Cloning and characterization of a novel human gene RNF38 encoding a conserved putative protein with a RING finger domain

BBRC Biochemical and Biophysical Research Communications 294 (2002) 1169–1176 www.academicpress.com

Cloning and characterization of a novel human gene RNF38 encoding a conserved putative protein with a RING finger domain Iris Eisenberg,a Hagit Hochner,a Tatjana Levi,b Rodrigo Yelin,c Tamar Kahan,d and Stella Mitrani-Rosenbauma,* a

Molecular Biology Unit, Hadassah Hospital-Mount Scopus, The Hebrew University-Hadassah Medical School, Jerusalem 91240, Israel b Department of Genetics, Harvard Medical School, Boston, MA 02115, USA c Novel Genomics, Compugen Ltd., Tel-Aviv, Israel d Bioinformatics Unit, The Hebrew University-Hadassah Medical School, Jerusalem, Israel Received 20 May 2002

Abstract RING finger (C3 HC4 -type zinc finger) is a variant zinc finger motif present in a large family of functionally distinct proteins. We describe the cloning and characterization of a novel human transcript RNF38 encoding a new member of the RING finger protein family. The complete mRNA consists of about 6.8 kb widely expressed in human tissues as a single transcript, most abundantly in testis. The predicted proline-rich protein consists of 432 amino acid residues with a coiled-coil motif and a RING-H2 motif ðC3 H2 C2 Þ at its carboxy-terminus. High degree homology was found between the human protein and hypothetical peptides from several other species including Rattus norvegicus, Mus musculus, and Drosophila melanogaster, indicating a significant conservation throughout evolution. The RNF38 genomic structure was determined and comprises at least 13 exons extending over more than 65 kb in the genome, 78 kb centromeric to the GNE gene on human chromosome 9p12–p13. The involvement of this chromosomal segment in a large number of human diseases and in particular in various types of malignancies urges the assessment of the potential functional role of RNF38 in these disorders. Ó 2002 Elsevier Science (USA). All rights reserved. Keywords: RING finger motif; RING-H2; RNF38; Chromosome 9; Genomic structure

RING (really interesting new gene) finger is a novel type of zinc-binding motif found in a large set of proteins playing a pivotal role in diverse cellular processes including oncogenesis, development, signal transduction, and apoptosis [1,2]. The RING motifs can be classified into two subgroups according to the presence of a cysteine or a histidine in the fifth position of the domain: C3 HC4 (RING-HC) are mostly nuclear proteins and the motif is involved in both protein–DNA and protein–protein interactions whereas the C3 H2 C3 (RING-H2) variant contains a histidine in place of the fourth cysteine and is able to bind two zinc atoms [2–5]. Recent studies suggested a model implicating a number of different, and functionally distinct, RING finger proteins in ubiquitin and ubiquitin-like pathways and

*

Corresponding author. Fax: +972-2-581-9134. E-mail address: stella@yam-suff.huji.ac.il (S. Mitrani-Rosenbaum).

events. It has been shown that RING proteins are able to mediate ubiquitin-conjugating enzyme (E2)-dependent ubiquitination in vitro [6,7] and thus act as E3 ubiquitin ligases; however, only some of these proteins are likely to function primarily as E3s and the RING finger-mediated ubiquitination probably provides many of these proteins with a self-regulatory function [6]. Various observations showed that genetic alterations in RING finger proteins are implicated in several types of human cancer through different mechanisms: point mutations within the RING finger domain of the tumor suppressor BRCA1 lead to breast and ovarian cancers [8]; human c-Cbl, a RING protein with an SH2 domain, becomes oncogenic when deletions include the RING finger domain [9,10]; v-Cbl lacking a complete RING finger domain induces carcinogenesis through constitutive activation of receptor protein tyrosine kinase (RPTK) signaling. In other cases, fusion of RING protein PML with retinoic acid receptor-a (RARA)

0006-291X/02/$ - see front matter Ó 2002 Elsevier Science (USA). All rights reserved. PII: S 0 0 0 6 - 2 9 1 X ( 0 2 ) 0 0 5 8 4 - 3

1170

I. Eisenberg et al. / Biochemical and Biophysical Research Communications 294 (2002) 1169–1176

underlies acute promyelocytic leukemia [11] and the RING protein TIF1a/T18 becomes oncogenic in mouse when fused with B-RAF proto oncogene [12]. These observations suggest a link between the loss of a structured RING finger domain and tumorigenesis. Multiple regions across human chromosome 9, and in particular the region 9p12–p13, are functionally involved in a large number of human cancer diseases, such as lung cancer [13], hepatocellular carcinoma [14], papillary renal cell carcinoma [15], squamous cell head and neck cancer [16], bladder transitional cell carcinomas [17], melanoma [18], acute lymphoblastic leukemia [19], and prostate cancer [20]. In the course of positional cloning of the gene causing hereditary inclusion body myopathy (IBM2) at the chromosomal segment 9p12–p13 [21,22], we identified a novel member of the RING finger protein family, designated RNF38 (RING finger protein 38). In this study, we describe the cloning and characterization of the 6.8 kb transcript, its expression profile, and its genomic structure. The identification of its functional motifs may give some insights into the biology of the putative encoded protein. Mutational analysis of the coding sequence excluded RNF38 as the disease gene in IBM2. Materials and methods Exon trapping. BAC DNA from clone 257I6 (Research Genetics) was partially digested with Sau3AI (NEB) and separated on 1% agarose gel. Fragments ranging from 3.5 to 10 kb were extracted (Qiaquick Gel Purification Kit, QIAGEN) and shotgun cloned into the BamHI site of the vector pSPL3 (Gibco-BRL) [23,24]. Plasmid DNA was prepared from the BAC/pSPL3 sublibrary and transfected into COS-7 cells. Total RNA was extracted after 24 h with TRI REAGENT (Molecular Research Center). Trapped exons were amplified with vector-specific primers after reverse transcription, cloned using CloneAmp pAMP10 system (Gibco-BRL), and sequenced with T7 and SP6 primers. Similarity searches with known genes and ESTs in GenBank were performed using the BLAST software [25]. cDNA library screening. Human placenta ‘‘Rapid-Screen’’ cDNA library (oligo(dT) primed) (OriGene) was screened by PCR using primers designed from the insert of IMAGE clone 943334, which is included in the assembled cDNA cluster (see Results and discussion section) 943334F: 50 -AAAAAGTCTTTGGAGTTCCA-30 943334R: 50 -GAAGATGGAGAAGTAGAA-30 generating a 542 bp product. Primary screening of the master plate identified a single subplate subsequently screened by the same primer set. Each well contains Escherichia coli glycerol stocks of approximately 50 independent clones which were further plated to identify the relevant cDNA clones by PCR and by standard hybridization procedures, using a radiolabeled probe of 542 bp amplified with the above primers. All clones identified were sequenced using the ABI Prism Big-Dye Terminator Cycle Sequencing Kit (PE Biosystems) and analyzed on an ABI PRISM 377 automated sequencer (PE). Sequences were assembled and analyzed using the SEQMAN and EDITSEQ programs from Lasergene package (DNASTAR). 50 -Rapid amplification of cDNA ends (RACE). RACE cDNA libraries derived from human pancreas and a human prostate cancer cell line (PC-3) were obtained from Clontech. Gene-specific reverse primers,

RACE 1: 50 -GTGTTGCATCGTTCCCCTGAGAAGT-30 RACE 2: 50 -CTGCCTATTTGATGTCATCTCCCATG-30 were used following manufacturer’s instructions. After a second nested PCR amplification, products were fractionated on a 2% agarose gel and bands were excised, cloned in pCR II-TOPO (Invitrogen), and sequenced. Expression studies. To determine the size of the RNF38 transcript and its expression profile, human multiple tissue Northern blots (MTN, Clontech) were used. The blots contained PolyA RNA from the following tissues: heart, brain, placenta, lung, liver, skeletal muscle, kidney, pancreas, spleen, thymus, prostate, testis, uterus, small intestine, colon, and peripheral blood leukocytes. Blots were hybridized independently with four PCR fragments amplified from human lymphocyte cDNA across the putative RNF38 coding sequence composite and deposited under Accession No. AF394047 (see Results and discussion) and also with the inserts of IMAGE cDNA clones 943334, 548053, and 566778 (Research Genetics). Fragment A (nt positions 87–266): 87F 50 -GACTCTGTCATCTCTGG-30 ; 266R 50 -CTCCTATTGTGACTGCTC-30 Fragment B (nt positions 338–475): 338F 50 -GCCAATTCAGCATCTCTAC-30 ; 475R 50 -CTGGAAGAAAGCTTTGAAGTG-30 Fragment C (nt positions 575–774): 575F 50 -GAGATGACATCAAATAGGCAG-30 774R 50 -GCTTGCTGCTGTGCGTAAGG-30 Fragment D (nt positions 4371–4534): 4371F 50 -TGGTTACCTCATTTTGCCGTTTC-30 4534R 50 -TCAAGCCTTCAAATGATTTGGTTAC-30 DNA fragments were gel-purified, 32 P-labeled, and hybridized to Northern blots as recommended by the manufacturer. The housekeeping gene b-actin, radiolabeled by nick translation [26], was used for assessment of RNA levels. Following hybridization, membranes were exposed to X-ray film at )80 °C for 2–10 days. Genomic structure. SEQMAN alignment of RNF38 assembled cDNA with genomic sequences of BAC clones 84P7 (AL161792) and 117L14 (AL354935) allowed the elucidation of RNF38 genomic structure. Identification of new polymorphic markers. As sequences from 9p12–p13 chromosomal region became available by the Human chromosome 9 sequencing group at the Sanger Center, we used the RepeatMasker web server (http://ftp.genome.washington.edu/cgi_bin/ repeatmasker) in order to identify di-, tri-, and tetra-nucleotide repeats. Once identified, PCR amplification primers flanking the repeat regions were designed. Each marker was tested on several unrelated individuals to assess its polymorphic status. Genotyping with the newly identified markers was performed as previously described [27]. Mutation analysis. Genomic DNA and total RNA from IBM2 patients and control individuals were extracted from previously established EBV-transformed lymphoblast cell lines. Total RNA (1–2 lg) was used for first strand cDNA synthesis using Superscript II reverse transcriptase (Gibco-BRL) and subsequent PCR with oligonucleotide primers designed from exonic sequences. RNF38 exons were amplified with specific primer pairs designed from the intronic flanking sequences. All PCR amplifications were carried out in a 50 ll volume containing 100–200 ng genomic DNA or first strand cDNA, 10 pmol of each forward and reverse primers, 0.8 mM dNT’Ps, 1.5 mM MgCl2 , 2.5 U Taq DNA polymerase, and 1 PCR buffer (Perkin–Elmer). Large DNA fragments (>500 bp) were amplified using Expand High Fidelity PCR System (Roche) according to manufacturer’s instructions. PCR products were purified from unincorporated nucleotides and primers by Qiaquick Purification Kit (Qiagen), and directly sequenced. RNF38 was sequenced in three IBM2 affected and three control individuals. Protein data analysis. A BLAST search (www.ncbi.nlm.nih.gov/ BLAST) [25] for related proteins was performed with the deduced 432

I. Eisenberg et al. / Biochemical and Biophysical Research Communications 294 (2002) 1169–1176 amino acid sequence against the non-redundant database. Comparisons of related amino acid sequences and the display of the resulting alignments were performed using the Pileup and Prettybox procedures of the GCG Package (Wisconsin Package Version 10.2, Genetic Computer Group [GCG] Madison, WI) with default parameters. A search for known protein sequence motifs was performed using the InterPro database (integrated resources of proteins domains and functional sites), (http://www.ebi.ac.uk/interpro/) [28]. The search for coiled-coil motif was performed using the GCG Coilscan tool (Wisconsin Package Version 10.2, Genetic Computer Group [GCG] Madison, WI) using a 21 aa window with weighting.

Results and discussion RNF38 cloning To identify putative transcribed sequences across the IBM2 candidate locus at chromosome 9p12–p13 [21], an extensive exon trapping analysis was performed on several BAC clones (47N15, 570K22, and 257I6) from the previously defined genomic interval. Eight putative exons were identified from the analysis carried out with BAC257I6. Following sequencing and BLAST searches, six of the exons showed similarity to several expressed sequence tags (ESTs): three exons were identical to different portions of a single human EST (AA493551, IMAGE clone 943334) and three other exons showed high similarity to three mouse ESTs (AA144752, AA492708, and AA254410, respectively). The remaining two exons did not identify sequences in the database. Complete sequencing of the human cDNA clone (IMAGE 943334) and subsequent comparisons to entries in the non-redundant GenBank database revealed significant overlaps with additional human EST sequences which were assembled using the SEQMAN program. The resulting assembly included an EST (GenBank Accession No. AA081689) derived from a 3300 bp cDNA clone (IMAGE 548053) which was also obtained and fully sequenced. Realignment of

1171

the complete clone sequence to the databases revealed an overlapping clone (IMAGE 566778) which was also sequenced. A polyA tail and a consensus polyadenylation sequence were identified at the 30 end of this clone. Independent Northern blot hybridizations with the insert of clones 943334, 548053, and 566778 gave the same 6.8 kb signal and the same expression profile, thus, suggesting they may be part of the same mature transcript. In an attempt to clone the 6.8 kb full-length coding sequence of the transcript, a human placenta cDNA library was screened using a probe generated from clone 943334. A single cDNA clone of 3191 bp was identified and isolated. Alignment of the clone sequence with the composite cDNA sequence obtained from clones 943334, 548053, and 566778 revealed that it is shorter by 165 bp but confirmed the assembled sequence and determined the 30 end of the transcript. Realignment to the databases identified a new overlapping clone (AK024996) which extended the 50 end of the transcript by additional 726 bases. Further extension of the transcript was achieved by 50 RACE reactions on human cDNA from pancreas and prostate with primers designed from the existing cDNA sequence, heading towards the 50 end. The results from the RACE reactions suggest the occurrence of alternative splicing at the 50 of RNF38 as two different transcript variants were detected. The combination of exons of shorter transcript is also supported by the EST sequences BI459742, BG722531, BF314071, and BE312559. The longer transcript obtained, 610 bp long was incorporated to the assembled sequence and enabled the extension of the transcript size to 4694 bp. No further extension could be reached neither by a modified 50 RACE technique [29] nor by overlap search with ESTs in the database or by exon prediction programs. Thus, the longest transcript obtained lacks about 2 kb at the 50 end of the 6.8 kb complete coding sequence. An open reading frame (ORF) for 432 amino

Table 1 Exon–intron boundaries of the human RNF38 gene Exon no.

Nucleotide positiona

1 2 3 4 5 6 7 8 9 10 11 12 13

1–325 326–475 476–669 670–883 884–1051 1052–1222 1223–1384 1385–1491 1492–1576 1577–1698 1699–1798 1799–4018 4019–4681

a

Exon size (bp) 325 150 194 214 168 171 162 107 85 122 100 2220 663

30 Splice acceptor tttttcccagATATCTCCCG gcattggcagAGTGAAGATA tttatcacagTCCTCCTGTC tcctttaaagCTCCATCAAG tctcttacagATGCTTCAGG ccctcctcagCCTCTGCAAA ccccttgcagCCTTATCCTC ttcactgcagATCAATGCTT accgctgcagGCCCTGTTAA ctttttttagGTGTGTAGTA tgttttgtagGCAAATCGTA tggctttaccATCTTAACTC

Nucleotide position in RNF38 cDNA, Accession No. AF394047.

50 Splice donor

Intron size (bp)

CCCCTCGCAGgtactggccg TTTCTTCCAGgttcttatat ACAGAAGAAGgttagttgat ACATGATCAGgtacaataac GCCTCCTCCAgtaagtctct ATCACGATCGgtaggtatct CTTTGGAGTAgtaagttttc CATATGTGTTgtaagttctt AAATTACGAGgttagtagat AACAGACTTTgtaagtaaat ATGGCTTAAGgtaaagtgat CTGCAAAAAAtttatatctg

9937 14,339 6001 11,776 1303 2971 321 1542 6161 2407 2510 532

189 228 122 199 149 135 119 CTCCTGACCTCAGGTGATCC GAGGCTGAGACAGGATAATCG CCAAGGCTCAGTCTCTGACTC GCAACAGAGCCAGAATCTGTC TCAGTGCTGCATAGCTGC GTGATGGCACCATTGCAC GAATCTAACCACTGCACTCTAG GTTGGTAGTTCCTACACAGC GCAGGCCCTCGCCATAATG GGATAAAACTGTAGTACAAC GTAGAGACAGGCTTTCTCCATG CACGCCACTGCATTCTAG GTTACCTTGGTTGAAACTGAG GCATTTAGAGTGGTGCTC 28 kb 30 to exon 13 26 kb 50 to exon 1 27 kb 50 to exon 1 124 kb 50 to exon 1 142 kb 50 to exon 1 162 kb 50 to exon 1 210 kb 50 to exon 1 BK000387 BK000386 BK000385 BK000388 BK000389 BK000390 BK000391 (GTTT)n (CTAT)n (AT)n (ATTT)n (ATT)n (ATT)n (ATT)n

Allele size (bp) 30 Primer sequence 50 Primer sequence Genomic position Accession No. Repeat type

Table 2 Oligonucleotide primers for novel polymorphic markers in the vicinity of RNF38

62 68 62 64 62 62 62

I. Eisenberg et al. / Biochemical and Biophysical Research Communications 294 (2002) 1169–1176

Annealing temperature (°C)

1172

Fig. 1. Expression profile of RNF38 in various human adult tissues. Northern blots were hybridized with a probe generated by PCR from the insert of IMAGE clone 548053 (nucleotide positions 2510–4146 in Accession No. AF394047). The single transcript detected is about 6.8 kb.

acids was identified extending from nucleotides 563 to 1859, with the ATG at nucleotide 563 having a moderate match to the translation initiation start site consensus for vertebrates (TGCGACCAUGG for RNF38 versus GCCAGCCAUGG) [30] and a consensus polyadenylation signal (AATAAA) at nucleotides 4656–4661 [31]. This transcript has been deposited in the EMBL/DDBJ/GenBank databases under the

Fig. 2. (A) Amino acid sequence of RNF38 with recognized protein domains underlined. Coiled-coil domain, amino acids 325–347 (in red); KIL domain, amino acids 357–363 (in green); RING-H2 domain, amino acids 380–420 (in blue). Asterisks indicate conserved cysteine/ histidine residues of the RING-H2 motif. (B) Alignment of RING finger C3 H2 C3 Homo sapiens RNF38 (AF394047) with its most related homologous proteins in Rattus norvegicus (NP_604462); Mus musculus (NP_598825); Drosophila melanogaster (XP_082352, aa 387–824); Arabidopsis thaliana (NP_566651). Shaded yellow boxes indicate the conserved cysteine/histidine residues of the RING-H2 motif.

I. Eisenberg et al. / Biochemical and Biophysical Research Communications 294 (2002) 1169–1176

Accession No. AF394047 and the gene symbol RNF38 (HGNC approved symbol). Genomic structure of RNF38 The availability of genomic sequences as a result of the Human Genome Project has been an enormous help in determining the genomic structure of a growing list of newly identified transcripts, including RNF38. Alignment of the 4694 bp transcript sequence to genomic BAC clones 84P7 and 117L14 (AL161792 and AL354935) harboring the RNF38 coding sequence revealed that the gene extends over more than 65 kb and consists of at least 13 exons, oriented with the 50 end of the gene towards the centromere and the 30 end towards the telomere of chromosome 9p. The coding region starts at base 88 of exon 3 and extends to the first 63 bp of exon 12. Exon–intron boundaries, except for exons 12 and 13, fully conformed to the consensus

1173

50 splice donor and 30 splice acceptor sequences and followed the GT–AG rules [32] (Table 1). In exon 12, the classical 50 splice donor consensus GT was replaced by TT and in exon 13, the 30 splice acceptor consensus AG was substituted with CC. Expression profile of RNF38 To evaluate the expression profile of RNF38, human multiple tissue Northern blots were independently hybridized with several cDNA probes spanning different portions of the 4694 bp transcript sequence (nucleotide positions: 87–226; 338–475; 575–774; 1550–2085; 2510– 4146; and 4371–4534 in cDNA). As shown in Fig. 1, a single transcript of approximately 6.8 kb in size was detected in all human adult tissues examined. Higher expression was observed in testis whereas only minor expression was detected in liver. In silico analysis of RNF38 ESTs revealed the presence of transcription in

Fig. 3. Alignment of RNF38 predicted amino acid sequence with the four most related protein sequences according to BLAST search. The sequences are: Homo sapiens RNF38 (AF394047); Rattus norvegicus (NP_604462); Mus musculus (NP_598825); Drosophila melanogaster (XP_082352, aa 387– 824); Arabidopsis thaliana (NP_566651). Solid boxes represent identical amino acids; shaded boxes indicate similarity. Dotted lines indicate gaps introduced to maximize alignment.

Annealing temperature (°C)

numerous cerebral regions (medulla, amygdala), fetal tissues (brain, heart, liver, spleen), malignant tissues (neuroblastoma, hepatocellular carcinoma, epitheloid carcinoma, adenocarcinoma, head–neck carcinoma, lung tumor, prostate tumor, melanotic melanoma), and some other adult tissues including retina, foreskin, melanocyte, thyroid, parathyroid, breast, tonsil, and stomach, thus, indicating that RNF38 is a widespread expressed transcript. To further address functional aspects of its biology, a more detailed knowledge of its tissue-specific regulation is needed.

610 387 2028a 389 546 388 413 259 249 220 256 3101 823 GAGCGAGAGAGCGAGGCC CAACAGAAAACAAGGAGACGA CTTCAACATCCTGGATATGCACC TTCAGCTTCTGTATTTCCAAGA CTCTAAAGAGGGTAAGAGTCGG GTAACTTAGGCATTCGTCTGG CTTTCCAACTGAATGCTGTCG CACCCAAAAGCTATAGACAC GCCAAAAGATTGGACACCTGTGG AAAGGAAATTTAGACGTGATGT CACTGAGCTATGAACTTACTC CAAGTGAGTCGGTAGATCTC CCAACAACCCTCTCAACTCC

The putative protein translated from the coding region of RNF38 (Fig. 2A), identical to two partially overlapping uncharacterized entries in the GenBank (CAB66751 and NP_073618), consists of 432 amino acid residues, with a calculated molecular mass of 48.5 kDa

1 2 3 4 5 6 7 8 9 10 11 12 13

RNF38 protein data analysis

50 Primer sequence

The involvement of RNF38 in the pathogenesis of IBM2 was assessed by PCR amplification (Table 3) and direct sequencing of the RNF38 coding region in three affected individuals. Three single nucleotide sequence polymorphisms were found which were also present in control unaffected unrelated individuals and therefore represented non-disease-related polymorphisms: in intron 4, an A ! C substitution, 690 bp before exon 5; in intron 1, a T ! C variation, 3782 bp after exon 1, and in exon 5 at nt 929, a G ! A polymorphism changing amino acid 123 from Ala to Thr. No other causative alteration could be detected, thus, excluding RNF38 as responsible for IBM2. In parallel to this study, the gene termed GNE, approximately 78 kb telomeric to RNF38, was shown to be the disease causing gene in IBM2 [22].

Table 3 Oligonucleotide primers for exon amplification of RNF38

Mutational analysis

Exon

30 Primer sequence

The contiguous genomic sequence generated at NCBI (NT_008387) from overlapping genomic clones sequenced at the Sanger Center, AL135841, AL138834, AL158830, AL161792, and AL354935, enabled the precise mapping of RNF38 124 kb centromeric to the CLTA gene (M20472) [33] and 236 kb telomeric to KIAA0175 gene (D79997) [34] within the 9p12–p13 chromosomal region. Additionally, in an effort to characterize the genomic region surrounding the RNF38 gene and construct a dense IBM2 disease haplotype (data not shown) we have identified seven novel polymorphic markers located in the vicinity of the RNF38 gene (Table 2). The precise location of these markers was determined based on their position in the contig NT_008387.

GGGTCTGTGATCGCCGAG AATTTCTTTCCTGTCTTCGCT TAAGAACTGATCATGTAAATCTGC TGATGGGGAATTTTAGCAGTTA GGACAGGCTAGAAGAGTTAATATAG GAGGTGTGACAATGACAG CAAGAGATGCATGGCCTTAAAGAC GACAGGCTATTTGTAAACGT CTCCCTGTCCTGTTCATTGA GTATTGGAATGCAAAATGTAAAG GTTATGACTACTGAAACCTAC CCTGCAGTTGATGTAATTGC ATCAGGAACACACACACAGG

Product size (bp)

RNF38 genomic mapping

a Exon 3 is 194 bp in size, however, its flanking sequences include Y-chromosome-specific repetitive sequence (HSDYZ1). To avoid unspecific amplification, primers were designed further 50 and 30 in the flanking introns.

I. Eisenberg et al. / Biochemical and Biophysical Research Communications 294 (2002) 1169–1176

62 62 62 60 60 64 64 64 64 58 58 58 58

1174

I. Eisenberg et al. / Biochemical and Biophysical Research Communications 294 (2002) 1169–1176

and an isoelectric point of 7.53. Protein database analysis revealed almost identity to the rat (Rattus norvegicus) sequence (NP_604462), high similarity to the mouse (Mus musculus) protein (NP_598825), and to the Drosophila (Drosophila melanogaster) protein (XP_082352, from position 387 to 824), and significant similarity to the Arabidopsis (Arabidopsis thaliana) expressed protein (NP_566651) (Fig. 3). Most likely these putative proteins are the respective species homologs of human RNF38, thus, demonstrating significant sequence conservation throughout evolution. However, no biological function has been described for any of these proteins (Table 3). A search for known sequence elements performed using the InterPro database revealed the C3 H2 C3 -type RING finger motif (IPR001841) at the 30 terminus of the protein. The RING finger domain is underlined in Fig. 2A (positions 380–420) and emphasized in Fig. 2B. The InterPro analysis indicates that the RNF38 sequence is proline-rich (68 out of 432 aa). In addition to the RING domain, a KIL motif (Lys– X2 –Ile/Leu–X2 –Ile/Leu) that was characterized as accompanying the RING finger motif [35] was found in positions 357–363 (Fig. 2A). Upstream to this motif, in positions 325–347, a coiled-coil motif [36] was found with a probability of 0.97 (Fig. 2A). In spite of these notable primary structural characteristics, no function can be assigned yet to RNF38 while several other members of the RING finger protein family have been shown to play crucial roles in growth, differentiation, signal transduction, and oncogenesis and their role in ubiquitination pathways is under extensive study. The gene encoding for RNF38 protein maps to human chromosome 9p12–p13, a chromosomal segment known to be involved in many common malignancies in human [13–20] and in several familial syndromes including arthrogryposis distal multiplex congenita type 1 (AMCD1) [37], acromesomelic dysplasia (AMDM) [38], autosomal recessive ataxic cerebral palsy (ACP) [39], and a form of distal hereditary motor neuropathy (HMN) found in Jerash [40]. Further characterization of RNF38 and the elucidation of its involvement in these disorders may provide important insights into the implication of the various structural motifs in its possible function.

Acknowledgments We thank Dr. Mira Korner and all the staff from the Laboratory of DNA Analysis at the Institute of Life Sciences, The Hebrew University of Jerusalem, for their skilful assistance in sequencing. This study was supported in part by Hadasit (Medical Research Services Development Co. Ltd., a subsidiary for R&D of Hadassah Medical Organization), by a grant from the Association Francßaise contre les Myopathies (AFM), and by a special donation from Hadassah Southern California, the Persian Group Council, Vanguard II, Healing Spirit, Haifa

1175

Metro Group, Malka Group, Haifa San Diego Group, and the Iranian-American Jewish Federation.

References [1] K.L. Borden, RING domains: master builders of molecular scaffolds? J. Mol. Biol. 295 (2000) 1103–1112. [2] A.J. Saurin, K.L. Borden, M.N. Boddy, P.S. Freemont, Does this have a familiar RING? Trends. Biochem. Sci. 121 (1996) 208–214. [3] P.S. Freemont, I.M. Hanson, J.A. Trowsdale, Novel cysteine-rich sequence motif, Cell 64 (1991) 483–484. [4] P.N. Barlow, B. Luisi, A. Milner, M. Elliott, R. Everett, Structure of the C3HC4 domain by 1H-nuclear magnetic resonance spectroscopy. A new structural class of zinc-finger, J. Mol. Biol. 237 (1994) 201–211. [5] P.S. Freemont, The RING finger. A novel protein sequence motif related to the zinc finger, Ann. N. Y. Acad. Sci. 684 (1993) 174– 192. [6] K.L. Lorick, J.P. Jensen, S. Fang, A.M. Ong, S. Hatakeyama, A.M. Weissman, RING fingers mediate ubiquitin-conjugating enzyme (E2)-dependent ubiquitination, Proc. Natl. Acad. Sci. USA 96 (1999) 11364–11369. [7] P.S. Freemont, RING for destruction?, Curr. Biol. 10 (2000) R84– R87. [8] Y. Miki, J. Swensen, D. Shattuck-Eidens, P.A. Futreal, K. Harshman, S. Tavtigian, Q. Liu, C. Cochran, L.M. Bennett, W. Ding, et al., A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1, Science 266 (1994) 66–71. [9] T.J. Blake, K.G. Heath, W.Y. Langdon, The truncation that generated the v-Cbl oncogene reveals an ability for nuclear transport, DNA binding and acute transformation, EMBO J. 12 (1993) 2017–2026. [10] O.M. Rivero-Lezcano, J.H. Sameshima, A. Marcilla, K.C. Robbins, Physical association between Src homology 3 elements and the protein product of the c-Cbl proto-oncogene, J. Biol. Chem. 269 (1994) 17363–17366. [11] K.L. Borden, M.N. Boddy, J. Lally, N.J. O’Reilly, S. Martin, K. Howe, E. Solomon, P.S. Freemont, The solution structure of the RING finger domain from the acute promyelocytic leukaemia proto-oncoprotein PML, EMBO J. 14 (1995) 1532–1541. [12] B. Le Douarin, C. Zechel, J.M. Garnier, Y. Lutz, L. Tora, P. Pierrat, D. Heery, H. Gronemeyer, P. Chambon, R. Losson, The N-terminal part of TIF1, a putative mediator of the liganddependent activation function (AF-2) of nuclear receptors, is fused to B-raf in the oncogenic protein T18, EMBO J. 14 (1995) 2020–2033. [13] S.K. Kim, J.Y. Ro, B.L. Kemp, J.S. Lee, T.J. Kwon, K.M. Fong, Y. Sekido, J.D. Minna, W.K. Hong, L. Mao, Identification of three distinct tumor suppressor loci on the short arm of chromosome 9 in small cell lung cancer, Cancer Res. 57 (1997) 400– 403. [14] C.T. Liew, H.M. Li, K.W. Lo, C.K. Leow, W.Y. Lau, L.Y. Hin, B.K. Lim, P.B. Lai, J.Y. Chan, X.Q. Wang, S. Wu, J.C. Lee, Frequent allelic loss on chromosome 9 in hepatocellular carcinoma, Int. J. Cancer 81 (1999) 319–324. [15] P. Schraml, D. Muller, R. Bednar, T. Gasser, G. Sauter, M.J. Mihatsch, H. Moch, Allelic loss at the D9S171 locus on chromosome 9p13 is associated with progression of papillary renal cell carcinoma, J. Pathol. 190 (2000) 457–461. [16] S. Jefferies, S.M. Edwards, R.A. Hamoudi, R. A’Hern, W. Foulkes, D. Goldgar, R. Eeles, MPT Collaborators, No germline mutations in CDKN2A (p16) in patients with squamous cell cancer of the head and neck and second primary tumours, Br. J. Cancer 85 (2001) 1383–1386. [17] I. Fadl-Elmula, L. Gorunova, N. Mandahl, P. Elfving, R. Lundgren, F. Mitelman, S. Heim, Karyotypic characterization

1176

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

I. Eisenberg et al. / Biochemical and Biophysical Research Communications 294 (2002) 1169–1176

of urinary bladder transitional cell carcinomas, Genes Chromosom. Cancer 3 (2000) 256–265. P.M. Pollock, J. Welch, N.K. Hayward, Evidence for three tumor suppressor loci on chromosome 9p involved in melanoma development, Cancer Res. 61 (2001) 1154–1161. G. Cazzaniga, M. Daniotti, S. Tosi, G. Giudici, A. Aloisi, E. Pogliani, L. Kearney, A. Biondi, The paired box domain gene PAX5 is fused to ETV6/TEL in an acute lymphoblastic leukemia case, Cancer Res. 61 (2001) 4666–4670. G. Perinchery, N. Bukurov, K. Nakajima, J. Chang, L.C. Li, R. Dahiya, High frequency of deletion on chromosome 9p21 may harbor several tumor-suppressor genes in human prostate cancer, Int. J. Cancer 83 (1999) 610–614. I. Eisenberg, H. Hochner, M. Shemesh, T. Levi, T. Potikha, M. Sadeh, Z. Argov, C.L. Jackson, S. Mitrani-Rosenbaum, Physical and transcriptional map of the hereditary inclusion body myopathy locus on chromosome 9p12–p13, Eur. J. Hum. Genet. 9 (2001) 501–509. I. Eisenberg, N. Avidan, T. Potikha, H. Hochner, M. Chen, T. Olender, M. Barash, M. Shemesh, M. Sadeh, G. Grabov-Nardini, I. Shmilevich, A. Friedmann, G. Karpati, W.G. Bradley, L. Baumbach, D. Lancet, E.B. Asher, J.S. Beckmann, Z. Argov, S. Mitrani-Rosenbaum, The UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase gene is mutated in recessive hereditary inclusion body myopathy, Nat. Genet. 29 (2001) 83–87. T.C. Burn, T.D. Connors, K.W. Klinger, G.M. Landes, Increased exon-trapping efficiency through modifications to the pSPL3 splicing vector, Gene 161 (1995) 183–187. D.M. Church, C.J. Stotler, J.L. Rutter, J.R. Murrell, J.A. Trofatter, A.J. Buckler, Isolation of genes from complex sources of mammalian genomic DNA using exon amplification, Nat. Genet. 6 (1994) 98–105. S.F. Altschul, T.L. Madden, A.A. Schaffer, J. Zhang, Z. Zhang, W. Miller, D.J. Lipman, Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25 (1997) 3389–3402. J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning: A laboratory Manual, second ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. S. Mitrani-Rosenbaum, Z. Argov, A. Blumenfeld, C.E. Seidman, J.G. Seidman, Hereditary inclusion body myopathy maps to chromosome 9p1–q1, Hum. Mol. Genet. 5 (1996) 159–163. R. Apweiler, T.K. Attwood, A. Bairoch, A. Bateman, E. Birney, M. Biswas, P. Bucher, L. Cerutti, F. Corpet, M.D. Croning, R. Durbin, L. Falquet, W. Fleischmann, J. Gouzy, H. Hermjakob, N. Hulo, I. Jonassen, D. Kahn, A. Kanapin, Y. Karavidopoulou, R. Lopez, B. Marx, N.J. Mulder, T.M. Oinn, M. Pagni, F.

[29]

[30] [31]

[32]

[33]

[34]

[35]

[36] [37]

[38]

[39]

[40]

Servant, The InterPro database, an integrated documentation resource for protein families domains and functional sites, Nucleic Acids Res. 29 (2001) 37–40. Y. Eyal, H. Neumann, E. Or, A. Frydman, Inverse single-strand RACE: an adapter-independent method of 50 RACE, Biotechniques 27 (1999) 656–658. M. Kozak, The scanning model for translation: an update, J. Cell Biol. 108 (1989) 229–241. N.J. Proudfoot, High altitude termination. Regulation of transcription elongation and termination: a Keystone Symposium, Keystone, CO, April 19–25, 1991, New Biol. 3 (1991) 851–854. M. Burset, I.A. Seledtsov, V.V. Solovyev, Analysis of canonical and non-canonical splice sites in mammalian genomes, Nucleic Acids Res. 28 (2000) 4364–4375. S. Ponnambalam, A.P. Jackson, M.M. LeBeau, D. Pravtcheva, F.H. Ruddle, C. Alibert, P. Parham, Chromosomal location and some structural features of human clathrin light-chain genes (CLTA and CLTB), Genomics 24 (1994) 440–444. T. Nagase, N. Seki, K. Ishikawa, A. Tanaka, N. Nomura, Prediction of the coding sequences of unidentified human genes. V. The coding sequences of 40 new genes (KIAA0161–KIAA0200) deduced by analysis of cDNA clones from human cell line KG-1, DNA Res. 3 (1996) 17–24. D.H. Macdonald, D. Lahiri, A. Sampath, A. Chase, J. Sohal, N.C. Cross, Cloning and characterization of RNF6, a novel RING finger gene mapping to 13q12, Genomics 58 (1999) 94– 97. A. Lupas, M. Van Dyke, J. Stock, Predicting coiled coils from protein sequences, Science 252 (1991) 1162–1164. M. Bamshad, W.S. Watkins, R.K. Zenger, J.F. Bohnsack, J.C. Carey, B. Otterud, P.A. Krakowiak, M. Robertson, L.B. Jorde, A gene for distal arthrogryposis type I maps to the pericentromeric region of chromosome 9, Am. J. Hum. Genet. 55 (1994) 1153– 1158. S. Kant, A. Polinkovsky, S. Mundlos, B. Zabel, R.T. Thomeer, H.M. Zonderland, L. Shih, A. van Haeringen, M.L. Warman, Acromesomelic dysplasia Maroteaux type maps to human chromosome, Am. J. Hum. Genet. 63 (1998) 155–162. D.P. McHale, A.P. Jackson, Campbell, M.I. Levene, P. Corry, C.G. Woods, N.J. Lench, R.F. Mueller, A.F. Markham, A gene for ataxic cerebral palsy maps to chromosome 9p12–q12, Eur. J. Hum. Genet. 4 (2000) 4267–4272. L.T. Middleton, K. Christodoulou, A. Mubaidin, E. Zamba, M. Tsingis, K. Kyriacou, S. Abu-Sheikh, T. Kyriakides, V. Neocleous, D.M. Georgiou, M. el-Khateeb, A. al-Qudah, K. Horany, Distal hereditary motor neuropathy of the Jerash type, Ann. N. Y. Acad. Sci. 883 (1999) 439–442.