- Email: [email protected]
Molecular cloning and characterization of a novel human gene (HERNA) which encodes a putative RNA-helicase1
Biochimica et Biophysica Acta 1490 (2000) 163^169 www.elsevier.com/locate/bba
Short sequence-paper
Molecular cloning and characterization of a novel human gene (HERNA) which encodes a putative RNA-helicase1 Satoru Matsuda a b
a;2;
*, Yasukatu Ichigotani a;2 , Takahito Okuda a;2 , Tatsuro Irimura b , Shigekazu Nakatsugawa c , Michinari Hamaguchi a
Department of Molecular Pathogenesis Nagoya University School of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya 466-8550 Japan Laboratory of Cancer Biology and Molecular Immunology, Graduate School of Pharmaceutical Sciences, The University of Tokyo, Hongo 7-3-1, Bunkyo-ku, Tokyo 113-0033, Japan c Division of Radiology, Nagoya University Daiko Medical Center, 1-1-20 Daiko-minami, Higashi-ku, Nagoya 461-0047 Japan Received 7 September 1999; received in revised form 12 October 1999; accepted 4 November 1999
Abstract A full-length cDNA encoding a novel protein was isolated and sequenced from a human hepatocellular cDNA library. This cDNA consists of 7037 base pairs and has a predicted open reading frame encoding 1924 amino acids. It possesses an RNA-helicase motif containing a DEXH-box in its amino-terminus and an RNase motif in the carboxy-terminus. From a striking homology to Caenorhabditis elegans K12H4.8, it might be a human homolog of the K12H4.8. PCR-based mapping with both a monochromosomal hybrid panel and radiation hybrid cell panels placed the gene to human chromosome 14q31 near the marker D14S605. ß 2000 Elsevier Science B.V. All rights reserved. Keywords: RNA helicase; RNase; Chromosome 14q31; RH mapping
Helicases catalyze disruption of the hydrogen bonds that facilitate base pairing, in a reaction that strictly coupled to hydrolysis of nucleotide 5P-triphosphate [1,2]. They are ubiquitously distributed over a wide range of organisms and are involved in important biological processes, such as replication, repair, recombination, and transcription of nucleotides [3,4]. Recently, an increasing number of putative helicases have been identi¢ed and isolated from prokaryotic and eukaryotic cells [5]. The identi¢ca* Corresponding author. Fax: 8152-744-2464; E-mail: [email protected] 1 The nucleotide sequence data reported in this paper have been deposited in DDBJ, EMBL and GenBank database under the accession number AB028449. 2 The authors contributed equally to this work.
tion and characterization of a variety of helicases are necessary to elucidate the mechanisms of its cellular function. In the present paper, we describe the cloning and characterization of a novel human helicase gene that encodes a protein belonging to the DEXHbox RNA-helicase family. We named the molecule HERNA as it seemed to be a novel putative helicase with RNase motif. A cDNA fragment was fortuitously discovered in a screen of a hepatocellular (HepG2 cell line) cDNA library using PCR with degenerate oligonucleotides (5P s TGCGAATTCGCCAAGACA/CTGA/C/G/TCC 6 3P and 5P s CCCCTCGAGCAGCTGCTA/C/ G/TTTA/C/G/TCACAT 6 3P) corresponding to p53/ p73 exon domains [6]. The coding sequence of the gene was found to lack any homology to p53/p73 coding domains; however, it represented a potential
0167-4781 / 00 / $ ^ see front matter ß 2000 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 7 - 4 7 8 1 ( 9 9 ) 0 0 2 2 1 - 3
BBAEXP 91342 20-1-00
164
S. Matsuda et al. / Biochimica et Biophysica Acta 1490 (2000) 163^169
Fig. 1. Nucleotide and predicted amino acid sequences of the herna gene. Numbering of the nucleotide and amino acid sequences is shown on the right. The nucleotide sequence data have been submitted to the GenBank/EMBL data libraries under the accession number AB028449. The conserved helicase domains and the RNase domain are double underlined and underlined, respectively. Shaded boxes correspond to the putative RNA binding motif at the carboxy-terminus. In the 3P-non-coding DNA sequence, the polyadenylation-signal (AATAAA) is underscored with a wavy line. The sequence products were run and analyzed in a Pharmacia A.L.F. and a BioApplied A.B.I. DNA sequencers as described in the text. The complete sequence of the cDNA was determined and con¢rmed by primer walking strategy using dideoxy sequencing.
novel helicase. We found preliminarily that the PCR fragments correspond to the helicase mRNA transcripts were well ampli¢ed in HepG2 cells relative to the other cells which we maintained (data not
shown). Subsequently, rhambda libraries of the HepG2 cDNA were screened by hybridization [7,8] using the PCR-generated product as a probe to yield cDNAs encoding full-length and obtained seven pos-
BBAEXP 91342 20-1-00
S. Matsuda et al. / Biochimica et Biophysica Acta 1490 (2000) 163^169
165
Fig. 1 (continued).
itive clones. This library had been produced from poly(A) RNA isolated from HepG2 stimulated by IL-2 (Clonetech). DNA sequencing was performed using a Sequenase Kit (Amersham) and an automatic sequencer for dideoxy sequencing according to the supplier's instruction. The resultant consensus sequence was employed as the correct cDNA sequence. The determined nucleotide sequence and predicted
amino acid sequence are shown in Fig. 1. The cDNA of 7037 bp contains an open reading frame of 5772 bp. The HERNA protein was then predicted to consist of 1924 amino acids. There is a potential ATG start codon favored [9] from position 183 (Fig. 1). The common features of helicase family are seven distinct helicase domains, all of which appear to be
BBAEXP 91342 20-1-00
166
S. Matsuda et al. / Biochimica et Biophysica Acta 1490 (2000) 163^169
Fig. 2. Sequence comparison of HERNA to related proteins. Sequence homology searches were conducted with the protein database at the National Center for Biotechnology Information (National Institute of Health, Bethesda) using the BLASTP and CLUSTAL W sequence database search tools. Amino acids identical in all three and similar residues of the proteins are indicated asterisks and dots, respectively. (A) Multiple sequence alignments of the helicase domains in HERNA, K12H4.8 (accession no. L14331), and C8A4.08C (accession no. Z66569) are shown. (B) Alignment of the RNase domain of HERNA with putative human RNase III (accession no. AF116910) and Bacillus subtilis RNase III (accession no. D64116).
essential for enzymatic function based on mutational studies. These amino acid sequence domains have been identi¢ed in helicases originating from organisms as diverse as Escherichia coli, herpes viruses, and human. The predicted amino acid sequences of HERNA contains the seven consensus sequences for structural motifs of the ATP-dependent RNA-helicase including ATP-binding domain, DEXH-box, and RNA binding domains (Fig. 1, Fig. 2A). More-
over, it contains another RNA binding domain and RNase III motif at the carboxy-terminus (Fig. 1, Fig. 2B). Searching the protein database (SWALL and PIR), it revealed that HERNA had high homology to the K12H4.8 (a hypothetical helicase) in C. elegans and to the C8A4.08C in yeast (Fig. 2A). The identity and similarity of K12H4.8 that had highest homology at present revealed to 54 and 78% in amino acid level with HERNA, respectively. All of these
BBAEXP 91342 20-1-00
S. Matsuda et al. / Biochimica et Biophysica Acta 1490 (2000) 163^169
167
Fig. 2 (continued).
genes might be homologous genes that encode ATPdependent RNA-helicase with RNase III motif (Fig. 2B). Human translation initiation factor eIF-4A, a well known RNA helicase, shows 27% identity at amino acid level to the amino-terminus of HERNA, which contains the helicase motifs. The conservation of the homologous domains among these proteins indicates that they can play an important role for functional activity of the proteins. Interestingly, Provost et al. have found that a part of HERNA (reported as a human homolog of K12H4.8) was interacted with 5-lipoxygenase involved in cellular leukotrien synthesis, suggesting additional roles complementing the putative RNA helicase and RNase activity [10]. The tissue distribution of herna transcript in various tissues was examined by using cycle-limited reverse transcription coupled polymerase reaction (RT-PCR) as described previously [11,12]. Primers used for RT-PCR correspond to the coding region of the gene (5P s TTAACCAGCTGTGGGGAGAGGGCTG 6 3P and 5P s AGCCAGCGATGCAAAGATGGTGTTG 6 3P, the expected product correspond to nt 4899^5433). Template-cDNAs from the human tissues were purchased from Clontech. As shown in Fig. 3, expression of herna mRNA
Fig. 3. Expression of herna in multiple human normal tissues. Reverse transcription and ampli¢cation by PCR with the specific primers for herna gene were carried out for analyzing herna expression (top panel). The seven tissues examined are indicated above each lane. The template cDNA for heart (lane 1), brain (lane 2), placenta (lane 3), lung (lane 4), liver (lane 5), skeletal muscle (lane 6) and kidney (lane 7) of the human normal tissues were purchased from Clontech (Palo Alto, CA, USA). Bottom panel: expression of the G3PDH that was analyzed as a control.
BBAEXP 91342 20-1-00
168
S. Matsuda et al. / Biochimica et Biophysica Acta 1490 (2000) 163^169
Fig. 4. Chromosomal assignment of the herna gene. (A) Representative PCR-based monochromosomal somatic cell hybrid mapping of herna. Primers from the 3P-UTR of the herna cDNA were used. Lanes 1^22 and the lanes X and Y represent human chromosomes. Lanes Ha, Mo and Hu represent cell hybrids containing genomic DNA from hamster, mouse and human, respectively. Lane P shows the control size marker expected for this PCR (a faint band exists). A single product of the expected size was generated from chromosome 14 and human genomic DNA (indicated by ). (B) Chromosomal localization of the herna gene in schematic ideogram of the human chromosome 14. Illustrating the approximate corresponding cytogenetic location of the gene on the chromosome 14q31 by RH panel mapping is shown. Distances are in centimorgans (cM) from the top of the chromosome 14 linkage group.
was detected in brain, heart, lung, liver, pancreas, kidney, and placenta, but not in skeletal muscle by using cycle-limited RT-PCR, suggesting that herna might be ubiquitously expressed, although the levels of expression varied. This expression pro¢le of herna seems to be consistent with that of K12H4.8, a C. elegans homolog of herna (data not shown). Considering its expression pro¢le and high conservation through evolution, HERNA might be involved in a basic function of many cells. To determine the chromosomal localization of the herna gene, PCR-based monochromosomal somatic cell hybrid mapping (Quantum) was performed with a set of 3P-UTR primers. This study indicated that the herna gene is located on human chromosome 14 (Fig. 4A). To re¢ne the further subchromosomal location of the gene, the RH panels (Stanford G3 and
Genebridge 4) were utilized. Both of the linkage analyses of the PCR results (the data vector for herna of the Stanford G3 and the Genebridge 4 RH panels: 00100010000000000001000000111000010010000000000000000000000000110000000001001010000 and 0100100000100001000101000000110110001111000100001000101111111111111111111111101000001, respectively) showed that the herna gene was linked to several markers in the distal region of the chromosome 14q31 with Lod score values higher than 9.0. The most likely order of the re¢ned loci is shown in Fig. 4B. Other genes that have been mapped to chromosome 14q31 include galactosylceramide gene (GALC) which cause Krabble disease [13,14], ovarian cancer G-protein-coupled receptor gene (OGR1) [15] and thyroid-stimulating hormone receptor gene (TSHR) [16]. The gene that presumptively causes
BBAEXP 91342 20-1-00
S. Matsuda et al. / Biochimica et Biophysica Acta 1490 (2000) 163^169
Graves disease was also reported to be mapped to 14q31 near to D14S81 [17,19]. Furthermore, it had been reported that loss of heterozygosity in the D14S62 region may impede the process of metastasis, suggesting the presence of a gene in this region that a¡ects metastatic potential [20]. Our precise chromosomal positioning data would contribute toward positional candidate approaches for these disease genes linked to this locus. And future studies will address the role of HERNA in this point considering the expression pattern of herna as well as the fact that HERNA was shown to interact with 5-lipoxygenase involved in cellular leukotriene synthesis. This work was supported in part by a Grant-inAid for Scienti¢c Research on Priority Areas and for COE Research from the Ministry of Education, Science and Culture of Japan, a Grant under the Monbusho International Scienti¢c Research Program. We thank Yumiko Yamazaki and Ryoko Miyabe for their excellent technical assistance and Dr. Kou Miyazaki for encouragement throughout the study. References [1] J. delaCruz, D. Kressler, P. Linder, Unwinding RNA in Saccharomyces cerevisiae: DEAD-box proteins and related families, Trends Biochem. Sci. 24 (1999) 192^198. [2] T.M. Lohman, K.P. Bjornson, Mechanisms of helicase catalyzed DNA unwinding, Annu. Rev. Biochem. 65 (1996) 169^ 214. [3] T.H. Chang, J. Arenas, J. Abelson, Identi¢cation of ¢ve putative yeast RNA helicase genes, Proc. Natl. Acad. Sci. USA 87 (1990) 1571^1575. [4] D.A. Wassarman, J.A. Steitz, RNA splicing. Alive with DEAD proteins, Nature 349 (1991) 463^464. [5] A. Eisen, M. Sattah, T. Gazitt, K. Neal, P. Szauter, J. Lucchesi, A novel DEAD-box RNA helicase exhibits high sequence conservation from yeast to humans, Biochim. Biophys. Acta 1397 (1998) 131^136. [6] M. Kaghad, H. Bonnet, A. Yang, L. Creancier, J.-C. Biscan, A. Valent, A. Minty, P. Chalon, J.-M. Lelias, X. Dumont, P. Ferrara, F. Mckeon, D. Caput, Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers, Cell 90 (1997) 809^819. [7] S. Kuramochi, S. Matsuda, Y. Matsuda, T. Saitoh, M. Ohsugi, T. Yamamoto, Molecular cloning and characterization of Byp, a murine receptor-type tyrosine phosphatase similar to human DEP-1, FEBS Lett. 378 (1996) 7^14.
169
[8] S. Matsuda, J.K. Tsuzuku, M. Ohsugi, M. Yoshida, M. Emi, Y. Nakamura, M. Onda, Y. Yoshida, A. Nishiyama, T. Yamamoto, Tob, a novel protein that interacts with p185erbB2, is associated with anti-proliferative activity, Oncogene 12 (1996) 705^713. [9] M. Kozak, The scanning model for translation: an update, J. Cell. Biol. 108 (1989) 229^241. [10] P. Provost, B. Samuelsson, O. Radmark, Interaction of 5lipoxygenase with cellular proteins, Proc. Natl. Acad. Sci. USA 96 (1999) 1881^1885. [11] N. Ueki, N. Seki, K. Yano, Y. Masuho, T. Saito, M. Muramatsu, Isolation and characterization of a novel human gene (HFB30) which encodes a protein with a RING ¢nger motif, Biochim. Biophys. Acta 1445 (1999) 232^236. [12] N. Seki, A. Hattori, A. Hayashi, S. Kozuma, M. Ohira, T. Hori, T. Saito, Structure, expression pro¢le and chromosomal location of an isolog of DNA-PKcs interacting protein (KIP) gene, Biochim. Biophys. Acta 1444 (1999) 143^147. [13] D. Jesionek-Kupnicka, A. Majchrowska, J. Krawczyk, J. Wendor¡, M. Barcikowska, S. Lukaszek, P.P. Liberski, Krabbe disease: an ultrastructural study of globoid cells and reactive astrocytes at the brain and optic nerves, Folia Neuropathol. 35 (1997) 155^162. [14] L.A. Cannizzaro, Y.Q. Chen, M.A. Ra¢, D.A. Wenger, Regional mapping of the human galactocerebrosidase gene (GALC) to 14q31 by in situ hybridization, Cytogenet. Cell. Genet. 66 (1994) 244^245. [15] Y. Xu, G. Casey, Identi¢cation of human OGR1, a novel G protein-coupled receptor that maps to chromosome 14, Genomics 35 (1996) 397^402. [16] M.F. Rousseau-Merck, M. Misrahi, H. Loosfelt, M. Atger, E. Milgrom, R. Berger, Assignment of the human thyroid stimulating hormone receptor (TSHR) gene to chromosome 14q31, Genomics 8 (1990) 233^236. [17] Y. Tomer, G. Barbesino, D.A. Greenberg, E. Concepcion, T.F. Davies, Linkage analysis of candidate genes in autoimmune thyroid disease. III. Detailed analysis of chromosome 14 localizes Graves' disease-1 GD-1) close to multinodular goiter-1 (MNG-1). International Consortium for the Genetics of Autoimmune Thyroid Disease, J. Clin. Endocrinol. Metab. 83 (1998) 4321^4327. [18] Y. Tomer, G. Barbesino, M. Keddache, D.A. Greenberg, T.F. Davies, Mapping of a major susceptibility locus for Graves' disease (GD-1) to chromosome 14q31, J. Clin. Endocrinol. Metab. 82 (1997) 1645^1648. [19] N. deRoux, M. Misrahi, N. Chatelain, B. Gross, E. Milgrom, Microsatellites and PCR primers for genetic studies and genomic sequencing of the human TSH receptor gene, Mol. Cell. Endocrinol. 117 (1996) 253^256. [20] P. O'Connell, K. Fischbach, S. Hilsenbeck, S.K. Mohsin, S.A. Fuqua, G.M. Clark, C.K. Osborne, D.C. Allred, Loss of heterozygosity at D14S62 and metastatic potential of breast cancer, J. Natl. Cancer Inst. 91 (1999) 1391^1397.
BBAEXP 91342 20-1-00
Short sequence-paper
Molecular cloning and characterization of a novel human gene (HERNA) which encodes a putative RNA-helicase1 Satoru Matsuda a b
a;2;
*, Yasukatu Ichigotani a;2 , Takahito Okuda a;2 , Tatsuro Irimura b , Shigekazu Nakatsugawa c , Michinari Hamaguchi a
Department of Molecular Pathogenesis Nagoya University School of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya 466-8550 Japan Laboratory of Cancer Biology and Molecular Immunology, Graduate School of Pharmaceutical Sciences, The University of Tokyo, Hongo 7-3-1, Bunkyo-ku, Tokyo 113-0033, Japan c Division of Radiology, Nagoya University Daiko Medical Center, 1-1-20 Daiko-minami, Higashi-ku, Nagoya 461-0047 Japan Received 7 September 1999; received in revised form 12 October 1999; accepted 4 November 1999
Abstract A full-length cDNA encoding a novel protein was isolated and sequenced from a human hepatocellular cDNA library. This cDNA consists of 7037 base pairs and has a predicted open reading frame encoding 1924 amino acids. It possesses an RNA-helicase motif containing a DEXH-box in its amino-terminus and an RNase motif in the carboxy-terminus. From a striking homology to Caenorhabditis elegans K12H4.8, it might be a human homolog of the K12H4.8. PCR-based mapping with both a monochromosomal hybrid panel and radiation hybrid cell panels placed the gene to human chromosome 14q31 near the marker D14S605. ß 2000 Elsevier Science B.V. All rights reserved. Keywords: RNA helicase; RNase; Chromosome 14q31; RH mapping
Helicases catalyze disruption of the hydrogen bonds that facilitate base pairing, in a reaction that strictly coupled to hydrolysis of nucleotide 5P-triphosphate [1,2]. They are ubiquitously distributed over a wide range of organisms and are involved in important biological processes, such as replication, repair, recombination, and transcription of nucleotides [3,4]. Recently, an increasing number of putative helicases have been identi¢ed and isolated from prokaryotic and eukaryotic cells [5]. The identi¢ca* Corresponding author. Fax: 8152-744-2464; E-mail: [email protected] 1 The nucleotide sequence data reported in this paper have been deposited in DDBJ, EMBL and GenBank database under the accession number AB028449. 2 The authors contributed equally to this work.
tion and characterization of a variety of helicases are necessary to elucidate the mechanisms of its cellular function. In the present paper, we describe the cloning and characterization of a novel human helicase gene that encodes a protein belonging to the DEXHbox RNA-helicase family. We named the molecule HERNA as it seemed to be a novel putative helicase with RNase motif. A cDNA fragment was fortuitously discovered in a screen of a hepatocellular (HepG2 cell line) cDNA library using PCR with degenerate oligonucleotides (5P s TGCGAATTCGCCAAGACA/CTGA/C/G/TCC 6 3P and 5P s CCCCTCGAGCAGCTGCTA/C/ G/TTTA/C/G/TCACAT 6 3P) corresponding to p53/ p73 exon domains [6]. The coding sequence of the gene was found to lack any homology to p53/p73 coding domains; however, it represented a potential
0167-4781 / 00 / $ ^ see front matter ß 2000 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 7 - 4 7 8 1 ( 9 9 ) 0 0 2 2 1 - 3
BBAEXP 91342 20-1-00
164
S. Matsuda et al. / Biochimica et Biophysica Acta 1490 (2000) 163^169
Fig. 1. Nucleotide and predicted amino acid sequences of the herna gene. Numbering of the nucleotide and amino acid sequences is shown on the right. The nucleotide sequence data have been submitted to the GenBank/EMBL data libraries under the accession number AB028449. The conserved helicase domains and the RNase domain are double underlined and underlined, respectively. Shaded boxes correspond to the putative RNA binding motif at the carboxy-terminus. In the 3P-non-coding DNA sequence, the polyadenylation-signal (AATAAA) is underscored with a wavy line. The sequence products were run and analyzed in a Pharmacia A.L.F. and a BioApplied A.B.I. DNA sequencers as described in the text. The complete sequence of the cDNA was determined and con¢rmed by primer walking strategy using dideoxy sequencing.
novel helicase. We found preliminarily that the PCR fragments correspond to the helicase mRNA transcripts were well ampli¢ed in HepG2 cells relative to the other cells which we maintained (data not
shown). Subsequently, rhambda libraries of the HepG2 cDNA were screened by hybridization [7,8] using the PCR-generated product as a probe to yield cDNAs encoding full-length and obtained seven pos-
BBAEXP 91342 20-1-00
S. Matsuda et al. / Biochimica et Biophysica Acta 1490 (2000) 163^169
165
Fig. 1 (continued).
itive clones. This library had been produced from poly(A) RNA isolated from HepG2 stimulated by IL-2 (Clonetech). DNA sequencing was performed using a Sequenase Kit (Amersham) and an automatic sequencer for dideoxy sequencing according to the supplier's instruction. The resultant consensus sequence was employed as the correct cDNA sequence. The determined nucleotide sequence and predicted
amino acid sequence are shown in Fig. 1. The cDNA of 7037 bp contains an open reading frame of 5772 bp. The HERNA protein was then predicted to consist of 1924 amino acids. There is a potential ATG start codon favored [9] from position 183 (Fig. 1). The common features of helicase family are seven distinct helicase domains, all of which appear to be
BBAEXP 91342 20-1-00
166
S. Matsuda et al. / Biochimica et Biophysica Acta 1490 (2000) 163^169
Fig. 2. Sequence comparison of HERNA to related proteins. Sequence homology searches were conducted with the protein database at the National Center for Biotechnology Information (National Institute of Health, Bethesda) using the BLASTP and CLUSTAL W sequence database search tools. Amino acids identical in all three and similar residues of the proteins are indicated asterisks and dots, respectively. (A) Multiple sequence alignments of the helicase domains in HERNA, K12H4.8 (accession no. L14331), and C8A4.08C (accession no. Z66569) are shown. (B) Alignment of the RNase domain of HERNA with putative human RNase III (accession no. AF116910) and Bacillus subtilis RNase III (accession no. D64116).
essential for enzymatic function based on mutational studies. These amino acid sequence domains have been identi¢ed in helicases originating from organisms as diverse as Escherichia coli, herpes viruses, and human. The predicted amino acid sequences of HERNA contains the seven consensus sequences for structural motifs of the ATP-dependent RNA-helicase including ATP-binding domain, DEXH-box, and RNA binding domains (Fig. 1, Fig. 2A). More-
over, it contains another RNA binding domain and RNase III motif at the carboxy-terminus (Fig. 1, Fig. 2B). Searching the protein database (SWALL and PIR), it revealed that HERNA had high homology to the K12H4.8 (a hypothetical helicase) in C. elegans and to the C8A4.08C in yeast (Fig. 2A). The identity and similarity of K12H4.8 that had highest homology at present revealed to 54 and 78% in amino acid level with HERNA, respectively. All of these
BBAEXP 91342 20-1-00
S. Matsuda et al. / Biochimica et Biophysica Acta 1490 (2000) 163^169
167
Fig. 2 (continued).
genes might be homologous genes that encode ATPdependent RNA-helicase with RNase III motif (Fig. 2B). Human translation initiation factor eIF-4A, a well known RNA helicase, shows 27% identity at amino acid level to the amino-terminus of HERNA, which contains the helicase motifs. The conservation of the homologous domains among these proteins indicates that they can play an important role for functional activity of the proteins. Interestingly, Provost et al. have found that a part of HERNA (reported as a human homolog of K12H4.8) was interacted with 5-lipoxygenase involved in cellular leukotrien synthesis, suggesting additional roles complementing the putative RNA helicase and RNase activity [10]. The tissue distribution of herna transcript in various tissues was examined by using cycle-limited reverse transcription coupled polymerase reaction (RT-PCR) as described previously [11,12]. Primers used for RT-PCR correspond to the coding region of the gene (5P s TTAACCAGCTGTGGGGAGAGGGCTG 6 3P and 5P s AGCCAGCGATGCAAAGATGGTGTTG 6 3P, the expected product correspond to nt 4899^5433). Template-cDNAs from the human tissues were purchased from Clontech. As shown in Fig. 3, expression of herna mRNA
Fig. 3. Expression of herna in multiple human normal tissues. Reverse transcription and ampli¢cation by PCR with the specific primers for herna gene were carried out for analyzing herna expression (top panel). The seven tissues examined are indicated above each lane. The template cDNA for heart (lane 1), brain (lane 2), placenta (lane 3), lung (lane 4), liver (lane 5), skeletal muscle (lane 6) and kidney (lane 7) of the human normal tissues were purchased from Clontech (Palo Alto, CA, USA). Bottom panel: expression of the G3PDH that was analyzed as a control.
BBAEXP 91342 20-1-00
168
S. Matsuda et al. / Biochimica et Biophysica Acta 1490 (2000) 163^169
Fig. 4. Chromosomal assignment of the herna gene. (A) Representative PCR-based monochromosomal somatic cell hybrid mapping of herna. Primers from the 3P-UTR of the herna cDNA were used. Lanes 1^22 and the lanes X and Y represent human chromosomes. Lanes Ha, Mo and Hu represent cell hybrids containing genomic DNA from hamster, mouse and human, respectively. Lane P shows the control size marker expected for this PCR (a faint band exists). A single product of the expected size was generated from chromosome 14 and human genomic DNA (indicated by ). (B) Chromosomal localization of the herna gene in schematic ideogram of the human chromosome 14. Illustrating the approximate corresponding cytogenetic location of the gene on the chromosome 14q31 by RH panel mapping is shown. Distances are in centimorgans (cM) from the top of the chromosome 14 linkage group.
was detected in brain, heart, lung, liver, pancreas, kidney, and placenta, but not in skeletal muscle by using cycle-limited RT-PCR, suggesting that herna might be ubiquitously expressed, although the levels of expression varied. This expression pro¢le of herna seems to be consistent with that of K12H4.8, a C. elegans homolog of herna (data not shown). Considering its expression pro¢le and high conservation through evolution, HERNA might be involved in a basic function of many cells. To determine the chromosomal localization of the herna gene, PCR-based monochromosomal somatic cell hybrid mapping (Quantum) was performed with a set of 3P-UTR primers. This study indicated that the herna gene is located on human chromosome 14 (Fig. 4A). To re¢ne the further subchromosomal location of the gene, the RH panels (Stanford G3 and
Genebridge 4) were utilized. Both of the linkage analyses of the PCR results (the data vector for herna of the Stanford G3 and the Genebridge 4 RH panels: 00100010000000000001000000111000010010000000000000000000000000110000000001001010000 and 0100100000100001000101000000110110001111000100001000101111111111111111111111101000001, respectively) showed that the herna gene was linked to several markers in the distal region of the chromosome 14q31 with Lod score values higher than 9.0. The most likely order of the re¢ned loci is shown in Fig. 4B. Other genes that have been mapped to chromosome 14q31 include galactosylceramide gene (GALC) which cause Krabble disease [13,14], ovarian cancer G-protein-coupled receptor gene (OGR1) [15] and thyroid-stimulating hormone receptor gene (TSHR) [16]. The gene that presumptively causes
BBAEXP 91342 20-1-00
S. Matsuda et al. / Biochimica et Biophysica Acta 1490 (2000) 163^169
Graves disease was also reported to be mapped to 14q31 near to D14S81 [17,19]. Furthermore, it had been reported that loss of heterozygosity in the D14S62 region may impede the process of metastasis, suggesting the presence of a gene in this region that a¡ects metastatic potential [20]. Our precise chromosomal positioning data would contribute toward positional candidate approaches for these disease genes linked to this locus. And future studies will address the role of HERNA in this point considering the expression pattern of herna as well as the fact that HERNA was shown to interact with 5-lipoxygenase involved in cellular leukotriene synthesis. This work was supported in part by a Grant-inAid for Scienti¢c Research on Priority Areas and for COE Research from the Ministry of Education, Science and Culture of Japan, a Grant under the Monbusho International Scienti¢c Research Program. We thank Yumiko Yamazaki and Ryoko Miyabe for their excellent technical assistance and Dr. Kou Miyazaki for encouragement throughout the study. References [1] J. delaCruz, D. Kressler, P. Linder, Unwinding RNA in Saccharomyces cerevisiae: DEAD-box proteins and related families, Trends Biochem. Sci. 24 (1999) 192^198. [2] T.M. Lohman, K.P. Bjornson, Mechanisms of helicase catalyzed DNA unwinding, Annu. Rev. Biochem. 65 (1996) 169^ 214. [3] T.H. Chang, J. Arenas, J. Abelson, Identi¢cation of ¢ve putative yeast RNA helicase genes, Proc. Natl. Acad. Sci. USA 87 (1990) 1571^1575. [4] D.A. Wassarman, J.A. Steitz, RNA splicing. Alive with DEAD proteins, Nature 349 (1991) 463^464. [5] A. Eisen, M. Sattah, T. Gazitt, K. Neal, P. Szauter, J. Lucchesi, A novel DEAD-box RNA helicase exhibits high sequence conservation from yeast to humans, Biochim. Biophys. Acta 1397 (1998) 131^136. [6] M. Kaghad, H. Bonnet, A. Yang, L. Creancier, J.-C. Biscan, A. Valent, A. Minty, P. Chalon, J.-M. Lelias, X. Dumont, P. Ferrara, F. Mckeon, D. Caput, Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers, Cell 90 (1997) 809^819. [7] S. Kuramochi, S. Matsuda, Y. Matsuda, T. Saitoh, M. Ohsugi, T. Yamamoto, Molecular cloning and characterization of Byp, a murine receptor-type tyrosine phosphatase similar to human DEP-1, FEBS Lett. 378 (1996) 7^14.
169
[8] S. Matsuda, J.K. Tsuzuku, M. Ohsugi, M. Yoshida, M. Emi, Y. Nakamura, M. Onda, Y. Yoshida, A. Nishiyama, T. Yamamoto, Tob, a novel protein that interacts with p185erbB2, is associated with anti-proliferative activity, Oncogene 12 (1996) 705^713. [9] M. Kozak, The scanning model for translation: an update, J. Cell. Biol. 108 (1989) 229^241. [10] P. Provost, B. Samuelsson, O. Radmark, Interaction of 5lipoxygenase with cellular proteins, Proc. Natl. Acad. Sci. USA 96 (1999) 1881^1885. [11] N. Ueki, N. Seki, K. Yano, Y. Masuho, T. Saito, M. Muramatsu, Isolation and characterization of a novel human gene (HFB30) which encodes a protein with a RING ¢nger motif, Biochim. Biophys. Acta 1445 (1999) 232^236. [12] N. Seki, A. Hattori, A. Hayashi, S. Kozuma, M. Ohira, T. Hori, T. Saito, Structure, expression pro¢le and chromosomal location of an isolog of DNA-PKcs interacting protein (KIP) gene, Biochim. Biophys. Acta 1444 (1999) 143^147. [13] D. Jesionek-Kupnicka, A. Majchrowska, J. Krawczyk, J. Wendor¡, M. Barcikowska, S. Lukaszek, P.P. Liberski, Krabbe disease: an ultrastructural study of globoid cells and reactive astrocytes at the brain and optic nerves, Folia Neuropathol. 35 (1997) 155^162. [14] L.A. Cannizzaro, Y.Q. Chen, M.A. Ra¢, D.A. Wenger, Regional mapping of the human galactocerebrosidase gene (GALC) to 14q31 by in situ hybridization, Cytogenet. Cell. Genet. 66 (1994) 244^245. [15] Y. Xu, G. Casey, Identi¢cation of human OGR1, a novel G protein-coupled receptor that maps to chromosome 14, Genomics 35 (1996) 397^402. [16] M.F. Rousseau-Merck, M. Misrahi, H. Loosfelt, M. Atger, E. Milgrom, R. Berger, Assignment of the human thyroid stimulating hormone receptor (TSHR) gene to chromosome 14q31, Genomics 8 (1990) 233^236. [17] Y. Tomer, G. Barbesino, D.A. Greenberg, E. Concepcion, T.F. Davies, Linkage analysis of candidate genes in autoimmune thyroid disease. III. Detailed analysis of chromosome 14 localizes Graves' disease-1 GD-1) close to multinodular goiter-1 (MNG-1). International Consortium for the Genetics of Autoimmune Thyroid Disease, J. Clin. Endocrinol. Metab. 83 (1998) 4321^4327. [18] Y. Tomer, G. Barbesino, M. Keddache, D.A. Greenberg, T.F. Davies, Mapping of a major susceptibility locus for Graves' disease (GD-1) to chromosome 14q31, J. Clin. Endocrinol. Metab. 82 (1997) 1645^1648. [19] N. deRoux, M. Misrahi, N. Chatelain, B. Gross, E. Milgrom, Microsatellites and PCR primers for genetic studies and genomic sequencing of the human TSH receptor gene, Mol. Cell. Endocrinol. 117 (1996) 253^256. [20] P. O'Connell, K. Fischbach, S. Hilsenbeck, S.K. Mohsin, S.A. Fuqua, G.M. Clark, C.K. Osborne, D.C. Allred, Loss of heterozygosity at D14S62 and metastatic potential of breast cancer, J. Natl. Cancer Inst. 91 (1999) 1391^1397.
BBAEXP 91342 20-1-00