Cloning and characterization of a novel Lustrin A gene from Haliotis discus hannai

Comparative Biochemistry and Physiology, Part B 240 (2020) 110385

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part B journal homepage: www.elsevier.com/locate/cbpb

Cloning and characterization of a novel Lustrin A gene from Haliotis discus hannai

T

Xiangnan Zhenga,b, Shuxian Zhaoa,b, Shanshan Leia,b, Ruijuan Maa,b, Lemian Liua,b, Youping Xiea,b, Xinguo Shia,b,⁎, Jianfeng Chena,b,⁎ a b

Fujian Engineering and Technology Research Center for Comprehensive Utilization of Marine Products Waste, Fuzhou University, Fuzhou, Fujian 350108, China Fuzhou Industrial Technology Innovation Center for High Value Utilization of Marine Products, Fuzhou University, Fuzhou, Fujian 350108, China

ARTICLE INFO

ABSTRACT

Keywords: Biomineralization Ocean warming Ocean acidification Lustrin A

Lustrin A is the first nacre protein with specific structure and amino acid residue content that was identified in abalone; since its identification, homologs have been found in several abalone species. In this study, we isolated and cloned the complete cDNA of Lustrin A from Haliotis discus hannai, which was named Hdh-Lustrin A. HdhLustrin A has characteristic cysteine- and proline-rich domains, glycine- and serine-rich domains, and a whey acidic protein (WAP)-like C-terminus. The cysteine- and proline-rich domains showed internal similarity repeats that arrayed in gene coding region, and the phylogenetic tree of these repeats indicated that the similarity of structural repetitive unit components in different abalone species, reflecting their evolutionary distance. A tissue distribution analysis showed that the mRNA level of Hdh-Lustrin A has tissue-specific expression in mantle. Under lipopolysaccharide (LPS) challenge, Hdh-Lustrin A showed a significantly increase, while it showed a more complex pattern with two peaks in the process of shell regeneration. Moreover, acidification and warming raised the expression level of Hdh-Lustrin A in shell regeneration in two different manners; acidification raised the gene expression in quick response, in contrast the long run in warming treatment. Similar pattern also has been detected in immune reaction and the thermal treatments. These results suggest that the Hdh-Lustrin A is a nacre protein, which can be distinguished by its cysteine- and proline-rich domain. It involves in shell regeneration and innate immunity in abalone, and its expression pattern during shell regeneration can be disrupted by physicochemical properties of the environment.

1. Introduction Most mollusk species form an exoskeleton in the form of a shell, which acts as the only supporting and protecting structure due to its excellent mechanical properties and also predetermines the individual size. The shell is formed by the mantle, and the deposition process of calcium carbonate is regulated by mantle secretory proteins, which are either called biomineralization-related protein or matrix protein (Blank et al., 2010). Trace matrix proteins in the shell confer the excellent mechanical strength of the shell compared to inorganic minerals. These also produce nacre nanoscale materials by defining the nucleating position, polymorph and atomic lattice orientation, and deposition speed (Falini et al., 1996). The expression of matrix proteins reflects the proceeding of shell growth, and abnormal expression of matrix proteins results in small or weak shells with irregular structure. Therefore, studies on matrix protein expression have been a major topic for decades,

and will continue to provide new insight into biomineralization. Haliotis spp. is a model genus of gastropoda for the study of biomineralization (Gaume et al., 2014). Moreover, it is an important aquaculture species and particularly popular in Asia (Choi et al., 2015). The shell of Haliotis spp. is of great value for gemology and in Chinese traditional medicine, and the quality and size of the shell are important features of abalone culture when considering the biological function of the shell for the mollusk. Consequently, the shell of Haliotis spp. is valuable not only for scientific investigations but also for economic reasons. However, ocean acidification is continually aggravating, which affects shell growth. The pH of the ocean surface has been predicted to gradually decline by 0.3 to 0.4 units by the year 2100 by the 4th and the 5th reports of the intergovernmental panel on climate change (IPCC) (IPCC, 2007, 2014). The growth and production of abalone are negatively affected by the lowered pH due to the dissolution and abnormal formation of their shells (Taylor et al., 2015). Furthermore, ocean

⁎ Corresponding authors at: Fujian Engineering and Technology Research Center for Comprehensive Utilization of Marine Products Waste, Fuzhou University, Fuzhou, Fujian 350108, China E-mail addresses: [email protected] (X. Shi), [email protected] (J. Chen).

https://doi.org/10.1016/j.cbpb.2019.110385 Received 18 July 2019; Received in revised form 2 October 2019; Accepted 5 November 2019 Available online 07 November 2019 1096-4959/ © 2019 Elsevier Inc. All rights reserved.

Comparative Biochemistry and Physiology, Part B 240 (2020) 110385

X. Zheng, et al.

acidification is always accompanied by ocean warming, which also results in mass mortality of abalone (Zhang et al., 2019). However, the effects of ocean warming on shell formation and the synergies between ocean warming and acidification in abalone still remain unclear. Considering the important role of matrix proteins in abalone biomineralization, many of them have been purified or cloned before (Gaume et al., 2014). Lustrin A is the first nacreous protein that was cloned and characterized from abalone (H. rufescens) (Shen et al., 1997) and attracted strong researcher attention due to its specific alternation of cysteine-rich and proline-rich repeats; its homologs were also found in many other abalone species (Gaume et al., 2014). Moreover, the nacre proteins Perlustrin and Perlucin were purified from H. laevigata (Weiss et al., 2000), and both their sequence and function of N-terminus were analyzed and predicted. The purified Perlucin was proved to induce the precipitation of calcium carbonate, the confluence of different aragonite layers and new nuclear layers in vitro. In H. rufescens, the protein structure of the N-terminus of AP7 and AP4 was confirmed via nuclear magnetic resonance (NMR) structure analysis, and putative Ca2+ interaction regions were detected (Wustman et al., 2004). However, most of these studies focused on the structure of proteins and their effects on in vitro calcium carbonate crystallization. The gene expression pattern during growth, development, damage repair, and response to stress still remain largely uninvestigated (Gaume et al., 2014). In H. tuberculata, a Lustrin A was found and its specific expression was detected at the nacre-forming region during juvenile stages, suggesting a biomineralization-relevant function (Gaume et al., 2014). However, more protein expression patterns under different physiological processes need to be evaluated. This study cloned and identified a Lustrin A gene from H. discus hannai, which was named Hdh-Lustrin A. It has the Lustrin A property of alternate cysteine-rich and proline-rich repeats and all repeats of reported Lustrin A homologs were aligned to identify the origin and duplication relationships between these repeats among species. To study the function of Lustrin A in biomineralization, etching tests were used to stimulate shell formation and the gene expression pattern of Lustrin A was detected by qRT-PCR. Moreover, the gene expression profile during shell repair under high temperature and low pH were studied to investigate the effects of environmental stress on shell growth. The specific expression pattern results demonstrated that Lustrin A plays an important role in shell regeneration and the results indicate the severity of the disturbance of physico-chemical characteristics of the environment on biomineralization.

were collected at different time intervals, 3 samples were collected randomly from each parallel. The samples collected immediately after notching were used as control zero, and other time intervals stood for the time after notching. No individual was dead during this treatment. The whole mantle tissue covering the notch was cut with a scalpel, rapidly frozen in liquid nitrogen, and stored at −80 °C.

2. Materials and methods

2.6. Phylogenetic analysis of characteristic domains or whole proteins

2.1. Animals

The deduced amino acid sequence structure was predicted via comparison with gastropods Lustrin A shown in Table 2. Top hits were collected and aligned with our sequences using Clustal X. Evolutionary analyses were conducted using MEGA 7 (Kumar et al., 2016) with the neighbor joining (NJ) method (Saitou and Nei, 1987) and MrBayes (http://nbisweden.github.io/MrBayes/) with Bayesian method. Support of nodes >70% in NJ bootstrap values and >0.70 in Bayesian posterior probability are both shown.

2.3. Lipopolysaccharide (LPS) challenge A total of 50 adult abalones were used for the LPS challenge assay. Each of them was injected into the foot with 0.1 mg/mL LPS (SigmaAldrich, Shanghai, China) diluted with PBS and then immediately returned to aquaria (20 °C, pH = 8.1). The mantles of five individuals were collected at 0, 3, 6, 12, 24, 36, 48, and 96 h after the challenge. No individual was dead during this treatment. The tissues were rapidly frozen in liquid nitrogen, and stored at −80 °C. 2.4. Nucleic acid sample preparation Total RNA of each tissue was extracted with Trizol (Invitrogen, Carlsbad, CA, USA), according to the manufacturer's protocol. The cDNA templates were obtained via reverse transcription with the PrimeScript® RT Reagent Kit (Takara, Dalian, China) and used for molecular cloning and quantitative real-time PCR (qRT-PCR). The 3′ and 5′ rapid amplification of cDNA ends (RACE) was performed using a BD SMART RACE cDNA Amplification Kit (Clontech, Palo Alto, CA, USA) to obtain the complete mRNA. 1 μg total RNA was used to synthesis 20 μL cDNA template, and the disturbance of genomic DNA in qRT-PCR was excluded by genomic DNAse treatment step in PrimeScript® RT Reagent Kit (Takara, Dalian, China). 2.5. Cloning the Hdh-Lustrin A complete coding DNA sequence The primers were designed based on the conserved domain in a Lustrin A homolog (GenBank accession no: AAB95154.1). The PCR reactions were conducted using mantle cDNA as template. A secondary nested PCR was conducted for higher specificity using the diluted primary PCR product as template. The complete coding DNA sequence (CDS) was obtained by assembling overlapping fragments. The primers used for cloning are shown in Table 1. The ORF of the complete CDS was analyzed using ORF finder (https://www.ncbi.nlm.nih.gov/ orffinder/).

Live adult abalones, Haliotis discus hannai (approximately 3–4 cm in length), were purchased from Shunzhoushuichan abalone Farm, Dongshan, Fujian Province, China. The animals were maintained in aerated 20 °C artificial seawater (3% salinity) for 3 days and then used for experiments. 2.2. Induction of shell regeneration under normal, thermal, or acidification treatments

2.7. qRT-PCR

A V-shaped notch was made in the shell growth edge, carefully avoiding the breath holes. The notch damaged the both the prismatic and nacre layers but not the mantle. Then, the abalones were immediately returned to aquaria with different temperatures and pH values. The temperature was maintained via a temperature control system while the pH was maintained via continuous inflow of CO2. The temperature gradients were 20 °C, 24 °C, and 26 °C, and the acidity gradients were pH = 8.1, 7.8, and 7.5. Two factors showed crossover and 6 treatment groups were set up. Each treatment group had 3 parallels with 10 notched individuals. When samples of these treatment groups

qRT-PCR was performed on a LightCycler®480 II System (Roche Diagnostics, Indianapolis, IN, USA) with the SYBR Premix Ex Taq II (Tli RNaseH Plus) (Takara) and gene-specific primers listed in Table 1. In the qRT-PCR, 2 μL cDNA was used as the template for 20 μL volume. qRT-PCR was carried out as 1 cycle of 30s at 95 °C, amplification for 40 cycles (95 °C, 5 s; 60 °C, 20 s), and then 0 s at 95 °C, 15 s at 65 °C and 0 s at 95 °C for dissolution curve analysis. 3 sample replicates were performed to exclude measurement errors and operation error. Cycle threshold (Ct) values were calculated for each reaction and normalized to an internal control (β-actin). The relative gene expression was 2

Comparative Biochemistry and Physiology, Part B 240 (2020) 110385

X. Zheng, et al.

Table 1 Primer sequences used for molecular cloning. Primer names

Sequence

Description

lus-1333f lus-2153f lus-4139r lus-145r lus-1350r lus-2415r lus-3158r lustrinA-cf lustrinA-cr actin-qf actin-qr GAPDH-qf GAPDH-qr lus-qf lus-qr

5′5′5′5′5′5′5′5′5′5′5′5′5′5′5′-

for 3’-RACE for 3’-RACE for 5’-RACE for 5’-RACE for 5’-RACE for 5’-RACE for 5’-RACE for sequence confirm for sequence confirm internal control primers for qRT-PCR internal control primers for qRT-PCR internal control primers for qRT-PCR internal control primers for qRT-PCR gene specific primers for qRT-PCR gene specific primers for qRT-PCR

CCAAGCCCATCCCCCCCTAC -3′ TGGGAAAACCAGCGTTGGATGA -3′ AATCTTTTGCCTGAGCGTCCTTGTTT -3′ GAAGACTGCAACTGAACACTAACCGA -3′ AGGGGGGGATGGGCTTGGTG -3′ GGGGCAGCCAGGTCGTCTACAGT -3′ CCAGACCCCGAGCCAGACCCT -3′ ATGGAGCGTTTTCTCTGGGTCCT -3′ CTAGACAAAGCAGGGCTTCTGGC -3′ GACGAAGATGTTGCTGCGTTGG -3′ CGTAGATGGGGACAGTGTGGGT -3′ CAGCCCAGAACATCATCCCCTC -3′ GGACGACACGGTTGGAATAGCC -3′ TGTCGTCTCGTGGCGTATTG -3′ TGGGGTAACATCTGAACTCCGT -3′

Lustrin A, Hdh-Lustrin A was shorter and liked another transcript of Hrf-Lustrin A with two cysteine- and proline-rich repeat deletions. However, no other longer or shorter Lustrin A transcripts were found in H. discus hannai. To analyze the Hdh-Lustrin A modular structure more deeply, the cysteine-rich domains (C1-C8) and proline-rich domains (P1-P6) in Hdh-Lustrin A were aligned, respectively. The result indicated that C1 to C8 shared many conserved residues, including 12 cysteine residues and a potential N-glycosylation site NCT at the N-terminus (Fig. S2a). However, although the proline percentage of each proline-rich domain is high, the proline-rich domains from each structural repetitive unit are little conserved (Fig. S2b). And these results were similar in that in H. rufescens.

Table 2 GenBank accession number of gastropods Lustrin A used for the phylogenetic analysis. Species name

GenBank accession number

H. asinina H. laevigata H. ovina H. rubra H. rufescens H. tuberculata (partial) H. varia Patella vulgate (partial)

ARF06729.1 ARF06732.1 ARF06735.1 ARF06733.1 AAB95154.1 ADM52208.2 ARF06734.1 CCJ09595.1

calculated using the comparative Ct method (Liu and Saint, 2002; Livak and Schmittgen, 2001; Pfaffl, 2001). And a second internal control (glyceraldehyde-3-phosphate dehydrogenase, GAPDH) was used to corroborate the results.

3.2. The phylogenetic analysis of Lustrin A homologs and their domain repeats The relationships among reported Lustrin A proteins and HdhLustrin A were further confirmed by a phylogenetic tree of seven Haliotis spp. species (Fig. 2). Lustrin A from H. discus hannai and H. rufescens formed a separate branch from those of the main species, suggesting their high conservation. In the remaining Lustrin A homologs, those from H. rubra and H. laevigata formed one branch, and those from H. varia and H. ovina formed a neighboring H. asinine branch. Considering the respective similarity among cysteine- and prolinerich domains, these might be duplicated from one to another. To determine the possible pattern of their formation or duplication in one specific species and also among species, repeats were segmented and aligned. The adjoining cysteine-rich domain and proline-rich domain in one structural repetitive unit were separated and numbered. The Lustrin A homologs had six to eight units. Firstly, the structural repetitive units from all reported Lustrin A CDS were aligned. The result did not show a visible pattern because some of the units with the same number but from different species were on different branches (e.g. varia 4, asinine 4, rufescens 4, and discus hannai 4 were on different branches), while some units with differently numbered were clustered on one branch (e.g. ovina 6/7/8 and asininia 6 were on the same branch, while varia 5/6/7 were on another branch) (Fig. 3). To present sthis the internal pattern more clearly, the similarities among all structural repetitive units were analyzed and the units were grouped accordingly (Fig. 4). The result showed that there were six basic structural repetitive units in Lustrin A homologs, which were constructed by a units model and marked with different colors. The results showed that modular I, II, V, and VI appeared in all homologs, but modular I, V, and VI had different repeat times among species. Only H. rufescens and H. discus hannai had two modular I, and H. ovina and H. varia had three duplications of modular VI. Modular III was deleted from H. varia and H.

2.8. Statistical analysis The significance of different were measured by Duncan's new multiple range method, and different superscript means significantly different (p < .05). 3. Results 3.1. Cloning and characterization of the Hdh-Lustrin A complete CDS and analysis of its protein domains The complete coding sequence of Lustrin A homologs was isolated by 3’RACE and 5’RACE and named Hdh-Lustrin A. The length of the complete CDS was 3102 bp, with a 54-bp 5′-untranslated region (UTR) and a 27-bp 3′-UTR, containing a putative polyadenylation signal AATAAT (GenBank accession no: MN581728). The open reading frame (ORF) had a length of 3021 bp and encoded a 1006-amino acid (aa) protein (Fig. S1). The protein structure of Hdh-Lustrin A was very similar (sequence identity 66.02%) to that of H. rufescens (Hruf-Lustrin A). There was a 19-aa signal peptide similar to that in Hruf-Lustrin A, suggesting that Hdh-Lustrin A was a secreted protein. In the N-terminal two-thirds of Hdh-Lustrin A, the cysteine-rich and the proline-rich domains were arranged in tandem and repeated seven and six times, respectively (marked as C1-C7 and P1-P6). These were highly conserved among reported Lustrin A homologs. In the C-terminus, a glycine- and serine-rich domain (“GS” domain), a cysteine-rich domain (C8), a basic domain, and a C-terminal domain with whey acidic protein (WAP)-like proteinase inhibitor characteristic sequence were identified (Fig. 1). These domains were common in Lustrin A homologs. Compared to Hrf3

Comparative Biochemistry and Physiology, Part B 240 (2020) 110385

X. Zheng, et al.

Fig. 1. Modular structure of Hdh-Lustrin A. The domain names and structural repetitive unit numbers are presented at the left. C is short for cysteine-rich domains, P is short for poline-rich domain, and unit is short for structural repetitive unit. Basic residues in the basic domain are shown in bold. Lysine, asparagine, and tyrosine residues in the basic domain are underlined. The C-terminus shared high homology with four-disulfide core family and is boxed.

discus hannai, while modular IV was lost in H. rufescens and H. discus hannai. This result confirmed the shorter length of Hdh-Lustirn A compared to Hrf-Lustrin A. Furthermore in H. rufescens, modular III and modular V both appeared twice, suggesting their duplication. The relationship among Lustrin A homologs could be measured with the units model. Hdh-Lustrin A most likely the one from H. rufescens. Lustrin A from H. ovina and H. varia were identical without a unit III, and they both had three continuous units VI. Lustrin A form H. laevigata had more unit V and unit VI than that form H. rubra. These similarities between two Lustrin A also followed the evolution distance in phylogenetic tree of Lustrin A. Moreover, the Lustrin A from H. rufescens, H. laevigata, and H. discus hannai all had two unit V, but two of them had an additional unit III or unit V, and one lost a unit III, respectively. Moreover, the contributions of cysteine-rich domain and prolinerich domain to the structural repetitive unit phylogenetic tree were measured via phylogenetic analysis. The results showed that the phylogenetic tree of the cysteine-rich domain and the structural repetitive unit were almost identical without branch length differences (Fig. S3); however, the proline-rich domain contributed little to the repeat structural repetitive unit phylogenetic tree (data not show).

H. varia H. ovina H. asinina H. rubra 74/0.98 99/ 1.00

H. laevigata H. tuberculata (partial) H. discus hannai

100/1.00

H. rufescens P. vulgata (partial)

0.10

Fig. 2. Phylogenetic analysis of reported Lustrin A homologs from gastropods. Evolutionary analyses were performed using the neighbor joining (NJ) method and Bayesian method. The analysis involved eight amino acid sequences whose GenBank accession numbers are shown in Table 2. Positions that contained gaps or missing data were eliminated. Support of nodes >70% in NJ bootstrap values (left) and > 0.70 in Bayesian posterior probability (right) are both shown.

3.3. Tissue distribution of Hdh-Lustrin A expression in abalone To provide evidence of the potential involvement of Hdh-Lustrin A in mantle function and shell formation, its spatio-temporal expression pattern in different tissues was analyzed by qRT-PCR. The result revealed that Hdh-Lustrin A had a significantly highly expression in 4

Comparative Biochemistry and Physiology, Part B 240 (2020) 110385

X. Zheng, et al.

Fig. 3. Phylogenetic analysis of cysteine-rich and proline-rich repeats in Lustrin A among Haliotis. spp. The species names are abbreviated by their specific epithet, and the structural repetitive unit numbers of repeats were marked after the specific epithet. The GenBank accession numbers of amino acid sequences used in this analysis are shown in Table 2. Evolutionary analyses were performed using the neighbor joining (NJ) method and Bayesian method. Support of nodes >70% in NJ bootstrap values (left) and > 0.70 in Bayesian posterior probability (right) are both shown.

ovina 7 ovina 8 asinina 6 ovina 6 varia 5 varia 6 varia 7 laevigata 8

biomineralization.

laevigata 6

97/1.00

78/0.98

75/0.95

rubra 6

3.4. The gene expression of the Hdh-Lustrin A pattern during abalone shell regeneration in response to different environmental factors

ovina 4 varia 3 72/0.95

To investigate the association of Hdh-Lustrin A in the shell regeneration and biomineralization, the gene expression level of HdhLustrin A was measured via qRT-PCR during shell regeneration. The result of this shell regeneration experiment showed that the first and maximum Hdh-Lustrin A expression peak appeared at 12 h after artificial shell etching, decreased at 12 h to day 2, increased on day 3, and then decreased from day 3 to 7 (Figs. 6a and S5a). When the abalone was exposed to low pH or high temperature, the expression levels of Hdh-Lustrin A increased (Figs. 6b-f, S5b-f). The double-peak expression patterns of Hdh-Lustrin A were similar; however, the peaks appeared at different time points and different levels. The experiment at pH 8.1 and 20 °C was used as control (Fig. 6a and Fig. S5a). Under 20 °C and pH 7.8, the gene expression of Hdh-Lustrin A increased to the maximum at 12 h, decreased from 12 h to day 2, and increased again to the second peak on day 5 (Figs. 6b, S5b). Under 20 °C and pH 7.5, the gene expression level increased at 12 h to the maximum and decreased from 12 h to day 2 as under pH 7.5, but showed a second peak on day 3, after which it deceased again (Figs. 6c and S5c). Under pH 8.1, 24 °C the expression of Hdh-Lustrin A reached its first peak on day 1, decreased from day 1 to day 3, and reached its maximum level on day 4 (Figs. 6d and S5d). Under pH 8.1 and 26 °C, the gene expression level increased at 12 h, decreased from 12 h to day 1, and the maximum value appeared on day 2. Afterward, the expression level decreased from day 2 to day 4, and then increased to a high level (Figs. 6e and S5e). To investigate the synergy between high temperature and low pH, abalones were exposed to pH 7.5 and 26 °C to inspect the shell regeneration process. The expression of Hdh-Lustrin A increased at 12 h, and increased significantly from day 3 to day 5 (Fig. 6f). These results demonstrated that the expression pattern of Lustrin A can be related with biomineraliztion, and this pattern can be affected by significantly environmental factors and results in a potential change in biomineralization process. The results normalized to GAPDH showed a similar tend like that in Fig. 6 were established in Fig. S5.

asinina 4

78/0.98

laevigata 4 97/1.00

rubra 4 discus hannai 5

99/1.00

rufescens 7 asinina 3

91/1.00

ovina 3

88/1.00

laevigata 3

91/1.00 94/1.00

rubra 3

71/0.94

rufescens 4 rufescens 6 discus hannai 3

96/1.00

rufescens 3 laevigata 2

76/0.98 98/1.00

rubra 2 asinina 2

91/1.00

ovina 2 varia 2 99/1.00 discus hannai 2

rufescens 2 discus hannai 1

99/1.00

rufescens 1 asinina 1

99/1.00

laevigata 1

84/1.00

ovina 1

98/1.00

rubra 1

90/1.00 90/1.00

varia 1

discus hannai 4 rufescens 5 rufescens 8 98/1.00 99/1.00

discus hannai 6

3.5. Relative expression of Hdh-Lustrin A after LPS challenge

asinina 5 93/1.00 72/0.95

ovina 5

qRT-PCR was performed to determine the temporal expression of Hdh-Lustrin A in the mantle following LPS challenge (Figs. 7 and S6. The expression of Hdh-Lustrin A in the mantle decreased significantly from 3 h to 6 h after injection, and returned to a slightly higher level than normal at 12 h. From 24 h, the expression level increased gradually to a relatively high level.

varia 4 laevigata 7 82/1.00 98/1.00

laevigata 5 rubra 5

0.050

4. Discussion Biomineralization is ubiquitous in both vertebrates and invertebrates, and biomaterial synthesis provided great insight into the biomineralization process (Jingtan et al., 2013; Zhang et al., 2012). In vertebrates, biomineralization has been studied in detail and related

mantle rather than sense organ, gill, gonad, viscera, and muscle (Figs. 5 and S4). The tissue-specific highly expression of Hdh-Lustrin A in biomineral tissues confirmed its important role and function in 5

Comparative Biochemistry and Physiology, Part B 240 (2020) 110385

X. Zheng, et al.

Fig. 4. Cysteine-rich and proline-rich structural repetitive unit modal analysis of Haliotis spp. The common model is presented at the bottom, numbered with Roman numerals and marked by different colors. Similar units are presented with the same color, and numbered by Arabic numbers according to their real order.

suggesting potential N-glycosylation and support for anionic groups for protein interaction. Furthermore, the proline-rich domains ensured that the separated cysteine-rich domains folded independently and helped the complex self-assembly of the multiple components that participate in the biomineralization (Gaume et al., 2014). The “GS” domain in HdhLustrin A was flexible without glycine loops due to the lack of aromatic side chains; however, the basic domain provided side chains with positive charge to interact with anionic-biomineralization-related molecules and promoted protein-protein cross-linking (Gaume et al., 2014). Furthermore, the protease inhibitor ability of the C-terminal WAP-like domain might improve the stability of secreted biomineralization proteins. Hence, both the known and conserved structures in Hdh-Lustrin A all benefit the biomineralization process, and their function requires further study. Via alignment of cysteine- and proline-rich repeats in Lustrin A, the possible pattern of repeats duplication or evolution can be evaluated (Shi et al., 2013). The results showed that cysteine- and proline-rich repeats could be modular grouped into six structural repetitive units, and each Lustrin A homolog had different modular components. H. discus hannai and H. varia Lustrin A lacked modular III, while H. discus hannai and H. rufescens Lustrin A lacked modular IV. However, only H. discus hannai and H. rufescens Lustrin A had two modular I. These results indicated the interspecific duplication of several basic units (modular I, II, V and VI) and further intraspecific duplication and evolution of other units. Therefore, the continuing double modular I and triple modular VI might be the repeat of the same modular. Moreover, modular III and modular IV might have evolved from modular II and V, respectively. Otherwise, they would lack modular III or modular IV. The different length of Lustrin A transcripts in the species suggested that there might be homologs with different repeat times of structural repetitive unit in one individual, or there were multiple alternative splicing forms among units. Furthermore, several repeat modular were separated by other modular, arranged as III-V-III-V or IV-V-IV-V, which might form via duplication of two nearby modular into one. Interestingly, there is a modular VI (unit 7) between the later modular III and V (unit 6 and 8) in Hrf-Lustrin A. This suggests that the unit 7 was duplicated from unit 8, which indicates that modular VI was duplicated and modified from modular V and confirmed the results that the modular VI was always last and near the modular V in other homologs. The evolution and similarity among Lustrin A proteins can be also analyzed by the structural repetitive unit modal and the phylogenetic tree of Lustrin A or their structural repetitive unit. The phylogenetic tree of Lustrin A showed that the Hdh-Lustrin A and Hrf-Lustrin A were on one branch, while Ho-Lustrin A and Hv-Lustrin A were on another branch, and the unit modal supported the results well: only Hdh-Lustrin A and Hrf-Lustrin A had a unit V after modular VI, and Ho-Lustrin A and

Fig. 5. Tissue distribution of Hdh-Lustrin A gene expression in Haliotis discus hannai. Relative mRNA expression in tissues was assessed by qRT-PCR and normalized to β-actin. The results were analyzed by Duncan's new multiple range method. Different superscript in the same figure means significantly different (p < .05).

signal pathways and the regulation mechanism have been reported (Graziana et al., 2014; Guiqian et al., 2012; Yang et al., 2013). In invertebrates, most of the research focuses on biomineralization-related proteins and their expression patterns (Dong et al., 2012; Liu et al., 2012; Zheng et al., 2015). In mollusks, many matrix proteins have been identified from prismatic and nacreous layers, and sorted into nucleating control proteins (Weiss et al., 2000; Zhenguang et al., 2007), prymorph and atomic lattice control proteins (Cen et al., 2006; Dong et al., 2012; Michio et al., 2009; Zhang et al., 2012), insoluble matrix frame proteins (Tetsuo et al., 2006; Zhang et al., 2003), and carbonic anhydrase-like proteins (Norizuki and Samata, 2008) according to their different functions. Therefore, biomineralization proteins have many specific functional domains or secondary structures, such as Ca2+ or Mg2+ binding sites (Norizuki and Samata, 2008; Wustman et al., 2004; Zhang et al., 2003), carbonic anhydrase domains (Norizuki and Samata, 2008), and random crimp and flexible domains (Gaume et al., 2014; Jingtan et al., 2013; Wustman et al., 2004). Additionally, they are rich in glycine, serine, tyrosine, lysine, and alanine (Cen et al., 2006; Dong et al., 2012; Michio et al., 2009; Norizuki and Samata, 2008; Weiss et al., 2000; Zhang et al., 2003; Zhenguang et al., 2007). Hdh-Lustrin A has specific domains in homologs: a signal peptide, alternating cysteine- and proline- rich repeats, a glycine- and serine-rich domain, a basic domain, and a WAP-like C-terminus. The cysteine residues in Hdh-Lustrin A cysteine-rich domains did not arrange in Cys-XCys or Cys-X-X-Cys forms; thus, Hdh-Lustrin A could not bind calcium or other heavy metal irons. However, the NCT sequence in Hdh-Lustrin A cysteine-rich domains was conserved among Lustrin A homologs, 6

Comparative Biochemistry and Physiology, Part B 240 (2020) 110385

X. Zheng, et al.

Fig. 6. Gene expression level of Hdh-Lustrin A under different temperature and pH. a) Control group (pH = 8.1, T = 20 °C). b) Mild acidification stress (pH = 7.8, T = 20 °C). c) Severe acidification stress (pH = 7.5, T = 20 °C). d) Mild thermal stress (pH = 8.1, T = 24 °C). e) Severe thermal stress (pH = 8.1, T = 26 °C). f) Twofold stress combining severe thermal and acidification (pH = 7.5, T = 26 °C). The results were normalized to β-actin and analyzed by Duncan's new multiple range method. Different superscript in the same figure means significantly different (p < .05).

hand, the modular VI of Hl-Lustrin A likes that of Hr-Lustrin A instead of Ha. Lustrin A, so Hl-Lustrin A might modified from Hr-Lustrin A along with species evolution. These results indicate a strong speciesspecific evolutionary process. Similar phenomenon also occurs in Prorocentrum donghaiense (Dinophyceae) (Shi et al., 2013), and phylogenetic analysis showed that rbcII coding units within species formed monophyletic clusters, indicative of intraspecific gene duplication or purifying evolution. However, the quality of existing abalone genome assembly is in sufficient to analyze the gene structure (Nam et al., 2017). We hope more gene organization information will be published soon to help further analysis. Furthermore, the similarity among structural repetitive units was mainly decided by cysteine-rich domains, and proline-rich domains without similarity contributed little. This result was confirmed by the phylogenetic tree of cysteine-rich domains, which was almost the same as that of the structural repetitive units. And as we mentioned before, the more the structural repetitive units component were alike, the closer they were in the Lustrin A homolog phylogenetic tree. This result also demonstrated that the cysteine- and proline-rich domains were important characteristic structures of Lustrin A homologs. A large amount of matrix proteins with biomineralization functions in mollusks are secretory proteins secreted by mantle epithelial cells (Sudo, 1997). The tissue-specific highly expression of Hdh-Lustrin A and its signal peptide confirmed its function characteristics and is consistent with previous protein or DNA locating results (Gaume et al., 2014; Shen et al., 1997). In the shell-notch experiment, the shells were forced to form a new layer in the gap and biomineralization-related proteins were either recruited or produced. During shell repair, two Hdh-Lustrin A expression peaks were found. In previous studies, the transcription level of matrix protein increased during the beginning of shell etching (Zheng et al., 2015). This might be caused by the feeling induced by the shell gap in the mantle (Zhao et al., 2012). Similar results also occurred in Hdh-Lustrin A, which was presented as the first peak. Since Lustrin A played a role in nacre formation, the second peak indicated the quick deposition of nacre (Liu et al., 2012), which

Fig. 7. Gene expression level of Hdh-Lustrin A following lipopolysaccharide (LPS) challenge. Relative mRNA expression in tissues was assessed by qRT-PCR and normalized to β-actin. The results were analyzed by Duncan's new multiple range method. Different superscript in the same figure means significantly different (p < .05).

Hv-Lustrin A had triple modular VI. So they had short evolution distance in the tree. However, Hr-Lustrin A and Hl-Lustrin A were on the same branch, and Ha-Lustrin A showed a shorter distance to Ho-Lustrin A and Hv-Lustrin A rather than Hr-Lustrin A and Hl-Lustrin A. It seems that the results did not confirm with the unit modal because the modal of Hr-Lustrin A and Ha-Lustrin A were the same while Hl-Lustrin A had more modular V and unit VI. But in the phylogenetic tree of structural repetitive unit, it can be found that the asinina 6, ovina 6/7/8 and varia 5/6/7 were in one cluster, but laevigata 6/8 and rubra 6 were in one cluster, and laevigata 5/7 and rubra 5 were in one cluster. That means that although Hr-Lustrin A and Ha-Lustrin A were the same in structural repetitive unit modal, but the details of each unit might have slightly differences. Modular VI of Ha-Lustrin A likes that of Ho-Lustrin A and Hv-Lustrin A more than that of Hr-Lustrin A, and the Ho-Lustrin A and Hv-Lustrin A has a duplication of modular VI. So the Ho-Lustrin A and Hv-Lustrin A might modified from Ha-Lustrin A along with species evolution as it showed in the phylogenetic tree of Lustrin A. In the other 7

Comparative Biochemistry and Physiology, Part B 240 (2020) 110385

X. Zheng, et al.

conformed to the delay of nacre formation after organic frame construction. To further study the relationship between Hdh-Lustrin A and innate immunity, LPS, the prevalent pyrogen in Gram-negative bacteria, was used to simulate the pathogen invasion. Considering the strong immune reaction caused by LPS injection, the gene expression of Hdh-Lustrin A from 3 h to 6 h might be suppressed by the predominant expression of immune factors (De et al., 2010). However, the expression increased slightly at 12 h, and significantly from 24 h without decreases. These increases might be regulated by upstream transcription activators which can activate the expression of important immune factors. Similar patterns were also found in two other abalone biomineralization proteins (data not show). However, the immune related factors showed a different pattern in immune challenge. We found an IFN-γ-induce enzyme GILT in H. discus hannai, which showed a peak at 3 h, and an increase from 6 h (data not show). And similar pattern with an early peak was also showed in reported factor AP-1 in H. discus discus, especially in morrhagic septicemia virus challenge (De et al., 2010). So we suggested that the proteins with different functions would has different expression pattern in immune reaction. The immune related factors will increase expression in short time after challenge while biomineraliztion protein will be suppressed at beginning, and then increase significantly. The significant increase of biomineralization protein after 24 h or 48 h might be related to the immune reaction because the immune reaction might indicate a shell damage or foreign matter insertion. In this case the abalone needs to repair the shell quickly or deposit the calcium carbonate to wrap the foreign matters or pathogen, so the biomineralization proteins expression increase fast. Therefore, this suggests that the increase of Hdh-Lustrin A expression form 24 h after shell notching might be the result of immune reaction, and the increased level can be affected by environmental factors. Under high temperature and low pH stimulation, a significant change in expression pattern of Hdh-Lustrin A was found, and low pH significantly up-regulated the gene expression. The low pH caused the calcium carbonate to dissolve and made it more difficult or slower to deposit (Fitzer et al., 2014; Lu et al., 2018). Therefore, to retain the normal thickness and strength of the shell, the mantle needed to assemble organic‑calcium carbonate compounds at higher speed or secret more nacre protein to increase the hardness of the shell (Meng et al., 2018). Lustrin A is a nacre protein whose expression is closely related to nacre formation (Gaume et al., 2014); therefore, the improvement of its gene expression under low pH might be a form of recovery of shell growth. However, the nacre deposition needs sufficient nucleating positions to form new crystals and a flat surface for the stacking of aragonite dishes (Huang et al., 2019). Decreased saturation levels of minerals under low pH will alter the crystal unit orientation and damage the outmost prismatic layer, which might not be suitable for nacre deposition (Meng et al., 2019). Hence, nacre reparation and the expression of biomineralization-related proteins will be delayed. Under slight acidification (pH = 7.8), the second peak delayed from day 3 to day 5, which might be caused by the dissolving of the newborn point of shell, and it also resulted in the longer time requirement for shell repair. However, under severe acidification (pH = 7.5), the expression of HdhLustrin A increased with little change in pattern, and might cause serious interruption in the biomineralization process. Therefore, a large amount of Hdh-Lustrin A needs to be expressed at a fast speed to increase the deposition to a required level. High temperature is a severe threat to abalone, and negatively affects their immune response (Huang et al., 2014). Previous researches showed that the immunity reaction, the nutrition physiology, and the gene transcription in abalone were always abnormal under thermal stress (Ivanina et al., 2013; Zhang et al., 2019). Compared to acidification, the gene expression pattern of Hdh-Lustrin A in the warming experiment changed more in pattern than in amount and showed higher similarity with that after LPS challenge. This result indicated the abnormality in innate immunity and gene transcription. As mentioned

above, this is due to an up-steam transcription factor, which responded to and is regulated by the immune reaction and also regulates the biomineralization protein expression. After day 4, the gene expression under both 24 °C and 26 °C increased, and the expression level was higher under 26 °C than under 24 °C. Under the combined stress of warming and acidification, the gene expression synthesized two change characteristics of warming and acidification (Ivanina et al., 2013), and the pattern after day 3 increased in response to high temperature rather than acidification. Moreover, the similarity of Hdh-Lustrin A between shell repair and immune reaction will increase with increasing temperature, suggesting that warming and acidification both affect the transcription level of the biomineralization protein and the high temperature might be the leading role. However, the results require further morphological and physiological data, such as scanning electron microscope analysis of the shell surface, the construction and expression of Hdh-Lustrin A, and its CaCO3 crystallization ability. Moreover, biomineralization is a process that involves multiple proteins; therefore, identification of more biomineralization proteins and characterization of their interaction relationship are also required. 5. Conclusion A new Lustrin A in H. discus hannai (named Hdh-Lustrin A) was identified and characterized. Hdh-Lustrin A had multiple conserved domains in Lustrin A homologs, and could be identified by its cysteineand proline-rich structural repetitive units. These characteristic units also reflect the Lustrin A homologs phyletic evolution. Immune reaction and shell regeneration could increase the expression of Hdh-Lustrin A, especially during nacre forming. The expression level of Hdh-Lustrin A also significantly increased in response to warming and acidification stress. And acidification and warming raised the expression of HdhLustrin A in shell regeneration in two different manners: acidification raised the gene expression in quick response, in contrast the long run in warming treatment which was similar to that in immune reaction. The obtained results confirm the importance of Lustrin A in abalone biomineralization and the warming effected in abalone immune, indicating that the biomineralization process is affected by warming and acidification through irregular expression of biomineralization proteins such as Lustrin A. Supplementary data to this article can be found online at https:// doi.org/10.1016/j.cbpb.2019.110385. Funding This study was financially supported by the Natural Science Foundation of Fujian Province, China (No. 2017J01632), the Education Department of Fujian Province, China (No. JZ160420), the Special Foundation for Yong Scientists of Fuzhou University, China (No. XRC1611), the Demonstration Project for Innovative Development of Fuzhou's Marine Economy during the 13th Five-Year Plan, China (Nos. FZHJ15 and FZHJ04), and the Fuzhou Administration of Science and Technology, China (No. 2016-G-48). Declaration of Competing Interest The authors declare that no conflict of interest exists. Acknowledgements Xinguo Shi and Jianfeng Chen designed the experiments; Ruijuan Ma, Lemian Liu, and Youping Xie collected the study materials; Shuxian Zhao and Shanshan Lei conducted the experiments and helped with data analysis. 8

X. Zheng, et al.

Comparative Biochemistry and Physiology, Part B 240 (2020) 110385

References

Environ. Res. 142, 141–146. Meng, Y., Guo, Z., Fitzer, S.C., Upadhyay, A., Chan, V.B.S., Li, C., Cusack, M., Yao, H., Yeung, K.W.K., Thiyagarajan, V., 2018. Ocean acidification reduces hardness and stiffness of the Portuguese oyster shell with impaired microstructure: A hierarchical analysis. Biogeosciences 15, 6833–6846. Meng, Y., Guo, Z., Yao, H., Yeung, K., 2019 Feb. Thiyagarajan, Calcium carbonate unit realignment under acidification: A potential compensatory mechanism in an edible estuarine oyster. Mar. Pollut. Bull. 139, 141–149. Michio, S., Kazuko, S., Toshihiro, K., Yuya, Y., Tatsuya, N., Takashi, K., Hiromichi, N., 2009. An acidic matrix protein, Pif, is a key macromolecule for nacre formation. Science 325, 1388–1390. Nam, B.H., Kwak, W., Kim, Y.O., Kim, D.G., Kong, H.J., Kim, W.J., Kang, J.H., Park, J.Y., An, C.M., Moon, J.Y., 2017. Genome sequence of pacific abalone (Haliotis discus hannai): the first draft genome in family Haliotidae. Gigascience 6, 1–8. Norizuki, M., Samata, T., 2008. Distribution and function of the Nacrein-related proteins inferred from structural analysis. Mar. Biotechnol. 10, 234–241. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RTPCR. Nucleic Acids Res. 29, e45. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Shen, X., Belcher, A.M., Hansma, P.K., Stucky, G.D., Morse, D.E., 1997. Molecular cloning and characterization of lustrin A, a matrix protein from shell and pearl nacre of Haliotis rufescens. J. Biol. Chem. 272, 32472–32481. Shi, X., Zhang, H., Lin, S., 2013. Tandem repeats, high copy number and remarkable diel expression rhythm of form II RuBisCO in Prorocentrum donghaiense (Dinophyceae). PLoS One 8, e71232. Sudo, S., 1997. Structures of mollusk shell framework proteins. Nature 387, 563–564. Taylor, J.R.A., Gilleard, J.M., Allen, M.C., Deheyn, D.D., 2015. Effects of CO2-induced pH reduction on the exoskeleton structure and biophotonic properties of the shrimp Lysmata californica. Sci. Rep. 5, 10608. Tetsuo, A., Megumi, H., Yasumoto, N., Sung-Won, H., Knight, D.P., 2006. Conformational study of silk-like peptides containing the calcium-binding sequence from calbindin D9k using 13C CP/MAS NMR spectroscopy. Biomacromolecules 7, 627–634. Weiss, I.M., Kaufmann, S., Mann, K., Fritz, M., 2000. Purification and characterization of Perlucin and Perlustrin, two new proteins from the shell of the mollusc Haliotis laevigata. Biochem. Biophys. Res. Commun. 267, 17–21. Wustman, B.A., Morse, D.E., Evans, J.S., 2004. Structural characterization of the Nterminal mineral modification domains from the molluscan crystal-modulating biomineralization proteins, AP7 and AP24. Biopolymers 74, 363–376. Yang, X., Dongyan, C., Lei, S., Yuhao, L., Lei, L., 2013. Characterization of zebrafish mutants with defects in bone calcification during development. Biochem. Biophys. Res. Commun. 440, 132–136. Zhang, Y., Xie, L., Meng, Q., Jiang, T., Pu, R., Chen, L., Zhang, R., 2003. A novel matrix protein participating in the nacre framework formation of pearl oyster, Pinctada fucata. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 135, 565–573. Zhang, Z., Xie, Y., Xu, X., Pan, H., Tang, R., 2012. Transformation of amorphous calcium carbonate into aragonite. J. Cryst. Growth 343, 62–67. Zhang, X., Shi, J., Sun, Y., Habib, Y.J., Yang, H., Zhang, Z., Wang, Y., 2019 January. Integrative transcriptome analysis and discovery of genes involving in immune response of hypoxia/thermal challenges in the small abalone Haliotis diversicolor. Fish Shellfish Immunol. 84, 609–626. Zhao, X., Wang, Q., Jiao, Y., Huang, R., Deng, Y., Wang, H., Du, X., 2012. Identification of genes potentially related to biomineralization and immunity by transcriptome analysis of pearl sac in pearl oyster Pinctada martensii. Mar. Biotechnol. 14, 730–739. Zheng, X., Cheng, M., Xiang, L., Liang, J., Xie, L., Zhang, R., 2015. The AP-1 transcription factor homolog Pf-AP-1 activates transcription of multiple biomineral proteins and potentially participates in Pinctada fucata biomineralization. Sci. Rep. 5, 14408. Zhenguang, Y., Gu, J., Ningping, G., Changzhong, L., Yujuan, Z., Liping, X., Rongqing, Z., 2007. N40, a novel nonacidic matrix protein from pearl oyster nacre, facilitates nucleation of aragonite in vitro. Biomacromolecules 8, 3597–3601.

Blank, S., Arnoldi, M., Khoshnavaz, S., Treccani, L., Kuntz, M., Mann, K., Grathwohl, G., Fritz, M., 2010. The nacre protein perlucin nucleates growth of calcium carbonate crystals. J. Microsc. 212, 280–291. Cen, Z., Liping, X., Jing, H., Xiaolei, L., Rongqing, Z., 2006. A novel matrix protein family participating in the prismatic layer framework formation of pearl oyster, Pinctada fucata. Biochem. Biophys. Res. Commun. 344, 735–740. Choi, M.J., Kim, G.D., Kim, J.M., Han, K.L., 2015. Differentially-expressed genes associated with faster growth of the Pacific abalone, Haliotis discus hannai. Int. J. Mol. Sci. 16, 27520–27534. De, Z.M., Nikapitiya, C., Lee, Y., Lee, S., Oh, C., Whang, I., Yeo, S.Y., Choi, C.Y., Lee, J., 2010. First molluscan transcription factor activator protein-1 (Ap-1) member from disk abalone and its expression profiling against immune challenge and tissue injury. Fish Shellfish Immunol. 29, 1028–1036. Dong, F., Cong, P., Huijuan, L., Ya, L., Guiyou, Z., Hongzhong, W., Maoxian, H., Liping, X., Rongqing, Z., 2012. Novel basic protein, PfN23, functions as key macromolecule during nacre formation. J. Biol. Chem. 287, 15776–15785. Falini, G., Albeck, S., Weiner, S., Addadi, L., 1996. Control of aragonite or calcite polymorphism by mollusk shell macromolecules. Science 271, 67–69. Fitzer, S.C., Maggie, C., Phoenix, V.R., Kamenos, N.A., 2014. Ocean acidification reduces the crystallographic control in juvenile mussel shells. J. Struct. Biol. 188, 39–45. Gaume, B., Denis, F., Wormhoudt, A.V., Huchette, S., Jackson, D.J., Avignon, S., AuzouxBordenave, S., 2014. Characterisation and expression of the biomineralising gene Lustrin A during shell formation of the European abalone Haliotis tuberculata. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 169, 1–8. Graziana, C., Giacomina, B., Maria Felicia, F., Silvia, C., Maria, G., 2014. Osteoporosis and obesity: role of Wnt pathway in human and murine models. World J. Orthop. 5, 242–246. Guiqian, C., Chuxia, D., Yi-Ping, L., 2012. TGF-β and BMP signaling in osteoblast differentiation and bone formation. Int. J. Biol. Sci. 8, 272–288. Huang, Y., Cai, X., Zou, Z., Wang, S., Wang, G., Wang, Y., Zhang, Z., 2014. Molecular cloning, characterization and expression analysis of three heat shock responsive genes from Haliotis diversicolor. Fish Shellfish Immunol. 36, 590–599. Huang, J., Xie, L., Zhang, R., 2019 Mar. Shell repair and the potential microbial causal in a shell disease of the pearl oyster Pinctada fucata. Fish Shellfish Immunol. 86, 934–941. IPCC, 2007. Climate Change 2007: Synthesis Report. IPCC, Geneva, Switzerland. IPCC, 2014. Climate Change 2014: Synthesis Report. IPCC, Geneva, Switzerland. Ivanina, A.V., Dickinson, G.H., Matoo, O.B., Bagwe, R., Dickinson, A., Beniash, E., Sokolova, I.M., 2013. Interactive effects of elevated temperature and CO2 levels on energy metabolism and biomineralization of marine bivalves Crassostrea virginica and Mercenaria mercenaria. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 166, 101–111. Jingtan, S., Xiao, L., Qiang, Z., Guiyou, Z., Hongzhong, W., Liping, X., Rongqing, Z., 2013. Structural characterization of amorphous calcium carbonate-binding protein: an insight into the mechanism of amorphous calcium carbonate formation. Biochem. J. 453, 179–186. Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870–1874. Liu, W., Saint, D.A., 2002. A new quantitative method of real time reverse transcription polymerase chain reaction assay based on simulation of polymerase chain reaction kinetics. Anal. Biochem. 302, 52–59. Liu, X., Li, J., Xiang, L., Sun, J., Zheng, G., Zhang, G., Wang, H., Xie, L., Zhang, R., 2012. The role of matrix proteins in the control of nacreous layer deposition during pearl formation. Proc. R. Soc. B Biol. Sci. 279, 1000–1007. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(−Delta Delta C(T)) method. Methods (San Diego, Calif.) 25, 402–408. Lu, Y., Wang, L., Wang, L., Cong, Y., Yang, G., Zhao, L., 2018. Deciphering carbon sources of mussel shell carbonate under experimental ocean acidification and warming. Mar.

9