite-enriched library in D. fimbriatum (Fan et al., 2009) and D. huoshanense, separately (Wang et al., 2012). There were 12, 14 and 15 trinucleotide library–SSR markers developed from a microsatelliteenriched library in D. loddigesii (Cai et al., 2012), D. thyrsiflorum (Yuan et al., 2011) and D. officinale (Hou et al., 2012). Obviously, the available SSR markers were still limited. Here, some more novel genome-wide SSR markers were released and some new insights into their potential values were also investigated.

137

interspecific Dendrobium species were shown in Fig. S1. Detailed information was shown in Table S1. 2.2. Intraspecific plant materials Thirty-two individuals in cultivated populations of D. officinale/ catenatum were collected from Sichuan, Jiangxi, Zhejiang, Anhui, Yunnan and Guangxi provinces. Thirty-two individuals in cultivated populations of D. denneanum were collected from Maliu, Xiema and Huatou, Sichuan province. Sixty-four individuals in cultivated populations of D. nobile were collected from Hejiang, Sichuan province, Chishui, Guizhou province and Hechuan, Chongqin province. Partial accessions showing obvious variances in phenotypes were shown in Fig. 1. Detailed information has been provided in Table S2. 2.3. Analysis of SSRs in genomic sequences of D. catenatum

2. Materials and methods

A total of 3814 genomic scaffolds (~1.01 Gb) of D. catenatum were obtained from the library of NCBI (https://www.ncbi.nlm.nih.gov/ assembly/GCA_001605985.2). Each of these scaffolds was screened for possible SSRs by using SSRHunter v1.3 (Li and Wan, 2005). Repeated units of dinucleotide, trinucleotide and tetra-nucleotide were searched in this study. Only if the number of repeats was more than 5 times, the information of this SSR site including repeated sequences and each 150 bp upstream and downstream sequences were recorded for further analysis.

2.1. Interspecific plant materials

2.4. Primers for SSR markers

A total of 32 wild Dendrobium species, including D. nobile, D. officinale, D. huoshanense, D. pendulum, D. aphyllum, D. dixanthum, D. moschatum, D. heterocarpum, D. chrysanthum, D. anosmum, D. crepidatum, D. fimbriatum, D. findlayanum, D. flexicaule, D. aurantiacum, D. hancockii, D. moniliforme, D. crystallinum, D. wardianum, D. lindleyi, D. chrysotoxum, D. christyanum, D. acinaciforme, D. hercoglossum, D. crumenatum, D. ellipsophyllum, D. longicornu, D. williamsonii, D. salaccense, D. xichouense, D. strongylanthum, D. stuposum, and five varietas or variant materials, including D. chrysanthum Wall. ex Lindl, D. fimbriatum var. oculatum, D. aurantiacum var. denneanum, D. nobile cv. Yunnan, D. hancockii cv. Jizhu, were collected for interspecific identification. These species had been identified by Professor Hao Zhang (West China School of Pharmacy, Sichuan University) according to the records in Flora Reipublicae Popularis Sinicae (Chinese Academy of Sciences, Editorial Committee of Flora of China 1999) and electronic specimens at http://frps.iplant.cn/ (Institute of Botany, Chinese Academy of Sciences). Taxonomy ID was observed from NCBI database (https://www.ncbi.nlm.nih.gov/Taxonomy/). The photographs of 37

Primers of SSR markers were designed from the above obtained sequences using Primer Premier v6.0 (Canada). A total of 100 primer pairs were randomly selected in this study. All primer pairs were synthesized by Tsingke Biotech (China). More detailed information of SSR markers were listed in Table 1. The sequences of each developed SSR primer pair were compared with previously reported Dendrobium SSRs (Fan et al., 2009; Xu et al., 2011; Yuan et al., 2011; Cai et al., 2012; Hou et al., 2012; Lu et al., 2012; Lu et al., 2014; Kang et al., 2015; Xu et al., 2017) in order to determine that they were novel. 2.5. DNA extraction Genomic DNA was extracted using a modified CTAB (cetyltrimethyl ammonium bromide) method (Zheng et al., 2017). Each of 0.5 g fresh leaves were grounded to a fine powder in liquid nitrogen. And 1 mL of extracting solution (2% (w/v) CTAB, 100 mM Tris–HCl, 20 mM EDTA, 1.4 M NaCl, pH 8.0) was added and incubated at 65 °C for 1 h. Then, equal volume of chloroform was added and mixed thoroughly.

Fig. 1. Some typical variations in collected individuals of three Dendrobium species. (A) D. catenatum. HTP indicates individuals with red-brown epidermis, QTP indicates individuals with green epidermis. (B) D. denneanum. (C) D. nobile. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

138

T.M. Zhao et al. / South African Journal of Botany 127 (2019) 136–146

Table 1 Designing information of genome-wide SSR markers. Marker name

dnsr1 dnsr2 dnsr4 dnsr6 dnsr7 dnsr9 dnsr10 dnsr11 dnsr12 dnsr15 dnsr17 dnsr20 dnsr22 dnsr24 dnsr25 dnsr26 dnsr27 dnsr28 dnsr29 dnsr30 dnsr35 dnsr36 dnsr37 dnsr39 dnsr40 dnsr41 dnsr42 dnsr43 dnsr44 dnsr46 dnsr47 dnsr48 dnsr49 dnsr50 dnsr52 dnsr54 dnsr55 dnsr56 dnsr58 dnsr59 dnsr62 dnsr64 dnsr65 dnsr66 dnsr67 dnsr68 dnsr69 dnsr70 dnsr71 dnsr72 dnsr73 dnsr74 dnsr75 dnsr76 dnsr77 dnsr78 dnsr80 dnsr81 dnsr82 dnsr83 dnsr84 dnsr85 dnsr86 dnsr87 dnsr91 dnsr92 dnsr95 dnsr96 dnsr97 dnsr98 dnsr99 dnsr100

Primer sequence (5′-3′) F

R

GAAGACAAACATTGTTGGCTGA TTGGAGTGTCAGCGTGTAGATA GCTGGAGTTGATGAGGAAGAG CAAAGGCTACCCTAACCTAAGA ACACCCTTGCACACAATAGAAA CCATTTATGTTGCTTGCGAGTT TCGATGTTGATGGAGTGGTATA CCCTTCACTAAGTGATGGATTT TCAATAGTTTGCGGCTTATGGA GCCTATGTTGATGTGCTTGATA GCCGCCTTTCTTATGTTAGTTG GAGGCAATCGAAGCATTCTCT CCAGGACGATCCAGGTCAATT TTCGAGGCAACGGAGTCAG GCATCATAAGCAGTAGGTAAAC AAATGGCTTTCTCCCTTTCTCC TTGCGATGCTGATGTAATGA TGGAGCAAGACTTGTCTAAGC AAATCGACTTTGTCTCGTGTGT CGAGCAAGTTTACAACACATCA CCCTCTTTAGTTCCCTCTACCA TAATTGCAGGTTGCCGACTT TGGCGATCCTTGCTATAATTGT ACCAATCCCAAACTCTACTCTC GCACAACAACAACAACAACAAC GAGTGGACGTAGGTCAAGGTT TCAAAGTCACATACCCACACAA GGTGTGGCATACTATTCATTGG ATTAAATGGACCCTGCCACAAT CGGCGGGATAGGTAAATCG AATCATCGTGCTGCCATGC TGGAAGTTTAGTCATCTCTGGT AAGCACATCCTCCACAATCC CCAGTTCAAGATTGCGTAGGT CCTAATCAGCATAATGGCACTA GTAAGGACATCTGGCTCATAGG GTCCTAAGATTCTACCGCATCA CCAAGTAACCAAGTGAGGGAGT GGTAGGTTGAGTAGCTGAGAC GGAAAGAGTGACCACCCAAAT TGTCATGGGAATGTCTTGGT GGAGTGCTACTGTCTTAACCTG CAACAATTAACTCCTCATCTCC GAGGCAGGAGAAGGCATGTATA GCACCAGGAGCCACATCAA TGCCCACCTAAATGATGTAGAC CAGTGAGGTTGGTGGAAATACA CACCTGTGCTTGCTTATCAT GCCACTTGTGCTACCTATTACT AATGGCACTGGATTTGGCAAT ACACGCAAATCAACACATCTCT GACACTTCACCGCCTTAACAA TGAGGTAGGTCCTTAAGCACG CCTTTCGCTTCTATCTGTTTCA ACCCAGCCAAACCCAAATAAC TGGTACATAGGGAAGTGAGAAG CGAGGGCTTAGAGGGAAGGA GGAGTTGTCGGTGCCTAA CAGAGCACTGACAGCGAAG TGGCAATCTTAGAGCATGTGTC GAGCTTACTCAAGTTGGAGGAT TCATGGCTCACATCATATTGTC GGATTCTATGAACTTCCATTGC TTGCTATTCTTGCGATCTACCT TTTAACGGCAACCATTCTCTG CCAACAGAACTTGCAGGACTAG CTTCTTCTCCTGAGCCTGTGA GTATGAGGCAAATGGAAAGTGT GCCAGTGCCTATGCTACTCC TTTGTGCTCAGTTTGTGTTTCC CCGCCACTTACAGCCATCT GCAGCAGCAGCAACAACA

AAAGGGAGAATAGGATGTTGGT GGCTTGTTGTTGTTGTTGTTGT CCTGTAGCCTGACACTATACTT AAGATCTCTACGTACACCAGGA ATCCTTGCCTTGCCAATGAC GCTCCGACGTAAGATTCACAA CAATGCTTCCTTGCCTTTCA TTGCTTGGTAATTCCTCCTCTT GAAAGTTGTCCCAAATGAAGGT TTGGCGGCGAATATACTGTAA GCGTAATGCTGTGACACCAA TCCCATTTGGCAAGATTTAGCA GATCCGGCACTATTCAGATTCG TCCACCAGCAAAGCACACT CCACTAGACTTGTTGATAGCAT CAGAGTTCAGATGATCCCGAAT GCTCATATTCTTGTGCCCTTC ACTTGAGATTAGCAAACAGCAC TCAAGATAAGGAAAGGCGATGC ACTTCACCCGGAAGAGGATAA GGGATATTGAGAGTGATGGAGA TTCCGACATACGCCTTGATT GAGTTCAGGTGCTTCCGAAT AATTGTGCTCTCTTCTCTTCCC AGGCTAACTCTCAAGTGGTGAT CAGCAAGGTGGTGTGGACA TGGAGTTGGCACATTATGTAGT TCATAAGTGAGCACAGCTACAT CGGTGACGATGATGATGTTCA GACTCCAAGCCATAGCCAATC GCCACCCAAGAGAAGATTCAAA AGTAGACAGGGAAATCGTAGAA CATGAAGGTGGTCCTTTCTAAT TGTCCAGGATGATTGGCTAATG GACAACACATATACAAGCTCCT ACCAAACCACCTAAGGTAACAA AAGGTGAAGCCTAAGGTCTACT TGGTGCTGATCTGGTGAGTG TCCCTAACAACAAACAGACATG AGTTCTAGGTTCCAACAGTGTT AGGCTTCATTTGATACAGCT ACAACTTGGAACCTTACTTGGA GCTTATTCGGCCAAGTCAA TGGTCGGAAGCAAGATGGTTA ACTGCTTGCGACTAAGTATCC AGTGCAATAAGGGATGCTAAGA TACTGAAAGCCTCGCAGGAA CCCATTGTAATGTGGAACTAAG GTTATTGGCTTAATGGCTTGCT GCGACTCCTCTGTTACTGTTC CGCCTGTCCCAAAGTCTCA GGCTTGAGATCTGGCAATGATA GTGGCTATACGACGGCTACA TATATCAGCCTCTTGTCACCAA CACGCACATCGAGGTAAGC TGGTCTGGTCGGCAATGT CGTGAGTGAGGAAGAAGCATTG GCCTAATGCTTTCGTTTCCA AGTACCCTCAGGATTTCCATTG GCAATAGGAGGAACAAGGTGG CGGATCGGACACCATTTCATA TACGCTCTTACAGGACTTGAC GCTATGAACGATATAGTGACAG TTGCTTCTCAAGCTCACATCC GCAACAAGTGGATCATCAAGC CGACTCCACGGGACTACTTT TGCTGCTGCCCTTACTAAGT GCCCTAAATCGCCCAAGAAT CGCCACGTCCGTTGTATCT GAATCTCACGCCATCTCTGC AACGAAGGACGCAACGAAC AACTCCACAACCTCAGAACCT

Scaffold (Genbank)

Repeat unit

Size (bp)

KZ501972 KZ502395 KZ502014 KZ502132 KZ502279 KZ502304 KZ502395 KZ502491 KZ503807 KZ502194 KZ501902 KZ503289 KZ502802 KZ503042 KZ503053 KZ503053 KZ503154 KZ503163 KZ502558 KZ503246 KZ503853 KZ502910 KZ501982 KZ503920 KZ502895 KZ502292 KZ502032 KZ503321 KZ502628 KZ502386 KZ502520 KZ502999 KZ503772 KZ502182 KZ503057 KZ502364 KZ503284 KZ502182 KZ502082 KZ502469 KZ502032 KZ503590 KZ503176 KZ502776 KZ502295 KZ502850 KZ502859 KZ502910 KZ502561 KZ503289 KZ502395 KZ503032 KZ5026701 KZ503536 KZ503461 KZ502571 KZ503131 KZ502855 KZ501974 KZ502732 KZ503351 KZ502383 KZ502898 KZ503234 KZ501850 KZ502469 KZ502700 KZ502198 KZ502406 KZ503863 KZ503084 KZ503619

AC(50) AAC(36) TG(54) TG(60) TTA(50) AG(51) AC(55) TAT(45) ATA(38) ATT(37) TAA(39) AAT(39) TAA(39) TTA(57) AC(50) AAT(53) ATT(43) TACA(11) GT(78) TAA(47) TCTA(11) ATA(67) TTA(36) AC(89) ACA(62) GT(95) AC(76) TTA(39) TAT(38) TG(85) TTA(67) GT(81) CA(74) AC(79) TG(87) TAA(66) TG(91) ATAC(9) TTTC(9) ATA(32) TAT(27) AG(47) TTTG(9) TAA(33) TAA(27) ATAC(9) TTA(33) AAT(28) TTA(32) ATT(28) ATT(28) TTA(29) TAA(26) TAT(25) TTA(29) AAT(33) TTA(30) ATTT(9) AAAT(9) GA(45) TATT(9) TG(46) TG(128) CTT(29) AAT(28) AT(46) ATT(73) AAT(28) TTA(30) TTA(77) TAT(71) TTA(76)

340 139 232 389 232 181 328 331 197 263 285 288 293 451 329 395 243 217 301 371 287 306 307 319 325 338 340 340 353 359 376 385 394 402 415 448 473 132 159 181 198 206 213 213 221 225 234 237 237 241 244 248 253 254 255 255 261 268 276 280 283 285 500 290 319 319 344 356 358 408 409 424

T.M. Zhao et al. / South African Journal of Botany 127 (2019) 136–146

139

The supernatant was collected after centrifuging at 10,000×g for 5 min. Equal volume of isopropyl alcohol was used to precipitate the extracts. After washing by ethanol for twice, the extracts were dissolved in 200 μL of TE buffer (10 mM Tris–HCl, 1 mM EDTA) containg 20 μg/mL RNase A. After incubating for 1 h at 37 °C, DNA samples were stored at − 20 °C. Fifty times dilution of the extracted genomic DNA was used as PCR templates.

least 500 were employed. PASW statistics 18.0 (IBM, USA) was used for statistical analysis. Quantitative data were recorded as mean ± SD. Student t-test and one-way analysis of variance (ANOVA) were used for significance evaluating. Chi-square test (χ2) was used for comparison of enumeration data.

2.6. PCR amplification and electrophoresis

3.1. Overview of SSR distribution in D. catenatum

The PCR amplification was performed on T Professional Standard System (Biometra, Germany). A final volume of 10 μL PCR reaction mixture was used, containing 5 μL of 2X Taq PCR Master Mix (CW biotech, China), 0.3 μL of each primer, 1 μL of DNA template, and 3.4 μL of ddH2O. The amplification program was pre-denaturation at 94 °C for 2 min; denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 30 s, with 40 cycles; extension at 72 °C for 10 min. An 8% (w/v) non-denaturing polyacrylamide gel was used to separate the PCR products. The gel was visualized by silver-staining (An et al., 2009).

A total of 198,990 SSRs have been searched from the 3814 genomic scaffolds of D. catenatum. The total repetition number of dinucleotide was significantly greater than that of trinucleotide and tetra-nucleotide (Fig. 2). The maximum repetition number of dinucleotide, trinucleotide and tetra-nucleotide was 3495, 1982 and 55, respectively. There were 1,340,651 dinucleotide SSRs, and they counted for 0.2428% of the genome size (Table 2). There were 200,144 trinucleotide SSRs, and they accounted for 0.0544% of the genome size (Table S3). There were 10,725 tetra-nucleotide SSRs, and they accounted for 0.0039% of the genome size (Table S4). AT and TA motifs were the dominant in dinucleotide SSRs, AAT and TGT motifs were the dominant in trinucleotide SSRs, and AAAT and TTTA motifs were the dominant in tetra-nucleotide SSRs. The total repetition number of A and T was significantly greater than that of C and G in all of the genome-wide SSRs (Fig. 2).

2.7. Statistics analysis Auto-genotyping of SSR bands was performed by gel-pro analyzer v4.0 (Media Cybernetics, USA). All of the data were recorded in office excel 2010 (Microsoft, USA). PICcalc (Nagy et al., 2012) was used for evaluating of polymorphism information content (PIC). POPGENE v1.32 (https://sites.ualberta.ca/) was used for analysis of EPBs, allele frequency, Nei's genetic diversity (Ht), molecular variances (AMOVA) and genetic distances (Masatoshi 1989). MEGA V7 (Kumar et al., 2016) was used for constructing of phylogenetic trees. Unweighted pair group method with arithmetic mean (UPGMA) and the bootstrap test of at

A

1600000

3. Results

3.2. Polymorphism of SSR markers in interspecific identification of Dendrobium Among the 100 randomly selected primer pairs, 73 SSR markers showed rich and good polymorphism had been screened out for

D

Total repeats

1400000

Number

Number

1200000 1000000 800000 600000

200000

B

9 8

**

1000000 800000 600000

**

**

C

G

200000

**

0 Dinucleotide

Total repeats

1200000

400000

**

400000

1400000

0

Trinucleotide Tetranucleotide

A

E

Average repeats

14

T

Average repeats

12

6

Number

Number

7 5 4

3

0

0 Dinucleotide

Trinucleotide

Tetranucleotide

A

F

Maximal repeats

3500

4500

T

C

G

Maximal repeats

4000

3500

3000

Number

Number

6

2

1

4000

8

4

2

C

10

**

2500 2000 1500

3000 2500 2000

1500

1000

1000

**

500 0 Dinucleotide

Trinucleotide

500

**

0

Tetranucleotide

Fig. 2. Nucleotide repeating information of SSRs in D. catenatum. Dinucleotide, trinucleotide and tetra-nucleotide were shown in A, B and C. Single nucleotide of A, T, C and G were shown in D, E and F. ⁎⁎ indicates p b .01.

140

T.M. Zhao et al. / South African Journal of Botany 127 (2019) 136–146

3.3. Effectiveness of SSR markers in intraspecific identification of D. catenatum

Table 2 Distribution of dinucleotide SSRs in D. catenatum. Units Total Presences/ Total presences Scaffold repeats

Average repeats

Maximal repeats

Proportion of genome (%)

AC AG AT CA CG CT GA GC GT TA TC TG Total

7.02 8.41 8.02 6.08 5.68 8.11 8.41 5.93 6.30 7.96 8.60 7.33

467 51 48 284 13 50 50 10 682 42 46 3495

0.0086 0.0294 0.0448 0.0092 0.0001 0.0332 0.0293 0.0002 0.0090 0.0438 0.0257 0.0097 0.2428

6740 19,279 30,799 8322 121 22,573 19,206 179 7927 30,403 16,474 7285 169,308

1.77 5.05 8.08 2.18 0.03 5.92 5.04 0.05 2.08 7.97 4.32 1.91

47,343 162,066 247,160 50,575 687 183,164 161,579 1061 49,928 241,982 141,708 53,398 1,340,651

A total of 23 newly developed SSR markers showed good polymorphism in the 32 selected individuals of D. catenatum (Table 4). The EPBs of each SSR marker were from 2.02 to 6.40. The average EPBs were 4.67. The PIC value was from 0.448 to 0.751. The average PIC was 0.592. The Ht value was from 0.506 to 0.843. The average Ht was 0.766. The Gst value was from 0.196 to 0.413. The average Gst was 0.297. The Nm value was from 0.710 to 2.050. The average Nm was 1.237. Partial electrophoresis photograms of them were shown in Fig. 4A. The main bands of each SSR marker were clear, stable and easy to be distinguished in each accession. 3.4. Availability of SSR markers in intraspecific identification of D. denneanum

The significantly higher values in each column were highlighted in bold.

interspecific identification (Table 3). The EPBs of each SSR marker were from 4.43 to 14.32. The average EPBs were 9.68. The PIC value was from 0.338 to 0.731. The average PIC was 0.528. The Ht value was from 0.258 to 0.501. The average Ht was 0.375. The Gst value was from 0.116 to 0.867. The average Gst was 0.499. The Nm value was from 0.076 to 3.807. The average Nm was 0.753. The molecular weight range of polymorphic bands was covered from 50 to 2000 bp. Partial electrophoresis photograms of these newly developed SSR markers were shown in Fig. 3A. Similar bands were observed between protospecies and its varietas or variant materials. For example, D. denneanum was a varietas of D. aurantiacum, and they showed similarity in dnsr7 and dnsr49; D. chrysanthum Wall. ex Lindl. and D. chrysanthum Lindl. showed similarity in dnsr24; D. nobile and D. nobile cv. Yunnan showed similarity in dnsr7, dnsr12 and dnsr30; D. hancockii and D. hancockii cv. Jizhu showed similarity in dnsr12; D. officinale and D. huoshanense showed similarity in dnsr12. But they also showed variances in some other SSRs. Especially in dnsr9, none of the 37 species or varietas showed same SSR bands between each other (Fig. 3A). Moreover, phylogenetic tree was constructed in Fig. 3B based on SSR genotypes. The clustering results visually displayed the affinity of the species and their corresponded varietas.

A total of 25 newly developed SSR markers had been screened out for identification of 32 selected individuals in D. denneanum (Table 4). The EPBs of each SSR marker were from 1.29 to 4.06. The average EPBs were 2.21. The PIC value was from 0.445 to 0.681. The average PIC was 0.565. The Ht value was from 0.224 to 0.753. The average Ht was 0.516. The Gst value was from 0.125 to 0.572. The average Gst was 0.245. The Nm value was from 0.374 to 3.483. The average Nm was 1.924. Partial electrophoresis photograms of them were shown in Fig. 5A. The main bands of each SSR marker were still clear, stable and easy to be distinguished in each accession. 3.5. Availability of SSR markers in intraspecific identification of D. nobile A total of 12 newly developed SSR markers had been screened out for identification of the 64 selected individuals of D. nobile (Table 4). The EPBs of each SSR marker were from 2.08 to 6.92. The average EPBs were 4.97. The PIC value was from 0.405 to 0.626. The average PIC was 0.505. The Ht value was from 0.193 to 0.808. The average Ht was 0.596. The Gst value was from 0.054 to 0.294. The average Gst was 0.137. The Nm value was from 1.200 to 8.627. The average Nm was 3.753. Partial electrophoresis photograms of them were

Table 3 Polymorphism of SSR markers in interspecific identification of Dendrobiuma. Markers

EPBs

PIC

Ht

Gst

Nm

Markers

EPBs

PIC

Ht

Gst

Nm

Markers

EPBs

PIC

Ht

Gst

Nm

dnsr1 dnsr2 dnsr4 dnsr6 dnsr7 dnsr9 dnsr10 dnsr11 dnsr12 dnsr15 dnsr17 dnsr20 dnsr22 dnsr24 dnsr25 dnsr26 dnsr27 dnsr28 dnsr29 dnsr30 dnsr35 dnsr36 dnsr37 dnsr39 dnsr40

8.04 13.08 14.32 12.05 11.22 12.10 10.16 7.22 9.97 8.19 16.19 13.19 8.06 12.16 9.94 11.09 9.49 8.78 10.94 10.05 9.75 7.97 6.34 9.26 9.75

0.579 0.603 0.504 0.553 0.489 0.497 0.605 0.492 0.437 0.660 0.544 0.642 0.485 0.427 0.604 0.465 0.510 0.471 0.623 0.476 0.612 0.547 0.526 0.493 0.550

0.306 0.311 0.258 0.305 0.401 0.287 0.301 0.308 0.306 0.335 0.328 0.322 0.317 0.334 0.364 0.296 0.418 0.259 0.325 0.461 0.410 0.356 0.339 0.334 0.287

0.689 0.687 0.867 0.423 0.426 0.601 0.246 0.246 0.246 0.218 0.340 0.335 0.430 0.246 0.601 0.118 0.608 0.598 0.117 0.281 0.116 0.676 0.598 0.678 0.437

0.225 0.225 0.076 0.680 0.680 0.332 1.530 1.530 1.530 1.783 0.970 0.992 0.661 1.530 0.332 3.743 0.321 0.335 3.743 1.276 3.807 0.236 0.335 0.236 0.642

dnsr41 dnsr42 dnsr43 dnsr44 dnsr46 dnsr47 dnsr48 dnsr49 dnsr50 dnsr52 dnsr54 dnsr55 dnsr56 dnsr58 dnsr59 dnsr62 dnsr64 dnsr65 dnsr66 dnsr67 dnsr68 dnsr69 dnsr70 dnsr71 dnsr72

12.16 12.18 7.05 9.43 9.53 5.72 6.13 10.76 8.41 8.41 11.19 5.22 9.72 10.66 12.92 4.43 12.44 10.75 8.03 8.34 10.63 7.59 11.25 9.28 10.91

0.481 0.485 0.731 0.542 0.486 0.541 0.560 0.483 0.509 0.499 0.477 0.505 0.338 0.589 0.550 0.603 0.517 0.529 0.473 0.503 0.594 0.512 0.578 0.522 0.559

0.407 0431 0.338 0.319 0.364 0.337 0.352 0.337 0.367 0.374 0.386 0.453 0.471 0.403 0.276 0.325 0.347 0.348 0.285 0.317 0.467 0.501 0.443 0.336 0.279

0.151 0.518 0.738 0.518 0.356 0.444 0.296 0.592 0.518 0.296 0.376 0.861 0.244 0.584 0.307 0.452 0.452 0.574 0.697 0.590 0.467 0.637 0.668 0.642 0.516

2.795 0.464 0.176 0.464 0.901 0.625 1.187 0.343 0.464 1.187 0.826 0.080 1.546 0.355 1.125 0.605 0.605 0.370 0.217 0.346 0.569 0.284 0.247 0.278 0.467

dnsr73 dnsr74 dnsr75 dnsr76 dnsr77 dnsr78 dnsr80 dnsr81 dnsr82 dnsr83 dnsr84 dnsr85 dnsr86 dnsr87 dnsr91 dnsr92 dnsr95 dnsr96 dnsr97 dnsr98 dnsr99 dnsr100

7.06 7.53 7.72 9.06 12.63 9.50 7.16 12.50 7.24 7.66 9.63 6.88 11.63 7.08 11.34 9.38 8.31 10.50 7.00 12.72 11.63 10.50

0.531 0.394 0.502 0.611 0.507 0.609 0.503 0.518 0.535 0.543 0.561 0.572 0.462 0.470 0.551 0.603 0.559 0.449 0.542 0.463 0.443 0.497

0.344 0.378 0.384 0.349 0.287 0.308 0.413 0.433 0.451 0.412 0.386 0.374 0.368 0.366 0.335 0.332 0.432 0.293 0.402 0.375 0.322 0.443

0.465 0.808 0.809 0.485 0.453 0.349 0.778 0.643 0.342 0.823 0.401 0.677 0.701 0.741 0.416 0.346 0.611 0.619 0.556 0.495 0.356 0.732

0.574 0.118 0.117 0.528 0.601 0.932 0.142 0.277 0.961 0.106 0.744 0.238 0.212 0.174 0.699 0.941 0.318 0.306 0.398 0.508 0.904 0.182

Average

9.68

0.528

0.375

0.499

0.753

a

EPBs effective polymorphic bands, PIC polymorphism information content, Ht Nei's genetic diversity, Gst genetic differentiation, Nm gene flow.

T.M. Zhao et al. / South African Journal of Botany 127 (2019) 136–146

141

Fig. 3. Electrophoresis photograms and phylogenetic tree of SSR markers in interspecific Dendrobium. (A) Red frames indicate the similar bands. (B) The similar materials were also labelled in red. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

shown in Fig. 6A. The main bands of each SSR marker were clear, stable and easy to be distinguished in each accession.

D. nobile (p b .01). But no significance was observed in association to collection sites.

3.6. Association between phylogenetic subgroups and phenotypic traits

4. Discussion

The phylogenetic trees of D. catenatum, D. denneanum and D. nobile were shown in Fig. 4B, Fig. 5B and Fig. 6B, respectively. Almost any two of the individuals could be branched at a certain distance. According to the clustering results, the individuals were subdivided into 7 groups in D. catenatum, 3 groups in D. denneanum and 4 groups in D. nobile (Table 5). The subgroups were significantly correlated to plant height in all of the three species (p b .01). The subgroups were significantly correlated to epidermis color in D. catenatum and D. nobile (p b .01). The subgroups were also significantly associated with flower color in

4.1. Genome-wide SSR markers in Dendrobium Characterization and utilization of genome-wide SSR markers became available after the releasing of genomic sequences (Cavagnaro et al., 2010; Liu et al., 2013). At present, only D. officinale/catenatum had been sequenced for the whole genome in Dendrobium genus (Yan et al., 2015; Zhang et al., 2016). In this paper, the newly improved genomic scaffolds of D. catenatum were used for SSR analysis. A total of 198,990 candidate SSRs have been searched out from the genome (Table 2, Table S1, Table S2). This is much higher than the 8527 potential

142

T.M. Zhao et al. / South African Journal of Botany 127 (2019) 136–146

Table 4 Polymorphism of SSR markers in intraspecific identification of Dendrobiuma. D. catenatum

D. denneanum

D. nobile

Markers

EPBs

PIC

Ht

Gst

Nm

Markers

EPBs

PIC

Ht

Gst

Nm

Markers

EPBs

PIC

Ht

Gst

Nm

dnsr7 dnsr9 dnsr12 dnsr14 dnsr24 dnsr25 dnsr28 dnsr30 dnsr37 dnsr49 dnsr55 dnsr56 dnsr58 dnsr63 dnsr71 dnsr82 dnsr83 dnsr86 dnsr87 dnsr88 dnsr93 dnsr94 dnsr95

4.00 2.86 5.27 4.87 6.32 2.72 5.82 5.75 2.02 4.45 4.97 6.40 4.83 4.92 6.32 3.84 4.00 3.79 5.50 5.22 4.78 3.10 5.56

0.677 0.583 0.603 0.687 0.751 0.531 0.648 0.575 0.448 0.650 0.512 0.477 0.619 0.624 0.610 0.560 0.545 0.554 0.566 0.647 0.620 0.589 0.538

0.750 0.650 0.810 0.794 0.841 0.632 0.828 0.826 0.506 0.775 0.798 0.843 0.793 0.796 0.841 0.740 0.750 0.736 0.818 0.808 0.791 0.677 0.820

0.270 0.375 0.344 0.351 0.313 0.209 0.226 0.281 0.413 0.294 0.295 0.351 0.251 0.196 0.313 0.345 0.312 0.236 0.331 0.265 0.288 0.354 0.238

1.346 0.832 0.951 0.923 1.09 1.882 1.708 1.277 0.710 1.196 1.190 0.921 1.490 2.050 1.096 0.946 1.100 1.618 1.007 1.381 1.230 0.910 1.618

2.185 4.941 2.303 1.200 3.640 4.734 4.000 8.627 3.737 3.200 2.693 3.784

1.238

1.910 3.428 3.243 3.483 3.250 3.250 3.162 2.153 1.388 1.662 0.535 1.647 0.821 1.237 1.200 2.514 3.250 1.743 1.292 0.374 0.965 1.381 2.000 1.082 1.142 1.924

0.186 0.091 0.178 0.294 0.120 0.095 0.111 0.054 0.118 0.135 0.156 0.116

0.297

0.207 0.127 0.133 0.125 0.133 0.133 0.136 0.188 0.264 0.231 0.483 0.232 0.378 0.287 0.294 0.165 0.133 0.222 0.279 0.572 0.341 0.265 0.200 0.316 0.304 0.245

0.508 0.193 0.623 0.432 0.808 0.505 0.803 0.546 0.566 0.614 0.773 0.778

0.766

0.631 0.429 0.541 0.482 0.468 0.468 0.615 0.404 0.531 0.650 0.574 0.570 0.753 0.658 0.597 0.412 0.468 0.342 0.455 0.731 0.498 0.404 0.468 0.525 0.224 0.516

0.526 0.626 0.405 0.547 0.470 0.555 0.471 0.407 0.439 0.537 0.613 0.463

0.592

0.445 0.681 0.615 0.601 0.594 0.437 0.616 0.467 0.563 0.571 0.658 0.530 0.498 0.583 0.544 0.594 0.540 0.577 0.595 0.678 0.664 0.457 0.540 0.543 0.534 0.565

5.91 2.08 6.28 3.69 5.45 4.20 5.63 4.73 6.92 3.61 6.66 4.51

4.67

2.71 1.75 2.17 1.93 1.88 1.88 2.59 1.68 2.13 2.86 2.35 2.33 4.06 2.92 2.48 1.70 1.88 1.52 1.84 3.71 1.99 1.68 1.88 2.10 1.29 2.21

dnsr9 dnsr23 dnsr24 dnsr25 dnsr28 dnsr35 dnsr49 dnsr55 dnsr58 dnsr70 dnsr83 dnsr95

Average

dnsr3 dnsr7 dnsr8 dnsr9 dnsr10 dnsr12 dnsr24 dnsr25 dnsr28 dnsr34 dnsr41 dnsr50 dnsr54 dnsr55 dnsr56 dnsr58 dnsr61 dnsr64 dnsr68 dnsr70 dnsr71 dnsr89 dnsr92 dnsr93 dnsr95 Average

Average

4.97

0.505

0.596

0.137

3.753

a

EPBs effective polymorphic bands, PIC polymorphism information content, Ht Nei's genetic diversity, Gst genetic differentiation, Nm gene flow.

Fig. 4. Electrophoresis photograms and phylogenetic tree of SSR markers in D. catenatum. (A) Red arrow indicates the main polymorphic bands in each marker. (B) Red frames indicate different subgroups. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

T.M. Zhao et al. / South African Journal of Botany 127 (2019) 136–146

143

Fig. 5. Electrophoresis photograms and phylogenetic tree of SSR markers in D. denneanum. (A) Red arrow indicates the main polymorphic bands in each marker. (B) Red frames indicate the different subgroups. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

transcriptome–SSRs reported on D. officinale (Xu et al., 2017). One-nt motifs were not considered in this paper because of the hardness in primer design. Five and more-nt motifs were also not considered because of their small proportion (Xu et al., 2017). Dinucleotide, trinucleotide and tetra-nucleotide conferred 85%, 14% and 1% of the total SSRs in D. catenatum (Fig. 2). The motifs containing A and T presented much more than the motifs containing G and C (Fig. 2). These results were consistent with the previous transcriptomic analysis in D. officinale and analysis in other plant genome (Fu et al., 2016; Xu et al., 2017). The SSR density in the whole genome of D. catenatum was about 180 SSRs/Mb. This was much lower than some plant species with small size genome, such as 551.9 SSRs/Mb in Cucumis sativus L. (203 Mb) and 872.60 SSRs/Mb in Ziziphus jujuba Mill (437.65 Mb, Cavagnaro et al., 2010; Fu et al., 2016). But it was equal to some other plant species with genomic size of about 1 Gb, such as 120 SSRs/Mb in Zea mays L. (Sharopova et al., 2002). In addition, the repeat number for dinucleotide was up to 128, the repeat number for trinucleotide was up to 77 and the repeat number for tetranucleotide was up to 11, in the randomly selected primer pairs (Table 1). This is much higher than previously reported SSR markers (Kang et al., 2015; Xu et al., 2017). The larger amounts and variation range would produce much more polymorphic loci on Dendrobium.

had been approved again in some more species. Most of the newly developed SSR markers (73 of 100) from D. catenatum showed rich and good polymorphism among 32 different Dendrobium species (Table 3). The EPBs of each SSR marker were mostly greater than 10. The PIC values of these novel SSR markers were mostly greater than 0.5. The Nei's genetic diversity Ht was less than 0.5, the genetic differentiation Gst was near to 0.5, the interspecific gene flow was less than 1. The electrophoretograms of them were clear for observation and were suitable for auto-genotyping by software. Some of them could also be applied to distinguish protospecies from its varietas or variant materials (Fig. 3). For example, D. denneanum was a varietas of D. aurantiacum, and they showed similarity in dnsr7 and dnsr49. But they also showed variances in other SSRs. Similar results were also observed in other similar materials. Especially, some SSR markers could distinguish all of the 37 Dendrobium species or varieties, such as dnsr9. This made it possible and easy for genetic analysis of dozens of hundreds Dendrobium species with few SSR markers, simultaneously. All of the above advantages have not been reported before on EST–SSR or library–SSR markers in Dendrobium (Wang et al., 2012; Lu et al., 2014). Thus, by utilizing the benefits of genome-wide SSR markers, interspecific identification, diversity and phylogenetic study, and evolutionary analysis would be expanded.

4.2. Rich polymorphism of genome-wide SSR markers in interspecific identification of Dendrobium

4.3. Efficacy of genome-wide SSR markers in intraspecific identification of Dendrobium

Previously, the transferability of SSR markers had been confirmed in some Dendrobium species (Lu et al., 2013; Kang et al., 2015). Here, it

Some of the newly developed SSR markers also showed perfect polymorphism between different individuals in the same species (Table 4).

144

T.M. Zhao et al. / South African Journal of Botany 127 (2019) 136–146

Fig. 6. Electrophoresis photograms and phylogenetic tree of SSR markers in D. nobile. (A) Red arrow indicates the main polymorphic bands in each marker. (B) Red frames indicate the different subgroups. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Table 5 Association of phylogenetic groups and phenotypic traitsa. Species

Groups

NO.

Plant height

D. catenatum Subgroup1 Subgroup2 Subgroup3 Subgroup4 Subgroup5 Subgroup6 Subgroup7 p value

3 8 4 4 3 4 6 –

30.90 ± 3.11 27.71 ± 4.07 19.53 ± 3.28 30.65 ± 2.88 33.23 ± 1.79 26.60 ± 3.66 22.35 ± 5.04 0.0003

Subgroup1 Subgroup2 Subgroup3 p value

10 9 13 –

43.51 ± 9.66 55.79 ± 8.30 60.93 ± 13.40 0.002

Subgroup1 Subgroup2 Subgroup3 Subgroup4 p value

17 16 11 16 –

44.85 ± 4.46 43.51 ± 7.61 35.95 ± 3.28 50.10 ± 9.30 3.61585E-05

D. denneanum

D. nobile

a

collection sites SC 0 2 0 0 1 1 2 0.081 ML 5 7 3 0.112 CS 6 7 4 6 0.751

YN 1 2 3 1 2 0 0

GX 0 4 0 0 0 0 2

JX 2 0 1 1 0 0 1

AH 0 0 0 1 0 1 1

XM 3 1 8

HT 2 1 2

HJ 8 4 4 6

HC 3 5 3 4

ZJ 0 0 0 1 0 2 0

Flower color

Epidermis color

Light yellow 3 8 4 4 3 4 6 – Yellow 10 9 13 – more purple 5 6 2 13 0.003

Red-brown 3 0 3 4 0 1 4 0.002 light green 6 3 4 0.32 light green 12 9 9 3 0.004

less purple 12 10 9 3

SC Sichuan, YN Yunnan, GX Guangxi, JX Jiangxi, AH Anhui, ZJ Zhejiang, ML Maliu, XM Xiema, HT Huatou, CS Chishui, HJ Hejiang, HC Hechuan.

Green 0 8 1 0 3 3 2 deep green 4 6 9 deep green 5 7 2 13

T.M. Zhao et al. / South African Journal of Botany 127 (2019) 136–146

The intraspecific EPBs (3.95) were less than interspecific EPBs (9.68), because of that EPBs were relatively fixed in a specific species (Cai et al., 2012; Ding et al., 2015). But the intraspecific Ht (0.626) was more than interspecific Ht (0.375), because of that more allelic sites presented in intraspecific individuals for each EPB (Hou et al., 2012; Fu et al., 2016). The intraspecific Gst (0.226) was less than interspecific Gst (0.499), but the intraspecific Nm (2.305) was much more than interspecific Nm (0.753). This was consistent with the evolutionary events in Dendrobium (Hou et al., 2012; Teixeira Da Silva et al., 2016). The intraspecific and interspecific PIC values (0.554 vs 0.528) showed no significant variances. This might be because PIC reflects the comprehensive diversity (Nagy et al., 2012). In D. catenatum, 23 SSR markers from the 100 selected primer pairs showed good efficacy on intraspecific identification of 32 individuals (Fig. 4). The proportion was consistent with previous studies. 17 transcriptome–SSR markers produced polymorphic products in 31 D. officinale individuals from 68 primer pairs (Xu et al., 2017). When transferred to D. denneanum (Fig. 5) and D. nobile (Fig. 6), 25 and 12 SSR markers showed good effectiveness on intraspecific identification of 32 and 64 individuals, respectively. Especially, seven SSR markers, dnsr9, dnsr24, dnsr25, dnsr28, dnsr55, dnsr58 and dnsr95, showed efficacy in all three species (Table 4). This confirmed the suitable transferability of genome-wide SSR markers from D. catenatum to other Dendrobium sepcies again. Previously, 20 EST–SSR markers and 17 transcriptome–SSR markers were identified from 19 and 31 individuals of D. officinale (Lu et al., 2012; Xu et al., 2017), 28 EST–SSR markers were screened from 24 individuals of D. nobile (Lu et al., 2014). And 10–20 library-SSR markers were characterized from 24 to 136 individuals of D. fimbriatum (Fan et al., 2009), D. thyrsiflorum (Yuan et al., 2011), D. loddigesii (Cai et al., 2012), D. huoshanense (Wang et al., 2012), D. calamiforme (Trapnell et al., 2015) and D. crystallinum (Ding et al., 2015), respectively. Here, SSR markers were firstly reported on D. denneanum. The diversity of these novel markers was suitable for identification of intraspecific genetic variances. More diagnostic markers would be identified from genome-wide SSR markers, and they could be applied on intraspecific identification of more Dendrobium species. 4.4. Potential values of genome-wide SSR markers in genetic studies on Dendrobium Previous genetic researches were mainly focused on interspecific Dendrobium. The currently reported genetic maps were constructed on populations of two different species, such as D. moniliforme × D. nobile and D. moniliforme × D. officinale (Lu et al., 2018). But abundant phenotypic variations were observed in intraspecific Dendrobium (Fig. 1). Now, the genotypic variations were also identified. In the preliminary observation, the clustered subgroups of different individuals in the same species showed significant association with some phenotypic traits. For example, red-brown epidermis (individuals beginning with HTP) and green epidermis (individuals beginning with QTP) were two obvious variant types of D. catenatum in cultivated populations (Fig. 1A, Yang et al., 2016; Lan et al., 2017). Based on the screened SSR markers, they could be clustered into special subgroups including HTP or QTP only or mainly (Fig. 4B). All of the three species showed significant association between clustering subgroups and plant height (Table 5). The phylogenetic subgroups of D. nobile were also correlated to flower color. Still, much more markers and individuals were needed to show a perfect association with ornamental trails traits or pharmaceutical components. Recently, few AFLP, ISSR and DAMD markers were shown to be correlated to some biochemical traits in D. nobile and D. thyrsiflorum (Bhattacharyya et al., 2015; Bhattacharyya et al., 2017). A relatively high-density genetic map was constructed by 8, 573 SLAF markers, and quantitative trait loci (QTL) related to stem total polysaccharide contents were identified (Lu et al., 2018). Furthermore, with more releasing of SSR and other type markers, the

145

quantity and quality of genetic maps on Dendrobium could be improved. This would be helpful for chromosome assembly, QTL mapping, association analysis, molecular breeding, quality and safety assessment, and other intraspecific genetic studies. Supplementary data to this article can be found online at https://doi. org/10.1016/j.sajb.2019.08.051. Declaration of Competing Interest The authors declare no conflict of interest. Acknowledgements Financial supports from Sichuan Provincial 13th Five-Year breeding program of traditional Chinese medicine [2016NYZ0036], key research and development projects in science and technology of Sichuan province [2017SZ0020, 2017SZ0022] and science and technology support program of Sichuan province [2018SZ0096, 2018NZ0062] are gratefully acknowledged. References An, Z.W., Xie, L.L., Cheng, H., Zhou, Y., Zhang, Q., He, X.G., Huang, H.S., 2009. A silver staining procedure for nucleic acids in polyacrylamide gels without fixation and pretreatment. Anal. Biochem. 391, 77–79. Bhattacharyya, P., Kumaria, S., Tandon, P., 2015. Applicability of ISSR and DAMD markers for phyto-molecular characterization and association with some important biochemical traits of Dendrobium nobile, an endangered medicinal orchid. Phytochemistry 117, 306–316. Bhattacharyya, P., Ghosh, S., Mandi, S.S., Kumaria, S., Tandon, P., 2017. Genetic variability and association of AFLP markers with some important biochemical traits in Dendrobium thyrsiflorum, a threatened medicinal orchid. S. Afr. J. Bot. 109, 214–222. Cai, X.Y., Feng, Z.Y., Hou, B.W., Xing, W.R., Ding, X.Y., 2012. Development of microsatellite markers for genetic diversity analysis of Dendrobium loddigesii Rolfe, an endangered orchid in China. Biochem. Syst. Ecol. 43, 42–47. Cakova, V., Bonte, F., Lobstein, A., 2017. Dendrobium:sources of active ingredients to treat age-related pathologies. Aging Dis. 8, 827–849. Cavagnaro, P.F., Senalik, D.A., Yang, L., Simon, P.W., Harkins, T.T., Kodira, C.D., Huang, S.W., Weng, Y.Q., 2010. Genome-wide characterization of simple sequence repeats in cucumber (Cucumis sativus L.). BMC Genomics 11, 569. Chinese Academy of Sciences Editorial Committee of Flora of China, 1999. Flora Reipublicae Popularis Sinicae. Science Press, Peking. Ding, G., Zhang, D.Z., Ding, X.Y., 2015. Isolation and characterization of microsatellites in Dendrobium crystallinum and application to germplasm identification. Conserv. Genet. Resour. 7, 735–737. Fan, W.J., Luo, Y.M., Li, X.X., Gu, S., Xie, M.L., He, J., Cai, W.T., Ding, X.Y., 2009. Development of microsatellite markers in Dendrobium fimbriatum hook, an endangered Chinese endemic herb. Mol. Ecol. Resour. 9, 373–375. Fu, P.C., Zhang, Y.Z., Ya, H.Y., Gao, Q.B., 2016. Characterization of SSR genomic abundance and identification of SSR markers for population genetics in Chinese jujube (Ziziphus jujuba mill.). Peerj 4, e1735. Hou, B.W., Min, T., Luo, J., Ji, Y., Xue, Q.Y., Ding, X.Y., 2012. Genetic diversity assessment and ex situ conservation strategy of the endangered Dendrobium officinale (Orchidaceae) using new trinucleotide microsatellite markers. Plant Syst. Evol. 298, 1483–1491. Kang, J.Y., Lu, J.J., Qiu, S., Chen, Z., Liu, J.J., Wang, H.Z., 2015. Dendrobium SSR markers play a good role in genetic diversity and phylogenetic analysis of Orchidaceae species. Sci. Hortic. 183, 160–166. Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870–1874. Lan, F., Li, L., Wei, X., Huang, R., Feng, P., 2017. Comparison of the morphological characteristics and medicinal materials quality among three different species of Dendrobium candidum. West China J. Pharm. Sci. 32, 615–617. Li, Q., Wan, J.M., 2005. SSRHunter:development of a local searching software for SSR sites. Yi Chuan 27, 808–810. Liu, S.R., Li, W.Y., Long, D., Hu, C.G., Zhang, J.Z., 2013. Development and characterization of genomic and expressed SSRs in citrus by genome-wide analysis. PLoS One 8, e75149. Lu, J.J., Suo, N.N., Hu, X., Wang, S., Liu, J.J., Wang, H.Z., 2012. Development and characterization of 110 novel EST-SSR markers for Dendrobium officinale (Orchidaceae). Am. J. Bot. 99, e415–e420. Lu, J.J., Kang, J.Y., Feng, S.G., Zhao, H.Y., Liu, J.J., Wang, H.Z., 2013. Transferability of SSR markers derived from Dendrobium nobile expressed sequence tags (ESTs) and their utilization in Dendrobium phylogeny analysis. Sci. Hortic. 158, 8–15. Lu, J.J., Kang, J.Y., Ye, S.R., Wang, H.Z., 2014. Isolation and characterization of novel ESTSSRs in the showy dendrobium, Dendrobium nobile (Orchidaceae). Genet. Mol. Res. GMR 13, 986–991. Lu, J.J., Liu, Y.Y., Xu, J., Mei, Z.W., Shi, Y.J., Liu, P.L., He, J.B., Wang, X.T., Meng, Y.J., Feng, S.G., Shen, C.J., Wang, H.Z., 2018. High-density genetic map construction and stem Total polysaccharide content-related QTL exploration for Chinese endemic Dendrobium (Orchidaceae). Front. Plant Sci. 9, 36.

146

T.M. Zhao et al. / South African Journal of Botany 127 (2019) 136–146

Masatoshi, N., 1989. Molecular Evolutionary Genetics. Columbia University Press, New York. Nagy, S., Poczai, P., Cernák, I., Gorji, A.M., Hegedűs, G., Taller, J., 2012. PICcalc: an online program to calculate polymorphic information content for molecular genetic studies. Biochem. Genet. 50, 670–672. Ng, T.B., Liu, J.Y., Wong, J.H., Ye, X.J., Wing Sze, S.C., Yao, T., Zhang, K.Y., 2012. Review of research on Dendrobium, a prized folk medicine. Appl. Microbiol. Biotechnol. 93, 1795–1803. Sawettalake, N., Bunnag, S., Wang, Y., Shen, L., Yu, H., 2017. DOAP1 promotes flowering in the orchid Dendrobium Chao Praya smile. Front. Plant Sci. 8, 400. Sharopova, N., McMullen, M.D., Schultz, L., Schroeder, S., Sanchez-Villeda, H., Bergstrom, D., Gardiner, J., Houchins, K., Melia-Hancock, S., Musket, T., Duru, N., Polacco, M., Edwards, K., Ruff, T., Register, J.C., Brouwer, C., Thompson, R., Velasco, R., Chin, E., Lee, M., Woodman-Clikeman, W., Long, M.J., Liscum, E., Karen, C., Davis, G., Coe Jr., E.H., 2002. Development and mapping of SSR markers for maize. Plant Mol. Biol. 48, 463–481. State Pharmacopeia Committee of China, 2015. Pharmacopoeia of People's Republic of China. The Medicine Science and Technology Press of China, Peking. Tang, H., Zhao, T., Sheng, Y., Zheng, T., Fu, L., Zhang, Y., 2017. Dendrobium officinale Kimura et Migo: a review on its ethnopharmacology, phytochemistry, pharmacology, and industrialization. Evid. Based Complement. Alternat. Med. 2017, 1–19. Teixeira Da Silva, J.A., Ng, T.B., 2017. The medicinal and pharmaceutical importance of Dendrobium species. Appl. Microbiol. Biotechnol. 101, 1–13. Teixeira Da Silva, J.A., Jin, X.Y., Dobránszki, J., Lu, J.J., Wang, H.Z., Zotz, G., Cardoso, J.C., Zeng, S.J., 2016. Advances in Dendrobium molecular research: applications in genetic variation, identification and breeding. Mol. Phylogenet. Evol. 95, 196–216. Trapnell, D.W., Beasley, R.R., Lance, S.L., Field, A.R., Jones, K.L., 2015. Characterization of microsatellite loci for an Australian epiphytic orchid, Dendrobium calamiforme, using Illumina sequencing. Appl. Plant Sci. 3, 1500016. Wang, H., Chen, N.F., Zheng, J.Y., Wang, W.C., Pei, Y.Y., Zhu, G.P., 2012. Isolation and characterization of eleven polymorphic microsatellite loci for the valuable medicinal plant Dendrobium huoshanense and cross-species amplification. Int. J. Mol. Sci. 13, 16779–16784.

Wang, S.S., Hou, F.X., Cao, J., Zhao, J.R., Wan, D.G., Guo, J.L., Peng, C., 2018. Authentication of Chinese herbal medicines Dendrobium species and phylogenetic study based on nrDNA ITS sequence. Int. J. Agric. Biol. 20, 369–374. Xu, W., Zhang, F., Lu, B.B., Cai, X.Y., Hou, B.W., Feng, Z.Y., Ding, X.Y., 2011. Development of novel chloroplast microsatellite markers for Dendrobium officinale, and cross-amplification in other Dendrobium species (Orchidaceae). Sci. Hortic. 128, 485–489. Xu, M., Liu, X., Wang, J.W., Teng, S.Y., Shi, J.Q., Li, Y.Y., Huang, M.R., 2017. Transcriptome sequencing and development of novel genic SSR markers for Dendrobium officinale. Mol. Breed. 37, 18. Yan, L., Wang, X., Liu, H., Tian, Y., Lian, J.M., Yang, R.J., Hao, S.M., Wang, X.J., Yang, S.C., Li, Q.Y., Qi, S., Kui, L., Moses, Okpekum, Ma, X., Zhang, J.J., Ding, Z.L., Zhang, G.J., Wang, W., Dong, Y., Sheng, J., 2015. The genome of Dendrobium officinale illuminates the biology of the important traditional Chinese orchid herb. Mol. Plant 8, 922–934. Yang, D., Li, K., Wang, L., Li, Q., Yue, J., 2016. Breeding of Dendrobium officinale ‘Qinggu 1’. Chin. J. Trop. Agric. 36, 50–54. Yuan, Y.H., Hou, B.B., Xu, H.J., Luo, J., Ding, X.Y., 2011. Identification of the geographic origin of Dendrobium thyrsiflorum on Chinese herbal medicine market using trinucleotide microsatellite markers. Biol. Pharm. Bull. 34, 1794–1800. Zhang, G.Q., Xu, Q., Bian, C., Tsai, W.C., Yeh, C.M., Liu, K.W., Yoshida, K., Zhang, L.S., Chang, S.B., Chen, F., Shi, Y., Su, Y.Y., Zhang, Y.Q., Chen, L.J., Yin, Y.Y., Lin, M., Huang, H.X., Deng, H., Wang, Z.W., Zhu, S.L., Zhao, X., Deng, C., Niu, S.C., Huang, J., Wang, M.N., Liu, G.H., Yang, H.J., Xiao, X.J., Hsiao, Y.Y., Wu, W.L., Chen, Y.Y., Mitsuda, N., Ohme-Takagi, M., Luo, Y.B., de Peer, Y.V., Liu, Z.J., 2016. The Dendrobium catenatum Lindl. Genome sequence provides insights into polysaccharide synthase, floral development and adaptive evolution. Sci. Rep. 6, 19029. Zheng, S.G., Li, Y.F., Lu, L., Liu, Z.H., Zhang, C.H., Ao, D.H., Li, L.R., Zhang, C.Y., Liu, R., Luo, C.P., Wu, Y., Zhang, L., 2017. Evaluating the contribution of Yr genes to stripe rust resistance breeding through marker-assisted detection in wheat. Euphytica 213, 50. Zheng, S.G., Hu, Y.D., Zhao, R.X., Yan, S., Zhang, X.Q., Zhao, T.M., Chun, Z., 2018. Genomewide researches and applications on Dendrobium. Planta 248, 769–784.