2) in red snapper (Lutjanus sanguineus)

Fish & Shellfish Immunology 32 (2012) 534e543

Contents lists available at SciVerse ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Cloning and expression analysis of recombination activating genes (RAG1/2) in red snapper (Lutjanus sanguineus) X.L. Zhang a, b, c, Y.S. Lu a, b, c, *, J.C. Jian a, b, c, Z.H. Wu b, c, d a

College of Fishery, Guangdong Ocean University, Zhanjiang 524025, China Guangdong Provincial Key Laboratory of Pathogenic Biology and Epidemiology for Aquatic Economic Animals, Zhanjiang 524025, China c Guangdong Key Laboratory of Control for Diseases of Aquatic Economic Animals, Zhanjiang 524025, China d Zhongkai University of Agriculture and Engineering, Guangzhou 510225, China b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 21 November 2011 Received in revised form 3 January 2012 Accepted 3 January 2012 Available online 10 January 2012

Recombination activating genes (RAG1 and RAG2), involved in the V(D)J recombination of immunoglobulin and T-cell receptor genes play a crucial role in the adaptive immune response in vertebrates. The expression of these genes was required for the proper development and maturity of lymphocytes so that they can be used as useful markers to evaluate the development of lymphoid organ. In this paper, the cDNA of RAG1 and RAG2 in red snapper, Lutjanus sanguineus were cloned by homological cloning and rapid amplification of cDNA ends (RACE) methods. Results showed the full length of RAG1 cDNA was 3944 bp, containing a 50 untranslated region (UTR) of 200 bp, a 30 -UTR of 561 bp and an open reading frame of 3183 bp encoding 1060 amino acids. Three important structural motifs, a RING/U-box domain, a RING/FYVE/PHD-type domain and a RAG Nonamer-binding domain were detected in the deduced amino acid sequence of RAG1 by InterProScan analysis. The full length of RAG2 cDNA was 2200 bp, consisting of a 141 bp 50 -UTR, a 457 bp 30 -UTR and an open reading frame of 1602 bp encoding 533 amino acids. Two important structural motifs, a Galactose oxidase/kelch, beta-propeller domain and a kelchtype beta-propeller domain were detected in the deduced amino acid sequence of RAG2 by InterProScan analysis. BLAST analysis revealed that the RAG1 and RAG2 in red snapper shared a high homology with other known RAG1 and RAG2 genes, while the greatest degree of identity was observed with Hippoglossus hippoglossus RAG1 at 82% and Takifugu rubripes RAG2 at 87%, respectively. The differential expressions of RAG1 and RAG2 in various tissues of red snapper were analyzed by fluorescent quantitative real-time PCR. The overall expression pattern of the two genes was quite similar. In healthy red snappers, the RAGs transcripts were mainly detected in thymus, following head kidney, spleen, intestine, liver and brain. After vaccinated with inactivated Vibrio alginolyticus 48 h later, the RAGs mRNA expression was significantly up-regulated in all studied tissues of red snapper. A clear time-dependent expression pattern of RAG1 and RAG2 after immunization and the expression reached the highest level at 48 h in thymus, 60 h in head kidney and spleen, respectively. These findings indicated that RAG1 and RAG2 could play an important role in the immune response to bacteria in red snapper. Ó 2012 Elsevier Ltd. All rights reserved.

Keywords: Lutjanus sanguineus RAG1 and RAG2 RACE Fluorescent quantitative real-time PCR

1. Introduction In vertebrates, the adaptive immune response requires a highly diversified repertoire of antigen receptors encoding immunoglobulin (Ig) and T-cell receptor (TCR) genes during the early stages of B- and T-cell development [1]. To achieve this diversity, the Ig and TCR genes are rearranged by the process of V(D)J recombination,

* Corresponding author. College of Fishery, Guangdong Ocean University, No. 40 of East Jiefang Road, Xiashan District, Zhanjiang, Guangdong Province 524025, China. Tel./fax: þ86 759 2339319. E-mail address: fi[email protected] (Y.S. Lu). 1050-4648/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2012.01.001

which is initiated by the products of the recombination activating genes (RAG-1 and RAG-2) [2e4]. V(D)J recombination is a programmed rearrangement of variable (V), diversity (D) and joining (J) gene segments which are flanked by recombination signal sequence (RSS) to produce the antigen receptor proteins of lymphocytes [5,6]. RSS is necessary and sufficient to direct recombination, consisting of a dyad-symmetric heptamer, an AT-rich nonamer and an intervening spacer region of either 12 or 23 bp [7,8]. RAGs initiate the V(D)J recombination by recognizing specific RSS and introducing a break between the RSS and the adjacent V(D)J coding segments [9,10]. Mice lacking either RAG1 or RAG2 are unable to initiate V(D)J recombination and have no mature B- or T-lymphocytes [11].

X.L. Zhang et al. / Fish & Shellfish Immunology 32 (2012) 534e543

RAG1 and RAG2 are two endonucleases, which are first isolated from mice NIH3T3 fibroblast [12,13]. The RAGs have an unusual arrangement on the chromosome, in which they are convergently transcribed and coordinately regulated [14]. The RAGs are expressed together exclusively in immature lymphocytes, however, in rare cases, only one is expressed independently in the mammalian central nervous system, chicken bursa and Xenopus oocyte [15e17]. The feature of RAGs involved in the development of lymphocytes has been used to follow the development of lymphoid organ in fish [18,19], and is essential in the development of immature T- and B-cells [20]. Therefore, the expression of RAGs can be used to monitor the appearance and location of these cells throughout the development of the immune organ [3,17]. Unlike most of the other molecules of adaptive immunity, RAGs are quite well conserved from amphibians to mammals [21e28]. Thus RAGs can be used as useful markers involved in the evolutionary analysis of the vertebrates. Red snapper (Lutjanus sanguineus) is one of the most important marine fishes in the south coastal regions of China. Extensive research on the diseases which caused high mortality was conducted in China owing to its enormous commercial interest [29]. However, fewer studies focused on the molecular field of red snapper, especially in the area of molecular studies related to the specific immune response, were carried out before. In the present work, the full lengths of the cDNA for RAG1 and RAG2 in red snapper were reported and their differential expression in various tissues of healthy fish and the fish immunized by inactivated Vibrio alginolyticus were analyzed. The expression patterns of RAGs in thymus, head kidney and spleen of vaccinated red snapper were also examined. 2. Materials and methods 2.1. Fish and immunization Samples of red snapper (average 15 g in body weight) were obtained from a commercial farm in Zhanjiang, Guangdong Province, China, and cultured at 27e28  C, in aerated sand-filtered seawater for one week prior to processing. V. alginolyticus HY9901, a virulent strain isolated from red snapper was used for immunostimulus [30]. The immunostimulation experiment was performed by injecting the red snapper with 0.1 ml of inactivated bacteria resuspended in sterilized PBS with the concentration of 1  107 cells ml1 into the abdominal cavity and the red snapper injected with 0.1 ml of sterilized PBS was used as control group. Then all processed red snappers were returned to tanks and treated as before. At time points of 0 h, 12 h, 24 h, 36 h, 48 h, 60 h, 72 h and 96 h post-immunization, eight tissues including head kidney, thymus, spleen, liver, heart, muscle, brain and intestine were collected from the control groups and vaccinated groups to detect differential expression of RAG1 and RAG2. 2.2. Cloning and characterization of cDNA for RAG1 and RAG2 All PCR primers used in this study were summarized in Table 1. Total RNA was extracted from thymus using Trizol Reagent (Invitrogen, USA) as described in the manufacturer’s instructions. The first-strand cDNA was synthesized from the previous total RNA using the Reverse Transcriptase M-MLV (TaKaRa, Japan) according to the manufacturer’s protocol and served as a template to amplify RAG1 and RAG2 partial cDNA sequences by polymerase chain reaction (PCR) using degenerated primers designed from conserved regions of known fish RAG1 and RAG2 sequences. The full-length cDNA of RAG1 and RAG2 was obtained by using 50 /30 RACE (rapid amplification of cDNA ends) methods with some gene-specific

535

primers designed based on the obtained cDNA partial sequences of RAG1 and RAG2. Each PCR was run in 25 mL reaction volume containing 2.5 mL of 10  PCR buffer, 2 mL of dNTP mix (2.5 mM each), 0.5 mL of each primers (10 mM), 1 mL of cDNA, 0.25 mL of Taq DNA polymerase (5 U mL1) and 18.25 mL PCR-grade water. The amplification procedure was performed as follows: 1 cycle at 95  C for 3 min followed by 35 cycles of 95  C for 30 s, annealing at primer specific temperatures (52e57  C) for 45 s and extending at 72  C for 90 s. After the final cycle, a further extension step was performed at 72  C for 7 min. All the PCR products were ligated into the pMD18-T vector (TaKaRa, Japan) and transformed into competent Escherichia coli cells and then sequenced on an ABI3730 Automated Sequencer (Applied Bio-systems). Finally, the partial sequences acquired through homology cloning, 30 end and 50 end were assembled using contigExpress application software. The similarity analyses of the determined nucleotide sequences and deduced amino acid sequences were performed by BLAST programs (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The potential open reading frame (ORF) was analyzed with ORF Finder program (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). The protein analysis was conducted with ExPASy tools (http://expasy.org/tools/). Location of the domains was predicted using the InterProScan program (http://www.ebi.ac.uk/Tools/pfa/iprscan/). Multiple alignments of RAG1 and RAG2 amino acid sequences were performed with the ClustalW2 program (http://www.ebi.ac.uk/Tools/clustalw2/). Phylogenic trees were constructed by the neighbor-joining method using MEGA 4 software and 1000 bootstrap replications. 2.3. Expression analysis of RAG1 and RAG2 The differential expression of RAG1 and RAG2 in eight tissues of red snappers, with pre and post-immunization by inactivated V. alginolyticus was measured by fluorescent quantitative realtime PCR using gene-specific primers (Table 1). Each tissue was collected from three individuals and pooled together as a replicate sample. Three replicates were taken for each sampling time point. The first-strand cDNA was synthesized from the DNase treated

Table 1 PCR primers used in this study. Primers

Sequence 50 / 30

Information

RAG1F1 RAG1R1 RAG1F2 RAG1R2 RAG1F3 RAG1R3 RAG2F0 RAG2A0 30 Oligo 30 anchor RAG1-P RAG2-P RAG1-SP1 RAG1-SP2 RAG1-SP3 RAG2-SP1 RAG2-SP2 RAG2-SP3 50 Oligo 50 anchor RAG1QS RAG1QA RAG2QS RAG1QA b-actionS b-actionA

TGGGHGATGTCRGYGAGAAG CRTCCTGRAAGATYTTGTAG CAAGCCCTTCATGGAGAC GTGTASAGCCAGTGRTGTTT YATCCWYAARGTCTTCAAAGTG GACAGTTCTGAGTTTGGCTTCGG AGAGGTWCCAGGRGCCAGAT ACRYGCAGGCRGWAGAGT AAGCAGTGGTATCAACGCAGAGTACT(30)VN AAGCAGTGGTATCAACGCAGAGT TTGCTGACCTCCTCTCCTCTAC GTCTACTTCATTGGCGGTCACTC GGTTCTTCAGTTCTTTCAGACGG GCAGGTGAAAGATAGGAGGAAGT TGATGTTCCTTACCCACTGCTCT CGAGTGACCGCCAATGAAGTAGA CAGGTAAAGTGTGTGCGGAGGAG CGTATCTGGCTCCTGGAACCTCT GACCACGCGTATCGATGTCGACT(16)V GACCACGCGTATCGATGTCG GACTCTCACTGCTGTTCTCTGG GACTCTCACTGCTGTTCTCTGG GACGGTGAAGTTCTCCTGTTTG ACAGCGTAATGGTGGAAGGTAG GCAGATGTGGATCAGCAAGCAGGA CGCCTGAGTGTGTATGAGAAATG

Primers used to obtain partial sequences

30 RACE

50 RACE

RT-PCR and real-time PCR

Fig. 1. Multiple alignments of RAG1 amino acid sequence of L. sanguineus with other species. Zinc finger, RING/FYVE/PHD-type domain and DDE motif are shadowed; RING/U-box domain and RAG Nonamer-binding domain are lined above the amino acid sequence. The GenBank accession numbers of the RAG1s are as follows: Hippoglossus hippoglossus: AAR83678.1; Takifugu rubripes: AAD20561.1; Oncorhynchus mykiss: NP_001118209.1; Danio rerio: NP_571464.1; Mus musculus: NP_033045.2; Ornithorhynchus anatinus: NP_001229683.1; Homo sapiens: NP_000439.1; Xenopus laevis: NP_001165554.1.

X.L. Zhang et al. / Fish & Shellfish Immunology 32 (2012) 534e543

537

Fig. 1. (continued).

total RNA using the Reverse Transcriptase M-MLV (TaKaRa, Japan) according to the manufacturer’s protocol. The b-actin gene was used as an internal control to normalize the potential variations in RNA loading. The relative expression levels of the red snapper RAG1 and RAG2 were calculated using red snapper b-actin expression as a reference, and the results were further compared to respective control group expression levels to determine the fold induction. The PCR was performed in a 25 mL reaction volume containing 0.5 mL of each primer (10 mM), 2 mL of diluted cDNA (1:10), 12.5 mL of 2  TransStartÔ Green qPCR SuperMix (TransGen, China) and 9.5 mL PCR-grade water. The PCR amplification procedure was carried out at 95  C for 4 min, followed by 40 cycles of 95  C for 20 s, 56  C for 20 s and 72  C for 20 s. Melt curve analysis of amplification products was performed over a range of 70e95  C at the end of each PCR reaction aiming to confirm single product generation. Samples were run in triplicate on the Bio-Rad iQ5 Real-time PCR System (Bio-rad, CA, USA). The relative expression levels of RAG1 and RAG2 were calculated by means of 2DDCt method [31]. All Quantitative data were presented as the means  standard deviation (SD). Statistical analysis was performed using SPSS statistics 17.0 software. A p-value less than 0.05 was considered to be significant.

3. Results 3.1. Cloning and characterization of red snapper RAG1 and RAG2 3.1.1. RAG1 The full length of RAG1 cDNA (GenBank accession NO. JN106042) contained a 50 untranslated region (UTR) of 200 bp, a 30 -UTR of 561 bp with four mRNA instability motifs (ATTTA), and an open reading frame (ORF) of 3183 bp encoding a protein of 1060 amino acids with a calculated molecular weight of 120.5 kDa and a theoretical isoelectric point of 8.72. By motif analysis, a RING/U-box domain (227e362 aa), a Zinc finger, RING/FYVE/PHD-type domain (286e386 aa) and a RAG Nonamer-binding domain (NBD, 411e478 aa) of the deduced amino acid sequence of RAG1 were predicted by the InterProScan program (Fig. 1). A DDE motif consisted of three acidic residues (D623, D733, E987) was a major active site for DNA cleavage in RAG1 core. The BLAST analysis revealed that the predicted amino acid sequence of red snapper RAG1 shared high homology with other known RAG1s and the greatest degree of identity was observed with Hippoglossus hippoglossus RAG1 at 82%. Multiple sequence alignment of red snapper RAG1 with other known species RAG1 revealed that they were

538

X.L. Zhang et al. / Fish & Shellfish Immunology 32 (2012) 534e543

Fig. 2. Multiple alignments of RAG2 amino acid sequence of L. sanguineus with other species. Kelch-type beta-propeller domain is shadowed; Galactose oxidase/kelch and betapropeller domain are lined above amino acid sequence. The GenBank accession numbers of the RAG1s are as follows: Oryctolagus cuniculus: NP_001164612.1; Takifugu rubripes: AAD20562.1; Oncorhynchus mykiss: AAB18138.1; Danio rerio: NP_571460.2; Mus musculus: AAI44857.1; Homo sapiens: EAW68117.1; Anolis carolinensis: XP_003214696.1; Xenopus laevis: NP_001091369.1.

X.L. Zhang et al. / Fish & Shellfish Immunology 32 (2012) 534e543

highly conserved (Fig. 2). The phylogenic analysis (Fig. 3) showed that the red snapper and H. hippoglossus clustered together and formed a sister group to the species in Tetraodontiformes, and then clustered to the species in Salmoniformes, Cypriniformes and finally mammalians. The relationships displayed in the phylogenic tree were generally in agreement with traditional taxonomy. 3.1.2. RAG2 The full length of RAG2 cDNA (GenBank accession NO. JN106041) contained a 50 UTR of 141 bp, a 30 UTR of 457 bp with a mRNA instability motif (ATTTA) and a typical polyadenylation signal (AATAAA), and an ORF of 1602 bp encoding a protein of 533 amino acids with a calculated molecular weight of 59.6 kDa and a theoretical isoelectric point of 5.42. A Galactose oxidase/kelch, beta-propeller domain (62e330 aa) and a kelch-type betapropeller domain (90e241 aa) of the deduced amino acid sequence of RAG2 were predicted by the InterProScan program (Fig. 2). The BLAST analysis revealed that the predicted amino acid sequence of red snapper RAG1 shared high homology with other known RAG2s and the greatest degree of identity was observed with Takifugu rubripes RAG2 at 87%. Multiple sequence alignment of red snapper RAG2 with other known species RAG2 revealed that they were highly conserved (Fig. 2). The phylogenic analysis (Fig. 4) showed that the red snapper and T. rubripes clustered together, and then clustered to the species in Salmoniformes, Cypriniformes and finally mammalians. 3.2. Expression analysis of RAG1 and RAG2 Fluorescent quantitative real-time PCR was used to examine the differential expression of RAG1 and RAG2 mRNA. The overall expression pattern of the two genes was quite similar. In healthy red snappers, the RAGs mRNA expression could be detected in

76

Lutjanus Sanguineus

100

Hippoglossus hippoglossus Takifugu rubripes

94

100

100

Tetraodon nigroviridis Oncorhynchus mykiss Danio rerio Ctenopharyngodon idella

100

Cyprinus carpio

75

Carassius auratus

99

Carcharhinus leucas Xenopus laevis Ornithorhynchus anatinus

100

Mus musculus 100

98 Homo sapiens 100 Pan troglodytes

100

Nomascus leucogenys 98

Oryctolagus cuniculus

0.1

Fig. 3. Phylogenetic tree of RAG1 family members constructed by neighbor-joining method. Numbers at each branch indicated the percentage bootstrap values on 1000 replicates. The species names and the GenBank accession numbers are as follows: Takifugu rubripes: AAD20561.1; Tetraodon nigroviridis: CAG03454.1; Hippoglossus hippoglossus: AAR83678.1; Oncorhynchus mykiss: NP_001118209.1; Carassius auratus: ABM46911.2; Ctenopharyngodon idella: ABM65103.1; Cyprinus carpio: AAX16495.1; Danio rerio: NP_571464.1; Mus musculus: NP_033045.2; Oryctolagus cuniculus: NP_001164611.1; Nomascus leucogenys: XP_003254485.1; Ornithorhynchus anatinus: NP_001229683.1; Pan troglodytes: XP_001154240.1; Homo sapiens: NP_000439.1; Xenopus laevis: NP_001165554.1; Carcharhinus leucas: AAB17267.1.

539 65

Danio rerio

83

Carassius auratus

100

Cyprinus carpio Ctenopharyngodon idella

100

Lutjanus Sanguineus

100

Takifugu rubripes 57

Oncorhynchus mykiss 67 69 35 85 100

99

Bos taurus Ailuropoda melanoleuca Equus caballus Homo sapiens Oryctolagus cuniculus Mus musculus Gallus gallus

46

Anolis carolinensis Xenopus laevis

0.1

Fig. 4. Phylogenetic tree of RAG2 family members constructed by neighbor-joining method. Numbers at each branch indicated the percentage bootstrap values on 1000 replicates. The species names and the GenBank accession numbers are as follows: Takifugu rubripes: AAD20562.1; Ctenopharyngodon idella: ABP98948.1; Cyprinus carpio: AAX16496.1; Carassius auratus: ABV79902.1; Danio rerio: NP_571460.2; Oncorhynchus mykiss: AAB18138.1; Xenopus laevis: NP_001091369.1; Gallus gallus: XP_421091.2; Oryctolagus cuniculus: NP_001164612.1; Equus caballus: XP_001488023.1; Mus musculus: AAI44857.1; Homo sapiens: EAW68117.1; Bos taurus: DAA21845.1; Anolis carolinensis: XP_003214696.1; Ailuropoda melanoleuca; XP_002926547.1.

thymus, head kidney, spleen, intestine, liver and brain. After vaccinated with inactivated V. alginolyticus 48 h later, the RAGs mRNA expression was significantly up-regulated in all studied tissues of red snapper (Fig. 5). A clear time-dependent expression pattern of RAGs was observed after immunization in thymus, head kidney and spleen. Interestingly, the RAGs expression levels were down-regulated at 0e12 h post-immunization, and up-regulated to the highest level once more at the time point of 48 h in thymus, 60 h in head kidney and spleen, respectively, and then dropped gradually but still slightly higher than the control level at 96 h (Fig. 6). Analysis of variance indicated that the expression levels of RAGs at 12 h post-immunization were significantly lower than that of the control group in thymus, head kidney and spleen (p < 0.05). The RAGs expression levels were significantly higher than that of the corresponding control group at the time point of 48 h in thymus, 60 h in head kidney and spleen after immunization (p < 0.05). 4. Discussion Red snapper is one of the most important marine-culture fishes in south China and frequently subjected to disease in recent years, which became a big obstacle to red snapper aquaculture. To understand the immune system and immune response against infection is useful for enhancing the immunity of cultured fish, which now becomes more and more important in aquatic research. The closely linked recombination activating genes, RAG1 and RAG2, initiated the V(D)J recombination of Ig and TCR to produce a highly diversified repertoire of antigen receptors, which are expressed together exclusively during the development of T- and B-lymphocytes. In this study, we cloned and sequenced the complete cDNA sequences of RAG1 and RAG2 from the red snapper. The full-length cDNA of RAG1 is 3944 bp, which encodes a polypeptide of 1060 amino acids with some important functional motifs, such as RING/U-box domain, Zinc finger, RING/FYVE/PHD-type domain, RAG Nonamer-binding domain and DDE motif. Among them, the

540

X.L. Zhang et al. / Fish & Shellfish Immunology 32 (2012) 534e543

Fig. 5. RAG1 (a) and RAG2 (b) mRNA levels in different tissues of healthy and vaccinated L. sanguineus determined by quantitative real-time PCR. The values are shown as means  S.D. Significant difference was indicated by asterisks, *: 0.05 > p > 0.01, **: p < 0.01.

U-box domain evolved from a RING finger domain has been identified as a new type of E3 [32,33], which was just detected in zebrafish, and also had an ubiquitin-protein ligase activity [34e36]. The full-length cDNA of RAG2 is 2200 bp, which encodes 533 amino acids with a Galactose oxidase/kelch, beta-propeller domain and a kelch-type beta-propeller domain. Studies involved in the RAGs genomic organization revealed that the RAGs genes are in close juxtaposition and in the opposite transcriptional orientation [13,21,37]. Whereas, the functions of these core catalytic domains of RAGs in the process of V(D)J recombination further supported the hypothesis that the RAGs arise from a transposase and the RAG proteins can be induced to catalyze transposition reactions under the appropriate conditions [10,37e40]. Both multiple alignment and phylogenic analyses revealed that the deduced amino acid sequences of RAG1 and RAG2 shared high identity with other known RAG1 and RAG2, especially with H. hippoglossus RAG1 at 82% and T. rubripes RAG2 at 87%, respectively. Overall, all the analyses suggested that RAGs are highly conserved in the process of vertebrate evolution and the branching positions of the taxa within the trees are consistent with the known evolution of these organisms. In addition, our analyses further supported the notion that the RAGs can be utilized as evolutional marker during the evolution of vertebrates. In red snapper, the mRNA expression of RAG1 is in accordance with RAG2, the highest expression levels of RAGs were detected in thymus, following head kidney, spleen, intestine, liver and brain. This pattern of expression is consistent with sites of lymphopoiesis

identified by histological analyses in teleost. The head kidney is a key organ for immunity and the major site of hematopoiesis, which contains granulocytes, B- and T-lymphocytes [41e44]. The thymus is thought to be the site of T-cell maturation [45]. The spleen combines the innate and adaptive immune system in a uniquely organized way [46,47]. In mammals and amphibians, relatively high levels of RAGs were detected in the thymus and lesser amounts were found in the kidney, spleen, liver, eye, intestinal epithelium and brain [16,17,48e51]. The expression pattern in zebrafish, trout and malabar grouper is similar to that in red snapper, supporting the idea that the thymus, head kidney and spleen are the major immune organs in teleosts [18,26,52]. Whereas, after immunization of red snapper with inactivated V. alginolyticus, the mRNA expression of RAGs in thymus, head kidney and spleen were completely down-regulated in the time of 0e12 h, which may owing to the reason that the expression of RAGs is restricted nearly entirely to developing lymphocytes where it carries out essential functions in the processes of V(D)J recombination and where cell death is common in part due to errors brought about by the recombination processes [53e55]. Downregulation of RAGs is essential for maintaining allelic exclusion upon expression of functional Ig [55]. Among thymus, head kidney and spleen of the vaccinated red snapper, the expression levels of RAGs were higher than the corresponding control groups, which indicated that immunization can improve the expression of immune related genes of red snapper and can enhance the ability of fish defending against bacterial pathogen.

X.L. Zhang et al. / Fish & Shellfish Immunology 32 (2012) 534e543 Fig. 6. Temporal expression of RAGs in thymus (a, b), head kidney (c, d) and spleen (e, f) of L. sanguineus after immunization measured by quantitative real-time PCR. The values are shown as means  S.D. Significant difference was indicated by asterisks, *: 0.05 > p > 0.01, **: p < 0.01. 541

542

X.L. Zhang et al. / Fish & Shellfish Immunology 32 (2012) 534e543

5. Conclusion RAGs genes of red snapper have been cloned and characterized. Our data suggested that the predicted RAGs proteins were structurally similar to other RAGs molecules previously described in fish. RAGs mRNA expression levels were analyzed in different tissues, different time points of healthy and vaccinated red snapper. In red snapper, the expression patterns of RAG1 and RAG2 genes in different tissues were quite similar, and mainly expressed in immune organs. There was a clear time-dependent expression pattern of RAGs in the thymus, head kidney and spleen in red snapper after immunization. This is the first report on the expression of RAGs induced by V. alginolyticus vaccine in teleost. Our findings suggested that the time-dependent expression pattern of RAGs may play an important role in the immune response.

[20] [21] [22] [23]

[24]

[25]

[26] [27]

Acknowledgments We thank all the laboratory members for their critical reviews and comments on this manuscript. We are especially grateful for the critical comments from the anonymous reviewers. This work was supported by research grants (No. 40906073, No. 10152408801000006) from the National Natural Science Foundation of China and Natural Science Foundation of Guangdong Province.

References

[28] [29]

[30]

[31] [32] [33] [34]

[1] Notarangelo LD, Villa A, Schwarz K. RAG and RAG defects. Curr Opin Immunol 1999;11:435e42. [2] Schatz DG, Oettinger MA, Baltimore D. The V(D)J recombination activation gene, RAG1. Cell 1989;59:1035e48. [3] Oettinger MA, Schatz DG, Gorka C, Baltimore D. RAG-1 and RAG-2, adjacent genes that synergistically activate V(D)J recombination. Science 1990;248: 1517e23. [4] van Gent DC, McBlane JF, Ramsden DA, Sadofsky MJ, Hesse JE, Gellert M. Initiation of V(D)J recombination in a cell-free system. Cell 1995;81:925e34. [5] McBlane JF, van Gent DC, Ramsden DA, Romeo C, Cuomo CA, Gellert M, et al. Cleavage at a V(D)J recombination signal requires only RAG1 and RAG2 proteins and occurs in two steps. Cell 1995;83:387e95. [6] Eastman QM, Leu TM, Schatz DG. Initiation of V(D)J recombination in vitro obeying the 12/23 rule. Nature 1996;380:85e8. [7] Tonegawa S. Somatic generation of antibody diversity. Nature 1983;302: 575e81. [8] Hesse JE, Lieber MR, Mizuuchi K, Gellert M. V(D)J recombination: a functional definition of the joining signals. Genes Dev 1989;3:1053e61. [9] Brandt VL, Roth DB. A recombinase diversified: new functions of the RAG proteins. Curr Opin Immunol 2002;14:224e9. [10] Landree MA, Wibbenmeyer JA, Roth DB. Mutational analysis of RAG1 and RAG2 identifies three catalytic amino acids in RAG1 critical for both cleavage steps of V(D)J recombination. Genes Dev 1999;13:3059e69. [11] Lewis SM. The mechanism of V(D)J joining: lessons from molecular, immunological, and comparative analyses. Adv Immunol 1994;56:27e150. [12] Schatz DG, Baltimore D. Stable expression of immunoglobulin gene V(D)J recombinase activity by gene transfer into 3T3 fibroblasts. Cell 1988;53: 107e15. [13] Peixoto BR, Mikawa Y, Brenner S. Characterization of the recombinase activating gene-1 and 2 locus in the Japanese pufferfish, Fugu rubripes. Gene 2000;246:275e83. [14] Willett CE, Cherry JJ, Steiner LA. Characterization and expression of the recombination activating genes (rag1 and rag2) of zebrafish. Immunogenetics 1997;45:394e404. [15] Carlson LM, Oettinger MA, Schatz DG, Masteller EL, Hurley EA, McCormack WT, et al. Selective expression of RAG-2 in chicken B cells undergoing immunoglobulin gene conversion. Cell 1991;64:201e8. [16] Chun JJ, Schatz DG, Oettinger MA, Jaenisch R, Baltimore D. The recombination activating gene-1 (RAG-1) transcript is present in the murine central nervous system. Cell 1991;64:189e200. [17] Greenhalgh P, Olesen CE, Steiner LA. Characterization and expression of recombination activating genes (RAG-1 and RAG-2) in Xenopus laevis. J Immunol 1993;151:3100e10. [18] Willett CE, Zapata AG, Hopkins N, Steiner LA. Expression of zebrafish rag genes during early development identifies the thymus. Dev Biol 1997;182: 331e41. [19] Lam SH, Chua HL, Gong Z, Lam TJ, Sin YM. Development and maturation of the immune system in zebrafish, Danio rerio: a gene expression profiling,

[35]

[36] [37] [38]

[39]

[40]

[41]

[42]

[43] [44] [45] [46] [47] [48]

[49] [50] [51]

[52]

in situ hybridization and immunological study. Dev Comp Immunol 2004; 28:9e28. Nagaoka H, Yu W, Nussenzweig MC. Regulation of RAG expression in developing lymphocytes. Curr Opin Immunol 2000;12:187e90. Schatz DG, Oettinger MA, Schlissel MS. V(D)J recombination: molecular biology and regulation. Annu Rev Immunol 1992;10:359e83. Oettinger MA. Activation of V(D)J recombination by RAG1 and RAG2. Trends Genet 1992;8:413e6. Bernstein RM, Schluter SF, Bernstein H, Marchalonis JJ. Primordial emergence of the recombination activating gene 1 (RAG1): sequence of the complete shark gene indicates homology to microbial integrases. Proc Natl Acad Sci U S A 1996;93:9454e9. Fuschiotti P, Harindranath N, Mage RG, McCormack WT, Dhanarajan P, Roux KH. Recombination activating genes-1 and -2 of the rabbit: cloning and characterization of germline and expressed genes. Mol Immunol 1993;30:1021e32. Hansen JD, Kaattari SL. The recombination activation gene 1 (RAG1) of rainbow trout (Oncorhynchus mykiss): cloning, expression, and phylogenetic analysis. Immunogenetics 1995;42:188e95. Hansen JD, Kaattari SL. The recombination activating gene 2 (RAG2) of the rainbow trout Oncorhynchus mykiss. Immunogenetics 1996;44:203e11. Greenhalgh P, Steiner LA. Recombination activating gene 1 (Rag1) in zebrafish and shark. Immunogenetics 1995;41:54e5. Ichihara Y, Hirai M, Kurosawa Y. Sequence and chromosome assignment to 11p13-p12 of human RAG genes. Immunol Lett 1992;33:277e84. Wang PC, Huang JP, Tsai MA, Cheng SY, Tsai SS, Chen SD, et al. Systemic infection of Kudoa lutjanus n. sp. (Myxozoa: Myxosporea) in red snapper Lutjanus erythropterus from Taiwan. Dis Aquat Organ 2005;67:115e24. Liang H, Xia L, Wu Z, Jian J, Lu Y. Expression, characterization and immunogenicity of flagellin FlaC from Vibrio alginolyticus strain HY9901. Fish Shellfish Immunol 2010;29:343e8. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2DDCt method. Methods 2001;25:402e8. Aravind L, Koonin EV. The U box is a modified RING finger e a common domain in ubiquitination. Curr Biol 2000;10:R132e4. Hatakeyama S, Nakayama KI. Ubiquitylation as a quality control system for intracellular proteins. J Biochem 2003;134:1e8. Xu Z, Devlin KI, Ford MG, Nix JC, Qin J, Misra S. Structure and interactions of the helical and U-box domains of CHIP, the C terminus of HSP70 interacting protein. Biochemistry 2006;45:4749e59. Hatakeyama S, Matsumoto M, Yada M, Nakayama KI. Interaction of U-box-type ubiquitin-protein ligases (E3s) with molecular chaperones. Genes Cells 2004;9: 533e48. McDonough H, Patterson C. CHIP: a link between the chaperone and proteasome systems. Cell Stress Chaperones 2003;8:303e8. Schluter SF, Marchalonis JJ. Cloning of shark RAG2 and characterization of the RAG1/RAG2 gene locus. FASEB J 2003;17:470e2. Hiom K, Melek M, Gellert M. DNA transposition by the RAG1 and RAG2 proteins: a possible source of oncogenic translocations. Cell 1998;94: 463e70. Agrawal A, Eastman QM, Schatz DG. Transposition mediated by RAG1 and RAG2 and its implications for the evolution of the immune system. Nature 1998;394:744e51. Fugmann SD, Villey IJ, Ptaszek LM, Schatz DG. Identification of two catalytic residues in RAG1 that define a single active site within the RAG1/RAG2 protein complex. Mol Cell 2000;5:97e107. Romano N. Ontogeny of the immune system of fish using specific markers. PhD thesis, Agricultural University of Wageningen, Wageningen (NL), Poesen, K & Looijen, BV Press; 1998. p. 1e168. Romano N, Ceccariglia S, Mastrolia L, Mazzini M. Cytology of lymphomyeloid head kidney of Antarctic fishes Trematomus bernacchii (Nototheniidae) and Chionodraco hamatus (Channicthyidae). Tissue Cell 2002;34:63e72. Al-Adhame MA, Kunz YW. Ontogenesis of haematopoietic sites in Brachydanio rerio (Hamilton-Buchanan) (Teleostei). Dev Growth Differ 1977;19:171e9. Zon LI. Developmental biology of hematopoiesis. Blood 1995;86:2876e91. Fishelson L. Cytological and morphological ontogenesis and involution of the thymus in cichlid fishes (Cichlidae, Teleostei). J Morphol 1995;223:175e90. Mebius RE, Kraal G. Structure and function of the spleen. Nat Rev Immunol 2005;5:606e16. Cesta MF. Normal structure, function, and histology of the spleen. Toxicol Pathol 2006;34:455e65. Lynch S, Kelleher D, McManus R, O’Farrelly C. RAG1 and RAG2 expression in human intestinal epithelium: evidence of extrathymic T cell differentiation. Eur J Immunol 1995;25:1143e7. Durand C, Charlemagne J, Fellah JS. RAG expression is restricted to the first year of life in the Mexican axolotl. Immunogenetics 2000;51:681e7. Mussmann R, Courtet M, Du Pasquier L. Development of the early B cell population in Xenopus. Eur J Immunol 1998;28:2947e59. Frippiat C, Kremarik P, Ropars A, Dournon C, Frippiat JP. The recombinationactivating gene 1 of Pleurodeles waltl (urodele amphibian) is transcribed in lymphoid tissues and in the central nervous system. Immunogenetics 2001;52:264e75. Lin JH-Y, Lin H-T, Lopez C, Chen T-Y, Chen M-S, Yang H-L. A comparison of the expression of immunity-related rag 1 and ikaros genes with histogenesis of the thymus in Epinephelus malabaricus (Bloch & Schneider). Aquacult Res 2008;39:252e62.

X.L. Zhang et al. / Fish & Shellfish Immunology 32 (2012) 534e543 [53] Wilson A, Held W, MacDonald HR. Two waves of recombinase gene expression in developing thymocytes. J Exp Med 1994;179:1355e60. [54] Grawunder U, Leu TM, Schatz DG, Werner A, Rolink AG, Melchers F, et al. Down-regulation of RAG1 and RAG2 gene expression in preB cells after

543

functional immunoglobulin heavy chain rearrangement. Immunity 1995;3: 601e8. [55] Da Sylva TR, Fong IC, Cunningham LA, Wu GE. RAG1/2 re-expression causes receptor revision in a model B cell line. Mol Immunol 2007;44:889e99.