Cloning and expression of vitellogenin (Vg) gene and its correlations with total carotenoids content and total antioxidant capacity in noble scallop Chlamys nobilis (Bivalve: Pectinidae)

Aquaculture 366-367 (2012) 46–53

Contents lists available at SciVerse ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aqua-online

Cloning and expression of vitellogenin (Vg) gene and its correlations with total carotenoids content and total antioxidant capacity in noble scallop Chlamys nobilis (Bivalve: Pectinidae) Huaiping Zheng ⁎, Qian Zhang, Helu Liu, Wenhua Liu, Zewei Sun, Shengkang Li, Tao Zhang Key Laboratory of Marine Biotechnology of Guangdong Province, Shantou University, Shantou 515063, China Mariculture Research Center for Subtropical Shellfish & Algae, Department of Education of Guangdong Province, Shantou 515063, China

a r t i c l e

i n f o

Article history: Received 1 May 2012 Received in revised form 20 August 2012 Accepted 23 August 2012 Available online 31 August 2012 Keywords: Scallop Chlamys nobilis Vitellogenin gene Clone and expression Carotenoids

a b s t r a c t As a nonpolar molecular carrier and a storage protein, vitellogenin (Vg) cannot only combine and transfer lipids, proteins, vitamin and carotenoids to oocytes during the oogenesis, but also be linked with the host immune defense. In this study, the full-length cDNA encoding Vg in noble scallop Chlamys nobilis was cloned. The complete Vg cDNA consists of 7760 nucleotides with an open reading frame encoding 2289 amino acid residues. Phylogenetic analysis of Vg gene revealed that Ch. nobilis was clustered together firstly with its sister species Chlamys farreri and another scallop Mizuhopecten yessoensis, then with other mollusks such as oyster and abalone, and finally with vertebrates. Tissue-specific checking results indicated that Vg gene was only expressed in the ovary. At different gonadal development stages, both orange and brown shell color scallops show the same trend that the amount of Vg mRNA expression kept at a high level at the growing stage, then dramatically decreased at the mature stage, and finally resumed to higher level at the post-spawning stage. Another very important finding is that significantly positive correlations existed between the Vg gene expression level and total carotenoids content, as well as total antioxidant capacity. The relationship among them needs further study. © 2012 Elsevier B.V. All rights reserved.

1. Introduction The noble scallop, Chlamys nobilis (Bivalve: Pectinidae), is an important edible marine bivalve, which has been commonly cultured in the southern coastal area in China since 1980s. The scallop displays polymorphism not only in shell colors including orange, brown, and orange-purple, but also in adductor muscle colors including orange and white. In the past few years, however, mass mortality of this scallop has occurred frequently (Huang, 2000; Zhou et al., 2006). Interestingly, individuals of orange shell color showed much higher survival rate than those with shells of other colors. The questions are then raised about why this phenomenon occurred and what is the mechanism laid behind. Previous study on this species showed that total carotenoids content in individuals with orange shell and adductor is higher than in those with brown shell and white adductor muscle (Zheng et al., 2010), and shell and adductor colors have been confirmed to be consistently inherited (Zheng et al., 2012). It is well known that carotenoids can enhance defense capability and immuno-competence in a ⁎ Corresponding author at: Key Laboratory of Marine Biotechnology of Guangdong Province, Shantou University, Shantou 515063, China. Tel.: + 86 754 82903285; fax: + 86 754 82903473. E-mail address: [email protected] (H. Zheng). 0044-8486/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.aquaculture.2012.08.031

variety of animal systems (Krinsky, 1989, 2001; Miyashita, 2009), which may be also one of the factors accounting for more survival rates during mortality cases of noble scallops. However, there is still no study conducted to investigate immune system in the noble scallops until now. Vitellogenin (Vg), a precursor of egg yolk protein, vitellin (Vn) (Matozzo et al., 2008), is very closely related to carotenoids (Ando and Hantano, 1991), and now it has been intensively revealed to be linked with the host immune defense in oviparous animals (Lourenço et al., 2009; Zhou et al., 2010). Vg has been demonstrated to possess both hemagglutinating and antibacterial activities (Li et al., 2008; Shi et al., 2006). To date, gene expression levels, cDNA full-length clones and sequences of Vg have mainly focused on insects, crustaceans and fish (LaFleur et al., 1995; Mouchel et al., 1996; Okuno et al., 2002; Tsutsui et al., 2000). In mollusks, the work have been only carried out in Pacific oyster Crasostrea gigas (Matsumoto et al., 2003), Pacific abalone Haliotis discus hannai (Matsumoto et al., 2008) and Zhikong scallop Chlamys farreri (Sun, 2009). The related studies on Vg, however, have been not carried out in the noble scallops yet. In this study, the full-length of the noble scallop Ch. nobilis Vg gene was first cloned and sequenced. At the same time, tissue-specific Vg expression levels and their gonad-development-dependent changes were also investigated. Moreover, total carotenoids content and total antioxidant capacity in ovaries were determined simultaneously, in order to

H. Zheng et al. / Aquaculture 366-367 (2012) 46–53 Table 1 Primers used for cDNA cloning. Primer name

Sequence

VPF VPR V3F NV3F 2V3F 2NV3F 3V3F 3NV3F 4V3F 4NV3F V5R NV5R M13-47 RV-M β-actinF β-actinR RVF RVR

5′ GGSAGCAMSATTTATTCCGG 3′ 5′ TGGCTYTCTGCWATRGCRCT 3′ 5′ TGGACGAGCGCCAGAGCCTAGACAC 3′ 5′ ACAGTCCCATGGCCAGAGCGAGTTC 3′ 5′ AGCAGCGTGGCTTTGTATGGGAGCTG 3′ 5′ ATAGAGCGAGCCGAAACACCAGGTC 3′ 5′ CAGTTGTTCCAGGATTGAGCCCTCCG 3′ 5′ ATTGCCGGACCAACCTGAAGAAG 3′ 5′ ACTCGAAGACGTGACAATGCCAGATG 3′ 5′ GGTGAAGGATGGCAATGTTCCAG 3′ 5′ CGCAAGCTTTGCCACCATATCTGCTG 3′ 5′ ATCTGCTGCCTGGTGGGATCGAGAC 3′ 5′ CGCCAGGGTTTTCCCAGTCACGAC 3′ 5′ GAGCGGATAACAATTTCACACAGG 3′ 5′ CAAACAGCAGCCTCCTCGTCAT 3′ 5′ CTGGGCACCTGAACCTTTCGTT 3′ 5′ AAAGGCTGATATGAAAGACCGAC 3′ 5′ GCGTTGGTGGATTTTGTGAC 3′

47

investigate whether there is correlation between Vg and carotenoids, as well as antioxidant capacity. The results here will lay solid foundation for the further study about Vg and its function in immune defense in the noble scallop in the future. 2. Material and methods 2.1. Animals and tissue sample The sixteen-month-old noble scallops Ch. nobilis with orange and brown shell color cultured at Nanao Island of Guangdong Province, China were used in the present study. Scallop gonads can be characterized as either empty, filling, full (mature), partially spawned, or spent, based on external appearance (Barber and Blake, 2006). For example, gonads become smaller, flatter in cross section, colorless, and watery in appearance after spawning and the release of gametes. Therefore, the most widely used (and simplest) method of assessing gametogenesis in scallops has been via gross visual examination of the gonads. Observations were made as to the relative size, shape

Fig. 1. The full-length nucleotide sequence and the deduced amino acid sequence of Vg gene in Chlamys nobilis. Boxes indicate the start codon ATG, conserved motif KTIGNAG, furin protease cleavage site RDRR and stop codon TAA, respectively. Underlined sequence is the deduced signal peptide. Sequence with gray background is the contained functional motifs vitellogenin N domain, DUF1943 and VWD domains. Bold sequence is the signal for polyadenylation.

48

H. Zheng et al. / Aquaculture 366-367 (2012) 46–53

Fig. 1 (continued).

(“condition”), and color of the gonads of several species (Barber and Blake, 2006). In the present study, the developmental stage of scallop's ovaries was classified as seven stages: S1 as undifferentiating or immature (small, flat; transparent, colorless), S2 as early differentiating (minute follicles visible; fawn colored), S3 as growing or filling (ovary larger and thinker, from fawn to orange), S4 as mature or full (ovary large, think, firm; grenadine; press slightly the ovum outflow automatically), S5 as spawning, S6 as post-spawning (ovary transparent), and S7 as degenerating stage (ovary dull, thin, collapsed; follicles empty) according to the report of Mori et al. (1977; Zhao et al., 1991; Barber and Blake, 2006). In fact, the scallops do not keep their gonads at the same developmental level. It is also impossible to distinguish every individual by the cytology and histology method. The individuals at S3, S4, and S6 were chosen to conduct this experiment through the visual examination. Ovary tissue of one orange shell scallop was sampled for cloning Vg gene. Tissues of kidney, gill, adductor muscle, gonad and mantle were separately sampled from male and female scallops for studying

the tissue-specific expression of Vg gene. Ovaries at S3, S4, and S6 from orange and brown shell individuals were separately sampled for investigating different Vg gene expression levels among different stages between two shell color scallops. Moreover, due to Vg gene expressed actively at S3, sampled ovaries at S3 to study the relationship between Vg gene expression level, TCC (total carotenoids content) and TAC (total antioxidant capacity). Collected samples were stored frozen at − 80 °C until use. Three replicates were employed for each sample except for the gene cloning sample.

2.2. Cloning of the full-length cDNA of Vg Total RNA was extracted using Trizol reagent (Invitrogen) following manufacturer's protocol. Then, 1 μg of total RNA was used as template for cDNA synthesis by using SuperScript III reverse transcriptase PCR and OligodT as primers following the instructions of the manufacturer (Invitrogen).

H. Zheng et al. / Aquaculture 366-367 (2012) 46–53

88 52 100 82

49

Chlamys farreri Mizuhopecten yessoensis Pecten maximus Chlamys nobilis

Crassostrea gigas

100 100 44

Mytilus edulis Haliotis discus hannai Apis mellifera

88

Bombyx mandarina

65

100 Bombyx mori

Caenorhabditis elegans Galaxea fascicularis 100

Marsupenaeus japonicus Fenneropenaeus merguiensis

100

Callinectes sapidus 100 42

Portunus trituberculatus Gallus gallus Xenopus laevis

100

Thunnus thynnus

69 95

Oncorhynchus mykiss

0.2 Fig. 2. Phylogenetic analysis of noble scallop Chlamys nobilis Vg with other Vgs. The accession numbers of the Vg sequences are Mizuhopecten yessoensis BAB63260, Chlamys farreri ADE05540, Pecten maximus CAQ06469, Mytilus edulis AAT72932, Crassostrea gigas BAC22716, Haliotis discus hannai BAF98238, Caenorhabditis elegans CAA39670, Thunnus thynnus ACX32463, Galaxea fascicularis BAD74020, Marsupenaeus japonicus BAB01568, Callinectes sapidus ABC41925, Apis mellifera NP_001011578, Fenneropenaeus merguiensis AAR88442, Bombyx mandarina BAB32642, Oncorhynchus mykiss CAA63421, Bombyx mori BAA06397, Gallus gallus CAA31942, Xenopus laevis AAA49982, Portunus trituberculatus AAX94762.

Degenerate primers were chosen in cDNA conserved regions of Vg coding sequences (NCBI, USA) from alignments of different species (Patinopecten yessoensis: AB055960; Pecten maximus: AM943022; Mytilus edulis: AY679116; C. gigas: AB084783; H. discus hannai: AB360714; Ch. farreri: GQ227743). The fragment was amplified in a 50 μL reaction volume containing 5 μL of 10× PCR buffer, 4 μL of dNTP mix, 2 μL of each primer (10 μmol L −1), 1 μL of template cDNA, 35.75 μL of PCR-grade water, 0.25 μL (1 U) of Taq polymerase (TaKaRa). The PCR temperature profile was 94 °C for 5 min followed by 30 cycles of 94 °C for 30 s, 54 °C for 30 s, 72 °C for 1 min and a final extension step at 72 °C for 10 min. The obtained PCR products were separated on 1% agarose gel, and then purified with a PCR purification kit (Sangon Biotech). The purified PCR product was ligated with the pMD18-T vector (TaKaRa), and transformed into competent Escherichia coli cells. The recombinants were identified through blue–white color selection in ampicillincontaining LB plates and screened with M13-47 and RV-M primers, and then sequenced on both strands. In order to obtain the full-length cDNA of the target genes, 5′ and 3′ RACE-PCRs were carried out using the SMART™ RACE cDNA amplification kit (Clontech) and LA Taq polymerase (TaKaRa). Based on the known partial sequences, specific primers V3F, V5R and nested primers NV3F, NV5R were designed for 3′ RACE and 5′ RACE, respectively. The preparation methods of cDNA and amplification conditions of RACE-PCRs were both conducted as suggested by the manufacturers. Since 3′ PCR product was too long to be sequenced, PCR walking was performed with the designed primers (2V3F, 2NV3F, 3V3F, 3NV3F, 4V3F, and 4NV3F). PCR products were subcloned and sequenced following the procedures described above. The full-length

cDNA of Vg was aligned from the overlapping cDNA clones. The sequences of primers used for clone are listed in Table. 1. 2.3. Sequence analysis and construction of phylogenetic tree The cDNA and deduced amino acid sequences of Vg were analyzed using DNAman and the Expert Protein Analysis System (http://au. expasy.org/tools/). The sequences of Vg from different species were compared using Blastx search of the GenBank. Signal peptide cleavage site was predicted by SignalP 4.0 using neural networks and hidden Markov models. The phylogenetic tree was constructed by the CLUSTAL X2.0 and MEGA 4.1 using the neighbor-joining (NJ) algorithm and the reliability of the branching was tested using bootstrap resampling (1000 pseudo-replicates) choosing the Vg domain area in the N-terminal region about 700 aa, except for some species which did not get the full length sequences. 2.4. Quantitative real-time PCR analysis of Vg expression The Vg gene expression levels were determined by SYBR Green quantitative real-time RT-PCR. RNA isolation was carried out as described above, and cDNA was synthesized by PrimeScript RT reagent kit with gDNA Eraser (TaKaRa). Quantitative real-time PCR was conducted in an ABI 7300 real-time PCR system using the SYBR Premix Ex Taq II qRT-PCR Kit (TaKaRa). Each assay was performed with β-actin mRNA as the internal control. Primer β-actin F and β-actin R were used to amplify the β-actin gene, and RVF and RVR were used for Vg amplification. The expression level of Vg

50

H. Zheng et al. / Aquaculture 366-367 (2012) 46–53

Fig. 3. Tissue-specific expression of Vg in male and female noble scallop Chlamys nobilis detected by qPCR. (G: gonad, K: kidney, M: mantle, A: adductor muscle, Gi: gill). The group of tissues among male and female, significant (P b 0.001) differences in expression of Vg gene are indicated by asterisk.

[cycle threshold (Ct) = 18] was used for normalization. A Ct of 38 was designated arbitrarily as 1.

supernatants were collected for TAC analysis with six major steps: 1) the working FRAP reagent was prepared by mixing 10 volumes of 300 mmol L −1 acetate buffer, pH 3.6, with 1 volume of 10 mmol L −1 TPTZ (2, 4, 6-tripyridyl-s-triazine) in 95% ethanol and with 1 volume of 20 mmol L−1 ferric chloride, and aqueous solutions of known Trolox concentration, in a range of 100–1000 μmol L −1 were used for calibration; 2) 60 μL of tissue supernatant and 180 μL of deionized water were subsequently added to 1.8 mL 37 °C FRAP reagent, was and then incubated for 30 min at 37 °C. Meanwhile, the tissue supernatant was substituted with the same volume of deionized water for control; 3) mixture was chilled in ice-cold water to stop the reaction after incubation; 4) the absorbance of sample (As) and control (Ac) was determined using Infinite 200 PRO multifunctional microplate reader (Tecan Austria GmbH) at 593 nm; 5) difference between As and Ac was subsequently transferred into Trolox equivalent concentration (μmol L −1, CT) with reference to the reaction signal given by a Trolox solution of known concentration; 6) protein concentration (CP, μg ml−1) of each tissue supernatant was measured by the method of Bradford (1976) using Inifinite200 PRO multifunctional microplate reader (Tecan Austria GmbH) at 595 nm; 7) total antioxidant capacity (TAC) was calculated by the following equation: −1

TACðμmol  mg

Þ¼

CT : CP

2.5. Determination of total carotenoids content (TCC) and total antioxidant capacity (TAC) 2.6. Statistical analysis TCC was determined following the method of Zheng et al. (2010). All samples were firstly dried in a vacuum freeze-drying machine and then grinded to a fine powder in mortars. Then, three homogenized samples of 0.01 to 0.03 g were added with 1 ml acetone and shaken at 200 r min −1 for 1 h in the dark at room temperature of 25 °C. The extraction was centrifuged at 5000 rpm (the centrifuge model) for 5 min and then supernatant was scanned in a UV–vis recording spectrophotometer (UV2501PC, Japan) from 400 to 700 nm. Finally, TCC (μg g −1 dry weight) was calculated by using the extinction coefficient E(1%, 1 cm) of 1.900 (Yanar et al., 2004) at the absorption value at 480 nm. TAC was determined using the ferric reducing antioxidant power (FRAP) (Benzie and Strain, 1996). All samples were firstly homogenated using a homogenizer (T18, IKA, Germany) with ice-cold 0.86% NaCl. Then, the tissue homogenate was immediately centrifuged (12000 g, 10 min, at 4 °C, using Sigma 3-18K Centrifuge, Germany), and the

All data were given in terms of relative mRNA expressed as means ± standard deviation of the means (SD). The results were subjected to one-way analysis of variance (ANOVA) and followed by Tukey test to establish the difference between treatments. A general linear model (GLM) was undertaken to evaluate the fixed effects of “developmental stage, S” and “shell color, C” and their interaction on Vg gene expression level, the model was: yijm ¼ μ þ Si þ C j þ ðS  C Þij þ eijm : Where, yijm = the Vg expression level of the m replicate in the i developmental stage from the j shell color; μ = overall constant; Si = the fixed effect of developmental stage (i = 1, 2, 3); Cj = the fixed effect of shell color (j = 1, 2); (S × C)ij = interaction effect between developmental stage and shell color; and eijm = random observation error (m = 1, 2, 3). Additionally, correlations among the Vg gene expression level, TCC and TAC of ovary were analyzed using linear regression and Pearson regression, respectively. All statistical analyses were done on a SAS system for windows (SAS, 8.0, SAS Institute Inc., Cary, NC, USA) and significance for all analyses was set to P b 0.05 unless noted otherwise. 3. Results 3.1. cDNA and the deduced amino acid sequence of Vg

Fig. 4. Vg expression in ovary at different developmental stages between orange (O) and brown (B) shell color individuals in Chlamys nobilis. (S3: growing stage, S4: mature stage, S6: post-spawning stage). Means with different letters indicate statistical significance (P b 0.05) between groups in orange and brown shell among different developmental stages, respectively.

The full-length cDNA of Vg (accession no.: JN638064) is 7760 bp, comprising a 5′-UTR of 39 bp, and a long 3′-UTR of 854 bp with a stop codon (TAA) and a canonical polyadenylation signals sequence (AATAAA) prior to the poly A tail (Fig. 1). The open reading frame (ORF) of 6870 bp encoded a polypeptide of 2289 amino acids with a predicted molecular mass of 265.07 kDa and theoretical isoelectric point of 8.73. The deduced amino acid sequence of Vg contained functional motifs such as vitellogenin N domain (24–704 aa), DUF1943 (Domain of unknown function) (736–1043 aa) and VWD (Von Willebrand factor type D domains) (1987–2161 aa), and also contained a signal peptide of the first 16 amino acids, an conserved amino acid

H. Zheng et al. / Aquaculture 366-367 (2012) 46–53

51

Table 2 Analysis of variance for Vg expression level in ovary among different developmental stages between two shell color scallops. Source

df

MS

F

P

Color Stage Color × stage Error

1 2 2 12

1.7623635E14 3.9434653E14 1.9136658E13 1.8443849E13

9.56 21.38 1.04

b0.01 b0.001 >0.05

motif (KTIGNAG) and a single potential furin protease cleavage site R–X– R–R (RDRR).

3.2. Homology analysis of Vg A phylogenetic tree (Fig. 2) was constructed based on the vitellogenin N-terminal domain region about 700 aa of Vg amino acid sequences from 20 species. Ch. nobilis was firstly clustered together with its sister species Ch. farreri and another scallop Mizuhopecten yessoensis, whereas Ch. farreri and M. yessoensis had closer relationship. Next, it was clustered together with other mollusks such as oyster and abalone, and then with other invertebrates. Vertebrates were clustered together finally. 3.3. Expression of Vg gene in different tissues Fig. 3 clearly showed a strong tissue-specific Vg expression of Ch. nobilis. Vg was strongly expressed in ovary tissue, but hardly detected in testis, kidney, mantle, adductor muscle and gill.

3.4. Expression of Vg gene in ovary at different developmental stages between two shell color individuals Fig. 4 showed that the amount of Vg expression in ovary had the same trend in brown and orange shell individuals during three tested stages. The Vg gene had a high expression level at S3, and then dramatically decreased at S4, finally significantly restored a high level of S3 at S6. And the expression level at S3 and at S6 were both significantly higher than that at S4 (P b 0.05). The Vg gene expression level in orange individuals was higher than that in brown individuals at three tested stages, and significantly difference was detected at S3 (P b 0.05). Analysis of variance in Table 2 demonstrated that the amount of Vg gene expression was significantly affected by ovary developmental stage (P b 0.001) and scallop shell color (P b 0.05).

Fig. 5. Linear correlation between the amount of Vg expression and TCC of ovary in the noble scallop Chlamys nobilis.

4. Discussion In the present study, the complete sequence of Vg gene in the noble scallop Ch. nobilis was for the first time cloned and sequenced. The deduced primary structure of Vg was similar to those of the other mollusk, fish, crustacean and nematode species, especially in the N-terminal region, and KTIGNAG is the best conserved amino acid motif between invertebrate and vertebrate Vgs (Mouchel et al., 1996) in this region. This sequence is speculated to play a highly conserved role in vitellogenesis, such as specific recognition by oocytes (Spieth et al., 1991). The amino acid sequences of scallop Vg was identified as a member of the lipid transport protein family, which includes regions vitellogenin N domain and a VWD domain (Babin et al., 1999). In general, Vgs contain the vitellogenin N-terminal domain and the VWD (Baker, 1988). However, in our study, domain of unknown function (DUF) was found. This domain family adopts a structure consisting of several large open beta-sheets (Thompson and Banaszak, 2002) and the exact function of this region has been not determined yet. This region, so far, has been known to be uniquely present in crustaceans and rarely detected in mollusks and vertebrates (Hwang et al., 2010; Smolenaars et al., 2007). Moreover, like crustaceans (Avarre et al., 2003; Phiriyangkul and Utarabhand, 2006), Vg gene in the noble scallop had no phosvitin and polyserine domains which contained tandem serine repeats and have been found in many insects and vertebrates. At present, the function of polyserine domain is still unknown. In mollusks, these domains only exist in the Pacific oyster C. gigas, but are absent in the Pacific abalone H. discus hannai and the Zhikong scallop Ch. farreri. The absence of these domains in most of these reported mollusks suggests that these domains may not be the necessary functional part for Vg in mollusks.

3.5. Correlations among the amount of Vg expression, TCC and TAC in ovary Significantly linear correlations (P b 0.05) were detected among the amount of Vg expression, TCC and TAC in ovary (Table 3). TCC increased with increasing amount of Vg gene expression (Fig. 5), TAC increased with increasing TCC (Fig. 6) and amount of Vg gene expression (Fig. 7). Table 3 Linear correlation (R2) and Pearson correlation (r) between the amount of Vg expression, TCC and TAC in ovaries of Chlamys nobilis. y TCC TAC TAC

x Vg TCC Vg

⁎⁎ P b 0.01. ⁎⁎⁎ P b 0.001.

a 253.91209 7.67423 8.90334

b

R2

r

8.47E − 6 0.00476 3.872185E − 8

0.7630⁎⁎⁎ 0.4495⁎⁎⁎ 0.3165⁎⁎

0.87353⁎⁎⁎ 0.67046⁎⁎⁎ 0.56256⁎⁎ Fig. 6. Linear correlation between the amount of TAC and TCC of ovary in the noble scallop Chlamys nobilis.

52

H. Zheng et al. / Aquaculture 366-367 (2012) 46–53

Fig. 7. Linear correlation between TAC and the amount of Vg expression of ovary in the noble scallop Chlamys nobilis.

The relationships displayed in the phylogenic tree were in generally agreement with the traditional taxonomy. Interestingly, we found that Ch. farreri had a closer relationship with M. yessoensis than Ch. nobilis in the present study. In the traditional taxonomy, Ch. farreri and Ch. nobilis belong to the same genus, and they should have closer relationship (Xu and Zhang, 2008). The present result may be attributed to their geographic distribution. Ch. nobilis naturally distributes in tropical sea waters, whereas Ch. farreri and M. yessoensis naturally distribute in north temperate sea waters (Xu and Zhang, 2008). During the long evolution of species, environmental factors can cause impacts on evolution of Vg gene. Real-time PCR analysis revealed a strong tissue-specific expression of Vg gene in the present study. Vg was strongly expressed in ovary tissue, but hardly detected in testis, kidney, mantle, adductor muscle and gill. This result was consistent to those reported in many other studies (Boutet et al., 2008; Matsumoto et al., 2008; Sun, 2009). The present result showed that Vg mRNA expression may be related to not only scallops' gonad development level but also scallops' shell colors, which is for the first time report in mollusks. At S3, the ovaries need to accumulate the nutriment for oogenesis, so a large amount of mRNA appeared due to active expression of Vg gene, providing the necessary foundation for Vg protein synthesis, yolk intake and accumulation in oocytes (Sun, 2009). At S4, the oocytes gradually fully grew and the accumulation of yolk came to the end, so the demand of yolk protein decreased lead to the decrease of Vg gene expression level (Boutet et al., 2008). At S6, ovaries stop developing and new oogonium did not begin after spawning, therefore the Vg expressed level should be very low (Boutet et al., 2008; Osada et al., 2004; Sun, 2009). However, the present result showed a higher expression level at S6 which might be attributed to reproductive feature of scallops and season. Indeed, Vg gene expression levels increase together with gonadosomatic index or in relation to specific qualitative gonad stages have been reported in fishes and shrimps (Pousis et al., 2011; Tiu et al., 2006). It is well known that the noble scallop can spawn several times with a very short time interval at a reproductive season (Bueno and Lovatelli, 1990; Hu et al., 1996). Especially from April to June, after spawning, their gonads can be reconditioned in a very short time due to suitable temperature, plentiful diets, after which a second spawning stimulation can be carried out (Hu et al., 1996). Therefore, the increase on amount of Vg gene expression may be found in the scallop at S6. One more important finding in the present study is that there existed significantly positive correlation between the amount of Vg gene expression and TCC at S3. Indeed, Vg has been found to be very closely related to the transport of carotenoids in crustaceans (Arcos et al., 2011; Fyffe and O'Connor, 1974; Pareraki and Stratakis, 1997; Puppione et al., 1986; Wallace et al., 1967; Zagalsky, 1985) and fish (Ando, 1986; Ando and Hatano, 1986, 1987; Lubzens et al., 2003). However, there is still no

study in mollusks which is different from vertebrate with open vascular system. It has been reported that the follicle cells (auxiliary cells) are the site of Vg synthesis (Matsumoto et al., 2003, 2008; Osada et al., 2004). In Mytilus edulis (Pipe, 1987) and Pecten maximus (Dorange and Pennec, 1989), they found that there exist extensive arrays of rough endoplasmic reticulums (RER) around the follicle cells, these organelles are generally associated with protein synthesis and transport. In ovary, carotenoids are usually non-covalently bound to proteins forming carotenoproteins (Cheesman et al., 1967). At the same time, we also found a positive correlation between the amount of Vg expression and TAC, which may indicate that Vg can transport carotenoproteins from RER. Recently, Vg has been considered to play immune defensive roles which not only possess cruor (Doolittle and Riley, 1990) and antimicrobial activity (Shi et al., 2006), but also can remove the internal free radicals (Seehuus et al., 2006). It is well known that carotenoids are effective antioxidants (Krinsky, 2001), which can enhance cell-mediated and humoral immune response in a variety of animal systems from invertebrates to human (Chew and Park, 2004; Krinsky, 1989). For example, carotenoid concentration was found to covary positively with the activity of phenoloxidase, a major component of the arthropod innate immune system, and this pattern was consistently found across 10 populations in the amphipod crustacean Gammarus pulex (Cornet et al., 2007). The function of Vg and the relationship between TCC and Vg in detail need to be studied further at the cellular level, as carotenoids can regulate many gene expressions (Bertram, 1999; Burri, 2000). In conclusion, the complete Vg gene was cloned and sequenced for the first time in the noble scallop Ch. nobilis. Moreover, Vg gene was for the first time demonstrated to be tissue-specific and gonaddevelopment-dependent. More importantly, it was found that there was a significantly positive correlation at S3 between the amount of Vg expression and TCC, as well as TAC, which is also for the first time reported in the animals. However, the functions of Vg and the roles of TCC in regulating Vg need further study in the noble scallop.

Acknowledgments Funding for this research was provided by the National Natural Science Foundation of China (41076107), the Ministry of Education of China (20114402110001), the Department of Education (GCZX-A0908), the Department of Science and Technology (2011B090400040), and the Oceanic and Fisheries Administrator of Guangdong (A201005D06), China.

References Ando, S., 1986. Studies on the food biochemical aspects of changes in Chum salmon, Oncorhynchus keta, during spawning migration: mechanisms of muscle deterioration and nuptial coloration. Memoirs of the Faculty of Fisheries — Hokkaido University 33, 2–95. Ando, S., Hantano, M., 1991. Distribution of carotenoids in the eggs from four species of samonid. Comparative Biochemistry and Physiology 99B, 341–344. Ando, S., Hatano, M., 1986. Deterioration of Chum salmon Oncorhynchus keta muscle during spawning migration: carotenoids in the serum lipoprotein of Chum salmon associated with migration. Bulletin of the Faculty of Fisheries Hokkaido University 37, 148–156. Ando, S., Hatano, M., 1987. Metabolic pathways of carotenoids in Chum salmon Oncorhynchus keta during spawning migration. Comparative Biochemistry and Physiology 87B, 411–416. Arcos, F.G., Ibarra, A.M., Racotta, L.S., 2011. Vitellogenin in hemolymph predicts gonad maturity in adult female Litopenaeus (Penaeus) vannamei shrimp. Aquaculture 316, 93–98. Avarre, J.C., Michelis, R., Tietz, A., Lubzens, E., 2003. Relationship between vitellogenin and vitellin in a marine shrimp (Penaeus semisulcatus) and molecular characterization of vitellogenin complementary DNAs. Biology of Reproduction 69, 355–364. Babin, P.J., Bogerd, J., Kooiman, F.P., van Marrewijk, W.J.A., Van der Horst, D.J., 1999. Apolipophorin II/I, apolipoprotein B, vitellogenin and microsomal triglyceride transfer protein genes are derived from a common ancestor. Journal of Molecular Evolution 49, 150–160. Baker, M.E., 1988. Is vitellogenin an ancestor of apolipoprotein-B-100 of human lowdensity lipoprotein and human lipoprotein-lipase. Biochemistry 255, 1057–1060.

H. Zheng et al. / Aquaculture 366-367 (2012) 46–53 Barber, B.J., Blake, N.J., 2006. Reproductive physiology, In: Shumway, S.E., Parsons, G.J. (Eds.), Scallops: Biology, Ecology and Aquaculture, Second Edition. Elsevier, pp. 357–416. Benzie, I.F., Strain, J.J., 1996. The ferric reducing ability of plasma (FRAP) as a measure of “antioxidant power”: the FRAP assay. Analytical Biochemistry 239, 70–76. Bertram, J., 1999. Carotenoids and gene regulation. Nutrition Reviews 57, 182–191. Boutet, I., Moraga, D., Marinovic, L., Obreque, J., Crooker, P.C., 2008. Characterization of reproduction-specific genes in a marine bivalve mollusc: influence of maturation stage and sex on mRNA expression. Gene 407, 130–138. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 72, 248–254. Bueno, P., Lovatelli, A., 1990. Brief introduction to mariculture of five selected species in China, Scallop Culture, SF/WP/90/1 ed. National Inland Fisheries Institute Kasetsart University, Bangkok Thailand. Burri, B.J., 2000. Carotenoids and gene expression. Nutrition 16, 577–578. Cheesman, D.F., Lee, W.L., Zagalsky, P.F., 1967. Carotenoproteins in invertebrates. Biological Reviews 42, 132–160. Chew, B.P., Park, J.S., 2004. Carotenoid action on the immune response. Journal of Nutrition 134, 257S–261S. Cornet, S., Biard, C., Moret, Y., 2007. Is there a role for antioxidant carotenoids in limiting self-harming immune response in invertebrates? Biology Letters 3, 284–288. Doolittle, R.F., Riley, M., 1990. The amino-terminal sequence of lobster fibrinogen reveals common ancestry with vitellogenins. Biochemical and Biophysical Research Communications 167, 16–19. Dorange, G., Pennec, M., 1989. Ultrastructural study of oogenesis and oocytic degeneration in Pecten maximus from the Bay of St. Brieuc. Marine Biology 103, 339–348. Fyffe, W.E., O'Connor, J.D., 1974. Characterization and quantification of a crustacean lipovitellin. Comparative Biochemistry and Physiology 47B, 851–867. Hu, J.X., Li, H., Guo, C.L., Jin, Q.Z., 1996. Gonad development and the reproductive cycle of Chlamys nobilis (Reeve) in Daya Bay. The Biology and Mariculture of Scallop Chlamys nobilis (Reeve). Science Press, Beijing, pp. 111–119 (in Chinese). Huang, Q.F., 2000. Primary discussion on suddenly mass death and its control counter measures of Chlamys nobilis. Journal of Fujian Fisheries 22, 75–77 (in Chinese). Hwang, D.S., Lee, K.W., Han, J., Park, H.G., Lee, J., Lee, Y.M., Lee, J.S., 2010. Molecular characterization and expression of vitellogenin (Vg) genes from the cyclopoid copepod, Paracyclopina nana exposed to heavy metals. Comparative Biochemistry and Physiology 151C, 360–368. Krinsky, N.I., 1989. Antioxidant functions of carotenoids. Free Radical Biology & Medicine 7, 617–635. Krinsky, N.I., 2001. Carotenoids as antioxidants. Nutrition 17, 815–817. LaFleur Jr., G.J., Byrne, B.M., Kanungo, J., Nelson, L.D., Greenberg, R.M., Wallace, R.A., 1995. Fundulus heteroclitus vitellogenin: the deduced primary structure of a piscine precursor to noncrystal-line, liquid-phase yolk protein. Journal of Molecular Evolution 41, 505–521. Li, Z., Zhang, S., Liu, Q., 2008. Vitellogenin functions as a multivalent pattern recognition receptor with an opsonic activity. PLoS One 3, e1940. Lourenço, A.P., Martins, J.R., Bitondi, M.M., Simões, Z.L., 2009. Trade-off between immune stimulation and expression of storage protein genes. Archives of Insect Biochemistry and Physiology 71, 70–87. Lubzens, E., Lissauer, L., Levavi-Sivan, B., Avarre, J.C., Sammar, M., 2003. Carotenoid and retinoid transport to fish oocytes and eggs: what is the role of retinol binding protein? Molecular Aspects of Medicine 24, 441–457. Matozzo, V., Gagne, F., Marin, M.G., Ricciardi, F., Blaise, C., 2008. Vitellogenin as a biomarker of exposure to estrogenic compounds in aquatic invertebrates: a review. Environmental International 34, 531–545. Matsumoto, T., Nakamura, M.A., Mori, K., Kayano, T., 2003. Molecular characterization of a cDNA encoding putative vitellogenin from the Pacific oyster Crassostrea gigas. Zoological Science 20, 37–42. Matsumoto, T., Yamano, K., Kitamura, M., Hara, A., 2008. Ovarian follicle cells are the site of vitellogenin synthesis in the Pacific abalone Haliotis discus hannai. Comparative Biochemistry and Physiology 149A, 293–298. Miyashita, K., 2009. Function of marine carotenoids. Forum of Nutrition 61, 136–146. Mori, K., Osanai, K., Sato, R., 1977. Seasonal gonad changes in scallops under culture in Toni Bay, Iwate Prefecture. Bulletin of the Japanese Society for the Science of Fish 43, 1–8 (in Japanese with English abstract). Mouchel, N., Trichet, V., Betz, A., Le Pennec, J.P., Wolff, J., 1996. Characterization of vitellogenin from rainbow trout (Oncorhynchus mykiss). Gene 174, 59–64. Okuno, A., Yang, W.J., Jayasankar, V., Saido-Sakanaka, H., Huong, D.T.T., Jasmani, S., Atmomarsono, M., Subramoniam, T., Tsutsui, N., Ohira, T., Kawazoe, I., Aida, K., Wilder, M.N., 2002. Deduced primary structure of vitellogenin in the giant

53

freshwater prawn, Macrobrachium rosenbergii, and yolk processing during ovarian maturation. The Journal of Experimental Zoology 292, 417–429. Osada, M., Harata, M., Kishida, M., Kijima, A., 2004. Molecular cloning and expression analysis of vitellogenin in scallop, Patinopecten yessoensis (Bivalvia, Mollusca). Molecular Reproduction and Development 67, 273–281. Pareraki, L.E., Stratakis, E., 1997. Characterization of vitellogenin and vitellin from land crab Potamon potamios: identification of a precursor polypeptide in the molecule. The Journal of Experimental Zoology 279, 597–608. Phiriyangkul, P., Utarabhand, P., 2006. Molecular characterization of a cDNA encoding vitellogenin in the banana shrimp, Penaeus merguiensis (Litopenaeus) and sites of vitellogenin mRNA expression. Molecular Reproduction and Development 73, 410–423. Pipe, R.K., 1987. Oogenesis in the marine mussel Mytilus edulis: an ultrastructural study. Marine Biology 95, 405–414. Pousis, C., De Giorgi, C., Mylonas, C.C., Bridges, C.R., Zupa, R., Vassallo-Agius, R., de la Gándara, F., Dileo, C., De Metrio, G., Corriero, A., 2011. Comparative study of liver vitellogenin gene expression and oocyte yolk accumulation in wild and captive Atlantic bluefin tuna (Thunnus thynnus L.). Animal Reproduction Science 123, 98–105. Puppione, D.L., Jensen, D.F., O'Connor, J.D., 1986. Physicochemical study of rock crab lipoproteins. Biochimica et Biophysica Acta 875, 563–568. Seehuus, S.C., Norberg, K., Gimsa, U., Krekling, T., Amdam, G.V., 2006. Reproductive protein protects functionally sterile honey bee workers from oxidative stress. PNAS 103, 962–967. Shi, X., Zhang, S., Pang, Q., 2006. Vitellogenin is a novel player in defense reactions. Fish & Shellfish Immunology 20, 769–772. Smolenaars, M.M.W., Madsen, O., Rodenburg, K.W., van der Horst, D.J., 2007. Molecular diversity and evolution of the large lipid transfer protein superfamily. Journal of Lipid Research 48, 489–502. Spieth, J., Nettleton, M., Zucker-Aprison, E., Lea, K., Blumenthal, T., 1991. Vitellogenin motifs conserved in nematodes and vertebrates. Journal of Molecular Evolution 32, 429–438. Sun, D.P., 2009. Investigation of large-scale fouling organisms with the method of hanging panels on scallop farming cages in Liuqing River Bay, Qingdao and full length cDNA cloning and expression analysis of vitellogenin in Chlamys farreri. Doc. Dissert. Ocean. Uni. China. (in Chinese with English abstract) Thompson, J.R., Banaszak, L.J., 2002. Lipid-protein interactions in lipovitellin. Biochemistry 41, 9398–9409. Tiu, S.H.K., Hui, J.H.L., Mak, A.S.C., He, J.G., Chan, S.M., 2006. Equal contribution of hepatopancreas and ovary to the production of vitellogenin (PmVg1) transcripts in the tiger shrimp, Penaeus monodon. Aquaculture 254, 666–674. Tsutsui, N., Kawazoe, I., Ohira, T., Jasmani, S., Yang, W.J., Wilder, M.N., Aida, K., 2000. Molecular characterization of a cDNA encoding vitellogenin and its expression in the hepatopancreas and ovary during vitellogenesis in the Kuruma prawn, Penaeus japonicus. Zoological Science 17, 651–660. Wallace, R.A., Walker, S.L., Hauschka, P.V., 1967. Crustacean lipovitellin. Isolation and characterization of the major high-density lipoprotein from the eggs of decapods. Biochemistry 6, 1582–1590. Xu, F.S., Zhang, S.P., 2008. An Illustrated Bivalvia Mollusca Fauna of China Seas, 1st ed. Science Press, Beijing . (in Chinese). Yanar, Y., Celik, M., Yanar, M., 2004. Seasonal changes in total carotenoid contents of wild marine shrimps (Penaeus semisulcatus and Metapenaeus monoceros) inhabiting the eastern Mediterranean. Food Chemistry 88, 267–269. Zagalsky, P.F., 1985. A study of the astaxanthin-lipovitellin, ovoverdin, isolated from the ovaries of the lobster, Homarus gammarus (L.). Comparative Biochemistry and Physiology 80B, 589–597. Zhao, Z.J., Li, F.X., Ke, C.H., 1991. On the sex gonad development and reproductive cycle of clam Paphia Undulata. Journal of Fisheries of China 15, 56–62 (in Chinese). Zheng, H.P., Liu, H.L., Zhang, T., Wang, S.Q., Sun, Z.W., Liu, W.H., Li, Y.Y., 2010. Total carotenoid differences in scallop tissues of Chlamys nobilis (Bivalve: Pectinidae) with regard to gender and shell colour. Food Chemistry 122, 1164–1167. Zheng, H.P., Zhang, T., Sun, Z.W., Liu, W.H., Liu, H.L., 2012. Inheritance of shell colors in the noble scallop Chlamys nobilis (Bivalve: Pectinidae). Aquaculture Research http://dx.doi.org/10.1111/j.1365-2109.2012.03124.x. Zhou, R.L., Lv, J.Y., Wu, J.F., 2006. Investigation about the cause of suddenly mass death of scallop Chlamys nobilis in Leizhou Peninsula North Bay. Fisheries Science and Technology 18, 22–23 (in Chinese). Zhou, T., Li, L., Pawar, R., Zhang, S.C., 2010. Vitellogenin is an acute phase protein with bacterial-binding and inhibiting activities. Immunobiology 215, 898–902.