Cloning and differential expression of a novel toll-like receptor gene in noble scallop Chlamys nobilis with different total carotenoid content

Fish & Shellfish Immunology 56 (2016) 229e238

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Cloning and differential expression of a novel toll-like receptor gene in noble scallop Chlamys nobilis with different total carotenoid content Yeqing Lu a, b, Huaiping Zheng a, b, *, Hongkuan Zhang a, b, Jianqin Yang a, b, Qiang Wang a, b a b

Key Laboratory of Marine Biotechnology of Guangdong Province, Shantou University, Shantou 515063, China Mariculture Research Center for Subtropical Shellfish & Algae of Guangdong Province, Shantou University, Shantou 515063, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 26 April 2016 Received in revised form 6 June 2016 Accepted 8 July 2016 Available online 9 July 2016

To investigate whether toll like receptors (TLRs) genes do have an immune influence on noble scallop Chlamys nobilis under pathogen stress, acute challenges lasting 48 h to Vibrio parahaemolyticus, lipopolysaccharide (LPS), polyinosinic polycytidylic acid (Poly I:C), and PBS were conducted in two scallop stains of orange and brown with different carotenoids content. A novel toll-like receptor gene called CnTLR-1 was cloned and its transcripts under different challenges were determined. Meantime, total carotenoids content (TCC) of different immune responses were determined to investigate whether there was a relationship between gene expression and carotenoids content. The full length cDNA of CnTLR-1 is 2982 bp with an open reading frame (ORF) of 1920 bp encoding 639-deduced amino acids, which contains five leucine-rich repeats (LRR), two LRR-C-terminal (LRRCT) motifs and a LRR-N-terminal (LRRNT) motif in the extracellular domain, a transmembrane domain and a Toll/Interleukin-1 Receptor (TIR) of 138-amino acids in the cytoplasmic region. Phylogenetic tree analysis showed that CnTLR-1 could be clustered with mollusk TLRs into one group and especially was related closely to Crassostrea gigas and Mytilus galloprovincialis TLRs. CnTLR-1 transcripts were detected in decreasing levels in the mantle, hemocytes, gill, kidney, gonad, hepatopancreas, intestines and adductor. Compared with PBS control group, CnTLR-1 transcripts were up-regulated in V. parahaemolyticus, LPS and Poly I:C groups. Further, CnTLR-1 transcripts were significantly higher in orange scallops than that of brown ones with and without pathogenic challenges. TCC, which is higher in orange scallops, was initially increased and then decreased during a 48 h immune challenge in the hemocytes. The present results indicate that CnTLR-1 is an important factor involved in the immune defense against pathogens in the noble scallop. © 2016 Elsevier Ltd. All rights reserved.

Keywords: Noble scallop Chlamys nobilis Toll-like receptor Carotenoids Vibrio parahaemolyticus Lipopolysaccharide (LPS) Polyinosinic polycytidylic acid (Poly I:C)

1. Introduction Pattern recognition receptors (PRRs) are a set of proteins of the innate immune system involved in the recognition of pathogenassociated molecular patterns (PAMPs), which are associated with microbial pathogens [1e3]. One types of the PRR, toll like receptors (TLRs), are important transmembrane proteins that connect innate immunity and adaptive immunity [4]. They detect microorganisms based on conserved PAMPs like peptidoglycans, lipoproteins, double-strand viral RNA, lipopolysaccharide (LPS), unmethylated bacterial CpG DNA and so on [5]. TLRs mainly have three functional domains, an ectodomain of tandem leucine-rich repeats (LRRs)

* Corresponding author. Key Laboratory of Marine Biotechnology of Guangdong Province, Shantou University, Shantou 515063, China. E-mail address: [email protected] (H. Zheng). http://dx.doi.org/10.1016/j.fsi.2016.07.007 1050-4648/© 2016 Elsevier Ltd. All rights reserved.

which participates in specific identification of pathogenic microorganisms, a transmembrane region, and an intracellular region that possesses a globular cytoplasmic Toll/Interleukin-1 Receptor (TIR) homology domain involving in meditating protein-protein interactions between TLRs and signal-transduction components, as well as directing localization of receptor [6,7]. The downstream signal components are pro-inflammatory cytokines including interleukins, interferon, and TNF, which are responsible for immediate innate response and for triggering adaptive immune cells [7]. The first toll-like receptor was identified in Drosophila melanogaster for its host defense against fungal infection [8] and then nine TLRs had been confirmed later [9]. As researchers paid more attention recent years, TLRs had been well-characterized [10]. In non-mammalian animals, from vertebrates to invertebrates, many species have also confirmed numerous TLRs [11]. The mollusk TLRs are mainly investigated in the bivalves, such as Chlamys farreri [12], Crassostrea gigas [13], Mytilus galloprovincialis [14], Mya arenaria

230

Y. Lu et al. / Fish & Shellfish Immunology 56 (2016) 229e238

[15], the cephalopod Euprymna scolopes [16], and Sepia officinalis [17]. The first TLR gene (CfToll-1) of Crassostrea farreri was identified in 2007 [12], then the TLR signaling pathway core components, MLR, CfMyd88, CfTRAF6, CfNF kappa B and Cfl kappa B have been characterized [18]. A TLR gene (CgToll-1) was acquired in C. gigas [13], the downstream genes Ref [19] and I kappa B [20], the upstream genes, MyD88 [21,22] and TRAF6 [23] were confirmed to be the signaling molecules. The application of Illumina technology in mussel, M. galloprovincialis help to identify 23 Toll-like receptors (TLRs) and 3 MyD88 adaptors [14]. In vivo infection with Vibrio splendidus in M. arenaria indicated that TLR2 and IRAK4 were regulated to participate in host immune response [15]. Other mollusks, for example, E. scolopes [16], Euprymna tasmanica [24], S. officinalis [17], bivalvias like the pearl oyster Pinctada martensii [25], Japanese scallop Mizuhopecten yessoensis [26] and manila clam Ruditapes philippinarum [27] only have been described several components of the TLR signaling pathway. Carotenoids are yellow-red isoprenoid polyene pigments extensively existed in nature [28]. A variety of biological activities and much medicinal values have been found in carotenoids, such as scavenging free radicals, resisting oxidative damage, delaying senescence, quenching singlet oxygen, increasing the vitality of B cells in the immune system, enhancing humoral immune response in animals and humans, acting as the precursor of vitamin A, treating photosensitivity diseases and preventing against cataracts [29e33]. Carotenoids also have recognized functions in gene expression and regulation [3e5,34,35], for examples, carotenoids can up-regulate connexin 43 to increase cell-to-cell communication and thus decrease cell proliferation [34], and can also up-regulate Vg gene to increase scallops’ immunity [35]. The noble scallop Chlamys nobilis, an important edible marine bivalve belongs to the family Pectinidae, is widely distributed in Japan, Indonesia and the Southern Sea of China. The scallop not only displays its polymorphism in shell colors including orange, brown, orange-purple and purple, but also polymorphism in muscle colors including white and orange [36]. Since 19800 , noble scallop has been cultured and developed into a large-scale industry because of the obvious advantages of quick growth, short culturing period, high profit, good taste and nutrition [37,38]. However, the cultured scallop often suffers from large-scale mortality in the past two decades [35,39,40]. Several potential reasons including reproduction pressure, environmental factors, inbreeding, opportunistic invaders and pathogens have been proposed by researchers. Vibrio is one of the most harmful pathogens in cultured shellfish distributed in all coastal waters around the world, whose outbreaks usually are concentrated during the summer and early fall when higher water temperatures favor higher levels of bacteria [41]. The typical processes of vibrio infection in shellfish include pathogenic vibrio adhesion, invasion, large-scale tissue damage and then death of shellfish [42e44]. In Shantou, Guangdong Province, Vibrio parahaemolyticus is one of the most dominant bacterial pathogens that contribute to mass morality of farming areas [22]. A genetic and breeding project on the noble scallop has been carried out by artificial selection in our laboratory since 2008. We first found that the orange scallops with orange shell, orange mantle and orange adductor had significantly higher total carotenoids content (TCC) than the brown ones with brown shell, white mantle and adductor [38]. Then, by establishing different strains, we found that the scallops’ shell and muscle colors were both consistently inherited in this species [36,38]. More importantly, TCC contained in orange scallops could be enhanced by selection breeding [36,38]. After four generations selection and two generations cultured demonstration, a new variety named “Nan’ao Golden Scallop” (ID: GS-01-009-2014) was bred and authorized in

2014 by the National Aquatic Protospecies and Improved Variety Approval Committee of China. Moreover, our previous study indicated that carotenoids content might be positively correlated with the expression levels of some genes of the immune system, which play an important role against pathogens in noble scallop C. nobilis [35]. Cellular immunity and humoral immunity are two main immune systems in scallops’ host defense [45]. Like many other invertebrates, scallops relies more on the non-specific immune responses for defence against pathogens, such as hydrolytic enzyme activity, phagocytosis of cells, cell-mediated cytotoxic effect against pathogens [46]. To investigate whether toll like receptors (TLRs) genes have an immune influence on noble scallop C. nobilis under pathogen stress, acute challenges lasting 48 h to V. parahaemolyticus, LPS, polyinosinic-polycytidylic acid (Poly I:C), and PBS were conducted in two scallop stains of orange and brown with different carotenoids content. A novel TLR gene was cloned and its transcripts under different challenges were determined. Moreover, TCC of different immune responses mentioned above at each timing were also determined. 2. Materials and methods 2.1. Experimental animals and microbes 12-month old orange and brown scallops with different carotenoids content that originated from same population of noble scallop C. nobilis were used in the present study. The scallops were cultured at 500 L experimental tanks, fitted with circulatory pumps, maintained in the seawater at 18.0  Ce19.5  C during the experiment, changing filtering seawater twice a day after feeding with diatom (Nitzschia closterium f. minutissima) and tetraselmis (Platymonas subcordiformis) which were cultured by our laboratory. The bacterium V. parahaemolyticus was preserved in our laboratory. The method of bacterium culture had been reported by Zhang et al. [35]. 2.2. Immune challenge and tissue collection To investigate the distribution of CnTLR-1 mRNA expression, seven tissues including the intestine, adductor, mantle, gonad, gill, kidney, hepatopancreas and hemolymph were collected from six orange and brown scallops, respectively. All these tissue samples were stored at 80  C after addition of 1 ml Trizol reagent (Invitrogen) for subsequent RNA extraction. The rest adductor, gill, mantle tissues and hemolymph of the 12 scallops were collected and stored at 20  C before using for determination of TCC. To explore the different immune responses between orange and brown scallops, 300 individuals (equally between the two scallop strains) were chosen and randomly divided into eight groups (36 scallops each group). After 24 h acclimatization, 100 ml Vibrio parahemolyticus suspension (5  107 cfu ml1 in PBS) were injected into two groups of scallops of one orange and one brown. Meanwhile, 100 ml LPS (Sigma Aldrich, 0.5 mg ml1 in PBS) and Poly I:C (Sigma Aldrich, 1 mg ml1 in PBS) were also applied to the scallops, respectively. For blank control, the scallops received an injection of 100 ml PBS. Then, the scallops were return to seawater tanks after treatment, six individuals were randomly sampled at 3, 6, 12, 24, 36 and 48 h post-challenge from each group. 6 orange or brown individuals without any treatment were randomly sampled at 0 h for control. The hemolymph was drawn from each scallop with a disposable syringe (1 ml) on ice and centrifuged at 800g and 4  C for 10 min to harvest the hemocytes for RNA isolation. Additional hemolymph was withdrawn for the determination of TCC. All these

Y. Lu et al. / Fish & Shellfish Immunology 56 (2016) 229e238

samples were stored at 80  C for the subsequent experiment. 2.3. Cloning of the full-length cDNA of TLR Total RNA from the hemocytes was isolated using Trizol reagent (Invitrogen, USA) and cDNA was synthesized by SuperScript III reverse transcriptase (Invitrogen, USA) following the instructions of the manufacturer. Partial cDNA sequence of TLR was obtained from high throughput transcriptome sequencing [47]. The complete TLR cDNA was amplified through 30 -RACE and 50 -RACE PCR with the SMARTer™ RACE cDNA Amplification Kit (Clontech, Mountain View, CA) and LA Taq polymerase (TaKaRa, Japan), using touch-down PCR and nested PCR strategy. The touch-down PCR was carried out in a 50 ml volume containing 2.5 ml 50 RACE cDNA (or 30 RACE cDNA) template, 1 ml TLR-GSP5-1 (or TLR-GSP3-1) primer (10 mmol L1), 5 ml UPM (long UPM 0.4 mM, short UPM 2 mM) (Table 1), 0.5 ml LA Taq DNA Polymerase (5 U/ml), 5 ml 10  LA Taq BufferⅡ(Mg2þ Plus), 8 ml dNTP Mixture (2.5 mM each), and 28 ml sterilized ultrapure water. The PCR reaction program was performed as follows: 94  C for 2 min followed by 35 cycles of 94  C for 30 s, 70  Ce60  C for 30 s in the initial 10 cycles decrementing 1  C/cycle, 60  C for 30 s for the remaining 25 cycles, 72  C for 2 min, and a final extension step at 72  C for 10 min. The products of touch-down PCR were used as template for the subsequent nested PCR. The expected DNA fragment was separated on a 1% agarose gel and then purified with a PCR purification kit (Sangon Biotech, China). Purified DNA fragment was sub-cloned into PMD®18-T vector (TaKaRa, Japan), then transformed into Escherichia coli. Positive recombinant clones were identified by blue-white color selection in ampicillin-containing LB plates and PCR screening with M13-47 and M13-RVM primers, and then sequenced by a commercial company (Sangon Biotech, Shanghai, China). The full length cDNA of TLR was aligned from the overlapping cDNA clones. 2.4. Bioinformatic analysis The acquired CnTLR-1 nucleotide and amino sequence was analyzed with the online BLAST program (http://www.ncbi.nlm. nih.gov/blast/) for homology comparisons. The predicted amino acid sequence was obtained by using the ORF Finder (http://www. ncbi.nlm.nih.gov/gorf/orfig.cgi). The Compute pI/Mw tool (http:// web.expasy.org/compute-pi/) was used to calculate molecular

Table 1 Oligonucleotide primers used in this study. Primer name CnTLR-1 UPM (long) UPM (short) NUP TLR-M-F TLR-M-R TLR-GSP5-1 TLR-GSP5-2 TLR-GSP3-1 TLR-GSP3-2 TLR-F TLR-R M13-47 M13-RVM Real-time PCR TLR-qRT-F TLR-qRT-R b-actin-F b-actin-R

Sequence (50 e30 ) CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT CTAATACGACTCACTATAGGGC AAGCAGTGGTATCAACGCAGAGT GAACCTTTCCTACAACTCCATACAGC TAGTAACACGCCGAATCCTACCG CAAATGGGTTATTGCTCAAATCGGC TCGACGCCCACATCTCCGCC AGTATAACCCCGGCGGAGATGT ACCCATTTGTTTGTGATTGCGAC TTCGGTAACACTGTAACCCACCTGT AATATTTCATGGACATATTGCCTGT CGCCAGGGTTTTCCCAGTCACGAC AGCGGATAACAATTTCACACAGGA AGGAAACGACAGGAGCGAGG TGAGTTTATCCCAGAACCAGCG GCGGCAGTGGTCATCTCCT GCCCTTCCTCACGCTATCCT

231

weight and theoretical isoelectric point. CnTLR-1 domain structures and transmembrane domain were predicted with the simple modular architecture research tool (SMART) program (http://www. smart.embl-heidelberg.de/) and TMHMM Server v.2.0 (http:// www.cbs.dtu.dk/services/TMHMM/). The potential N-linked glycosylation sites were predicted by the Asn-X-Ser/Thr rule (http://cbs.dtu.dk/services/NetNGlyc). The Clustal Omega program (http://www.ebi.ac.uk/Tools/msa/clustalo/) was used to perform multiple protein sequences alignment. Phylogenetic tree and molecular evolutionary analyses of the predicted amino acid sequence of CnTLR-1 was carried out with MEGA 5.0 software by neighborjoining method. The reliability of the branching was tested by bootstrap resampling with 1000 pseudo-replicates. 2.5. Real-time PCR analysis of toll-like receptor transcript levels Total RNA from different tissues and the hemocytes was isolated as described above. First-strand cDNA was synthesized using RT reagent Kit with gDNA Eraser (Takara, Dalian, China) according to the manufacturer’s instructions. Two gene-specific primers was designed to amplify a product of 281 bp, which was quantified by real-time RT-PCR with the SYBR®Premix Ex Taq™ II Kit (Perfect Real Time) (Takara, Japan) following the manufacturer’s protocol. The reaction was performed in a LightCycler® 480 (Roche). A total reaction volume of 20 ml containing 10 ml SYBR® Premix Ex Taq™ II, 2 ml the four-fold diluted cDNA, 0.8 ml each primer (TLR-qRT-F and TLR-qRT-R to amply TLR gene, b-actin-F and b-actin-R to amply bactin, 10 mmol L1) and 6.4 ml ultra-pure water was carried out following a denaturation step of 95  C for 30 s, 45 cycles of 95  C for 5 s, 60  C for 30 s, a melting curve analysis from 65  C to 95  C and a cooling step of 40  C for 10 min. Each sample was run in triplicate. Data were analyzed by using the LightCycler480 software (Roche) after the PCR program. The amplification efficiency of CnTLR-1 and b-actin was also determined. Relative mRNA expression level of CnTLR-1 was determined with the 2△△Ct algorithm with b-actin from C. nobilis as the internal control [48e50]. 2.6. Determination of total carotenoids content (TCC) TCC was determined following the method of Zheng et al. [38]. All samples were dried in a vacuum freeze-drying machine (Cool Safe 110 4, Gene Company), then the adductor, gill and mantle tissue (except hemolymph) samples were grinded to homogenous powder in mortars. 0.2e0.4 g tissue power was extracted with 8 ml acetone to extract TCC. After freeze-drying, hemolymph powder were weighed 0.02e0.05 g and extracted with 800 ml acetone to determinate TCC. The samples were then shaken at 200 rpm for 12 h at room temperature in the dark. The extraction was centrifuged at 5000-rpm for 5 min and the supernatant was assayed in a UVevis recording spectrophotometer at 480 nm. The values was calculated as TCC mg per g dry weight by using the extinction coefficient E (1%, 1 cm) of 1.900 [51] at 480 nm. 2.7. Statistical analysis CnTLR-1 transcripts and TCC were expressed as means ± standard deviation of the means (SD). The results were subjected to One-way Analysis of Variance (ANOVA) and followed by Tukey’s test to establish the difference between treatments. A general linear model (GLM) was undertaken to evaluate the fixed effects of “Strain, S”, “Immunostimulant, I” and “Time, T” and their interaction on mRNA transcripts in the hemolymph. The model was:

232

Y. Lu et al. / Fish & Shellfish Immunology 56 (2016) 229e238

Fig. 1. (A) The full cDNA sequence and deduced amino acid sequences of CnTLR-1. The nucleotide and deduced amino acid sequence of an open reading frame and flanking region were numbered on the left. Start codon (ATG) and stop codon (TAA) are boldface. The underlined letters represent the TM region (amino acids 433e455). The LRRs, LRRCTs, LRRNT and TIR domains are shaded. The N-linked glycosylation sites are shown with dark gray underlay. Polyadenylation signal (AATAAA) is boxed. (B) Alignment of ectodomain of CnTLR-1 to the consensus sequences of LRRs. Identical amino acid residues were black and similar amino acids were gray. X represented any amino acid, f was any hydrophobic residue, L and F were frequently replaced by other hydrophobic residues.

Y. Lu et al. / Fish & Shellfish Immunology 56 (2016) 229e238

Yijm ¼ m þ Si þ Ij þ Tk þ ðS  IÞij þ ðS  TÞik þ ðI  TÞjk þ ðS  I  TÞijk þ eijkm where, Yijkm ¼ data (mRNA transcripts) of the m replicate from i strain, j immunostimulant and k time; m ¼ overall constant; Si ¼ strain effect on data (i ¼ 1, 2); Ij ¼ immunostimulant on data (j ¼ 1, 2, 3, 4) Tk ¼ time effect on data (j ¼ 1, 2, 3 … 7); (S  I)ij ¼ interaction effect between strain and immunostimulant; (S  T)ik ¼ interaction effect between strain and time; (I  T)jk ¼ interaction effect between immunostimulant and time; (S  I  T)ijk ¼ interaction effect among strain, immunostimulant and time; and eijkm ¼ random observation error (m ¼ 1, 2, 3 … 6). A general linear model (GLM) was undertaken to evaluate the fixed effects of “Immunostimulant, I” and “Time, T” and their interaction on TCC in the hemocytes. The model was:

Yjkm ¼ m þ Ij þ Tk þ ðI  TÞjk þ ejkm where, Yjkm ¼ TCC of the m replicate from j immunostimulant and k time; m ¼ overall constant; Ij ¼ immunostimulant on TCC (j ¼ 1, 2, 3, 4) Tk ¼ time effect on TCC (j ¼ 1, 2, 3 … 7); (I  T)jk ¼ interaction effect between immunostimulant and time and ejkm ¼ random observation error (m ¼ 1, 2, 3). All the data were analyzed using a SAS System for windows (SAS, 8.0, SAS Institute Inc., Cary, NC, USA) and significance for all analyses was set to P < 0.05 unless noted otherwise.

233

complete cDNA sequence of CnTLR-1 was obtained from noble scallop C. nobilis by RACE-PCR strategy. A 50 untranslated region (UTR) of 364 bp, an open reading frame (ORF) of 1920 bp encoding 639-deduced amino acids containing an estimated molecular weight of 74.53 kDa with a theoretical isoelectric point of 5.46, and a 30 UTR of 698 bp with a poly (A) tail and a predicted canonical polyadenylation signal site (AATAAA) (Fig. 1) were identified in the cDNA sequence. There were 9 potential N-linked glycosylation sites predicted for CnTLR-1. It was deposited in GenBank under the accession number of LN994760. Five LRRs domains (residues 35e58, 60e83, 84e107, 133e156, 323e346), two LRR-C-terminals (LRRCTs) (residues 205e260, 380e430), a LRR-N-terminal (LRRNT) (residues 264e302), a transmembrane domain (residues 433e455) and a core cytoplasmic TIR domain (residues 487e628) were identified by using the SMART database (Fig. 2). As a vital N-terminal extracellular domain of toll like receptors, the LRR consensus is typically a short sequence containing ~24 residues with leucine residues at conserved positions and plays a crucial role in ligand binding. Similarities of 5 CnTLR-1 LRRs (except LRRCT and LRRNT) are shown in Fig. 1. The LRR consensus sequence of CnTLR-1 is the 24-residue motif of xLxxLxLxxNxfxxfxxxxFxx, where x represents any amino acid, f is any hydrophobic residue, L and F are frequently replaced by other hydrophobic amino acids. From the consensus sequence, CnTLR-1 contains the highly conserved L(Leu) and N(Asn) at position 7 and 10, respectively.

3.2. Multiple sequence alignments and phylogenetic tree analysis 3. Results 3.1. Cloning and sequencing of the CnTLR-1 gene A total of 2982-bp nucleotide sequence representing the

In comparison with other known TIRs domains, CnTLR-1 was most closely related to C. gigas TLR (CgToll, 60% identity), followed by M. galloprovincialis TLR (MgTLR-i, 55% identity) and other selected invertebrate TLRs (30e35% identity) (Fig. 3). When applied

Fig. 2. Predicted protein domain architecture of CnTLR-1 determined by SMART analysis. TM domain in dark blue. LRR, LRRCT and LRRNT domains are labeled accordingly. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Fig. 3. Multiple sequences alignment of TIR domain of CnTLR-1 with other invertebrate TLRs. Highly conserved or identical residues were shaded in black and similar residues were in gray. At the bottom of sequences, identical (*) and similar (.or:) were indicated. Gaps($) were used to maximize the alignment. Amino acid sequences for the alignment were acquired from Genbank (accession numbers are in brackets): CnTLR-1, C. nobilis toll-like receptor 1 (LN994760); CgToll, C. gigas protein toll-like (XP_011435861.1), 60% identity; MgTLR-i, M. galloprovincialis toll-like receptor i (AFU48617.1), 55% identity; CgToll2, C. gigas protein toll (EKC28748.1), 35% identity; PcToll, P. canadensis protein toll (XP_014613497.1), 32% identity; AeToll, A. echinatior Toll (EGI70800.1), 31% identity; DqToll, D. quadriceps (XP_014472682.1), 30% identity.

234

Y. Lu et al. / Fish & Shellfish Immunology 56 (2016) 229e238

Fig. 4. Phylogenetic tree of CnTLR-1. Full-length amino acid sequences of CnTLR-1 were aligned with other invertebrate TLRs showed high similarities in BLASTp homology searches by the ClustalW program and the tree was constructed using MEGA 5.0 software with the neighbor-joining method. The bootstrap sampling was performed with 1000 replicates. Abbreviations and the accession numbers of TLR sequences were listed on the right.

to the NCBI BLASTp program, the whole amino acid sequence of CnTLR-1 shared 47% and 40% similarities with C. gigas (XP_011435861.1) and M. galloprovincialis (AFU48617.1), respectively. To investigate the molecular evolutional relationships between CnTLR-1 and other species, full length amino acid sequence of CnTLR-1 and other TLRs showed high similarities in BLASTp homology searches were used to construct the phylogenetic tree by Neighbor-joining statistical method. Fig. 4 showed that the TLR members were mainly clustered into two groups, mollusk and arthropod. CnTLR-1 was clustered with mollusk TLRs, especially closely related to C. gigas (XP_011435861.1) and M. galloprovincialis (AFU48617.1) TLRs.

was found in the mantle (Fig. 5). CnTLR-1 transcripts were significantly up-regulated (P < 0.05) in both orange and brown scallops challenged with LPS, V. parahemolyticus, or Poly I:C groups, which reached to the peak at 3, 6 and 12 h (P < 0.05) in orange scallops, while at 6, 6 and 12 h (P < 0.05) in brown scallops. In addition, CnTLR-1 transcript levels of orange scallops were significantly higher than that of the brown ones at 3 h (P < 0.05), 6 h (P < 0.05) in V. parahemolyticus and LPS challenge groups and at 12 h (P < 0.05) , 24 h (P < 0.05) in Poly I:C groups, indicating a stronger immune competence in orange scallops (Fig. 6). Analysis of variance in Table 2 showed that strain, immunostimulant and time made a significant impact on CnTLR-1 transcripts independently, and their interaction were all significant.

3.3. Tissue distribution and comparison of CnTLR-1 transcirpt profiles after challenges between orange and brown scallops C. nobilis

3.4. Changes of TCC in the hemolymph after immunologic stimulants challenge

The amplification efficiency of CnTLR-1 and b-actin was 96.1% and 97.23%, respectively. CnTLR-1 transcripts were wildly distributed in examined tissues including the mantle, gill, kidney, hepatopancreas and gonad with different expression levels. The level was relatively lower in the adductor muscle, while the highest level

Fig. 7 revealed that after V. parahaemolyticus, LPS, Poly I:C injection, TCC in the hemolymph of orange scallops increased first, then decreased below that of PBS control group, and returned to the normal levels in the end. The biggest rise of TCC was in the Poly I:C challenge groups and the highest point was at 6 h. TCC peaked at

Y. Lu et al. / Fish & Shellfish Immunology 56 (2016) 229e238

Fig. 5. Tissue distributions of CnTLR-1 in healthy C. nobilis by qRT-PCR analysis. Expression levels in all tissues are presented relative to that in intestines (1). Vertical bars represent ± S.E. (N ¼ 6) for each tissue.

3 h and 6 h in LPS and V. parahaemolyticus challenge groups, respectively. Analysis of variance in Table 3 showed that only time made a significant impact on TCC.

4. Discussion As key molecules that identify various PAMPs in the immune system after the invasion of microbial infections, toll-like receptors are important bridges connecting innate and adaptive immunity in many species [5]. In C. nobilis, we cloned a toll-like receptor gene CnTLR-1 with a potential immune function against pathogens. The putative protein sequence of CnTLR-1 cDNA was found to share high similarities with other mollusk like M. galloprovincialis [14] and C. gigas [13]. The TIR domain is a highly-conserved region presented in toll-like receptors and mediates protein-protein interactions between TLRs and signal-transduction components like MyD88 [7]. Result of CnTLR-1 TIR multiple alignment revealed that TIR of C. nobilis shared high homology with mollusk C. gigas and M. galloprovincialis, suggesting that they may have similar functions in shellfish TLR signaling pathway. The LRR motif “xLxxLxLxxNxfxxfxxxxFxx” in C. nobilis was similar compared with other species, such as C. farreri TLR (xLxxLxLxxNxfxxfxxxxFxxLx) [12], C. gigas TLR (xLxxLxLxxNxfxxfxxxxFxxLx) [13], Eriocheir sinensis TLRs (xLxxLxLxxNxfxxfxxxxFxxLx) [52], and Apostichopus japonicus TLRs (LxxLxLxxNxL) [53]. Unlike most TLRs, CnTLR-1 lacked the signal peptide in the N-terminus, which was also found in A. japonicus AjToll [53]. Though divergence was detected the ectodomain, the TIR domain in the cytoplasmic region was highly conserved, permitting different lineages to share basically common signaling mechanisms and analogous regulatory module [11]. In addition, phylogenetic tree analysis based on full-length CnTLR-1 and other species showed that CnTLR-1 might be derived from C. gigas (XP_011435861.1) and M. galloprovincialis, suggesting that CnTLR-1 may have similar downstream signal adaptors like MyD88 [21], TRAF6 [23], Ref [19], I Kappa B [20] in the TLR signal pathway.

235

Further studies need to be done to understand if other molecules involved in ligands recognition of CnTLR-1 and to confirm the subcellular localizations of CnTLR-1. CnTLR-1 transcripts were detected in different tissues, with the highest level found in the mantle, followed by the haemocyte. As an important filtering organ, the mantle contacts directly with the outside world, not only can it secrete chemicals that form shells, but also plays a vital role in the process of immune defense. Bivalves execute immune defense mainly by relying on the innate and nonlymphoid system consisting of both cellular and humoral components [45]. The cellular system includes phagocytosis or encapsulation of cells, leading to pathogen destruction through hydrolytic enzyme activity and oxygen metabolite release, while the humoral components include antimicrobial peptides and opsonins [46]. All these functions depend greatly on the hemolymph circulation, which is believed to be important in scallops’ interior defense [1]. To better understand the biological role of CnTLR-1, three immune stimulants, V. parahaemolyticus, LPS and Poly I:C were applied and the expression profiles of CnTLR-1 was investigated. V. parahaemolyticus is widely distributed in coastal seawater, bottom sediments and seafoods including scallop, oyster, clam, shrimp, crab and so on, it’s a main food-borne pathogens that causes gastrointestinal illness in humans especially in some coastal cities in China [54]. LPS are found in the outer membrane of Gramnegative bacteria, they are known as endotoxins and lipoglycans which induce strong immune responses of normal animal immune systems [55]. Some marine invertebrates, such as C. farreri, C. gigas, A. japanicus are highly sensitive to LPS [12,13,53]. Poly I:C is a structural mismatched double-stranded RNA, it is used as an immunostimulant in the research of immune mechanism to simulate viral infections [56]. The result showed that CnTLR-1 transcripts were significantly up-regulated after V. parahemolyticus and LPS and Poly I:C challenges. In orange scallops, CnTLR-1 transcripts reach the highest points at 6 h (112-fold) in V. parahemolyticus groups, 3 h (148-fold) in LPS groups and 12 h (43-fold) in Poly I:C groups, while in the brown ones, the respective increase was only 52-, 30- and 21-fold, indicating that the immunocompetences were discrepant in scallops of the same genetic background but different carotenoid content. Combined with the CnTLR-1 expression, we can speculate that the immunocompetence between orange and brown scallops were different, and even the orange scallops had a stronger immune competence in resisting bacteria and viruses than brown ones. Why in the same genetic and growing background, orange and brown scallops performed such a big difference in immune defense? Carotenoids should be a key factor. It is generally known that carotenoids are efficient antioxidants scavenging singlet molecular oxygen and peroxyl radicals [29], which enhancing cell-mediated and humoral immune response and photoprotection in animals and humans [31]. Numerous epidemiological researches showed that diets rich in carotenoids are related to reduced risk for degenerative disorders [29]. For example, acting as the precursor of vitamin A, b-carotene could reduce morbidity of childhood blindness [57], lutein and zeaxanthin have functions on relieving visual fatigue and enhancing the visual care [58], carotenoids can increase the vitality of B cells in the immune system, prevent cardiovascular disease, cancer, age-related macular degeneration, osteoporosis and eye diseases [30e33] and so on. Orange scallops were rich in TCC in adductor muscle, mantle and gill [36,38], when suffered from V. parahemolyticus, LPS, Poly I:C challenges, CnTLR-1 expression was up-regulated under the influence of carotenoids, suggesting that scallops might circulated more carotenoids in hemolymph to help regulate CnTLR-1 expression. The results of TCC did confirm it. We observed that TCC were different degrees up-

236

Y. Lu et al. / Fish & Shellfish Immunology 56 (2016) 229e238

Fig. 6. qRT-PCR analysis of CnTLR-1 mRNA expression in hemocytes at different time points in response to V. parahemolyticus, LPS and Poly I:C challenges. Relative expressions of CnTLR-1 were expressed as fold changes over PBS control samples taken at the same time point as normalized to change in expression. Error bars represent ± S.E. of six independent investigations. Significant differences across control in same color scallops at same timing was indicated by * (P < 0.05) or ** (P < 0.01). Asterisk on the polygonal line represent the significant differences between orange and brown scallops at same timing.

Table 2 Analyses of variance for CnTLR-1 mRNA expression in hemocytes of C. nobilis. Source

DF

MS

F

P

Strain (S) Immunostimulant (I) Time (T) SI ST IT SIT

1 3 6 3 6 18 18

9962.56646 14845.43760 11733.15598 3725.08545 4846.53166 3758.28814 2296.63357

15.34 22.85 18.06 5.73 7.49 5.79 3.54

<0.001 <0.001 <0.001 <0.001 <0.001 <0.001 <0.001

regulated and then down-regulated in three immune stimulant groups compared to PBS control group (Fig. 7.). Carotenoids are important pigments in both enzymatic and non-enzymatic antioxidant systems [29]. Orange scallops store large amount carotenoids in the tissues, may have a meaningful role in the evolution of their immune system, which become a genetic advantage in

helping regulate various genes. For instance, carotenoids can upregulate Vg gene in scallops [35], connexin 43 in human and animal cells [34], a-carotene can inhibit the synthesis of N-myc RNA [59], b-carotene can increase the UVA-induced up-regulation of haemoxygenase-1 (HO-1) transcripts [60]. So as an important immune gene, CnTLR-1 together with carotenoids may constitute the immune defense mechanism in Nan’ao Golden Scallop. Further study are need to be done to investigate the mechanism. In conclusion, the novel CnTLR-1 gene in noble scallop C. nobilis may function as an acute phase protein involved in anti-bacterial and anti-fungal immune defenses, thus contribute to the capacity of scallops to mount an proper innate immune response to diverse PAMPs. The transcripts of CnTLR-1 in orange scallops was significantly higher than the brown ones under V. parahemolyticus, LPS, Poly I:C stress, indicating that the immunocompetence between orange and brown scallops might be different, and “Nan’ao Golden Scallop” might have a stronger immune competence in resisting

Y. Lu et al. / Fish & Shellfish Immunology 56 (2016) 229e238

[6]

[7] [8]

[9] [10]

[11] [12]

[13]

[14]

[15] Fig. 7. Total carotenoids content (TCC) in hemocytes of orange scallops C. nobilis at different time points in response to V. parahemolyticus, LPS, Poly I:C or PBS challenges. Error bars represent ± S.E. of six independent investigations. [16] Table 3 Analyses of variance for TCC in hemocytes of C. nobilis.

[17]

Source

DF

MS

F

P

Immunostimulant (I) Time (T) IT

3 6 18

6.4229249 27.9770708 4.0397231

1.81 7.89 1.14

>0.05 <0.001 >0.05

[18]

[19]

bacteria and viruses. Further, TCC increased first and then decreased after V. parahemolyticus, LPS and Poly I:C challenges, showed that carotenoids could play roles in immune defense system and up-regulate gene expression under pathogens stress in the noble scallop. Further studies are needed to be done to identify additional toll-like receptor genes of C. nobilis and to illuminate their innate immune functions against different PAMPs under the influence of carotenoids.

[20]

[21]

[22]

[23]

Acknowledgements We are very grateful to Dr. Chiju Wei (Multidisciplinary Research Center, Shantou University) for his careful revision and many constructive comments. Funding for this research was provided by National Natural Science Foundation of China (31372528), China Modern Agro-industry Technology Research System (CARS-48), Guangdong Province Natural Sciences Foundation (2015A030311027), Science & Technology Plan (2013B020503061, 2015B090903081) and Marine and Fishery Promotion Project (B201300B06), China.

[24]

[25]

[26]

[27]

References [28] [1] R. Medzhitov, C.A. Janeway Jr., Innate immunity, New Engl. J. Med. 343 (2000) 338e344. [2] R. Medzhitov, C.A. Janeway Jr., Decoding the patterns of self and non-self by the innate immune system, Science 296 (2002) 298e300. [3] C.A. Janeway Jr., R. Medzhitov, Innate immune recognition, Annu. Rev. Immunol. 20 (2002) 197e216. [4] B. Beutler, Z. Jiang, P. Georgel, K. Crozat, B. Croker, S. Rutschmann, X. Du, K. Hoebe, Genetic analysis of host resistance: toll-like receptor signaling and immunity at large, Annu. Rev. Immunol. 24 (2006) 353e389. [5] K. Hoshino, O. Takeuchi, T. Kawai, H. Sanjo, T. Ogawa, Y. Takeda, K. Taleda,

[29] [30] [31] [32]

237

S. Akira, Cutting edge: toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product, J. Immunol. 162 (1999) 3749e3752. J.K. Bell, G.E. Mullen, C.A. Leifer, A. Mazzoni, D.R. Davies, D.M. Segal, Leucinerich repeats and pathogen recognition in Toll-like receptors, Trends Immunol. 24 (2003) 528e533. M. Yamamoto, S. Akirz, TIR domain-containing adaptors regulate TLR signaling pathways, Adv. Exp. Med. Biol. 560 (2005) 1e9. B. Lemaitre, E. Nicolas, L. Michaut, J.M. Reichhart, J.A. Hoffmann, The dorso€tzle/Toll/cactus controls the potent antiventral regulatory gene cassette spa fungal response in Drosophila adults, Cell 86 (6) (1996) 973e983. S. Valanne, J.H. Wang, M. R€ amet, The Drosophila toll signaling pathway, J. Immunol. 186 (2011) 649e656. D. Zhang, G. Zhang, M.S. Hayden, M.B. Greenblatt, C. Bussey, R.A. Flavell, S. Ghosh, A toll-like receptor that prevents infection by uropathogenic bacteria, Science 303 (5336) (2004) 1522e1526. M.R. Coscia, S. Giacomelli, U. Oreste, Toll-like receptors: an overview from invertebrates to vertebrates, ISJ-Invertebr. Surviv. J. 8 (2011) 210e226. L.M. Qiu, L.S. Song, W. Xu, D.J. Ni, Y.D. Yu, Molecular cloning and expression of a toll receptor gene homologue from Zhikong Scallop, Chlamys farreri, Fish Shellfish Immunol. 22 (5) (2015) 451e466. L.L. Zhang, L. Li, G.F. Zhang, A Crassostrea gigas toll-like receptor and comparative analysis of TLR pathway in invertebrates, Fish Shellfish Immunol. 30 (2) (2011) 653e660. M. Toubiana, M. Gerdol, U. Rosani, A. Pallavicini, P. Venier, P. Roch, Toll-like receptors and MyD88 adaptors in Mytilus: complete cds and gene expression levels, Dev. Comp. Immunol. 40 (2) (2013) 158e166. D.R. Mateo, S.J. Greenwood, M.T. Araya, F.C. Berthe, G.R. Johnson, A. Siah, Differential gene expression of gamma-actin, Toll-like receptor 2 (TLR-2) and interleukin-1 receptor-associated kinase 4 (IRAK-4) in Mya arenaria haemocytes induced by in vivo infections with two Vibrio splendidus strains, Dev. Comp. Immunol. 34 (7) (2010) 710e714. M.S. Goodson, M. Kojadinovic, J.V. Troll, T.E. Scheetz, T.L. Casavant, M.B. Soares, M.J. McFall-Ngai, Identifying components of the NF-kappa B pathway in the beneficial Euprymna scolopes-Vibrio fischeri light organ symbiosis, Appl. Environ. Microbiol. 71 (2005) 6934e6946. , C. Zatylny-Gaudin, The Toll/NFV. Cornet, J. Henry, E. Corre, G. Le Corguille kappa B pathway in cuttlefish symbiotic accessory nidamental gland, Dev. Comp. Immunol. 53 (1) (2015) 42e46. M. Wang, J. Yanga, Z. Zhoua, L. Qiu, L. Wang, H. Zhang, A primitive Toll-like receptor signaling pathway in mollusk Zhikong scallop Chlamys farreri, Dev. Comp. Immunol. 35 (2011) 511e520. C. Montagnani, C. Kappler, J.M. Reichhart, J.M. Escoubas, Cg-Rel, the first Rel/ NF kappa B homolog characterized in a mollusk, the Pacific oyster Crassostrea gigas, FEBS Lett. 561 (2004) 75e82. C. Montagnani, Y. Labreuche, J.M. Escoubas, CgIkappaB. A new member of the I kappa B protein family characterized in the pacific oyster Crassostrea gigas, Dev. Comp. Immunol. 32 (2008) 182e190. re, A.L. Giradot, Y. Gueguen, J.P. Cadoret, D. Flament, C. Barreau-Roumiguie re, J.M. Escpibas, Immune gene discovery by J. Garnier, A. Hoareau, E. Bache expressed sequence tags generated from haemocytes of the bacteriachallenged oyster, Crassostrea gigas, Gene 303 (2003) 139e145. Y.S. Du, L.L. Zhang, B.Y. Huang, X.D. Guan, L. Li, G.F. Zhang, Molecular cloning, characterization, and expression of two Myeloid Differentiation Factor 88 (Myd88) in pacific oyster, Crassostrea gigas, J. World Aquac. Soc. 44 (6) (2013) 759e774. S. Roberts, G. Goetz, S. White, F. Goetz, Analysis of genes isolated from plated haemocytes of the Pacific oyster, Crassostrea gigas, Mar. Biotech. 11 (2009) 24e44. K.A. Salazar, N.R. Joffe, N. Dinguirard, P. Houde, M.G. Castillo, Transcriptome analysis of the white body of the squid Euprymna tasmanica with emphasis on immune and hematopoietic gene discovery, Plos One 10 (3) (2015), 1932e6203. Y. Jiao, Q.L. Tian, X.D. Du, Q.H. Wang, R.L. Huang, Y.W. Deng, S.L. Shi, Molecular characterization of tumor necrosis factor receptor-associated factor 6 (TRAF6) in pearl oyster Pinctada martensii, Genet. Mole Res. 13 (4) (2014) 10545e10555. C.B. He, Y. Wang, W.D. Liu, X.G. Gao, P.H. Chen, Y.F. Li, X.B. Bao, Cloning, promoter analysis and expression of the tumor necrosis factor receptorassociated factor 6 (TRAF6) in Japanese scallop (Mizuhopecten yessoensis), Mol. Biol. Rep. 40 (8) (2013) 4769e4779. Y. Lee, I. Whang, N. Umasuthan, M. Zoysa De, C. Oh, C.Y. Choi, C.J. Park, J. Lee, Characterization of a novel molluscan MyD88 family protein from manila clam, Ruditapes philippinarum, Fish Shellfish Immunol. 31 (6) (2011) 887e893. T. Maoka, Recent progress in structural studies of carotenoids in animals and plants, Arch. Biochem. Biophys. 483 (2) (2009) 191e195. W. Stahl, H. Sies, Antioxidant activity of carotenoids, Mole Asp. Medic 24 (2003) 345e351. W. Stahl, H. Sies, Bioactivity and protective effects of natural carotenoids, Biochem. Biophys. Acta-Mole Basis Dis. 1740 (2) (2005) 101e107. A.V. Rao, L.G. Rao, Carotenoids and human health, Pharmacol. Res. 55 (2007) 207e216. S. Kuhnen, P.M.M. Lemos, L.H. Campestrini, B.J. Ogliari, P.F. Dias, M. Maraschin, Antiangiogenic properties of carotenoids: a potential role of maize as functional food, J. Funct. Foods 3 (1) (2009) 284e290.

238

Y. Lu et al. / Fish & Shellfish Immunology 56 (2016) 229e238

n, G. Catasta, E. Toti1, I.G. Cambrodo  n, A. Bysted, [33] G. Maiani, M.J. Periago Casto €hm, F. Granado-Lorencio, B. Olmedilla-Alonso, P. Knuthsen, M. Valoti, V. Bo E. Mayer-Miebach, D. Behsnilian, U. Schlemmer, Carotenoids: actual knowledge on food sources, intakes, stability and bioavailability and their protective role in humans, Mol. Nutr. Food Res. 53 (S2) (2009) S194eS218. [34] J. Bertram, Carotenoids and gene regulation, Nutr. Rev. 57 (1999) 182e191. [35] Q. Zhang, Q.Y. Lu, H.P. Zheng, H.L. Liu, S.K. Li, Differential immune response of vitellogenin gene to Vibrio anguillarum in noble scallop Chlamys nobilis and its correlation with total carotenoid content, Fish Shellfish Immunol. 50 (2016) 11e15. [36] H.P. Zheng, Z.W. Sun, T. Zhang, W.H. Liu, H.L. Liu, Inheritance of shell colors in the noble scallop Chlamys nobilis (Bivalve: Pectinidae), Aquac. Res. 44 (2013) 1229e1235. [37] X.M. Guo, S.E. Ford, F.S. Zhang, Molluscan aquaculture in China, J. Shellfish Res. 18 (1999) 19e31. [38] H.P. Zheng, H.L. Liu, T. Zhang, S.Q. Wang, Z.W. Sun, W.H. Liu, Y.Y. Li, Total carotenoid differences in scallop tissues of Chlamys nobilis (Bivalve: Pectinidae) with regard to gender and shell color, Food Chem. 122 (2010) 1164e1167. [39] Q.F. Huang, Primary discussion on suddenly mass death and its control counter measures of Chlamys nobilis, J. Fujian Fish 22 (3) (2000) 75e77 (in Chinese). [40] R.L. Zhou, J.Y. Lv, J.F. Wu, Investigation about the cause of suddenly mass death of scallop Chlamys nobilis in Leizhou Peninsula North Bay, Fish. Sci. Technol. 18 (2) (2006) 22e23 (in Chinese). [41] K.J. Ryan, C.G. Ray, Sherris Medical Microbiology, fourth ed., McGraw Hill, 2004. ISBN 0-8385-8529-9. [42] C. Brown, E. Losee, Observations on natural and induced epizootics of Vibriosis in Crassostrea lirginia larvae, J. Invertebr. Pathol. 31 (1978) 41e47. [43] R.A. Elston, E.L. Ellio, R.R. Colwel, Conchiolin infection and surface coating vibrio: shell fragility, growth depression and mortalities in cultured oyster and clams, Crassostrea virginica, Ostrea edulis and Mercenaria mercenaia, J. Fish. Dis. 5 (1982) 265e284. [44] S. Li, L. Sun, H. Wu, Z. Hu, W. Liu, Y. Li, X. Wen, The intestinal microbial diversity in mud crab (Scylla paramamosain) as determined by PCR-DGGE and clone library analysis, J. Appl. Microbiol. 113 (2012) 1341e1351. [45] P. Roch, Defense mechanisms and disease prevention in farmed marine invertebrates, Aquaculture 172 (1999) 125e145. [46] A.M. Lackie, Invertebrate immunity, Parasitology 80 (1980) 393e412. [47] H.L. Liu, H.P. Zheng, H.K. Zhang, L.H. Deng, W.H. Liu, S.Q. Wang, F. Meng, Y.J. Wang, Z.C. Guo, S.K. Li, G.F. Zhang, A de novo transcriptome of the noble scallop, Chlamys nobilis, focusing on mining transcripts for carotenoid-based coloration, BMC Genom. 16 (44) (2015) 1e13.

[48] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real time quantitative PCR and the 2△△Ct method, Methods 25 (2001) 402e408. [49] S.A. Bustin, V. Benes, J.A. Garson, J. Hellemans, J. Huggett, M. Kubista, R. Mueller, T. Nolan, M.W. Pfaffl, G.L. Shipley, J. Vandesompele, C. Wittwer, The MIQE guidelines-Minimum information for publication of quantitative realtime PCR experiments, Clin. Chem. 55 (2009) 611e622. [50] S.A. Bustin, J.F. Beaulieu, J. Huggett, F.S. Kibenge, P. Olsvik, L.C. Penning, cis: practical implementation of minimum standard S. Toegel, MIQE pre guidelines for fluorescence based quantitative real-time PCR experiments, BMC Mol. Biol. 11 (2010) 74e79. [51] Y. Yanar, M. Celik, M. Yanar, Seasonal changes in total carotenoid contents of wild marine shrimps (Penaeus semisulcatus and Metapenaeus monoceros) inhabiting the eastern Mediterranean, Food Chem. 88 (2004) 267e269. [52] A.Q. Yu, X.K. Jin, X.N. Guo, S. Li, M.H. Wu, W.W. Li, Q. Wang, Two novel Toll genes (EsToll1 and EsToll2) from Eriocheir sinensis are differentially induced by lipopolysaccharide, peptidoglycan and zymosan, Fish Shellfish Immunol. 35 (2013) 1282e1292. [53] H.J. Sun, Z.C. Zhou, Y. Dong, B. Yang AF.Jiang, S. Gao, Z. Chen, X.Y. Guan, B. Wang, X.L. Wang, Identification and expression analysis of two Toll-like receptor genes from sea cucumber (Apostichopus japonicus), Fish Shellfish Immunol. 34 (1) (2013) 147e158. [54] Y.C. Su, C. Liu, Vibro parahaemolyticus: a concern of seafood safety, Food Microbiol. 24 (6) (2007) 549e558. [55] E.T. Rietschel, T. Kirikae, F.U. Schade, U. Mamat, G. Schmidt, H. Loppnow, €hringer, U. Seydel, F. Di Padova, Bacterial endotoxin: molecA.J. Ulmer, U. Za ular relationships of structure to activity and function, FASEB J. 8 (2) (1994) 217e225. [56] M.E. Fortier, S. Kent, H. Ashdown, S. Poole, P. Boksa, G.N. Luheshi, The viral mimic, polyinosinic:polycytidylic acid, induces fever in rats via an interleukin1-dependent mechanism, Am. J. Physiol. Regul. Integr. Comp. Physiol. 287 (4) (2004) R759eR766. [57] A. Sommer, K.S. Vyas, A global clinical view on vitamin A and carotenoids, Am. J. Clini Nutri 96 (5) (2012) 1204Se1206S. [58] A. Yagi, K. Fujimoto, K. Michihiro, B. Goh, D. Tsi, H. Nagai, The effect of lutein supplementation on visual fatigue: a psychophysiological analysis, Appl. Ergon. 40 (6) (2009) 1047e1054. [59] M. Murakoshi, J. Takayasu, O. Kimura, E. Kohmura, H. Nishino, A. Iwashima, J. Okuzumi, T. Sakai, T. Sugimoto, J. Imanishi, R. Iwasaki, Inhibitory effects of acarotene on proliferation of the human neuroblastoma cell line GOTO, J. Natl. Cancer Inst. 81 (1989) 1649e1652. [60] U.C. Obermüller-Jevic, P.I. Francz, J. Frank, A. Flaccus, H.K. Biesalski, Enhancement of the UVA induction of haem oxygenase-1 expression by bcarotene in human skin fibroblasts, FEBS Lett. 46 (1999) 212e216.