- Email: [email protected]
Cloning and characterization of a novel caspase-10 isoform that activates NF-κB activity
Available online at www.sciencedirect.com
Biochimica et Biophysica Acta 1770 (2007) 1528 – 1537 www.elsevier.com/locate/bbagen
Cloning and characterization of a novel caspase-10 isoform that activates NF-κB activity Hui Wang a,d,1 , Pingzhang Wang b,1 , Xiaoqing Sun c , Ying Luo a,c , Xin Wang b , Dalong Ma b , Jun Wu a,c,⁎ a
c
Department of Life Science and Biotechnology, Shanghai Jiaotong University, 1954 Huashan Road, Shanghai, 200030, China b Chinese National Human Genome Center, #3-707 North YongChang Road BDA, Beijing 100176, China Shanghai Genomics, Inc. and Functional Genomics II of the Chinese National Human Genome Center, Zhangjiang Hi-Tech Park, Shanghai, 201203, China d College of Life Sciences, Fujian Normal University, 8 Cangsan Road Fuzhou, Fujian, 350007, China Received 1 March 2007; received in revised form 16 July 2007; accepted 25 July 2007 Available online 8 August 2007
Abstract Caspase-10 (also known as Mch4 and FLICE2) is an initiator caspase in the death receptor (DR)-dependent apoptotic pathway. So far six splice variants (caspase-10a–f) have been identified. Here we describe a novel isoform of the caspase-10 family named caspase-10g that is widely expressed in normal human tissues and various cell lines. Caspase-10g consists of 247 amino acids and does not contain the large or small subunit. A caspase-10g-specific exon is present between exon 5 and exon 6, which results in a protein product truncated shortly after the death-effector domain (DED)-containing prodomain. We further show that overexpression of caspase-10g dramatically enhances NF-κB activity in a dose- and time-dependent manner. Moreover, caspase-10g, unlike the protease-active caspase-10a, only promotes slight apoptosis when overexpressed in mammalian cells and it has no effect on caspase-10a-mediated apoptosis. Taken together, these results suggest that caspase-10g, as a novel prodomain-only isoform of caspase-10, may play a regulatory role preferentially in the NF-κB pathways. © 2007 Elsevier B.V. All rights reserved. Keywords: Caspase-10; Caspase-10g; NF-κB; Apoptosis
1. Introduction Apoptosis (programmed cell death) is an essential mechanism to eliminate unwanted cells during the development and homeostasis of multi-cellular organisms [1,2]. It may be directly involved in many human degenerative diseases, autoimmune disorders, and neoplasia [3,4]. This extremely well-organized process involves DNA fragmentation, membrane blebbing, cell shrinkage and disassembly into membrane-enclosed vesicles. Most of these changes are mediated by a family of proteins ⁎ Corresponding author. Shanghai Genomics, Inc. and Functional Genomics of the Chinese National Human Genome Center, 647 Song Tao Road, Building 1, Zhangjiang Hi-Tech Park, Pudong New Area, Shanghai 201203, P. R. China. Tel.: +86 21 50802786; fax: +86 21 50802783. E-mail address: [email protected] (J. Wu). 1 These authors contributed equally to this paper. 0304-4165/$ - see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.bbagen.2007.07.010
known as caspases that cleave and inactivate proteins essential for survival [5]. Caspases, which are cysteine aspartate proteases, play essential roles at various stages of the apoptotic process. To date, at least twelve human caspases have been cloned. They are synthesized as inactivate proenzymes that have to be activated by proteolytic cleavage after specific aspartate residues. Once caspases are activated, they cleave their substrates, leading to the disintegration of cells [4]. There are two different apoptotic signaling pathways involved in the caspase cascade. The intrinsic pathway occurs as the consequence of cellular stresses such as ionizing radiation, chemotherapeutic drugs, mitochondrial damage and certain developmental cues. Following the death trigger, mitochondria may become selectively permeabilized, leading to the release of cytochrome c and recruitment and activation of the apical caspases of the intrinsic pathway (such as caspase-9 and caspase-2). The extrinsic pathway is dependent on
H. Wang et al. / Biochimica et Biophysica Acta 1770 (2007) 1528–1537
death receptors (DR) that are triggered by members of the TNFα receptor superfamily such as Fas (CD95 or APO-1) or TNF-α receptor [6]. Although particular apoptotic signals may stimulate either the extrinsic or intrinsic pathway, crosstalk between these pathways occurs through caspase-8 engaged by the extrinsic pathway, which can cleave and activate the proapoptotic Bcl-2
1529
family member Bid to promote mitochondrial cytochrome c release [7]. In this DR-dependent pathway, caspase-10 along with caspase8, are important initiator caspases [8]. For example, during TRAIL- and CD95L-induced apoptosis, caspase-10 is the second death effector domain (DED)-containing caspase besides caspase-
Fig. 1. Nucleotide and deduced amino acid sequences and the genomic structure of caspase-10g. (A) Nucleotide and deduced amino acid sequences of human caspase10g. The 744 nucleotides (underlined) are the open reading frame of caspase-10g. The 287 nucleotides (lower case) are specific for caspase-10g and represent a novel exon. The shaded region represents the 96 nucleotides specific for caspase-10g in the initial PCR product. The boxed letters represent the poly (A) tail. The nucleotide sequence of caspase-10g has been submitted to GenBank with the accession number AY690601. (B) Amino acid sequence alignment of caspase-10g with other known caspase-10 isoforms. The boxed region indicates the amino acid residues specific for caspase-10g. The known sequence-specific cleavage sites, prodomain, large subunit and small subunit are denoted. (C) The genomic structure of human caspase-10. Exons are numbered 1 to 11 at the top, with their lengths shown below. The box between exon 5 and exon 6 indicates a novel exon specific for caspase-10g. The translation start (ATG) and stop (TAA or TAG) codons are shown and a–g represent caspase-10a–g, respectively. All the translation initiation codons start from exon 2.
1530
H. Wang et al. / Biochimica et Biophysica Acta 1770 (2007) 1528–1537
Fig. 1 (continued ).
H. Wang et al. / Biochimica et Biophysica Acta 1770 (2007) 1528–1537
1531
Fig. 1 (continued ).
8. It can also be recruited to the death-inducing signaling complex (DISC) via the adaptor molecule FADD through DED–DED interactions similar to caspase-8. In the DISC, FADD simultaneously binds to the TRAIL receptor or Fas through death domain (DD)–death domain (DD) interactions [8–10]. In addition to inducing apoptosis, caspase-10 is capable of activating NF-κB, suggesting that it also has a role in the anti-apoptotic signaling pathway [11]. Loss of function of caspase-10 correlates with certain human diseases, such as autoimmune lymphoproliferative syndrome (ALPS) type II characterized by abnormal lymphocyte and dendritic cell homeostasis and immune regulatory defects [12]. The inactivating mutations of caspase-10 gene might also be involved in the development of non-Hodgkin lymphomas (NHL) [13] and gastric cancers [14]. All these findings have implied that caspase-10 plays important roles in certain pathological conditions including inflammation, autoimmune diseases and cancer. Up to date, four caspase-10 splice variants have been reported [15–17]. Caspase-10a (Mch4), 10b (FLICE2), and 10d contain the whole cysteine aspartate-specific protease (CASP) domain, and they are cleaved and activated during CD95 and p55induced apoptosis [8,10,16,17]. Caspase-10c was firstly identified as a truncated protein that lacks the CASP domain. Its mRNA contains exon 6 but not exon 7, which results in a protein that is truncated shortly after the DED-containing prodomain [16]. However, there is growing evidence that nonsense-
mediated mRNA decay (NMD) in mammalian cells can degrade mRNAs that terminate translation more than 40–55 nucleotides upstream of a splicing-generated exon–exon junction [18]. A recent study analyzing human alternative protein isoforms described in the SWISS-PROT database found that some isoform sequences including caspase-10c were derived from mRNAs with premature termination codons (PTC+ mRNA) [19]. Therefore the caspase-10c transcript (NM_032976.2) is most likely degraded rapidly in cells and does not encode a protein product. Moreover, two other unpublished caspase-10 splice variants were registered in GenBank database with accession number AJ487679 for caspase-10e and AJ487678 for caspase-10f. Here, we report the identification of one additional isoform of caspase-10, designated as caspase-10g, from human Jurkat cDNA library by RT-PCR. This novel isoform of caspase-10 is generated by the alternative splicing of human caspase-10 gene. It is a prodomain-only form containing two DEDs. We further present evidence that caspase-10g dramatically activates NF-κB pathway, which is consistent with previous studies on caspase10a and caspase-8 [20]. Moreover, caspase-10g can only promote slight apoptosis in HeLa cells compared with caspase-10a. All these data suggest that caspase-10g, as a novel prodomainform of caspase-10, is a new regulator in the DR-dependent pathway to keep a balance between cell death and survival.
1532
H. Wang et al. / Biochimica et Biophysica Acta 1770 (2007) 1528–1537
2. Materials and methods 2.1. Molecular cloning of caspase-10g cDNA PCR was performed using human Jurkat cDNA library (Shanghai Genomics Inc.) as the template to amplify the open reading frame (ORF) of caspase-10. The purified PCR products were subcloned into pGEMT-Easy vector (Promega) and sequenced. The specific forward and reverse primers for full-length caspase10g were designed as 5′-AGCAAGTCTTGAAGTCTC TTCCCAAG-3′ and 5′GGAGGTGTTACCATTTCTTTT AATTAA-3′, respectively. The ORF fragment of caspase-10g was also subcloned into a pEF-BOS expression vector with a Flag epitope at the N terminus and an IRES GFP protein (Clontech) or a pHA expression vector (Clontech). Sequence analysis of caspase-10 isoforms was performed using DNAstar and BLAST from NCBI. The BLAT program from the UCSC website (http:// genome.ucsc.edu) was used to view the genomic structure of caspase-10 through nucleotide sequences input. Protein domains were searched by the NCBI Conserved Domain Database. The sequence alignment was generated using the Clustal W program (http://www.ebi.ac.uk/clustalw/) and modified manually.
(DMEM, Hyclone, USA) containing 10% FBS (GIBCO). Human leukemic Jurkat cells were grown in RPMI 1640 medium (PAA, USA) supplemented with 10% FBS (GIBCO). Cells were transfected with indicated plasmids using the Lipofectamine™ 2000 reagent (Invitrogen) according to manufacturer's instructions.
2.4. Antibodies The following antibodies were used for immunoblotting and apoptosis assay: mouse monoclonal anti-caspase 10 antibody was from MBL (Medical & Biological laboratories, Nagoya, Japan). Rabbit polyclonal antibody anti-PARP was from Cell Signaling Technology Inc. Goat anti-mouse and goat anti-rabbit IgG secondary antibodies conjugated with horseradish peroxidase (HRP) were from Santa Cruz Biotechnology. Mouse monoclonal anti-Flag M2 antibody and anti-HA (hemagglutinin) antibody (12CA5) were obtained from Roche Diagnostics (Indianapolis, IN, USA).
2.5. Coimmunoprecipitation and western blots
To determine the expression of caspase-10g mRNA in different tissues or human cell lines, total RNA was isolated from various adult human tissues or human cell lines using Trizol Reagent (Invitrogen, USA) according to manufacturer's protocol, and reverse transcription was performed using Superscript II enzyme with oligo (dT) primers from Life Technologies, Inc., USA. The following specific primers of caspase-10g were used: 10 g forward: 5′ATGAAATCTCAAGGTCAACATTGG-3′; reverse: 5′-GCATAGTCTTCAGGTGGGCG TTT G-3′. β-actin mRNA was amplified as the internal control.
HEK293T cells were transfected with the indicated plasmids. After 24 h, cells were harvested and lysed in 200 μl NP-40 lysis buffer (1% NP40, 150 mM NaCl, 10 mM Tris–HCl (pH 7.5), 5 mM EDTA and protease inhibitors, as previously described) [21]. 20 μl of lysates were used for western blot analysis to compare protein expression levels. For coimmunoprecipitation, 100 μl cell lysates were incubated with mouse monoclonal anti-Flag M2 antibody at 4 °C for 1 h and with protein G-Sepharose beads (Sigma) for 2 h at 4 °C. After the beads were washed with lysis buffer, the bound proteins were eluted by boiling in SDS sample buffer, separated by SDS-PAGE, and electrophoretically transferred to PVDF membranes (Millipore, Bedford, MA). The membranes were incubated with indicated primary antibodies followed by secondary antimouse Ig HRP (Santa Cruz Biotechnology) and assayed by enhanced chemiluminescence (SuperSignal Western Blotting Kit, PIERCE).
2.3. Cell line and transfection
2.6. Apoptosis assay
Human embryonic kidney (HEK) 293T cells (ATCC: CRL-11268) and HeLa cells (ATCC:CCL-2) were maintained in Dulbecco's modified Eagle's medium
HeLa cells were transfected with the indicated plasmids using Lipofectamine™ 2000 reagent (Invitrogen). Empty vector was transfected as the negative
2.2. RNA isolation and RT-PCR analysis
Fig. 2. RT-PCR analysis of caspase-10g expression in human tissues and cell lines. (A) Expression of caspase-10g in normal human tissues. RT-PCR was performed using total RNA extracted from selected human normal tissues (Shanghai Genomics Inc.) with specific primers for caspase-10g. The specific band representing caspase-10g was 793 bp in size. Control (CTRL) PCR reaction used a caspase-10g plasmid as the template. β-actin was also amplified as the control. (B) RT-PCR was performed using RNA prepared from various human cell lines with specific primers for caspase-10g.
H. Wang et al. / Biochimica et Biophysica Acta 1770 (2007) 1528–1537 control. The total amount of transfected DNA was kept constant by adding empty vector. Cells were harvested 20–24 h after transfection and resuspended in 1× binding buffer (10 mM HEPES, 140 mM NaCl, 2.5 mM CaCl2, pH 7.4). Cells were washed twice with cold PBS and stained with PE-conjugated annexin V (Becton Dickinson) according to the manufacturer's protocol. Flow cytometric analysis was performed with a FACSCalibur flow cytometry (Becton Dickinson) using CellQuest software (Becton Dickinson).
1533
ubiquitously expressed. Caspase-10g was detected in most normal tissues with high expression in the lung, stomach, uterus, spleen, ovary and small intestine (Fig. 2A). Caspase-10g mRNA was also detected in each of the four human cell lines examined including HeLa, MCF7, Jurkat and 293 cells (Fig. 2B).
2.7. Reporter gene assays Approximately 1 × 105 293T cells were plated into each well of a 24-well plate 24 h before transfection. The indicated cDNAs with pNF-κB-luciferase reporter plasmid (pNF-κB-LUX, Clontech) were cotransfected into cells. pRLTK plasmid containing the Renilla luciferase gene was also cotransfected into cells as the internal control. Cells were harvested 24–36 h after transfection, lysed in the reporter lysis buffer (Promega) and assayed with the DualLuciferase® Reporter Assay System (Promega), using a luminometer (Dynex Technology). Luciferase activities were normalized by using the Renilla luciferase internal control. At lease three independent transfection experiments were performed.
3. Results 3.1. Molecular cloning of caspase-10g Initially, we intended to amplify the full-length caspase-10a using PCR from a human Jurkat cDNA library. A PCR product of ∼ 800 bp (base pair) was obtained and subsequently sequenced. The sequence was well matched to the sequence of caspase-10a, except for the 96 nucleotides at the carboxyl terminus shown in Fig. 1A. These 96 nucleotides were not included in any other existing splice variants of caspase-10, suggesting an existence of a novel caspase-10 splice variant. We then attempted to identify the full sequence, especially the coding sequence of this novel variant. First, we extended the genomic sequence using the GT-AG rule of RNA splicing. According to the rule, the extended sequence does not appear to be spliced as an intron. Next, we searched the EST database using this prolonged sequence and found two EST sequences, BU657322 and AW190618, suggesting that this sequence is indeed expressed. Then we re-designed primers to amplify the full length cDNA fragment of the novel caspase-10 splice variant and a 1127 bp fragment was obtained (Fig. 1A). This novel splice variant was designated as caspase-10g since so far six other splice variants of caspase-10 have been named in the GenBank database. As shown in Fig. 1C, caspase-10g is a novel splice variant comprising five exons including exons 2–5 and a specific exon between exons 5 and 6 of caspase-10 gene. This additional exon causes a frameshift resulting in the premature termination of translation. Caspase-10g is composed of the deduced 247 amino acid residues with the calculated molecular weight at approximately 30 kDa (Fig. 1A). It contains only an intact prodomain and lacks the large and small subunits (Fig. 1B and C). 3.2. Tissue and cell line-specific mRNA expression of caspase-10g We examined the expression of caspase-10g mRNA in several normal human tissues by RT-PCR and the results showed that it is
Fig. 3. Expression of caspase-10g protein in HeLa and Jurkat cells. (A) The specificity of the caspase-10 antibody was confirmed by blotting overexpressed caspase-10a and -10g encoded by pEF-Flag-caspase-10a and pEF-Flag-caspase10g that were transiently transfected into HEK293T cells. Lysates were blotted by either the anti-caspase-10 or anti-Flag antibody. (B) Endogenous caspase-10g was detected in lysates from HeLa cells. HeLa cell lysates were blotted with the caspase-10 antibody. Cell lysates from HEK293T cells transfected with pEFFlag-caspase-10g were used as the positive control. (C) Endogenous caspase10g was detected in lysates from Jurkat cells. Jurkat cell lysates were blotted with the caspase-10 antibody. Cell lysates from HEK293T cells transfected with pEF-Flag-caspase-10g were used as the positive control.
1534
H. Wang et al. / Biochimica et Biophysica Acta 1770 (2007) 1528–1537
3.3. Caspase-10g protein expression in HeLa and Jurkat cells Based on the RT-PCR analyses, we attempted to examine the expression of caspase-10g protein in several cell lines. A specific antibody that recognizes the prodomain of caspase-10 detected
two bands of 55 kDa and 33 kDa in HEK293T cells transfected with expression plasmids encoding recombinant caspase-10a and -10g, respectively (Fig. 3A). Moreover, a protein band of approximately 33 kDa, corresponding to the molecular weight of caspase-10g, was detected in lysates prepared from HeLa and
H. Wang et al. / Biochimica et Biophysica Acta 1770 (2007) 1528–1537
1535
Jurkat cells using the same antibody (Fig. 3B and C). This endogenous 33-kDa protein co-migrated with the recombinant caspase-10g. In addition, two larger isoforms of caspase-10 (caspase-10a: p55 and caspase-10d: p59) were also detected in the lysates derived from both cell lines (Fig. 3B and C), which is consistent with previous findings [9]. To date, among the known six splice variants of caspase-10 (caspase-10a–f), only caspase10c that lacks the catalytic subunits has a similar molecular weight to caspase-10g. When Ng et al. first identified caspase10c, they recognized an in vitro translated protein of approximately 40 kDa [16]. When an endogenous 28 kDa protein was identified in Jurkat and BJAB cells with a specific antibody against the prodomain of caspase-10, Sprick et al. thought that it corresponds to caspase-10c [10]. However, recent studies showed that the caspase-10c transcript is a nonsense mediated mRNA decay (NMD) candidate and is most likely degraded rapidly in cells [19]. Therefore the sequence of caspase-10c (NM_032976.2) was deleted in the NCBI database recently. We suggest that the endogenous protein bands identified by us in HeLa cells and Sprick et al. in Jurkat and BJAB cells most likely corresponded to caspase-10g [10]. 3.4. Caspase-10g activates NF-κB in a dose and time-dependent manner Previous studies have demonstrated that DED-containing polypeptides, such as FLIP, FADD, caspase-8 and -10 could induce NF-κB activation [20,22]. Moreover, the prodomain alone of caspase-10 is capable of activating NF-κB [11]. Therefore we performed a reporter assay to determine whether caspase-10g can activate NF-κB. TNF-α is a well-known activator of the NF-κB pathway and our data showed that caspase-10g activated NF-κB to a similar level compared to TNF-α (Fig. 4A). As shown in Fig. 4B and C, overexpression of caspase-10g in HEK293T cells led to a significant induction of NF-κB activity in a dose- and timedependent manner. The NF-κB inducing ability of caspase-10g was not limited to HEK293T cells since it also activated NF-κB in HeLa cells (Fig. 4D). Further analysis showed that the ability of caspase10g to activate NF-κB was more potent than the protease-dead mutant of caspase-10a (caspase-10a-C358A) and caspase-8 (caspase-8-C360S), and was comparable to PDCasp-10 (Fig. 4E), which is consistent with previous studies [20]. In contrast, overexpression of caspase-10a failed to induce NF-κB. Meanwhile, consistent with
Fig. 5. Caspase-10g induces low level of apoptosis and has no effect on caspase10a-mediated cell apoptosis. (A) HeLa cells were transiently transfected with either the empty vector, pEF-Flag-caspase-10g, pEF-Flag-caspase-10a or different ratios of pEF-Flag-caspase-10a and pEF-Flag-caspase-10g, respectively. Cells were then harvested, stained with annexin V-PE and subjected to flow cytometry. The annexin V-PE-positive cells are shown as apoptotic cells. The presented data are from three independent experiments. (B) HEK293T cells were transfected with the indicated expression plasmids as in Fig. 5A. After 24 h, cells were harvested and lysates were separated by SDS-PAGE and immunoblotted with anti-PARP antibody. β-actin immunoblot serves as a control.
the previous findings, the active site mutant of caspase-9 (caspase-9C288A) could not activate NF-κB (Fig. 4E) [11]. In the TNFR1-mediated NF-κB pathway, RIP and IKK are thought to be essential components. Therefore, to further elucidate the mechanism of caspase-10g-induced NF-κB activation, we tested the ability of caspase-10g to physically interact with RIP and IKK using co-immunoprecipitation assays. As shown in Fig. 4F, caspase-10g interacted with RIP, but not IKKα or IKKβ. These results are consistent with previous studies using the prodomain of caspase-10 [11,20]. Other molecules in the TNFR1mediated NF-κB pathway such as TRAF2 and TRAF6 were also found to interact with caspase-10g (data not shown).
Fig. 4. Activation of NF-κB by caspase-10g. (A) Caspase-10g induces NF-κB activation in HEK293T cells. HEK293T cells were transfected with either the empty vector or pEF-Flag-caspase-10g along with pNF-κB-LUX (100 ng). At 24 h after transfection, cells transiently transfected with empty vector were either untreated or treated with TNFα (20 ng/ml) for 12 h. Dual-luciferase reporter gene assay was performed using the lysates from transfected cells. (B) Dose response of caspase-10ginduced NF-κB activation. HEK293T cells were transfected with either the empty vector or indicated amounts of pEF-Flag-caspase-10g along with pNF-κB-LUX (100 ng). Dual-luciferase reporter gene assay was performed using the lysates from transfected cells. Western blot with a Flag antibody demonstrates the expression level of caspase-10g and β-actin immunoblot serves as a control. (C) Time course of caspase-10g-induced NF-κB activation. HEK293T cells were transfected with either the empty vector or pEF-Flag-caspase-10g along with pNF-κB-LUX (100 ng). Dual-luciferase reporter gene assay was performed at the indicated time points after transfection. (D) Caspase-10g induces NF-κB activation in HeLa cells. HeLa cells were transfected with either the empty vector or pEF-Flag-caspase-10g along with pNF-κB-LUX (100 ng). Dual-luciferase reporter gene assay was performed using the lysates from transfected cells. (E) Comparison of caspase-10g-induced NFκB activation with other caspases in HEK293T cells. HEK293T cells were transfected with either the empty vector, pEF-Flag-caspase-10g or other indicated caspases along with pNF-κB-LUX (100 ng). Dual-luciferase reporter gene assay was performed using the lysates from transfected cells. All the data above are the means of three independent transfection experiments in which pRL-TK was used to standardize the efficiency of transfection. (F) Interaction of caspase-10g with RIP. HEK293T cells were cotransfected with pHA-caspase-10g and either pEF-Flag-RIP, pEF-Flag-IKKα, pEF-Flag-IKKβ or pEF-BOS control vector. Cell lysates were immunoprecipitated with anti-Flag M2 antibody followed by immunoblotting with the corresponding antibodies. TCL: total cell lysates.
1536
H. Wang et al. / Biochimica et Biophysica Acta 1770 (2007) 1528–1537
Taken together, these results demonstrate that NF-κB activation by caspase-10g is dependent on the DED-containing prodomain and independent of the protease activity. Caspase10g may activate NF-κB by directly interacting with multiple molecules (such as RIP and TRAFs) in the NF-κB pathway. 3.5. Caspase-10g induces low level of apoptosis and has no effect on the caspase-10a-mediated cell apoptosis To further explore the function of caspase-10g, we next examined whether it could induce apoptosis of HeLa cells. HeLa cells were transiently transfected with the empty vector, caspase-10g or caspase-10a. To examine whether caspase-10g interferes with the apoptotic effect of caspase-10a, caspase-10a and caspase-10g were also cotransfected. Cells were harvested and analyzed by flow cytometry 24 h after transfection. Interestingly, cells transfected with caspase-10g exhibited weak cell apoptosis compared to cells transfected with the empty vector (Fig. 5A). In contrast, caspase-10a, as a proteaseactive isoform, potently induced apoptosis as described in previous reports [16]. Moreover, caspase-10g had no effect on the caspase-10a-induced cell apoptosis (Fig. 5A). PARP is a 116-kDa poly (ADP-ribose) polymerase that is important for cells to maintain their viability and cleavage of PARP facilitates cellular disassembly and serves as a marker for cells undergoing apoptosis induced by caspase-10a or other initiator caspases [23,24]. To further examine whether overexpression of caspase-10g affects the caspase activity of caspase-10a, we examined the cleavage level of PARP in HEK293T cells. As shown in Fig. 5B, caspase-10a induced the cleavage of PARP and caspase-10g had no effect on the level of cleaved PARP induced by caspase-10a. Taken together, our data suggested that overexpression of caspase-10g has no effect on the caspase activity of caspase-10a. 4. Discussion Caspases are an evolutionarily conserved family of cysteine proteases that are responsible for diverse cellular functions including inflammation and apoptosis. Caspases involved in apoptosis are currently categorized into initiator and effector caspases [25–28]. As a well-defined caspase, caspase-10 is structurally homologous to caspase-8. Although both of them can initiate caspase cascade in the Fas-induced apoptosis [8,29–31], they may have different substrates and therefore potentially distinct roles in death receptor signaling or other cellular processes [8,10]. In previous studies, multiple isoforms of caspase-8, caspase-10 and their homolog MRIT were found and they are most likely splice variants or variants derived from post-translation modifications, but the biological significance of these variants is mostly unclear. In the present study, we identified a novel isoform of caspase-10 named caspase-10g that contains only a prodomain. The mRNA expression of caspase-10g was detected in most human normal tissues and various cell lines (Fig. 2) and the protein expression of caspase-10g in HeLa and Jurkat cells was also detected (Fig. 3B and C). The antibody specific for the prodomain of caspase-10 used should recognize all the isoforms of caspase-10. However,
only three isoforms (caspase-10a, caspase-10d and caspase-10g) were detected in HeLa and Jurkat cells in the study and in BJAB cells in the previous report [10]. Caspase-10b and other isoforms (caspase-10e and 10f) cannot be detected in any of these cell lines (Fig. 3B and C) [10], although the mRNA expression of caspase10b in Jurkat and HeLa cells was detected [17]. DED-containing polypeptides, such as FLIP, FADD, caspase8 and caspase-10 could induce NF-κB activation [11,20,22]. PDCasp-10 also has this ability and it mediates NF-κB activation by binding to a selective set of proteins upstream of NF-κB, such as RIP and TRAF2 [11,20]. Our results showed that caspase-10g, as a prodomain only isoform, greatly activates NF-κB (Fig. 4). Moreover, the known caspase-inhibitor CrmA cannot block NFκB activation by caspase-10g (data not shown). Therefore, our data indicate that caspase-10g activates NF-κB independent of the caspase cascade, further supporting the conclusions from previous studies on DED-containing proteins' activation of the NF-κB pathway. Previous work has shown that caspase-10 mediates NFκB activation by binding to several proteins upstream of NF-κB through its DED domain [11,20]. We also found that caspase-10g bound to RIP, TRAF2 and TRAF6 but not to IKKα or IKKβ in the co-immunoprecipitation assays (Fig. 4F and data not shown). Our results suggest that caspase-10g, like caspase-10a, may also activate NF-κB by directly or indirectly interacting with multiple molecules (such as RIP and TRAFs) in the NF-κB pathway. It is well known that caspase-8 and caspase-10 are both important proteins in the DR-dependent apoptotic pathway. Caspase-10, caspase-8 and their homolog MRIT all have isoforms that lack the protease domain. The DED-only isoform caspase-8d (MACH β1) is pro-apoptotic whereas longer isoforms caspase-8c (MACH α3) and caspase-8L protect cells from DR-induced apoptosis [29,32]. Our apoptosis results showed that caspase-10g induces low level of apoptosis in HeLa cells, reminiscent of the DED-only isoform caspase-8d (Fig. 5A) [29]. Moreover, caspase10g had no effect on the cell apoptosis mediated by caspase-10a or the cleavage of PARP by caspase-10a (Fig. 5A and B). Overexpression of caspase-10g may induce apoptosis by recruiting apoptotic molecule, such as FADD or procaspase to initiate or amplify apoptotic response [33,34]. Although the structure of caspase-10g is similar to caspase-8L, their effects on the proteaseactive caspase-mediated apoptosis pathway are obviously opposite. The controversial results may be due to the difference in experimental system, cell type or the level of expression. For example, c-FLIPL shows either anti-apoptotic activity when highly expressed or pro-apoptotic activity when lowly expressed [35]. The different functions of the prodomain-only isoforms of caspase-8 and caspase-10 also suggest that there might be a distinct apoptosis pathway triggered by caspase-10, and the exact role of the specific exon of caspase-10g after the prodomain in the apoptosis induced by caspase-10g requires further investigation. In conclusion, caspase-10g is a novel isoform of caspase-10 that contains only the prodomain and lacks the large and small subunits. Caspase-10g can potently activate NF-κB pathway and also promote low level of apoptosis. The decision of life or death in response to an inducing signal within a cell is dependent upon a delicate balance of positive and negative influences. Most studies show that NF-κB not only plays an anti-apoptotic role in some
H. Wang et al. / Biochimica et Biophysica Acta 1770 (2007) 1528–1537
cells, but also mediates apoptosis under certain conditions [36]. This may explain the pro-apoptotic ability of caspase-10g and caspase-10g may keep the balance between cell death and survival. Since the expression profiles of caspase-10 isoforms may have an effect on the regulation of cell death, and their imbalance may lead to tumorigenesis or immunological disorders. Further research on the expression, physiological functions and biological significance of caspase-10g and other isoforms of caspase-10 could enhance our understanding of apoptosis and perhaps provide clues for potential therapeutic applications of certain human diseases. Acknowledgments We thank Dr. Bing-e Xu for helpful discussions and careful reading of the manuscript. We thank Yanjuan Xu, F. Tian and L. Gao for technical support. We also thank colleagues at Shanghai Genomics Inc. for discussions and suggestions during our work. This work was supported by the National Natural Science Foundation of China (NSFC) 30430630, National Outstanding Youth Fund of NSFC, 30225022, and Key Program of Basic Research, Shanghai STC 05JC14087. References [1] M.D. Jacobson, M. Weil, M.C. Raff, Programmed cell death in animal development, Cell 88 (1997) 347–354. [2] M. Raff, Cell suicide for beginners, Nature 396 (1998) 119–122. [3] D.A. Carson, E.M. Tan, Apoptosis in rheumatic disease, Bull. Rheum. Dis. 44 (1995) 1–3. [4] C.B. Thompson, Apoptosis in the pathogenesis and treatment of disease, Science 267 (1995) 1456–1462. [5] G.M. Cohen, Caspases: the executioners of apoptosis, Biochem. J. 326 (1997) 1–16. [6] K.M. Boatright, G.S. Salvesen, Mechanisms of caspase activation, Curr. Opin. Cell Biol. 15 (2003) 725–731. [7] N.N. Danial, S.J. Korsmeyer, Cell death: critical control points, Cell 116 (2004) 205–219. [8] J. Wang, H.J. Chun, W. Wong, D.M. Spencer, M.J. Lenardo, Caspase-10 is an initiator caspase in death receptor signaling, Proc. Natl. Acad. Sci. U. S. A. 98 (2001) 13884–13888. [9] F.C. Kischkel, D.A. Lawrence, A. Tinel, H. LeBlanc, A. Virmani, P. Schow, A. Gazdar, J. Blenis, D. Arnott, A. Ashkenazi, Death receptor recruitment of endogenous caspase-10 and apoptosis initiation in the absence of caspase-8, J. Biol. Chem. 276 (2001) 46639–46646. [10] M.R. Sprick, E. Rieser, H. Stahl, A. Grosse-Wilde, M.A. Weigand, H. Walczak, Caspase-10 is recruited to and activated at the native TRAIL and CD95 death-inducing signalling complexes in a FADD-dependent manner but cannot functionally substitute caspase-8, EMBO J. 21 (2002) 4520–4530. [11] Y. Shikama, M. Yamada, T. Miyashita, Caspase-8 and caspase-10 activate NF-kappaB through RIP, NIK and IKKalpha kinases, Eur. J. Immunol. 33 (2003) 1998–2006. [12] J. Wang, L. Zheng, A. Lobito, F.K. Chan, J. Dale, M. Sneller, X. Yao, J.M. Puck, S.E. Straus, M.J. Lenardo, Inherited human Caspase 10 mutations underlie defective lymphocyte and dendritic cell apoptosis in autoimmune lymphoproliferative syndrome type II, Cell 98 (1999) 47–58. [13] M.S. Shin, H.S. Kim, C.S. Kang, W.S. Park, S.Y. Kim, S.N. Lee, J.H. Lee, J.Y. Park, J.J. Jang, C.W. Kim, S.H. Kim, J.Y. Lee, N.J. Yoo, S.H. Lee, Inactivating mutations of CASP10 gene in non-Hodgkin lymphomas, Blood 99 (2002) 4094–4099. [14] W.S. Park, J.H. Lee, M.S. Shin, J.Y. Park, H.S. Kim, J.H. Lee, Y.S. Kim, S.N. Lee, W. Xiao, C.H. Park, S.H. Lee, N.J. Yoo, J.Y. Lee, Inactivating mutations of the caspase-10 gene in gastric cancer, Oncogene 21 (2002) 2919–2925.
1537
[15] T. Fernandes-Alnemri, R.C. Armstrong, J. Krebs, S.M. Srinivasula, L. Wang, F. Bullrich, L.C. Fritz, J.A. Trapani, K.J. Tomaselli, G. Litwack, E.S. Alnemri, In vitro activation of CPP32 and Mch3 by Mch4, a novel human apoptotic cysteine protease containing two FADD-like domains, Proc. Natl. Acad. Sci. U. S. A. 93 (1996) 7464–7469. [16] P.W. Ng, A.G. Porter, R.U. Janicke, Molecular cloning and characterization of two novel pro-apoptotic isoforms of caspase-10, J. Biol. Chem. 274 (1999) 10301–10308. [17] C. Vincenz, V.M. Dixit, Fas-associated death domain protein interleukin1beta-converting enzyme 2 (FLICE2), an ICE/Ced-3 homologue, is proximally involved in CD95- and p55-mediated death signaling, J. Biol. Chem. 272 (1997) 6578–6583. [18] L.E. Maquat, Nonsense-mediated mRNA decay: splicing, translation and mRNP dynamics, Nat. Rev., Mol. Cell Biol. 5 (2004) 89–99. [19] R.T. Hillman, R.E. Green, S.E. Brenner, An unappreciated role for RNA surveillance, Genome Biol. 5 (2004) R8. [20] P.M. Chaudhary, M.T. Eby, A. Jasmin, A. Kumar, L. Liu, L. Hood, Activation of the NF-kappaB pathway by caspase 8 and its homologs, Oncogene 19 (2000) 4451–4460. [21] H. Wang, X. Sun, Y. Luo, Z. Lin, J. Wu, Adapter protein NRBP associates with Jab1 and negatively regulates AP-1 activity, FEBS Lett. 580 (2006) 6015–6021. [22] W.H. Hu, H. Johnson, H.B. Shu, Activation of NF-kappaB by FADD, Casper, and caspase-8, J. Biol. Chem. 275 (2000) 10838–10844. [23] A.H. Boulares, A.G. Yakovlev, V. Ivanova, B.A. Stoica, G. Wang, S. Iyer, M. Smulson, Role of poly (ADP-ribose) polymerase (PARP) cleavage in apoptosis. Caspase 3-resistant PARP mutant increases rates of apoptosis in transfected cells, J. Biol. Chem. 274 (1999) 22932–22940. [24] M. Germain, E.B. Affar, D. D'Amours, et al., Cleavage of automodified poly(ADP-ribose) polymerase during apoptosis. Evidence for involvement of caspase-7, J. Biol. Chem. 274 (1999) 28379–28384. [25] W.C. Earnshaw, L.M. Martins, S.H. Kaufmann, Mammalian caspases: structure, activation, Annu. Rev. Biochem. 68 (1999) 383–424. [26] N.A. Thornberry, Y. Lazebnik, Caspases: enemies within, Science 271 (1998) 1312–1316. [27] S. Urnowey, T. Ansai, V. Bitko, K. Nakayama, T. Takehara, S. Barik, Temporal activation of anti- and pro-apoptotic factors in human gingival fibroblasts infected with the periodontal pathogen, Porphyromonas gingivalis: potential role of bacterial proteases in host signalling, BMC Microbiol. 6 (2006) 26. [28] P.J. Utz, P. Anderson, Life and death decisions: regulation of apoptosis by proteolysis of signaling molecules, Cell Death Differ. 7 (2000) 589–602. [29] M.P. Boldin, T.M. Goncharov, Y.V. Goltsev, D. Wallach, Involvement of MACH, a novel MORT1/FADD-interacting protease, in Fas/APO-1- and TNF receptor-induced cell death, Cell 85 (1996) 803–815. [30] D. Milhas, O. Cuvillier, N. Therville, P. Clave, M. Thomsen, T. Levade, H. Benoist, B. Segui, Caspase-10 triggers Bid cleavage and caspase cascade activation in FasL-induced apoptosis, J. Biol. Chem. 280 (2005) 19836–19842. [31] M. Muzio, A.M. Chinnaiyan, F.C. Kischkel, K. O'Rourke, A. Shevchenko, J. Ni, C. Scaffidi, J.D. Bretz, M. Zhang, R. Gentz, M. Mann, P.H. Krammer, M.E. Peter, V.M. Dixit, FLICE, a novel FADD-homologous ICE/CED-3-like protease, is recruited to the CD95 (Fas/APO-1) deathinducing signaling complex, Cell 85 (1996) 817–827. [32] D. Himeji, T. Horiuchi, H. Tsukamoto, K. Hayashi, T. Watanabe, M. Harada, Characterization of caspase-8L: a novel isoform of caspase-8 that behaves as an inhibitor of the caspase cascade, Blood 99 (2002) 4070–4078. [33] R.M. Siegel, D.A. Martin, L. Zheng, S.Y. Ng, J. Bertin, J. Cohen, M.J. Lenardo, Death-effector filaments: novel cytoplasmic structures that recruit caspases and trigger apoptosis, J. Cell Biol. 141 (1998) 1243–1453. [34] Y. Shikama, L. Shen, M. Yonetani, J. Miyauchi, T. Miyashita, M. Yamada, Death effector domain-only polypeptides of caspase-8 and -10 specifically inhibit death receptor-induced cell death, Biochem. Biophys. Res. Commun. 29 (2002) 291484–291493. [35] D.W. Chang, Z. Xing, Y. Pan, A. Algeciras-Schimnich, B.C. Barnhart, S. Yaish-Ohad, M.E. Peter, X. Yang, c-FLIP(L) is a dual function regulator for caspase-8 activation and CD95-mediated apoptosis, EMBO J. 21 (2002) 3704–3714. [36] S. Shishodia, B.B. Aggarwal, Nuclear factor-kappaB activation: a question of life or death, J. Biochem. Mol. Biol. 35 (2002) 28–40.
Biochimica et Biophysica Acta 1770 (2007) 1528 – 1537 www.elsevier.com/locate/bbagen
Cloning and characterization of a novel caspase-10 isoform that activates NF-κB activity Hui Wang a,d,1 , Pingzhang Wang b,1 , Xiaoqing Sun c , Ying Luo a,c , Xin Wang b , Dalong Ma b , Jun Wu a,c,⁎ a
c
Department of Life Science and Biotechnology, Shanghai Jiaotong University, 1954 Huashan Road, Shanghai, 200030, China b Chinese National Human Genome Center, #3-707 North YongChang Road BDA, Beijing 100176, China Shanghai Genomics, Inc. and Functional Genomics II of the Chinese National Human Genome Center, Zhangjiang Hi-Tech Park, Shanghai, 201203, China d College of Life Sciences, Fujian Normal University, 8 Cangsan Road Fuzhou, Fujian, 350007, China Received 1 March 2007; received in revised form 16 July 2007; accepted 25 July 2007 Available online 8 August 2007
Abstract Caspase-10 (also known as Mch4 and FLICE2) is an initiator caspase in the death receptor (DR)-dependent apoptotic pathway. So far six splice variants (caspase-10a–f) have been identified. Here we describe a novel isoform of the caspase-10 family named caspase-10g that is widely expressed in normal human tissues and various cell lines. Caspase-10g consists of 247 amino acids and does not contain the large or small subunit. A caspase-10g-specific exon is present between exon 5 and exon 6, which results in a protein product truncated shortly after the death-effector domain (DED)-containing prodomain. We further show that overexpression of caspase-10g dramatically enhances NF-κB activity in a dose- and time-dependent manner. Moreover, caspase-10g, unlike the protease-active caspase-10a, only promotes slight apoptosis when overexpressed in mammalian cells and it has no effect on caspase-10a-mediated apoptosis. Taken together, these results suggest that caspase-10g, as a novel prodomain-only isoform of caspase-10, may play a regulatory role preferentially in the NF-κB pathways. © 2007 Elsevier B.V. All rights reserved. Keywords: Caspase-10; Caspase-10g; NF-κB; Apoptosis
1. Introduction Apoptosis (programmed cell death) is an essential mechanism to eliminate unwanted cells during the development and homeostasis of multi-cellular organisms [1,2]. It may be directly involved in many human degenerative diseases, autoimmune disorders, and neoplasia [3,4]. This extremely well-organized process involves DNA fragmentation, membrane blebbing, cell shrinkage and disassembly into membrane-enclosed vesicles. Most of these changes are mediated by a family of proteins ⁎ Corresponding author. Shanghai Genomics, Inc. and Functional Genomics of the Chinese National Human Genome Center, 647 Song Tao Road, Building 1, Zhangjiang Hi-Tech Park, Pudong New Area, Shanghai 201203, P. R. China. Tel.: +86 21 50802786; fax: +86 21 50802783. E-mail address: [email protected] (J. Wu). 1 These authors contributed equally to this paper. 0304-4165/$ - see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.bbagen.2007.07.010
known as caspases that cleave and inactivate proteins essential for survival [5]. Caspases, which are cysteine aspartate proteases, play essential roles at various stages of the apoptotic process. To date, at least twelve human caspases have been cloned. They are synthesized as inactivate proenzymes that have to be activated by proteolytic cleavage after specific aspartate residues. Once caspases are activated, they cleave their substrates, leading to the disintegration of cells [4]. There are two different apoptotic signaling pathways involved in the caspase cascade. The intrinsic pathway occurs as the consequence of cellular stresses such as ionizing radiation, chemotherapeutic drugs, mitochondrial damage and certain developmental cues. Following the death trigger, mitochondria may become selectively permeabilized, leading to the release of cytochrome c and recruitment and activation of the apical caspases of the intrinsic pathway (such as caspase-9 and caspase-2). The extrinsic pathway is dependent on
H. Wang et al. / Biochimica et Biophysica Acta 1770 (2007) 1528–1537
death receptors (DR) that are triggered by members of the TNFα receptor superfamily such as Fas (CD95 or APO-1) or TNF-α receptor [6]. Although particular apoptotic signals may stimulate either the extrinsic or intrinsic pathway, crosstalk between these pathways occurs through caspase-8 engaged by the extrinsic pathway, which can cleave and activate the proapoptotic Bcl-2
1529
family member Bid to promote mitochondrial cytochrome c release [7]. In this DR-dependent pathway, caspase-10 along with caspase8, are important initiator caspases [8]. For example, during TRAIL- and CD95L-induced apoptosis, caspase-10 is the second death effector domain (DED)-containing caspase besides caspase-
Fig. 1. Nucleotide and deduced amino acid sequences and the genomic structure of caspase-10g. (A) Nucleotide and deduced amino acid sequences of human caspase10g. The 744 nucleotides (underlined) are the open reading frame of caspase-10g. The 287 nucleotides (lower case) are specific for caspase-10g and represent a novel exon. The shaded region represents the 96 nucleotides specific for caspase-10g in the initial PCR product. The boxed letters represent the poly (A) tail. The nucleotide sequence of caspase-10g has been submitted to GenBank with the accession number AY690601. (B) Amino acid sequence alignment of caspase-10g with other known caspase-10 isoforms. The boxed region indicates the amino acid residues specific for caspase-10g. The known sequence-specific cleavage sites, prodomain, large subunit and small subunit are denoted. (C) The genomic structure of human caspase-10. Exons are numbered 1 to 11 at the top, with their lengths shown below. The box between exon 5 and exon 6 indicates a novel exon specific for caspase-10g. The translation start (ATG) and stop (TAA or TAG) codons are shown and a–g represent caspase-10a–g, respectively. All the translation initiation codons start from exon 2.
1530
H. Wang et al. / Biochimica et Biophysica Acta 1770 (2007) 1528–1537
Fig. 1 (continued ).
H. Wang et al. / Biochimica et Biophysica Acta 1770 (2007) 1528–1537
1531
Fig. 1 (continued ).
8. It can also be recruited to the death-inducing signaling complex (DISC) via the adaptor molecule FADD through DED–DED interactions similar to caspase-8. In the DISC, FADD simultaneously binds to the TRAIL receptor or Fas through death domain (DD)–death domain (DD) interactions [8–10]. In addition to inducing apoptosis, caspase-10 is capable of activating NF-κB, suggesting that it also has a role in the anti-apoptotic signaling pathway [11]. Loss of function of caspase-10 correlates with certain human diseases, such as autoimmune lymphoproliferative syndrome (ALPS) type II characterized by abnormal lymphocyte and dendritic cell homeostasis and immune regulatory defects [12]. The inactivating mutations of caspase-10 gene might also be involved in the development of non-Hodgkin lymphomas (NHL) [13] and gastric cancers [14]. All these findings have implied that caspase-10 plays important roles in certain pathological conditions including inflammation, autoimmune diseases and cancer. Up to date, four caspase-10 splice variants have been reported [15–17]. Caspase-10a (Mch4), 10b (FLICE2), and 10d contain the whole cysteine aspartate-specific protease (CASP) domain, and they are cleaved and activated during CD95 and p55induced apoptosis [8,10,16,17]. Caspase-10c was firstly identified as a truncated protein that lacks the CASP domain. Its mRNA contains exon 6 but not exon 7, which results in a protein that is truncated shortly after the DED-containing prodomain [16]. However, there is growing evidence that nonsense-
mediated mRNA decay (NMD) in mammalian cells can degrade mRNAs that terminate translation more than 40–55 nucleotides upstream of a splicing-generated exon–exon junction [18]. A recent study analyzing human alternative protein isoforms described in the SWISS-PROT database found that some isoform sequences including caspase-10c were derived from mRNAs with premature termination codons (PTC+ mRNA) [19]. Therefore the caspase-10c transcript (NM_032976.2) is most likely degraded rapidly in cells and does not encode a protein product. Moreover, two other unpublished caspase-10 splice variants were registered in GenBank database with accession number AJ487679 for caspase-10e and AJ487678 for caspase-10f. Here, we report the identification of one additional isoform of caspase-10, designated as caspase-10g, from human Jurkat cDNA library by RT-PCR. This novel isoform of caspase-10 is generated by the alternative splicing of human caspase-10 gene. It is a prodomain-only form containing two DEDs. We further present evidence that caspase-10g dramatically activates NF-κB pathway, which is consistent with previous studies on caspase10a and caspase-8 [20]. Moreover, caspase-10g can only promote slight apoptosis in HeLa cells compared with caspase-10a. All these data suggest that caspase-10g, as a novel prodomainform of caspase-10, is a new regulator in the DR-dependent pathway to keep a balance between cell death and survival.
1532
H. Wang et al. / Biochimica et Biophysica Acta 1770 (2007) 1528–1537
2. Materials and methods 2.1. Molecular cloning of caspase-10g cDNA PCR was performed using human Jurkat cDNA library (Shanghai Genomics Inc.) as the template to amplify the open reading frame (ORF) of caspase-10. The purified PCR products were subcloned into pGEMT-Easy vector (Promega) and sequenced. The specific forward and reverse primers for full-length caspase10g were designed as 5′-AGCAAGTCTTGAAGTCTC TTCCCAAG-3′ and 5′GGAGGTGTTACCATTTCTTTT AATTAA-3′, respectively. The ORF fragment of caspase-10g was also subcloned into a pEF-BOS expression vector with a Flag epitope at the N terminus and an IRES GFP protein (Clontech) or a pHA expression vector (Clontech). Sequence analysis of caspase-10 isoforms was performed using DNAstar and BLAST from NCBI. The BLAT program from the UCSC website (http:// genome.ucsc.edu) was used to view the genomic structure of caspase-10 through nucleotide sequences input. Protein domains were searched by the NCBI Conserved Domain Database. The sequence alignment was generated using the Clustal W program (http://www.ebi.ac.uk/clustalw/) and modified manually.
(DMEM, Hyclone, USA) containing 10% FBS (GIBCO). Human leukemic Jurkat cells were grown in RPMI 1640 medium (PAA, USA) supplemented with 10% FBS (GIBCO). Cells were transfected with indicated plasmids using the Lipofectamine™ 2000 reagent (Invitrogen) according to manufacturer's instructions.
2.4. Antibodies The following antibodies were used for immunoblotting and apoptosis assay: mouse monoclonal anti-caspase 10 antibody was from MBL (Medical & Biological laboratories, Nagoya, Japan). Rabbit polyclonal antibody anti-PARP was from Cell Signaling Technology Inc. Goat anti-mouse and goat anti-rabbit IgG secondary antibodies conjugated with horseradish peroxidase (HRP) were from Santa Cruz Biotechnology. Mouse monoclonal anti-Flag M2 antibody and anti-HA (hemagglutinin) antibody (12CA5) were obtained from Roche Diagnostics (Indianapolis, IN, USA).
2.5. Coimmunoprecipitation and western blots
To determine the expression of caspase-10g mRNA in different tissues or human cell lines, total RNA was isolated from various adult human tissues or human cell lines using Trizol Reagent (Invitrogen, USA) according to manufacturer's protocol, and reverse transcription was performed using Superscript II enzyme with oligo (dT) primers from Life Technologies, Inc., USA. The following specific primers of caspase-10g were used: 10 g forward: 5′ATGAAATCTCAAGGTCAACATTGG-3′; reverse: 5′-GCATAGTCTTCAGGTGGGCG TTT G-3′. β-actin mRNA was amplified as the internal control.
HEK293T cells were transfected with the indicated plasmids. After 24 h, cells were harvested and lysed in 200 μl NP-40 lysis buffer (1% NP40, 150 mM NaCl, 10 mM Tris–HCl (pH 7.5), 5 mM EDTA and protease inhibitors, as previously described) [21]. 20 μl of lysates were used for western blot analysis to compare protein expression levels. For coimmunoprecipitation, 100 μl cell lysates were incubated with mouse monoclonal anti-Flag M2 antibody at 4 °C for 1 h and with protein G-Sepharose beads (Sigma) for 2 h at 4 °C. After the beads were washed with lysis buffer, the bound proteins were eluted by boiling in SDS sample buffer, separated by SDS-PAGE, and electrophoretically transferred to PVDF membranes (Millipore, Bedford, MA). The membranes were incubated with indicated primary antibodies followed by secondary antimouse Ig HRP (Santa Cruz Biotechnology) and assayed by enhanced chemiluminescence (SuperSignal Western Blotting Kit, PIERCE).
2.3. Cell line and transfection
2.6. Apoptosis assay
Human embryonic kidney (HEK) 293T cells (ATCC: CRL-11268) and HeLa cells (ATCC:CCL-2) were maintained in Dulbecco's modified Eagle's medium
HeLa cells were transfected with the indicated plasmids using Lipofectamine™ 2000 reagent (Invitrogen). Empty vector was transfected as the negative
2.2. RNA isolation and RT-PCR analysis
Fig. 2. RT-PCR analysis of caspase-10g expression in human tissues and cell lines. (A) Expression of caspase-10g in normal human tissues. RT-PCR was performed using total RNA extracted from selected human normal tissues (Shanghai Genomics Inc.) with specific primers for caspase-10g. The specific band representing caspase-10g was 793 bp in size. Control (CTRL) PCR reaction used a caspase-10g plasmid as the template. β-actin was also amplified as the control. (B) RT-PCR was performed using RNA prepared from various human cell lines with specific primers for caspase-10g.
H. Wang et al. / Biochimica et Biophysica Acta 1770 (2007) 1528–1537 control. The total amount of transfected DNA was kept constant by adding empty vector. Cells were harvested 20–24 h after transfection and resuspended in 1× binding buffer (10 mM HEPES, 140 mM NaCl, 2.5 mM CaCl2, pH 7.4). Cells were washed twice with cold PBS and stained with PE-conjugated annexin V (Becton Dickinson) according to the manufacturer's protocol. Flow cytometric analysis was performed with a FACSCalibur flow cytometry (Becton Dickinson) using CellQuest software (Becton Dickinson).
1533
ubiquitously expressed. Caspase-10g was detected in most normal tissues with high expression in the lung, stomach, uterus, spleen, ovary and small intestine (Fig. 2A). Caspase-10g mRNA was also detected in each of the four human cell lines examined including HeLa, MCF7, Jurkat and 293 cells (Fig. 2B).
2.7. Reporter gene assays Approximately 1 × 105 293T cells were plated into each well of a 24-well plate 24 h before transfection. The indicated cDNAs with pNF-κB-luciferase reporter plasmid (pNF-κB-LUX, Clontech) were cotransfected into cells. pRLTK plasmid containing the Renilla luciferase gene was also cotransfected into cells as the internal control. Cells were harvested 24–36 h after transfection, lysed in the reporter lysis buffer (Promega) and assayed with the DualLuciferase® Reporter Assay System (Promega), using a luminometer (Dynex Technology). Luciferase activities were normalized by using the Renilla luciferase internal control. At lease three independent transfection experiments were performed.
3. Results 3.1. Molecular cloning of caspase-10g Initially, we intended to amplify the full-length caspase-10a using PCR from a human Jurkat cDNA library. A PCR product of ∼ 800 bp (base pair) was obtained and subsequently sequenced. The sequence was well matched to the sequence of caspase-10a, except for the 96 nucleotides at the carboxyl terminus shown in Fig. 1A. These 96 nucleotides were not included in any other existing splice variants of caspase-10, suggesting an existence of a novel caspase-10 splice variant. We then attempted to identify the full sequence, especially the coding sequence of this novel variant. First, we extended the genomic sequence using the GT-AG rule of RNA splicing. According to the rule, the extended sequence does not appear to be spliced as an intron. Next, we searched the EST database using this prolonged sequence and found two EST sequences, BU657322 and AW190618, suggesting that this sequence is indeed expressed. Then we re-designed primers to amplify the full length cDNA fragment of the novel caspase-10 splice variant and a 1127 bp fragment was obtained (Fig. 1A). This novel splice variant was designated as caspase-10g since so far six other splice variants of caspase-10 have been named in the GenBank database. As shown in Fig. 1C, caspase-10g is a novel splice variant comprising five exons including exons 2–5 and a specific exon between exons 5 and 6 of caspase-10 gene. This additional exon causes a frameshift resulting in the premature termination of translation. Caspase-10g is composed of the deduced 247 amino acid residues with the calculated molecular weight at approximately 30 kDa (Fig. 1A). It contains only an intact prodomain and lacks the large and small subunits (Fig. 1B and C). 3.2. Tissue and cell line-specific mRNA expression of caspase-10g We examined the expression of caspase-10g mRNA in several normal human tissues by RT-PCR and the results showed that it is
Fig. 3. Expression of caspase-10g protein in HeLa and Jurkat cells. (A) The specificity of the caspase-10 antibody was confirmed by blotting overexpressed caspase-10a and -10g encoded by pEF-Flag-caspase-10a and pEF-Flag-caspase10g that were transiently transfected into HEK293T cells. Lysates were blotted by either the anti-caspase-10 or anti-Flag antibody. (B) Endogenous caspase-10g was detected in lysates from HeLa cells. HeLa cell lysates were blotted with the caspase-10 antibody. Cell lysates from HEK293T cells transfected with pEFFlag-caspase-10g were used as the positive control. (C) Endogenous caspase10g was detected in lysates from Jurkat cells. Jurkat cell lysates were blotted with the caspase-10 antibody. Cell lysates from HEK293T cells transfected with pEF-Flag-caspase-10g were used as the positive control.
1534
H. Wang et al. / Biochimica et Biophysica Acta 1770 (2007) 1528–1537
3.3. Caspase-10g protein expression in HeLa and Jurkat cells Based on the RT-PCR analyses, we attempted to examine the expression of caspase-10g protein in several cell lines. A specific antibody that recognizes the prodomain of caspase-10 detected
two bands of 55 kDa and 33 kDa in HEK293T cells transfected with expression plasmids encoding recombinant caspase-10a and -10g, respectively (Fig. 3A). Moreover, a protein band of approximately 33 kDa, corresponding to the molecular weight of caspase-10g, was detected in lysates prepared from HeLa and
H. Wang et al. / Biochimica et Biophysica Acta 1770 (2007) 1528–1537
1535
Jurkat cells using the same antibody (Fig. 3B and C). This endogenous 33-kDa protein co-migrated with the recombinant caspase-10g. In addition, two larger isoforms of caspase-10 (caspase-10a: p55 and caspase-10d: p59) were also detected in the lysates derived from both cell lines (Fig. 3B and C), which is consistent with previous findings [9]. To date, among the known six splice variants of caspase-10 (caspase-10a–f), only caspase10c that lacks the catalytic subunits has a similar molecular weight to caspase-10g. When Ng et al. first identified caspase10c, they recognized an in vitro translated protein of approximately 40 kDa [16]. When an endogenous 28 kDa protein was identified in Jurkat and BJAB cells with a specific antibody against the prodomain of caspase-10, Sprick et al. thought that it corresponds to caspase-10c [10]. However, recent studies showed that the caspase-10c transcript is a nonsense mediated mRNA decay (NMD) candidate and is most likely degraded rapidly in cells [19]. Therefore the sequence of caspase-10c (NM_032976.2) was deleted in the NCBI database recently. We suggest that the endogenous protein bands identified by us in HeLa cells and Sprick et al. in Jurkat and BJAB cells most likely corresponded to caspase-10g [10]. 3.4. Caspase-10g activates NF-κB in a dose and time-dependent manner Previous studies have demonstrated that DED-containing polypeptides, such as FLIP, FADD, caspase-8 and -10 could induce NF-κB activation [20,22]. Moreover, the prodomain alone of caspase-10 is capable of activating NF-κB [11]. Therefore we performed a reporter assay to determine whether caspase-10g can activate NF-κB. TNF-α is a well-known activator of the NF-κB pathway and our data showed that caspase-10g activated NF-κB to a similar level compared to TNF-α (Fig. 4A). As shown in Fig. 4B and C, overexpression of caspase-10g in HEK293T cells led to a significant induction of NF-κB activity in a dose- and timedependent manner. The NF-κB inducing ability of caspase-10g was not limited to HEK293T cells since it also activated NF-κB in HeLa cells (Fig. 4D). Further analysis showed that the ability of caspase10g to activate NF-κB was more potent than the protease-dead mutant of caspase-10a (caspase-10a-C358A) and caspase-8 (caspase-8-C360S), and was comparable to PDCasp-10 (Fig. 4E), which is consistent with previous studies [20]. In contrast, overexpression of caspase-10a failed to induce NF-κB. Meanwhile, consistent with
Fig. 5. Caspase-10g induces low level of apoptosis and has no effect on caspase10a-mediated cell apoptosis. (A) HeLa cells were transiently transfected with either the empty vector, pEF-Flag-caspase-10g, pEF-Flag-caspase-10a or different ratios of pEF-Flag-caspase-10a and pEF-Flag-caspase-10g, respectively. Cells were then harvested, stained with annexin V-PE and subjected to flow cytometry. The annexin V-PE-positive cells are shown as apoptotic cells. The presented data are from three independent experiments. (B) HEK293T cells were transfected with the indicated expression plasmids as in Fig. 5A. After 24 h, cells were harvested and lysates were separated by SDS-PAGE and immunoblotted with anti-PARP antibody. β-actin immunoblot serves as a control.
the previous findings, the active site mutant of caspase-9 (caspase-9C288A) could not activate NF-κB (Fig. 4E) [11]. In the TNFR1-mediated NF-κB pathway, RIP and IKK are thought to be essential components. Therefore, to further elucidate the mechanism of caspase-10g-induced NF-κB activation, we tested the ability of caspase-10g to physically interact with RIP and IKK using co-immunoprecipitation assays. As shown in Fig. 4F, caspase-10g interacted with RIP, but not IKKα or IKKβ. These results are consistent with previous studies using the prodomain of caspase-10 [11,20]. Other molecules in the TNFR1mediated NF-κB pathway such as TRAF2 and TRAF6 were also found to interact with caspase-10g (data not shown).
Fig. 4. Activation of NF-κB by caspase-10g. (A) Caspase-10g induces NF-κB activation in HEK293T cells. HEK293T cells were transfected with either the empty vector or pEF-Flag-caspase-10g along with pNF-κB-LUX (100 ng). At 24 h after transfection, cells transiently transfected with empty vector were either untreated or treated with TNFα (20 ng/ml) for 12 h. Dual-luciferase reporter gene assay was performed using the lysates from transfected cells. (B) Dose response of caspase-10ginduced NF-κB activation. HEK293T cells were transfected with either the empty vector or indicated amounts of pEF-Flag-caspase-10g along with pNF-κB-LUX (100 ng). Dual-luciferase reporter gene assay was performed using the lysates from transfected cells. Western blot with a Flag antibody demonstrates the expression level of caspase-10g and β-actin immunoblot serves as a control. (C) Time course of caspase-10g-induced NF-κB activation. HEK293T cells were transfected with either the empty vector or pEF-Flag-caspase-10g along with pNF-κB-LUX (100 ng). Dual-luciferase reporter gene assay was performed at the indicated time points after transfection. (D) Caspase-10g induces NF-κB activation in HeLa cells. HeLa cells were transfected with either the empty vector or pEF-Flag-caspase-10g along with pNF-κB-LUX (100 ng). Dual-luciferase reporter gene assay was performed using the lysates from transfected cells. (E) Comparison of caspase-10g-induced NFκB activation with other caspases in HEK293T cells. HEK293T cells were transfected with either the empty vector, pEF-Flag-caspase-10g or other indicated caspases along with pNF-κB-LUX (100 ng). Dual-luciferase reporter gene assay was performed using the lysates from transfected cells. All the data above are the means of three independent transfection experiments in which pRL-TK was used to standardize the efficiency of transfection. (F) Interaction of caspase-10g with RIP. HEK293T cells were cotransfected with pHA-caspase-10g and either pEF-Flag-RIP, pEF-Flag-IKKα, pEF-Flag-IKKβ or pEF-BOS control vector. Cell lysates were immunoprecipitated with anti-Flag M2 antibody followed by immunoblotting with the corresponding antibodies. TCL: total cell lysates.
1536
H. Wang et al. / Biochimica et Biophysica Acta 1770 (2007) 1528–1537
Taken together, these results demonstrate that NF-κB activation by caspase-10g is dependent on the DED-containing prodomain and independent of the protease activity. Caspase10g may activate NF-κB by directly interacting with multiple molecules (such as RIP and TRAFs) in the NF-κB pathway. 3.5. Caspase-10g induces low level of apoptosis and has no effect on the caspase-10a-mediated cell apoptosis To further explore the function of caspase-10g, we next examined whether it could induce apoptosis of HeLa cells. HeLa cells were transiently transfected with the empty vector, caspase-10g or caspase-10a. To examine whether caspase-10g interferes with the apoptotic effect of caspase-10a, caspase-10a and caspase-10g were also cotransfected. Cells were harvested and analyzed by flow cytometry 24 h after transfection. Interestingly, cells transfected with caspase-10g exhibited weak cell apoptosis compared to cells transfected with the empty vector (Fig. 5A). In contrast, caspase-10a, as a proteaseactive isoform, potently induced apoptosis as described in previous reports [16]. Moreover, caspase-10g had no effect on the caspase-10a-induced cell apoptosis (Fig. 5A). PARP is a 116-kDa poly (ADP-ribose) polymerase that is important for cells to maintain their viability and cleavage of PARP facilitates cellular disassembly and serves as a marker for cells undergoing apoptosis induced by caspase-10a or other initiator caspases [23,24]. To further examine whether overexpression of caspase-10g affects the caspase activity of caspase-10a, we examined the cleavage level of PARP in HEK293T cells. As shown in Fig. 5B, caspase-10a induced the cleavage of PARP and caspase-10g had no effect on the level of cleaved PARP induced by caspase-10a. Taken together, our data suggested that overexpression of caspase-10g has no effect on the caspase activity of caspase-10a. 4. Discussion Caspases are an evolutionarily conserved family of cysteine proteases that are responsible for diverse cellular functions including inflammation and apoptosis. Caspases involved in apoptosis are currently categorized into initiator and effector caspases [25–28]. As a well-defined caspase, caspase-10 is structurally homologous to caspase-8. Although both of them can initiate caspase cascade in the Fas-induced apoptosis [8,29–31], they may have different substrates and therefore potentially distinct roles in death receptor signaling or other cellular processes [8,10]. In previous studies, multiple isoforms of caspase-8, caspase-10 and their homolog MRIT were found and they are most likely splice variants or variants derived from post-translation modifications, but the biological significance of these variants is mostly unclear. In the present study, we identified a novel isoform of caspase-10 named caspase-10g that contains only a prodomain. The mRNA expression of caspase-10g was detected in most human normal tissues and various cell lines (Fig. 2) and the protein expression of caspase-10g in HeLa and Jurkat cells was also detected (Fig. 3B and C). The antibody specific for the prodomain of caspase-10 used should recognize all the isoforms of caspase-10. However,
only three isoforms (caspase-10a, caspase-10d and caspase-10g) were detected in HeLa and Jurkat cells in the study and in BJAB cells in the previous report [10]. Caspase-10b and other isoforms (caspase-10e and 10f) cannot be detected in any of these cell lines (Fig. 3B and C) [10], although the mRNA expression of caspase10b in Jurkat and HeLa cells was detected [17]. DED-containing polypeptides, such as FLIP, FADD, caspase8 and caspase-10 could induce NF-κB activation [11,20,22]. PDCasp-10 also has this ability and it mediates NF-κB activation by binding to a selective set of proteins upstream of NF-κB, such as RIP and TRAF2 [11,20]. Our results showed that caspase-10g, as a prodomain only isoform, greatly activates NF-κB (Fig. 4). Moreover, the known caspase-inhibitor CrmA cannot block NFκB activation by caspase-10g (data not shown). Therefore, our data indicate that caspase-10g activates NF-κB independent of the caspase cascade, further supporting the conclusions from previous studies on DED-containing proteins' activation of the NF-κB pathway. Previous work has shown that caspase-10 mediates NFκB activation by binding to several proteins upstream of NF-κB through its DED domain [11,20]. We also found that caspase-10g bound to RIP, TRAF2 and TRAF6 but not to IKKα or IKKβ in the co-immunoprecipitation assays (Fig. 4F and data not shown). Our results suggest that caspase-10g, like caspase-10a, may also activate NF-κB by directly or indirectly interacting with multiple molecules (such as RIP and TRAFs) in the NF-κB pathway. It is well known that caspase-8 and caspase-10 are both important proteins in the DR-dependent apoptotic pathway. Caspase-10, caspase-8 and their homolog MRIT all have isoforms that lack the protease domain. The DED-only isoform caspase-8d (MACH β1) is pro-apoptotic whereas longer isoforms caspase-8c (MACH α3) and caspase-8L protect cells from DR-induced apoptosis [29,32]. Our apoptosis results showed that caspase-10g induces low level of apoptosis in HeLa cells, reminiscent of the DED-only isoform caspase-8d (Fig. 5A) [29]. Moreover, caspase10g had no effect on the cell apoptosis mediated by caspase-10a or the cleavage of PARP by caspase-10a (Fig. 5A and B). Overexpression of caspase-10g may induce apoptosis by recruiting apoptotic molecule, such as FADD or procaspase to initiate or amplify apoptotic response [33,34]. Although the structure of caspase-10g is similar to caspase-8L, their effects on the proteaseactive caspase-mediated apoptosis pathway are obviously opposite. The controversial results may be due to the difference in experimental system, cell type or the level of expression. For example, c-FLIPL shows either anti-apoptotic activity when highly expressed or pro-apoptotic activity when lowly expressed [35]. The different functions of the prodomain-only isoforms of caspase-8 and caspase-10 also suggest that there might be a distinct apoptosis pathway triggered by caspase-10, and the exact role of the specific exon of caspase-10g after the prodomain in the apoptosis induced by caspase-10g requires further investigation. In conclusion, caspase-10g is a novel isoform of caspase-10 that contains only the prodomain and lacks the large and small subunits. Caspase-10g can potently activate NF-κB pathway and also promote low level of apoptosis. The decision of life or death in response to an inducing signal within a cell is dependent upon a delicate balance of positive and negative influences. Most studies show that NF-κB not only plays an anti-apoptotic role in some
H. Wang et al. / Biochimica et Biophysica Acta 1770 (2007) 1528–1537
cells, but also mediates apoptosis under certain conditions [36]. This may explain the pro-apoptotic ability of caspase-10g and caspase-10g may keep the balance between cell death and survival. Since the expression profiles of caspase-10 isoforms may have an effect on the regulation of cell death, and their imbalance may lead to tumorigenesis or immunological disorders. Further research on the expression, physiological functions and biological significance of caspase-10g and other isoforms of caspase-10 could enhance our understanding of apoptosis and perhaps provide clues for potential therapeutic applications of certain human diseases. Acknowledgments We thank Dr. Bing-e Xu for helpful discussions and careful reading of the manuscript. We thank Yanjuan Xu, F. Tian and L. Gao for technical support. We also thank colleagues at Shanghai Genomics Inc. for discussions and suggestions during our work. This work was supported by the National Natural Science Foundation of China (NSFC) 30430630, National Outstanding Youth Fund of NSFC, 30225022, and Key Program of Basic Research, Shanghai STC 05JC14087. References [1] M.D. Jacobson, M. Weil, M.C. Raff, Programmed cell death in animal development, Cell 88 (1997) 347–354. [2] M. Raff, Cell suicide for beginners, Nature 396 (1998) 119–122. [3] D.A. Carson, E.M. Tan, Apoptosis in rheumatic disease, Bull. Rheum. Dis. 44 (1995) 1–3. [4] C.B. Thompson, Apoptosis in the pathogenesis and treatment of disease, Science 267 (1995) 1456–1462. [5] G.M. Cohen, Caspases: the executioners of apoptosis, Biochem. J. 326 (1997) 1–16. [6] K.M. Boatright, G.S. Salvesen, Mechanisms of caspase activation, Curr. Opin. Cell Biol. 15 (2003) 725–731. [7] N.N. Danial, S.J. Korsmeyer, Cell death: critical control points, Cell 116 (2004) 205–219. [8] J. Wang, H.J. Chun, W. Wong, D.M. Spencer, M.J. Lenardo, Caspase-10 is an initiator caspase in death receptor signaling, Proc. Natl. Acad. Sci. U. S. A. 98 (2001) 13884–13888. [9] F.C. Kischkel, D.A. Lawrence, A. Tinel, H. LeBlanc, A. Virmani, P. Schow, A. Gazdar, J. Blenis, D. Arnott, A. Ashkenazi, Death receptor recruitment of endogenous caspase-10 and apoptosis initiation in the absence of caspase-8, J. Biol. Chem. 276 (2001) 46639–46646. [10] M.R. Sprick, E. Rieser, H. Stahl, A. Grosse-Wilde, M.A. Weigand, H. Walczak, Caspase-10 is recruited to and activated at the native TRAIL and CD95 death-inducing signalling complexes in a FADD-dependent manner but cannot functionally substitute caspase-8, EMBO J. 21 (2002) 4520–4530. [11] Y. Shikama, M. Yamada, T. Miyashita, Caspase-8 and caspase-10 activate NF-kappaB through RIP, NIK and IKKalpha kinases, Eur. J. Immunol. 33 (2003) 1998–2006. [12] J. Wang, L. Zheng, A. Lobito, F.K. Chan, J. Dale, M. Sneller, X. Yao, J.M. Puck, S.E. Straus, M.J. Lenardo, Inherited human Caspase 10 mutations underlie defective lymphocyte and dendritic cell apoptosis in autoimmune lymphoproliferative syndrome type II, Cell 98 (1999) 47–58. [13] M.S. Shin, H.S. Kim, C.S. Kang, W.S. Park, S.Y. Kim, S.N. Lee, J.H. Lee, J.Y. Park, J.J. Jang, C.W. Kim, S.H. Kim, J.Y. Lee, N.J. Yoo, S.H. Lee, Inactivating mutations of CASP10 gene in non-Hodgkin lymphomas, Blood 99 (2002) 4094–4099. [14] W.S. Park, J.H. Lee, M.S. Shin, J.Y. Park, H.S. Kim, J.H. Lee, Y.S. Kim, S.N. Lee, W. Xiao, C.H. Park, S.H. Lee, N.J. Yoo, J.Y. Lee, Inactivating mutations of the caspase-10 gene in gastric cancer, Oncogene 21 (2002) 2919–2925.
1537
[15] T. Fernandes-Alnemri, R.C. Armstrong, J. Krebs, S.M. Srinivasula, L. Wang, F. Bullrich, L.C. Fritz, J.A. Trapani, K.J. Tomaselli, G. Litwack, E.S. Alnemri, In vitro activation of CPP32 and Mch3 by Mch4, a novel human apoptotic cysteine protease containing two FADD-like domains, Proc. Natl. Acad. Sci. U. S. A. 93 (1996) 7464–7469. [16] P.W. Ng, A.G. Porter, R.U. Janicke, Molecular cloning and characterization of two novel pro-apoptotic isoforms of caspase-10, J. Biol. Chem. 274 (1999) 10301–10308. [17] C. Vincenz, V.M. Dixit, Fas-associated death domain protein interleukin1beta-converting enzyme 2 (FLICE2), an ICE/Ced-3 homologue, is proximally involved in CD95- and p55-mediated death signaling, J. Biol. Chem. 272 (1997) 6578–6583. [18] L.E. Maquat, Nonsense-mediated mRNA decay: splicing, translation and mRNP dynamics, Nat. Rev., Mol. Cell Biol. 5 (2004) 89–99. [19] R.T. Hillman, R.E. Green, S.E. Brenner, An unappreciated role for RNA surveillance, Genome Biol. 5 (2004) R8. [20] P.M. Chaudhary, M.T. Eby, A. Jasmin, A. Kumar, L. Liu, L. Hood, Activation of the NF-kappaB pathway by caspase 8 and its homologs, Oncogene 19 (2000) 4451–4460. [21] H. Wang, X. Sun, Y. Luo, Z. Lin, J. Wu, Adapter protein NRBP associates with Jab1 and negatively regulates AP-1 activity, FEBS Lett. 580 (2006) 6015–6021. [22] W.H. Hu, H. Johnson, H.B. Shu, Activation of NF-kappaB by FADD, Casper, and caspase-8, J. Biol. Chem. 275 (2000) 10838–10844. [23] A.H. Boulares, A.G. Yakovlev, V. Ivanova, B.A. Stoica, G. Wang, S. Iyer, M. Smulson, Role of poly (ADP-ribose) polymerase (PARP) cleavage in apoptosis. Caspase 3-resistant PARP mutant increases rates of apoptosis in transfected cells, J. Biol. Chem. 274 (1999) 22932–22940. [24] M. Germain, E.B. Affar, D. D'Amours, et al., Cleavage of automodified poly(ADP-ribose) polymerase during apoptosis. Evidence for involvement of caspase-7, J. Biol. Chem. 274 (1999) 28379–28384. [25] W.C. Earnshaw, L.M. Martins, S.H. Kaufmann, Mammalian caspases: structure, activation, Annu. Rev. Biochem. 68 (1999) 383–424. [26] N.A. Thornberry, Y. Lazebnik, Caspases: enemies within, Science 271 (1998) 1312–1316. [27] S. Urnowey, T. Ansai, V. Bitko, K. Nakayama, T. Takehara, S. Barik, Temporal activation of anti- and pro-apoptotic factors in human gingival fibroblasts infected with the periodontal pathogen, Porphyromonas gingivalis: potential role of bacterial proteases in host signalling, BMC Microbiol. 6 (2006) 26. [28] P.J. Utz, P. Anderson, Life and death decisions: regulation of apoptosis by proteolysis of signaling molecules, Cell Death Differ. 7 (2000) 589–602. [29] M.P. Boldin, T.M. Goncharov, Y.V. Goltsev, D. Wallach, Involvement of MACH, a novel MORT1/FADD-interacting protease, in Fas/APO-1- and TNF receptor-induced cell death, Cell 85 (1996) 803–815. [30] D. Milhas, O. Cuvillier, N. Therville, P. Clave, M. Thomsen, T. Levade, H. Benoist, B. Segui, Caspase-10 triggers Bid cleavage and caspase cascade activation in FasL-induced apoptosis, J. Biol. Chem. 280 (2005) 19836–19842. [31] M. Muzio, A.M. Chinnaiyan, F.C. Kischkel, K. O'Rourke, A. Shevchenko, J. Ni, C. Scaffidi, J.D. Bretz, M. Zhang, R. Gentz, M. Mann, P.H. Krammer, M.E. Peter, V.M. Dixit, FLICE, a novel FADD-homologous ICE/CED-3-like protease, is recruited to the CD95 (Fas/APO-1) deathinducing signaling complex, Cell 85 (1996) 817–827. [32] D. Himeji, T. Horiuchi, H. Tsukamoto, K. Hayashi, T. Watanabe, M. Harada, Characterization of caspase-8L: a novel isoform of caspase-8 that behaves as an inhibitor of the caspase cascade, Blood 99 (2002) 4070–4078. [33] R.M. Siegel, D.A. Martin, L. Zheng, S.Y. Ng, J. Bertin, J. Cohen, M.J. Lenardo, Death-effector filaments: novel cytoplasmic structures that recruit caspases and trigger apoptosis, J. Cell Biol. 141 (1998) 1243–1453. [34] Y. Shikama, L. Shen, M. Yonetani, J. Miyauchi, T. Miyashita, M. Yamada, Death effector domain-only polypeptides of caspase-8 and -10 specifically inhibit death receptor-induced cell death, Biochem. Biophys. Res. Commun. 29 (2002) 291484–291493. [35] D.W. Chang, Z. Xing, Y. Pan, A. Algeciras-Schimnich, B.C. Barnhart, S. Yaish-Ohad, M.E. Peter, X. Yang, c-FLIP(L) is a dual function regulator for caspase-8 activation and CD95-mediated apoptosis, EMBO J. 21 (2002) 3704–3714. [36] S. Shishodia, B.B. Aggarwal, Nuclear factor-kappaB activation: a question of life or death, J. Biochem. Mol. Biol. 35 (2002) 28–40.