- Email: [email protected]
Development of novel chloroplast microsatellite markers for Dendrobium officinale, and cross-amplification in other Dendrobium species (Orchidaceae)
Scientia Horticulturae 128 (2011) 485–489
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
Development of novel chloroplast microsatellite markers for Dendrobium officinale, and cross-amplification in other Dendrobium species (Orchidaceae) Wen Xu, Feng Zhang, Beibei Lu, Xiaoyan Cai, Beiwei Hou, Zhenyu Feng, Xiaoyu Ding ∗ Jiangsu Provincial Key Laboratory for Biodiversity and Biotechnology, College of Life Sciences, Nanjing Normal University, No. 1, Wenyuan Road, Nanjing 210046, China
a r t i c l e
i n f o
Article history: Received 2 December 2010 Received in revised form 21 February 2011 Accepted 22 February 2011 Keywords: Dendrobium officinale Chloroplast microsatellites Development Polymorphism Transferability
a b s t r a c t Nine pairs of polymorphic chloroplast microsatellite primers were developed for Dendrobium officinale Kimura et Migo, an endangered herb. Levels of polymorphism were tested across a total of 55 individuals from four natural populations (12–15 individuals per population). Allele numbers varied from two to four per locus, while the number of haplotypes ranged from four to six per population. Transferability of the nine polymorphic chloroplast microsatellite primers was checked on an additional set of 51 Dendrobium individuals (belonging to 17 different species). Three markers could be transferable to all the species tested, while the remaining six markers successfully cross-amplified in most species tested. Moreover, polymorphism of the nine chloroplast microsatellite primers was tested across Dendrobium moniliforme (L.) Sw. and Dendrobium loddigesii Rolfe. All of them were polymorphic in D. moniliforme, while seven of which were polymorphic in D. loddigesii. These polymorphic chloroplast microsatellite primers developed for D. officinale will be a useful tool for the study of genetic diversity, population genetic structure, evolution of D. officinale and establishment of effective conservation strategies. © 2011 Elsevier B.V. All rights reserved.
1. Introduction The genus Dendrobium is one of the largest genera in Orchidaceae (Wood, 2006). It has an important position in ornamental orchid cut flower industry (Jin et al., 2009). Some Dendrobium species are also used as traditional Chinese tonic medicine. As a rare and endangered perennial herb endemic to China, Dendrobium officinale Kimura et Migo (Orchidaceae) is famous for its unparalleled medicinal value and ranked “the first of the Chinese nine kinds of supernatural medicinal herbs”. The stems of D. officinale are commonly used as medicine named “Tiepi Fengdou”. Their main function is to nourish yin, clear away heat-evil, benefit the stomach, moisten the lung, relieve a cough, promote the production of body fluid, resist cancer and prolong life (Ding et al., 2008). Unfortunately, the natural resource of D. officinale has been in severe danger of extinction because of habitat deterioration and human exploitation enticed by high profit using the stems as good traditional Chinese medicine in recent years. Therefore, it is necessary to investigate the genetic diversity and the population genetic structure of D. officinale natural resource using molecular method with
∗ Corresponding author. Present address: College of Life Sciences, Nanjing Normal University, No. 1, Wenyuan Road, Nanjing 210046, China. Tel.: +86 13305159218; fax: +86 02585891526. E-mail address: [email protected] (X. Ding). 0304-4238/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.scienta.2011.02.016
the purpose of presenting effective conservation strategies and serving evolutionary study. At present, several studies have examined ecological and evolution aspects of D. officinale based on AFLP and SRAP analysis (Li et al., 2008; Ding et al., 2008). Additional, microsatellites or simple sequence repeats (SSR), a group of tandem repeated sequences constituted from mono-, di-, tri-, tetra-, penta-, or hexa-nucleotide units (Chen et al., 2006) and widely distributed throughout nuclear and mitochondrial genome as well as chloroplast genome in eukaryotes (Deguilloux et al., 2004; Hu et al., 2009), were also applied in the research of this species (Xie et al., 2010). Although specific SSR markers for D. officinale have been developed (Xie et al., 2010; Gu et al., 2007), there is a complete lack of cpSSR markers for D. officinale and the other closely related species. Compared to nuclear microsatellites, chloroplast simple sequence repeats (cpSSR) are principally constituted from mononucleotide A/T repeats (Bryan et al., 1999). In particular, cpSSR were developed in the 1990s (Powell et al., 1995; Vendramin et al., 1996; Vendramin and Ziegenhagen, 1997). To date, cpSSR markers have been developed for a variety of species and demonstrated utility in studying evolution, differentiation, genetic diversity and genetic structure of plant population. In this study, we developed a set of polymorphic cpSSR markers for D. officinale and tested their transferability on the other Dendrobium species. Furthermore, we also examined the level of polymorphism of these markers across Dendrobium moniliforme (L.) Sw. and Dendrobium loddigesii Rolfe.
486
W. Xu et al. / Scientia Horticulturae 128 (2011) 485–489
Table 1 Location and sampling size of each population of three species. Population code Dendrobium officinale TT YJ GN XL Dendrobium loddigesii ML HN HH HC Dendrobium moniliforme ZJ JX FJ
Location Tiantai, Zhejiang Province Yongjia, Zhejiang Province Guangnan, Yunnan Province Xilin, Guangxi Province Maolan, Guizhou Province Hainan Province Honghe, Yunnan Province Hechi, Guangxi Province Zhejiang Province Jiangxi Province Fujiang Province
2.2. Development of cpSSR markers and examination of polymorphism Sample size 55 12 15 14 14 53 12 15 13 13 37 11 14 12
2. Materials and methods 2.1. Plant materials To analyse the polymorphism of the isolated cpSSR loci, a total of 55 individuals of D. officinale were collected from 4 natural populations (12–15 individuals per population). Additionally, 51 individuals belonging to 17 different Dendrobium species (3 individuals per species) were used to check the transferability of polymorphic cpSSR markers. Moreover, 37 individuals of D. moniliforme (three populations, 11–14 individuals per population) and 53 individuals of D. loddigesii (four populations, 12–15 individuals per population) were used to test the polymorphism of the cpSSR primers that exhibited polymorphism in D. officinale across D. moniliforme and D. loddigesii. All materials were placed in zip-lock plastic bags with silica gel and stored at −80 ◦ C. Details on sample collection are given in Tables 1 and 5.
Total genomic DNA was extracted from 100 mg silica gel exsiccated leaves from D. officinale using a modified cetyltrimethyl ammonium bromide (CTAB) method (Lian et al., 2003). CpSSR regions were isolated from D. officinale by sequencing 12 noncoding regions of chloroplast DNA (cpDNA). Briefly, cpDNA fragments were amplified by PCR using chloroplast universal primer pairs described in Table 2. PCR reactions were performed in a total volume of 50 l containing: 25 ng of genomic DNA, 1× Buffer, 1.5 mM MgCl2 , 150 M dNTP (TaKaRa), 0.4 M of each primer pair and 0.3 U TaqDNA polymerase (TaKaRa Inc., Dalian, China). All amplifications were carried out on a Mastercycler Pro thermocycler (Eppendorf) programmed as follows: 94 ◦ C for 3 min, followed by 30 cycles of 94 ◦ C for 1 min, annealing temperature (Ta , described in Table 2) for 1 min, 72 ◦ C for 2 min and a final elongation step at 72 ◦ C for 10 min. The amplified fragments were purified using the QIAquick gel extraction kit (QIAGEN) and sequenced. Forward and reverse sequences were edited using SeqMan 5.01 (Lasergene 7.0, DNASTAR Inc.) and multiple sequences were aligned using the ClustalW ver 1.74 (Thompson et al., 1994). Each of the 12 sequences was aligned to corresponding chloroplast noncoding regions sequences of other species obtained from GenBank using NCBI BLAST. Additionally, the partial sequence of trnL gene and trnL-trnF intergenic spacer from D. officinale was obtained from GenBank (Accession No. EF397937). Chung and Staub (2003) defined a microsatellite as a repeat of n ≥ 7. The microsatellite repeats were screened from all of the thirteen sequences using this classification. Specific primers for D. officinale were designed based on the sequences flanking each of the cpSSR loci using Primer 3 v.0.4.0 (http://frodo.wi.mit.edu/) (Table 3). To analyse the polymorphism of the newly developed cpSSR primers, total genomic DNA was extracted from four populations of D. officinale using a modified CTAB method as mentioned above (Lian et al., 2003). All PCR were carried out in a total volume of 10 l
Table 2 The details of chloroplast universal primers used to search for microsatellite regions in D. officinale. Primer pairs (referencea )
Primer sequences (5 –3 )
Ta (◦ C)
Size (bp)
Repeat motifs
Accession no.
trnD-trnT (1)
F:ACCAATTGAACTACAATCCC R:CTACCACTGAGTTAAAAGGG F:GAGAGAGAGGGATTCGAACC R:CATAACCTTGAGGTCACGGG F:CGGGGGACTGCAAATCCAT R:TACCATTAAAGCAGCCCAAG F:CAGAGGTCTTCTAAACCTTTGGT R:CCTTTTGAAAGAAGCTATTCAGG F:CATTACAAATGCGATGCTCT R:TCTACCGATTTCGCCATATC F:TTAAAAGCCGAGTACTCTACC R:AAAGTGGGTTTTTATGATCC F:CCGACTAGTTCCGGGTTCGA R:ACGGGAATTGAACCCGCGCA F:GGAGTTCATTTTGGTCATGG R:GAGTTGGAAATGAGAGATATT F:GCTTTTATGGAAGCTTTAACAAT R:ACTCGCACACACTCCCTTTCC
56
1224
T9
HM768327
55
1081
(A11 ) (A8 )
HM768328
54
941
(T10 . . .T11 ) (A13 )
HM768329
55
286
A12
HM768330
56
731
A10
HM768331
56
719
(A8 ) (T10 )
HM768332
55
490
T9
HM768333
55
397
A12
HM768334
56
366
A8
HM768335
56
1278 1504
(T8 ) (T13 ) (T9 ) Nob
EF397937 HM768336
54
950
Nob
HM768337
56
1204
Nob
HM768338
trnS-trnfM (1) trnC-petN (7) trnR-atpA (7) trnT-trnL (2,3) rps16-trnK (4) trnH-trnK (1) rpoc2-rps2 (7) atpF-atpH (5) trnL-trnF psbC-trnS (1) rbcL-accD (7) accD-psal (6)
F:GGTTCGAATCCCTCTCTCTC R:GGTCGTGACCAAGAAACCAC F:GCTAGCCGCTGCTTGTGAA R:AGACAACATTGAATTGAACCA F:GGAAGTTTGAGCTTTATGCAAATGG R:AGAAGCCATTGCAATTGCCGGAAA
a 1, Demesure et al. (1995); 2, Cipriani et al. (1995); 3, Taberlet et al. (1991); 4, Shaw et al. (2007); 5, Ning et al. (2008); 6, Davis et al. (2007); 7, primers that were designed based on the complete sequence of Oncidium Gower Ramsey chloroplast genome(GQ324949). b SSR region absent.
XWcp09
trnR-atpA F:TGGTATAGGTTCAAATCC R:AGCTATTCAGGAACAGAT 255 A12 62
X Wcp08
rps2-rpoc2 F:TCGTAGATTAATGGTC R:CCATGACCAAAATGAACTCC 178 A12 56
XWcp07
rps16-trnK F:GTGCTCAACCCACAGGAACT R:AATAAGTATGAATAGAAC 186 A8 53
XWcp06
2.3. Application of polymorphic cpSSR markers In addition, the transferability of the cpSSR markers that showed polymorphism in D. officinale were tested across 17 Dendrobium species (3 individuals per species). Further investigation was carried out with D. moniliforme and D. loddigesii due to a complete lack of cpSSR markers for them. We examined the level of polymorphism of the cpSSR markers that exhibited polymorphism in D. officinale across D. moniliforme and D. loddigesii. The method was the same as mentioned above. 3. Result
ES, expected band size; Ta , annealing temperature; F, forward primer; R, reverse primer.
XWcp05 XWcp04
trnL-F F:GTGGTAACTTCCAAATTC R:GCTACTAACGTAACGTAG 169 T8 60 trnC-petN F:TGTTGATCGAACTTGACG R:GAGCCACACTCAGAACC 149 A13 65
XWcp03 XWcp02
trnD-trnT F:CTACCACTGAGTTAAAAGG R:GAATCTTGTTCTGATGGA 225 T9 60 Region Primer Sequences (5 –3 ) ES (bp) Repeat motifs Ta (◦ C)
trnS-trnfM F:CTACGAATAGAACATATG R:GACATGAATGAATTGATT 118 A11 54
XWcp01 Locus
Table 3 Information of specific chloroplast microsatellite markers developed from D. officinale.
487
containing: 10 ng of genomic DNA, 1× Buffer, 2 mM MgCl2 , 0.2 mM dNTP (TaKaRa), 0.2 M of each primer pair and 0.5 U TaqDNA polymerase (TaKaRa Inc., Dalian, China). All amplifications were performed on a Mastercycler Pro thermocycler (Eppendorf). The PCR cycling conditions were 94 ◦ C for 3 min, followed by 30 cycles of 94 ◦ C for 1 min, annealing temperature (Ta , described in Table 3) for 1 min, 72 ◦ C for 2 min and a final elongation step at 72 ◦ C for 10 min. The PCR products were separated on an 8% denaturing polyacrylamide gel, electrophoresed at 180 V for 2.5 h and visualized by silver-staining, using 500 bp ladder molecular size standard (TaKaRa).
trnL-F F:CATGTCAATACCGACAAC R:CATATATGTTCATATCGT 298 T13 55
trnL-F F:TCATTCATAGTCCATAT R:GCATCATCCTAGCAGAGT 143 T9 54
W. Xu et al. / Scientia Horticulturae 128 (2011) 485–489
Ten regions out of the 13 noncoding cpDNA regions contained cpSSR loci (Table 2). The trnS-trnfM, trnC-petN and rps16-trnK regions contained two cpSSR loci each. The trnL-trnF regions contained three cpSSR loci. In total, 15 primer pairs were designed for 10 loci from D. officinale. For all these primer pairs, 9 pairs showed polymorphism (Table 3). Allele numbers varied from two to four per polymorphic locus, and genetic diversity (Nei, 1978) ranged between 0.133 and 0.703 (Table 4). According to ARLEQUIN 3.01 (Excoffier et al., 2005), five, six, four and six of cpSSR haplotypes were identified in Tiantai population (TT), Yongjia population (YJ), Guangnan population (GN) and Xilin population (XL), separately. In total, 17 haplotypes were defined in four populations of D. officinale. The transferability of the 9 polymorphic cpSSR primers was examined using 51 individuals belonging to 17 different Dendrobium species (3 individuals per species) under the same amplification conditions described as above. Three primer pairs (XWcp03, XWcp04 and XWcp05) successfully amplified across all species tested, while the remaining 6 pairs of primer successfully produced amplification products across most species (Table 5). Polymorphism of the 9 cpSSR primer pairs was tested across D. moniliforme and D. loddigesii. In D. moniliforme, all of the 9 primer pairs amplified PCR products and were polymorphic (Table 3). Allele numbers per polymorphic locus and the gene diversity (Nei, 1978) ranged from 2 to 4 and 0.167 to 0.582, respectively (Table 4). Based on these 9 cpSSR loci, four, five and six of cpSSR haplotypes were identified in Zhejiang population (ZJ), Jiangxi population (JX) and Fujian population (FJ), using ARLEQUIN 3.01 (Excoffier et al., 2005). In total, 15 haplotypes were detected in three populations of D. moniliforme. In D. loddigesii, all of the 9 primer pairs amplified PCR products, of which 7 loci were polymorphic (Tables 3 and 4). Allele numbers per polymorphic locus and the gene diversity (Nei, 1978) ranged from 2 to 3 and 0.167 to 0.718, separately (Table 4). Combining these 7 cpSSR loci, four, four, two and five of cpSSR haplotypes were identified in Maolan population (ML), Hainan population (HN), Honghe population (HH) and Hechi population (HC), using ARLEQUIN 3.01 (Excoffier et al., 2005). In total, 11 haplotypes were detected in four populations of D. loddigesii.
488
W. Xu et al. / Scientia Horticulturae 128 (2011) 485–489
Table 4 Levels of diversity of specific chloroplast microsatellite markers developed from D. officinale. Locus
XWcp01
XWcp02
XWcp03
XWcp04
XWcp05
XWcp06
XWcp07
X Wcp08
XWcp09
Species
A
HE
A
HE
A
HE
A
HE
A
HE
A
HE
A
HE
A
HE
A
HE
1 3 2 2 1 1 1 1 2 1 2
0.000 0.257 0.143 0.143 0.000 0.000 0.000 0.000 0.467 0.000 0.545
2 2 1 2 1 1 1 1 1 1 2
0.409 0.476 0.000 0.440 0.000 0.000 0.000 0.000 0.000 0.000 0.167
1 2 1 2 1 2 1 2 1 1 2
0.000 0.133 0.000 0.363 0.000 0.476 0.000 0.462 0.000 0.000 0.409
3 2 2 2 2 1 1 2 1 3 1
0.439 0.533 0.527 0.264 0.167 0.000 0.000 0.513 0.000 0.582 0.000
1 2 1 2 2 1 1 2 1 2 3
0.000 0.343 0.000 0.440 0.167 0.000 0.000 0.462 0.000 0.495 0.530
2 2 1 3 1 1 1 3 1 1 2
0.167 0.343 0.000 0.703 0.000 0.000 0.000 0.718 0.000 0.000 0.167
1 1 1 2 2 1 1 2 2 3 1
0.000 0.000 0.000 0.264 0.303 0.000 0.000 0.513 0.356 0.648 0.000
1 2 1 2 2 2 2 1 2 1 3
0.000 0.133 0.000 0.363 0.409 0.514 0.513 0.000 0.356 0.000 0.439
2 2 2 3 1 2 1 2 2 3 1
0.303 0.419 0.495 0.582 0.000 0.419 0.000 0.462 0.533 0.275 0.000
(population code) D. officinale (TT) D. officinale (YJ) D. officinale (GN) D. officinale (XL) D. loddigesii (ML) D. loddigesii (HN) D. loddigesii (HH) D. loddigesii (HC) D. moniliforme (ZJ) D. moniliforme (JX) D. moniliforme (FJ)
A, number of alleles; HE , expected heterozygosity. Table 5 Cross-amplification information in other Dendrobium species for 9 polymorphic cpSSR markers developed in D. officinale. Species (locality)
XW cp01
XW cp02
XW cp03
XW cp04
XW cp05
XW cp06
XW cp07
XW cp08
XW cp09
D. loddigesii (Yunnan) D. moniliforme (Yunnan) D. crepidatum (Yunnan) D. hancockii (Yunnan) D. falconeri (Yunnan) D. findlayanum (Yunnan) D. aphyllum (Guizhou) D. brymerianum (Yunnan) D. gratiosissimum (Yunnan) D. primulinum (Yunnan) D. nobile (Yunnan) D. fimbriatum (Guangxi) D. devonianum (Yunnan) D. williamsonii (Hainan) D. dixanthum (Yunnan) D. salaccense (Hainan) D. wardianum (Yunnan)
+ + + + − + + + + + + + + + + + +
+ + + + + + − − + − − + − + + + +
+ + + + + + + + + + + + + + + + +
+ + + + + + + + + + + + + + + + +
+ + + + + + + + + + + + + + + + +
+ + + + − − − + + + + + + + + + +
+ + + + + + + + + + + + + − + + +
+ + + + + + + + + + − + + + − + −
+ + + + + − − − − + + − + + − + +
+, PCR amplification; −, no PCR amplification.
4. Discussion Changes in the length of SSR sequences in coding regions would change the structure of encoded proteins and thus might be strongly suppressed (Li et al., 2010). That is why the cpSSR loci located in coding regions of the chloroplast genome were monomorphic in several previous studies (Bryan et al., 1999; Ishii and McCouch, 2000; Jakobsson et al., 2007). Therefore, we selected 13 noncoding chloroplast DNA regions to develop cpSSR markers for D. officinale and screened polymorphic cpSSR loci. The polymorphism of the cpSSR loci arises from mononucleotide repeat variation or insertion–deletion (indel) variation. To ascertain the reason of the observed polymorphism, we sequenced a large proportion of the different length variants for each locus. In present study, the results showed that polymorphism arose not only from the number of the mononucleotide repeats, but also from insertion–deletion (indel) variation. Nine polymorphic cpSSR markers developed from D. officinale were transferable to all or most of 17 Dendrobium species due to the flanking regions of cpSSR loci are conserved. However, the conservatism of the flanking regions of cpSSR loci is relative. At some loci (XWcp01, XWcp02, XWcp06, XWcp07, XWcp08, XWcp09), some species had no PCR amplification which could result from base substitution mutation. 5. Conclusion We developed the first set of cpSSR loci from D. officinale. The results revealed that these loci provided polymorphic cpSSR mark-
ers within populations and among populations within species. They are useful in studying genetic diversity, population genetic structure, evolution and presenting effective conservation strategies of D. officinale. Furthermore, cross-amplification experiment showed that all of the polymorphic cpSSR loci developed from D. officinale were transferable to all or most of 17 Dendrobium species under the same amplification conditions (Table 5), suggesting that these cpSSR loci may be commonly applicable to other Dendrobium species. Further investigation will be carried out with more natural populations and related species. Acknowledgements The work was supported by the National Natural Science Foundation of China (No. 30870234) and Natural Science Foundation of Jiangsu Province (No. BK2008431). References Bryan, G.J., McNicoll, J., Ramsay, G., Meyer, R.C., De Jong, W.S., 1999. Polymorphic simple sequence repeat markers in chloroplast genomes of Solanaceous plants. Theor. Appl. Genet. 99, 859–867. Chen, C., Zhou, P., Choi, Y.A., Huang, S., Gmitter, F.G., 2006. Mining and characterizing microsatellites from citrus ESTs. Theor. Appl. Genet. 112, 1248–1257. Chung, S., Staub, J.E., 2003. The development and evaluation of consensus chloroplast primer pairs that possess highly variable sequence regions in a diverse array of plant taxa. Theor. Appl. Genet. 107, 757–767. Cipriani, C., Testolin, R., Morgante, M., 1995. Paternal inheritance of plastids in interspecific hybrids of the genus Actinidia revealed by PCR-amplification of chloroplast DNA fragments. Mol. Gen. Genet. 247, 693–697.
W. Xu et al. / Scientia Horticulturae 128 (2011) 485–489 Davis, A.P., Chestier, M., Maurin, O., Fay, M.F., 2007. Searching for the relatives of coffea (Rubiaceae Ixoroideae): the circumscription and phylogeny of coffeeae based on plastid sequence data and morphology. Am. J. Bot. 94, 313–329. Deguilloux, M.F., Pemonge, M.H., Petit, R.J., 2004. Use of chloroplast microsatellites to differentiate oak populations. Ann. For. Sci. 61, 825–830. Demesure, B., Sodzi, N., Petie, R.J., 1995. A set of universal primers for amplification of polymorphic non-coding regions of mitochondrial and chloroplast DNA in plants. Mol. Ecol. 4, 129–131. Ding, G., Zhang, D.Z., Ding, X.Y., Zhou, Q., Zhang, W.C., Li, X.X., 2008. Genetic variation and conservation of the endangered Chinese endemic herb Dendrobium officinale based on SRAP analysis. Plant Syst. Evol. 276, 149–156. Excoffier, L., Laval, L.G., Schneider, S., 2005. ARLEQUIN version 3.0: an integrated software package for population genetics data analysis. Evol. Bioinform. Online 1, 47–50. Gu, S., Ding, X.Y., Wang, Y., Zhou, Q., Ding, G., Li, X.X., Qian, L., 2007. Isolation and characterization of microsatellite markers in Dendrobium officinale, an endangered herb endemic to China. Mol. Ecol. Notes 7, 1166–1168. Hu, J.B., Zhou, X.Y., Li, J.W., 2009. Development of novel chloroplast microsatellite markers for Cucumis from sequence database. Biol. Plant. 53, 793–796. Ishii, T., McCouch, S.R., 2000. Microsatellites and microsynteny in the chloroplast genomes of Oryza and eight other Gramineae species. Theor. Appl. Genet. 100, 1257–1266. Jakobsson, M., Sa¨ll, T., Lind-Halldeˇın, C., Halldeˇın, C., 2007. Evolution of chloroplast mononucleotide microsatellites in Arabidopsis thaliana. Theor. Appl. Genet. 114, 223–235. Jin, X.H., Chen, S.H., Luo, Y.B., 2009. Taxonomic revision of Dendrobium moniliforme complex (Orchidaceae). Sci. Hortic. 120, 143–145. Li, X.X., Ding, X.Y., Chu, B.H., Zhou, Q., Ding, G., Gu, S., 2008. Genetic diversity analysis and conservation of the endangered Chinese endemic herb Dendrobium officinale Kimura et Migo (Orchidaceae) based on AFLP. Genetica. 133, 159–166.
489
Li, R.Y., Zhang, H., Zhou, X.C., Guan, Y.N., Yao, F.X., Song, G.A., Wang, J.C., Zhang, C.Q., 2010. Genetic diversity in Chinese sorghum landraces revealed by chloroplast simple sequence repeats. Genet. Resour. Crop Evol. 57, 1–15. Lian, C.L., Oishi, R., Miyashita, N., Nara, K., Nakaya, H., Wu, B., Zhou, Z., Hogetsu, T., 2003. Genetic structure and reproduction dynamics of Salix reinii during primary succession on Mount Fuji, as revealed by nuclear and chloroplast microsatellite analysis. Mol. Ecol. 12, 609–618. Nei, M., 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89, 583–590. Ning, S.P., Yan, H.F., Hao, G., Ge, X.J., 2008. Current advances of DNA barcoding study in plants. Biodivers. Sci. 16, 417–425. Powell, W., Morgante, M., McDevitt, R., Vendramin, G., Rafalski, J., 1995. Polymorphic simple-sequence repeat regions in chloroplast genomes: applications to the population genetics of pines. Proc. Natl. Acad. Sci. U.S.A. 92, 7759–7763. Shaw, J., Lickey, E.B., Schilling, E.E., Small, R.L., 2007. Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: the tortoise and the hare III. Am. J. Bot. 94, 275–288. Taberlet, P., Gielly, L., Pautou, G., Bouvet, J., 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant. Mol. Biol. 17, 1105–1109. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTALW: improving the sensitivity of progressive multiple alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl. Acid Res. 22, 4673–4680. Vendramin, G.G., Ziegenhagen, B., 1997. Characterization and inheritance of polymorphic plastid microsatellites in Abies. Genome 40, 857–864. Vendramin, G.G., Lelli, L., Rossi, P., Morgante, M., 1996. A set of primers for the amplification of 20 chloroplast microsatellites in Pinaceae. Mol. Ecol. 5, 595–598. Wood, H.P., 2006. The Dendrobiums. A.R.G. Gantner Verlag, Ruggell. Xie, M.L., Hou, B.W., Han, L., Ma, Y.H., Ding, X.Y., 2010. Development of microsatellites of Dendrobium officinale and its application in purity identification of germplasm. Acta Pharm. Sin. 45, 667–672.
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
Development of novel chloroplast microsatellite markers for Dendrobium officinale, and cross-amplification in other Dendrobium species (Orchidaceae) Wen Xu, Feng Zhang, Beibei Lu, Xiaoyan Cai, Beiwei Hou, Zhenyu Feng, Xiaoyu Ding ∗ Jiangsu Provincial Key Laboratory for Biodiversity and Biotechnology, College of Life Sciences, Nanjing Normal University, No. 1, Wenyuan Road, Nanjing 210046, China
a r t i c l e
i n f o
Article history: Received 2 December 2010 Received in revised form 21 February 2011 Accepted 22 February 2011 Keywords: Dendrobium officinale Chloroplast microsatellites Development Polymorphism Transferability
a b s t r a c t Nine pairs of polymorphic chloroplast microsatellite primers were developed for Dendrobium officinale Kimura et Migo, an endangered herb. Levels of polymorphism were tested across a total of 55 individuals from four natural populations (12–15 individuals per population). Allele numbers varied from two to four per locus, while the number of haplotypes ranged from four to six per population. Transferability of the nine polymorphic chloroplast microsatellite primers was checked on an additional set of 51 Dendrobium individuals (belonging to 17 different species). Three markers could be transferable to all the species tested, while the remaining six markers successfully cross-amplified in most species tested. Moreover, polymorphism of the nine chloroplast microsatellite primers was tested across Dendrobium moniliforme (L.) Sw. and Dendrobium loddigesii Rolfe. All of them were polymorphic in D. moniliforme, while seven of which were polymorphic in D. loddigesii. These polymorphic chloroplast microsatellite primers developed for D. officinale will be a useful tool for the study of genetic diversity, population genetic structure, evolution of D. officinale and establishment of effective conservation strategies. © 2011 Elsevier B.V. All rights reserved.
1. Introduction The genus Dendrobium is one of the largest genera in Orchidaceae (Wood, 2006). It has an important position in ornamental orchid cut flower industry (Jin et al., 2009). Some Dendrobium species are also used as traditional Chinese tonic medicine. As a rare and endangered perennial herb endemic to China, Dendrobium officinale Kimura et Migo (Orchidaceae) is famous for its unparalleled medicinal value and ranked “the first of the Chinese nine kinds of supernatural medicinal herbs”. The stems of D. officinale are commonly used as medicine named “Tiepi Fengdou”. Their main function is to nourish yin, clear away heat-evil, benefit the stomach, moisten the lung, relieve a cough, promote the production of body fluid, resist cancer and prolong life (Ding et al., 2008). Unfortunately, the natural resource of D. officinale has been in severe danger of extinction because of habitat deterioration and human exploitation enticed by high profit using the stems as good traditional Chinese medicine in recent years. Therefore, it is necessary to investigate the genetic diversity and the population genetic structure of D. officinale natural resource using molecular method with
∗ Corresponding author. Present address: College of Life Sciences, Nanjing Normal University, No. 1, Wenyuan Road, Nanjing 210046, China. Tel.: +86 13305159218; fax: +86 02585891526. E-mail address: [email protected] (X. Ding). 0304-4238/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.scienta.2011.02.016
the purpose of presenting effective conservation strategies and serving evolutionary study. At present, several studies have examined ecological and evolution aspects of D. officinale based on AFLP and SRAP analysis (Li et al., 2008; Ding et al., 2008). Additional, microsatellites or simple sequence repeats (SSR), a group of tandem repeated sequences constituted from mono-, di-, tri-, tetra-, penta-, or hexa-nucleotide units (Chen et al., 2006) and widely distributed throughout nuclear and mitochondrial genome as well as chloroplast genome in eukaryotes (Deguilloux et al., 2004; Hu et al., 2009), were also applied in the research of this species (Xie et al., 2010). Although specific SSR markers for D. officinale have been developed (Xie et al., 2010; Gu et al., 2007), there is a complete lack of cpSSR markers for D. officinale and the other closely related species. Compared to nuclear microsatellites, chloroplast simple sequence repeats (cpSSR) are principally constituted from mononucleotide A/T repeats (Bryan et al., 1999). In particular, cpSSR were developed in the 1990s (Powell et al., 1995; Vendramin et al., 1996; Vendramin and Ziegenhagen, 1997). To date, cpSSR markers have been developed for a variety of species and demonstrated utility in studying evolution, differentiation, genetic diversity and genetic structure of plant population. In this study, we developed a set of polymorphic cpSSR markers for D. officinale and tested their transferability on the other Dendrobium species. Furthermore, we also examined the level of polymorphism of these markers across Dendrobium moniliforme (L.) Sw. and Dendrobium loddigesii Rolfe.
486
W. Xu et al. / Scientia Horticulturae 128 (2011) 485–489
Table 1 Location and sampling size of each population of three species. Population code Dendrobium officinale TT YJ GN XL Dendrobium loddigesii ML HN HH HC Dendrobium moniliforme ZJ JX FJ
Location Tiantai, Zhejiang Province Yongjia, Zhejiang Province Guangnan, Yunnan Province Xilin, Guangxi Province Maolan, Guizhou Province Hainan Province Honghe, Yunnan Province Hechi, Guangxi Province Zhejiang Province Jiangxi Province Fujiang Province
2.2. Development of cpSSR markers and examination of polymorphism Sample size 55 12 15 14 14 53 12 15 13 13 37 11 14 12
2. Materials and methods 2.1. Plant materials To analyse the polymorphism of the isolated cpSSR loci, a total of 55 individuals of D. officinale were collected from 4 natural populations (12–15 individuals per population). Additionally, 51 individuals belonging to 17 different Dendrobium species (3 individuals per species) were used to check the transferability of polymorphic cpSSR markers. Moreover, 37 individuals of D. moniliforme (three populations, 11–14 individuals per population) and 53 individuals of D. loddigesii (four populations, 12–15 individuals per population) were used to test the polymorphism of the cpSSR primers that exhibited polymorphism in D. officinale across D. moniliforme and D. loddigesii. All materials were placed in zip-lock plastic bags with silica gel and stored at −80 ◦ C. Details on sample collection are given in Tables 1 and 5.
Total genomic DNA was extracted from 100 mg silica gel exsiccated leaves from D. officinale using a modified cetyltrimethyl ammonium bromide (CTAB) method (Lian et al., 2003). CpSSR regions were isolated from D. officinale by sequencing 12 noncoding regions of chloroplast DNA (cpDNA). Briefly, cpDNA fragments were amplified by PCR using chloroplast universal primer pairs described in Table 2. PCR reactions were performed in a total volume of 50 l containing: 25 ng of genomic DNA, 1× Buffer, 1.5 mM MgCl2 , 150 M dNTP (TaKaRa), 0.4 M of each primer pair and 0.3 U TaqDNA polymerase (TaKaRa Inc., Dalian, China). All amplifications were carried out on a Mastercycler Pro thermocycler (Eppendorf) programmed as follows: 94 ◦ C for 3 min, followed by 30 cycles of 94 ◦ C for 1 min, annealing temperature (Ta , described in Table 2) for 1 min, 72 ◦ C for 2 min and a final elongation step at 72 ◦ C for 10 min. The amplified fragments were purified using the QIAquick gel extraction kit (QIAGEN) and sequenced. Forward and reverse sequences were edited using SeqMan 5.01 (Lasergene 7.0, DNASTAR Inc.) and multiple sequences were aligned using the ClustalW ver 1.74 (Thompson et al., 1994). Each of the 12 sequences was aligned to corresponding chloroplast noncoding regions sequences of other species obtained from GenBank using NCBI BLAST. Additionally, the partial sequence of trnL gene and trnL-trnF intergenic spacer from D. officinale was obtained from GenBank (Accession No. EF397937). Chung and Staub (2003) defined a microsatellite as a repeat of n ≥ 7. The microsatellite repeats were screened from all of the thirteen sequences using this classification. Specific primers for D. officinale were designed based on the sequences flanking each of the cpSSR loci using Primer 3 v.0.4.0 (http://frodo.wi.mit.edu/) (Table 3). To analyse the polymorphism of the newly developed cpSSR primers, total genomic DNA was extracted from four populations of D. officinale using a modified CTAB method as mentioned above (Lian et al., 2003). All PCR were carried out in a total volume of 10 l
Table 2 The details of chloroplast universal primers used to search for microsatellite regions in D. officinale. Primer pairs (referencea )
Primer sequences (5 –3 )
Ta (◦ C)
Size (bp)
Repeat motifs
Accession no.
trnD-trnT (1)
F:ACCAATTGAACTACAATCCC R:CTACCACTGAGTTAAAAGGG F:GAGAGAGAGGGATTCGAACC R:CATAACCTTGAGGTCACGGG F:CGGGGGACTGCAAATCCAT R:TACCATTAAAGCAGCCCAAG F:CAGAGGTCTTCTAAACCTTTGGT R:CCTTTTGAAAGAAGCTATTCAGG F:CATTACAAATGCGATGCTCT R:TCTACCGATTTCGCCATATC F:TTAAAAGCCGAGTACTCTACC R:AAAGTGGGTTTTTATGATCC F:CCGACTAGTTCCGGGTTCGA R:ACGGGAATTGAACCCGCGCA F:GGAGTTCATTTTGGTCATGG R:GAGTTGGAAATGAGAGATATT F:GCTTTTATGGAAGCTTTAACAAT R:ACTCGCACACACTCCCTTTCC
56
1224
T9
HM768327
55
1081
(A11 ) (A8 )
HM768328
54
941
(T10 . . .T11 ) (A13 )
HM768329
55
286
A12
HM768330
56
731
A10
HM768331
56
719
(A8 ) (T10 )
HM768332
55
490
T9
HM768333
55
397
A12
HM768334
56
366
A8
HM768335
56
1278 1504
(T8 ) (T13 ) (T9 ) Nob
EF397937 HM768336
54
950
Nob
HM768337
56
1204
Nob
HM768338
trnS-trnfM (1) trnC-petN (7) trnR-atpA (7) trnT-trnL (2,3) rps16-trnK (4) trnH-trnK (1) rpoc2-rps2 (7) atpF-atpH (5) trnL-trnF psbC-trnS (1) rbcL-accD (7) accD-psal (6)
F:GGTTCGAATCCCTCTCTCTC R:GGTCGTGACCAAGAAACCAC F:GCTAGCCGCTGCTTGTGAA R:AGACAACATTGAATTGAACCA F:GGAAGTTTGAGCTTTATGCAAATGG R:AGAAGCCATTGCAATTGCCGGAAA
a 1, Demesure et al. (1995); 2, Cipriani et al. (1995); 3, Taberlet et al. (1991); 4, Shaw et al. (2007); 5, Ning et al. (2008); 6, Davis et al. (2007); 7, primers that were designed based on the complete sequence of Oncidium Gower Ramsey chloroplast genome(GQ324949). b SSR region absent.
XWcp09
trnR-atpA F:TGGTATAGGTTCAAATCC R:AGCTATTCAGGAACAGAT 255 A12 62
X Wcp08
rps2-rpoc2 F:TCGTAGATTAATGGTC R:CCATGACCAAAATGAACTCC 178 A12 56
XWcp07
rps16-trnK F:GTGCTCAACCCACAGGAACT R:AATAAGTATGAATAGAAC 186 A8 53
XWcp06
2.3. Application of polymorphic cpSSR markers In addition, the transferability of the cpSSR markers that showed polymorphism in D. officinale were tested across 17 Dendrobium species (3 individuals per species). Further investigation was carried out with D. moniliforme and D. loddigesii due to a complete lack of cpSSR markers for them. We examined the level of polymorphism of the cpSSR markers that exhibited polymorphism in D. officinale across D. moniliforme and D. loddigesii. The method was the same as mentioned above. 3. Result
ES, expected band size; Ta , annealing temperature; F, forward primer; R, reverse primer.
XWcp05 XWcp04
trnL-F F:GTGGTAACTTCCAAATTC R:GCTACTAACGTAACGTAG 169 T8 60 trnC-petN F:TGTTGATCGAACTTGACG R:GAGCCACACTCAGAACC 149 A13 65
XWcp03 XWcp02
trnD-trnT F:CTACCACTGAGTTAAAAGG R:GAATCTTGTTCTGATGGA 225 T9 60 Region Primer Sequences (5 –3 ) ES (bp) Repeat motifs Ta (◦ C)
trnS-trnfM F:CTACGAATAGAACATATG R:GACATGAATGAATTGATT 118 A11 54
XWcp01 Locus
Table 3 Information of specific chloroplast microsatellite markers developed from D. officinale.
487
containing: 10 ng of genomic DNA, 1× Buffer, 2 mM MgCl2 , 0.2 mM dNTP (TaKaRa), 0.2 M of each primer pair and 0.5 U TaqDNA polymerase (TaKaRa Inc., Dalian, China). All amplifications were performed on a Mastercycler Pro thermocycler (Eppendorf). The PCR cycling conditions were 94 ◦ C for 3 min, followed by 30 cycles of 94 ◦ C for 1 min, annealing temperature (Ta , described in Table 3) for 1 min, 72 ◦ C for 2 min and a final elongation step at 72 ◦ C for 10 min. The PCR products were separated on an 8% denaturing polyacrylamide gel, electrophoresed at 180 V for 2.5 h and visualized by silver-staining, using 500 bp ladder molecular size standard (TaKaRa).
trnL-F F:CATGTCAATACCGACAAC R:CATATATGTTCATATCGT 298 T13 55
trnL-F F:TCATTCATAGTCCATAT R:GCATCATCCTAGCAGAGT 143 T9 54
W. Xu et al. / Scientia Horticulturae 128 (2011) 485–489
Ten regions out of the 13 noncoding cpDNA regions contained cpSSR loci (Table 2). The trnS-trnfM, trnC-petN and rps16-trnK regions contained two cpSSR loci each. The trnL-trnF regions contained three cpSSR loci. In total, 15 primer pairs were designed for 10 loci from D. officinale. For all these primer pairs, 9 pairs showed polymorphism (Table 3). Allele numbers varied from two to four per polymorphic locus, and genetic diversity (Nei, 1978) ranged between 0.133 and 0.703 (Table 4). According to ARLEQUIN 3.01 (Excoffier et al., 2005), five, six, four and six of cpSSR haplotypes were identified in Tiantai population (TT), Yongjia population (YJ), Guangnan population (GN) and Xilin population (XL), separately. In total, 17 haplotypes were defined in four populations of D. officinale. The transferability of the 9 polymorphic cpSSR primers was examined using 51 individuals belonging to 17 different Dendrobium species (3 individuals per species) under the same amplification conditions described as above. Three primer pairs (XWcp03, XWcp04 and XWcp05) successfully amplified across all species tested, while the remaining 6 pairs of primer successfully produced amplification products across most species (Table 5). Polymorphism of the 9 cpSSR primer pairs was tested across D. moniliforme and D. loddigesii. In D. moniliforme, all of the 9 primer pairs amplified PCR products and were polymorphic (Table 3). Allele numbers per polymorphic locus and the gene diversity (Nei, 1978) ranged from 2 to 4 and 0.167 to 0.582, respectively (Table 4). Based on these 9 cpSSR loci, four, five and six of cpSSR haplotypes were identified in Zhejiang population (ZJ), Jiangxi population (JX) and Fujian population (FJ), using ARLEQUIN 3.01 (Excoffier et al., 2005). In total, 15 haplotypes were detected in three populations of D. moniliforme. In D. loddigesii, all of the 9 primer pairs amplified PCR products, of which 7 loci were polymorphic (Tables 3 and 4). Allele numbers per polymorphic locus and the gene diversity (Nei, 1978) ranged from 2 to 3 and 0.167 to 0.718, separately (Table 4). Combining these 7 cpSSR loci, four, four, two and five of cpSSR haplotypes were identified in Maolan population (ML), Hainan population (HN), Honghe population (HH) and Hechi population (HC), using ARLEQUIN 3.01 (Excoffier et al., 2005). In total, 11 haplotypes were detected in four populations of D. loddigesii.
488
W. Xu et al. / Scientia Horticulturae 128 (2011) 485–489
Table 4 Levels of diversity of specific chloroplast microsatellite markers developed from D. officinale. Locus
XWcp01
XWcp02
XWcp03
XWcp04
XWcp05
XWcp06
XWcp07
X Wcp08
XWcp09
Species
A
HE
A
HE
A
HE
A
HE
A
HE
A
HE
A
HE
A
HE
A
HE
1 3 2 2 1 1 1 1 2 1 2
0.000 0.257 0.143 0.143 0.000 0.000 0.000 0.000 0.467 0.000 0.545
2 2 1 2 1 1 1 1 1 1 2
0.409 0.476 0.000 0.440 0.000 0.000 0.000 0.000 0.000 0.000 0.167
1 2 1 2 1 2 1 2 1 1 2
0.000 0.133 0.000 0.363 0.000 0.476 0.000 0.462 0.000 0.000 0.409
3 2 2 2 2 1 1 2 1 3 1
0.439 0.533 0.527 0.264 0.167 0.000 0.000 0.513 0.000 0.582 0.000
1 2 1 2 2 1 1 2 1 2 3
0.000 0.343 0.000 0.440 0.167 0.000 0.000 0.462 0.000 0.495 0.530
2 2 1 3 1 1 1 3 1 1 2
0.167 0.343 0.000 0.703 0.000 0.000 0.000 0.718 0.000 0.000 0.167
1 1 1 2 2 1 1 2 2 3 1
0.000 0.000 0.000 0.264 0.303 0.000 0.000 0.513 0.356 0.648 0.000
1 2 1 2 2 2 2 1 2 1 3
0.000 0.133 0.000 0.363 0.409 0.514 0.513 0.000 0.356 0.000 0.439
2 2 2 3 1 2 1 2 2 3 1
0.303 0.419 0.495 0.582 0.000 0.419 0.000 0.462 0.533 0.275 0.000
(population code) D. officinale (TT) D. officinale (YJ) D. officinale (GN) D. officinale (XL) D. loddigesii (ML) D. loddigesii (HN) D. loddigesii (HH) D. loddigesii (HC) D. moniliforme (ZJ) D. moniliforme (JX) D. moniliforme (FJ)
A, number of alleles; HE , expected heterozygosity. Table 5 Cross-amplification information in other Dendrobium species for 9 polymorphic cpSSR markers developed in D. officinale. Species (locality)
XW cp01
XW cp02
XW cp03
XW cp04
XW cp05
XW cp06
XW cp07
XW cp08
XW cp09
D. loddigesii (Yunnan) D. moniliforme (Yunnan) D. crepidatum (Yunnan) D. hancockii (Yunnan) D. falconeri (Yunnan) D. findlayanum (Yunnan) D. aphyllum (Guizhou) D. brymerianum (Yunnan) D. gratiosissimum (Yunnan) D. primulinum (Yunnan) D. nobile (Yunnan) D. fimbriatum (Guangxi) D. devonianum (Yunnan) D. williamsonii (Hainan) D. dixanthum (Yunnan) D. salaccense (Hainan) D. wardianum (Yunnan)
+ + + + − + + + + + + + + + + + +
+ + + + + + − − + − − + − + + + +
+ + + + + + + + + + + + + + + + +
+ + + + + + + + + + + + + + + + +
+ + + + + + + + + + + + + + + + +
+ + + + − − − + + + + + + + + + +
+ + + + + + + + + + + + + − + + +
+ + + + + + + + + + − + + + − + −
+ + + + + − − − − + + − + + − + +
+, PCR amplification; −, no PCR amplification.
4. Discussion Changes in the length of SSR sequences in coding regions would change the structure of encoded proteins and thus might be strongly suppressed (Li et al., 2010). That is why the cpSSR loci located in coding regions of the chloroplast genome were monomorphic in several previous studies (Bryan et al., 1999; Ishii and McCouch, 2000; Jakobsson et al., 2007). Therefore, we selected 13 noncoding chloroplast DNA regions to develop cpSSR markers for D. officinale and screened polymorphic cpSSR loci. The polymorphism of the cpSSR loci arises from mononucleotide repeat variation or insertion–deletion (indel) variation. To ascertain the reason of the observed polymorphism, we sequenced a large proportion of the different length variants for each locus. In present study, the results showed that polymorphism arose not only from the number of the mononucleotide repeats, but also from insertion–deletion (indel) variation. Nine polymorphic cpSSR markers developed from D. officinale were transferable to all or most of 17 Dendrobium species due to the flanking regions of cpSSR loci are conserved. However, the conservatism of the flanking regions of cpSSR loci is relative. At some loci (XWcp01, XWcp02, XWcp06, XWcp07, XWcp08, XWcp09), some species had no PCR amplification which could result from base substitution mutation. 5. Conclusion We developed the first set of cpSSR loci from D. officinale. The results revealed that these loci provided polymorphic cpSSR mark-
ers within populations and among populations within species. They are useful in studying genetic diversity, population genetic structure, evolution and presenting effective conservation strategies of D. officinale. Furthermore, cross-amplification experiment showed that all of the polymorphic cpSSR loci developed from D. officinale were transferable to all or most of 17 Dendrobium species under the same amplification conditions (Table 5), suggesting that these cpSSR loci may be commonly applicable to other Dendrobium species. Further investigation will be carried out with more natural populations and related species. Acknowledgements The work was supported by the National Natural Science Foundation of China (No. 30870234) and Natural Science Foundation of Jiangsu Province (No. BK2008431). References Bryan, G.J., McNicoll, J., Ramsay, G., Meyer, R.C., De Jong, W.S., 1999. Polymorphic simple sequence repeat markers in chloroplast genomes of Solanaceous plants. Theor. Appl. Genet. 99, 859–867. Chen, C., Zhou, P., Choi, Y.A., Huang, S., Gmitter, F.G., 2006. Mining and characterizing microsatellites from citrus ESTs. Theor. Appl. Genet. 112, 1248–1257. Chung, S., Staub, J.E., 2003. The development and evaluation of consensus chloroplast primer pairs that possess highly variable sequence regions in a diverse array of plant taxa. Theor. Appl. Genet. 107, 757–767. Cipriani, C., Testolin, R., Morgante, M., 1995. Paternal inheritance of plastids in interspecific hybrids of the genus Actinidia revealed by PCR-amplification of chloroplast DNA fragments. Mol. Gen. Genet. 247, 693–697.
W. Xu et al. / Scientia Horticulturae 128 (2011) 485–489 Davis, A.P., Chestier, M., Maurin, O., Fay, M.F., 2007. Searching for the relatives of coffea (Rubiaceae Ixoroideae): the circumscription and phylogeny of coffeeae based on plastid sequence data and morphology. Am. J. Bot. 94, 313–329. Deguilloux, M.F., Pemonge, M.H., Petit, R.J., 2004. Use of chloroplast microsatellites to differentiate oak populations. Ann. For. Sci. 61, 825–830. Demesure, B., Sodzi, N., Petie, R.J., 1995. A set of universal primers for amplification of polymorphic non-coding regions of mitochondrial and chloroplast DNA in plants. Mol. Ecol. 4, 129–131. Ding, G., Zhang, D.Z., Ding, X.Y., Zhou, Q., Zhang, W.C., Li, X.X., 2008. Genetic variation and conservation of the endangered Chinese endemic herb Dendrobium officinale based on SRAP analysis. Plant Syst. Evol. 276, 149–156. Excoffier, L., Laval, L.G., Schneider, S., 2005. ARLEQUIN version 3.0: an integrated software package for population genetics data analysis. Evol. Bioinform. Online 1, 47–50. Gu, S., Ding, X.Y., Wang, Y., Zhou, Q., Ding, G., Li, X.X., Qian, L., 2007. Isolation and characterization of microsatellite markers in Dendrobium officinale, an endangered herb endemic to China. Mol. Ecol. Notes 7, 1166–1168. Hu, J.B., Zhou, X.Y., Li, J.W., 2009. Development of novel chloroplast microsatellite markers for Cucumis from sequence database. Biol. Plant. 53, 793–796. Ishii, T., McCouch, S.R., 2000. Microsatellites and microsynteny in the chloroplast genomes of Oryza and eight other Gramineae species. Theor. Appl. Genet. 100, 1257–1266. Jakobsson, M., Sa¨ll, T., Lind-Halldeˇın, C., Halldeˇın, C., 2007. Evolution of chloroplast mononucleotide microsatellites in Arabidopsis thaliana. Theor. Appl. Genet. 114, 223–235. Jin, X.H., Chen, S.H., Luo, Y.B., 2009. Taxonomic revision of Dendrobium moniliforme complex (Orchidaceae). Sci. Hortic. 120, 143–145. Li, X.X., Ding, X.Y., Chu, B.H., Zhou, Q., Ding, G., Gu, S., 2008. Genetic diversity analysis and conservation of the endangered Chinese endemic herb Dendrobium officinale Kimura et Migo (Orchidaceae) based on AFLP. Genetica. 133, 159–166.
489
Li, R.Y., Zhang, H., Zhou, X.C., Guan, Y.N., Yao, F.X., Song, G.A., Wang, J.C., Zhang, C.Q., 2010. Genetic diversity in Chinese sorghum landraces revealed by chloroplast simple sequence repeats. Genet. Resour. Crop Evol. 57, 1–15. Lian, C.L., Oishi, R., Miyashita, N., Nara, K., Nakaya, H., Wu, B., Zhou, Z., Hogetsu, T., 2003. Genetic structure and reproduction dynamics of Salix reinii during primary succession on Mount Fuji, as revealed by nuclear and chloroplast microsatellite analysis. Mol. Ecol. 12, 609–618. Nei, M., 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89, 583–590. Ning, S.P., Yan, H.F., Hao, G., Ge, X.J., 2008. Current advances of DNA barcoding study in plants. Biodivers. Sci. 16, 417–425. Powell, W., Morgante, M., McDevitt, R., Vendramin, G., Rafalski, J., 1995. Polymorphic simple-sequence repeat regions in chloroplast genomes: applications to the population genetics of pines. Proc. Natl. Acad. Sci. U.S.A. 92, 7759–7763. Shaw, J., Lickey, E.B., Schilling, E.E., Small, R.L., 2007. Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: the tortoise and the hare III. Am. J. Bot. 94, 275–288. Taberlet, P., Gielly, L., Pautou, G., Bouvet, J., 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant. Mol. Biol. 17, 1105–1109. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTALW: improving the sensitivity of progressive multiple alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl. Acid Res. 22, 4673–4680. Vendramin, G.G., Ziegenhagen, B., 1997. Characterization and inheritance of polymorphic plastid microsatellites in Abies. Genome 40, 857–864. Vendramin, G.G., Lelli, L., Rossi, P., Morgante, M., 1996. A set of primers for the amplification of 20 chloroplast microsatellites in Pinaceae. Mol. Ecol. 5, 595–598. Wood, H.P., 2006. The Dendrobiums. A.R.G. Gantner Verlag, Ruggell. Xie, M.L., Hou, B.W., Han, L., Ma, Y.H., Ding, X.Y., 2010. Development of microsatellites of Dendrobium officinale and its application in purity identification of germplasm. Acta Pharm. Sin. 45, 667–672.