- Email: [email protected]
Molecular cloning and characterization of high mobility group box1 (Ls-HMGB1) from humphead snapper, Lutjanus sanguineus
Fish & Shellfish Immunology 40 (2014) 539e544
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Short communication
Molecular cloning and characterization of high mobility group box1 (Ls-HMGB1) from humphead snapper, Lutjanus sanguineus Jia Cai a, b, c, 1, Hongli Xia a, b, c, 1, Yucong Huang a, b, c, Yishan Lu a, b, c, Zaohe Wu b, c, d, Jichang Jian a, b, c, * a
College of Fishery, Guangdong Ocean University, Zhanjiang 524088, China Guangdong Provincial Key Laboratory of Pathogenic Biology and Epidemiology for Aquatic Economic Animals, Zhanjiang 524088, China Guangdong Key Laboratory of Control for Diseases of Aquatic Economic Animals, Zhanjiang 524088, China d Zhongkai University of Agriculture and Engineering, Guangzhou 510225, China b c
a r t i c l e i n f o
a b s t r a c t
Article history: Received 22 May 2014 Received in revised form 20 July 2014 Accepted 3 August 2014 Available online 10 August 2014
High mobility group box1 (HMGB1) is a kind of chromatin-associated nonhistone protein important for nucleosome formation, transcriptional regulation and inflammation. However, the reports about HMGB1 of marine fish were still limited. Here, we cloned and characterized a HMGB1 gene from humphead snapper, Lutjanus sanguineus (Ls-HMGB1). The Ls-HMGB1 cDNA composed of 1199 bp with a 70 bp of 50 UTR, 630 bp open reading frame (ORF) and 499 bp 30 -UTR, encoded a polypeptide of 210 amino acids (GenBank Accession No: KJ783442). Sequence alignment of Ls-HMGB1 showed the highest similarity of 91% with Sciaenops ocellatus HMGB1 protein. Quantitative real-time PCR (qRT-PCR) analysis revealed that Ls-HMGB1 had relatively high expression level in skin, kidney and heart. After Vibrio harveyi and poly I:C stimulation, transcripts of Ls-HMGB1 were significantly increased and reached to peak at 18 h p.i. The L. sanguineus interleukin-6 (Ls-IL6) transcription in HK leukocytes was significantly induced by recombinant LsHMGB1 (rLsHMGB1). These results indicated that Ls-HMGB1 may play an important role in immune response of L. sanguineus during pathogen challenge. © 2014 Published by Elsevier Ltd.
Keywords: Humphead snapper HMGB1 Interleukin-6 Immune response
1. Introduction High mobility group box1 (HMGB1) is a conserved nonhistone protein contained two HMG boxes (termed A box and B box) and an acidic C-terminal region [1]. In mammals, the nuclear HMGB1 played different roles in nucleosome structure stability, DNA mismatch repair and gene expression regulation [2e4]. Except the intracellular role, the extracellular HMGB1 was shown to function as an elicitor or mediator of inflammatory response [5e11]. To date, HMGB1 orthologues have been recorded in many vertebrate or invertebrate species [6,12e17]. In teleost fish, HMGB1 expression can be induced by bacteria [17,19], virus or viral pathogen associated molecular patterns (PAMPs) stimulation [18]. The
* Corresponding author. Fisheries College, Guangdong Ocean University, Huguang Yan East, Zhanjiang, Guangdong Province 524088, China. Tel./fax: þ86 759 2383507. E-mail address: [email protected] (J. Jian). 1 These authors contributed to the work equally and should be regarded as cofirst authors. http://dx.doi.org/10.1016/j.fsi.2014.08.004 1050-4648/© 2014 Published by Elsevier Ltd.
red drum HMGB1 (SoHMGB1) can promote monocytes/macrophages activation [17]. Additionally, HMGB1 from goldfish induces activation of NF-kB and promotes the production of cytokines, such as TNFa-2 and IL-1b [19]. On the other hand, the requirements of zebrafish HMGB1 during brain development [15] and regeneration after spinal cord injury have been documented as well [20]. But the information about HMGB1 in marine fish is still limited. Humphead snapper (Lutjanus sanguineus) is one of the most important marine fishes in the south coastal regions of China. However, diseases caused by Vibrio sp have resulted in huge economic losses in snapper farming industry. And the immune response of L. sanguineus against pathogen invasion remains largely unknown. In this study, a HMGB1 gene from L. sanguineus (Ls-HMGB1) was isolated and characterized. The tissue distribution and expression analysis after stimulation with Vibrio harveyi/ Poly I:C were investigated. Moreover, the ability of LsHMGB1 to induce expression of inflammatory cytokine Ls-IL6 was also detected. The present results contributed to expand the understanding of immune response in L. sanguineus during pathogen infection.
540
J. Cai et al. / Fish & Shellfish Immunology 40 (2014) 539e544
2. Materials and methods
2.4. Bioinformatics analysis of Ls-HMGB1
2.1. Fish
The similarity analyses of the determined nucleotide sequences and deduced amino acid sequences were performed by BLAST program (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The nucleotide and predicted amino acid sequences of Ls-HMGB1 were analyzed using Genetyx 7.0 software. Multiple-sequence alignment of the reported HMGB1 amino acid sequences was performed using ClustalX2.0 and a phylogenetic tree was constructed using the MEGA 5.0 software. The protein motif features were predicted by Simple Modular Architecture Research Tool (SMART) (http://smart. embl-heidelberg.de/)
Humphead snapper (average weight 500e600 g) were purchased from local commercial market (Zhanjiang, China). The fish were maintained in aerated sea water tank at 28 C and fed for one week prior to experimental manipulation. The fish were anesthetized using “cold-anesthetize” by dumping ice into fish bucket before killing. A series of tissues including head kidney, gill, heart, intestine, thymus, muscle, liver, skin, spleen, stomach, kidney, brain were sampled from the killed fishes and immediately frozen by liquid nitrogen, followed by storage at 80 C until used.
2.5. Tissue distribution of Ls-HMGB1 2.2. RNA isolation and cDNA synthesis Total RNA was isolated from the sampled tissues of humphead snapper using Trizol Reagent (Invitrogen) according to the manufacturer's protocol, the quality of total RNA was detected by electrophoresis on 1% agarose gel. The first-strand cDNA synthesis was carried out according to protocols of M-MLV Reverse Transcriptase (Promega, USA) after DNaseI treatment (Promega, USA). The RNA isolated from spleen was used for templates synthesis of RACE PCR through SMARTer RACE cDNA Amplification Kit (Clontech, USA) after DNaseI treatment (Promega, USA).
2.3. Amplification of Ls-HMGB1 cDNA 2.3.1. Amplification of Ls-HMGB1 fragment HMGB1 fragment was amplified using degenerated primer LsHMGB-DF, LsHMGB-DR (Table 1) designed on conserved regions of known fish HMGB1 sequences of Oncorhynchus mykiss (BT073355), Salmo salar (NM_001139629), Danio rerio (BC045917). The PCR products were purified, ligated into the pMD18-T vector (TaKaRa, Japan) and cloned. Then the positive clones were sequenced by SANGON BIOTECH (Shanghai, China).
The healthy fish were sacrificed and the gill, heart, liver, head kidney, kidney, spleen, stomach, intestine, muscle, brain, thymus and skin were collected. Total RNA was extracted using TRIzol Reagent (Invitrogen, USA) according to manufacturer's instructions. The tissue with lowest expression of Ls-HMGB1 was chose as a calibrator for calculating Ls-HGMB1 expression in the rest tissues. Expression of Ls-HMGB1 in different tissues was determined by qRT-PCR using primers shown in Table 1. 2.6. Challenge experiment The synthetic dsRNA analog polyinosinicpolycytidylic acid sodium salt (poly I:C) was purchased from Sigma Corporation (USA) and dissolved in PBS. The V. harveyi used in this study was isolated from diseased Humphead snapper and kept in our laboratory. For bacterial challenge experiment, each fish was injected intraperitoneally (i.p.) with 200 ml live V. harveyi resuspended in PBS (2 108 CFU/ml). For viral PAMP stimulation, each fish was injected with 200 ml poly I:C (1 mg/ml). The control group was injected with 200 ml PBS. Each sample contained 3 independent individuals respectively to eliminate the individual differences. Total RNA of head kidneys was isolated immediately at 0, 6, 12, 18, 24, 48 and 72 h post-injection for further analysis. 2.7. Quantitative real-time PCR (qRT-PCR) analysis
2.3.2. Rapid amplification of cDNA ends (RACE) of Ls-HMGB1 cDNA The primers used for RACE PCR were designed according to the obtained sequence in 2.3.1, the 50 and 30 ends of the Ls-HMGB1 cDNA were amplified following the manufacturer's protocol of SMARTer RACE cDNA amplification kit (Clontech, USA). The sequences of the primers used were listed in Table 1. The RACE PCR condition and assembly of Ls-HMGB1 cDNA were performed as mentioned in Ref. [21].
Table 1 Sequences of primers used in this study. Genes
Primers
Sequences (50 e30 )
HMGB1
LsHMGB-DF LsHMGB-DR LsHMGB30 GSP1 LsHMGB30 GSP2 LsHMGB50 NGSP1 LsHMGB50 NGSP2 RT- LsHMGB-F RT- LsHMGB-R RT-Actin-F RT-Actin-R pET-LsHMGB-F pET-LsHMGB-R RT- LsIL6-F RT- LsIL6-R
ATGTCSTCHTATGCHTACTTYGTSCAG CTTWTCGTACTTCTCCTTCAGCTTGG TCAAGGACCCTAATGCCCCCAAGAG CTGCTCAGAGTTCCGCCCTAAGGT TTAGGGCGGAACTCTGAGCAGAAGAT GCATTAGGGTCCTTGAACTTCTTCT ACCTCCATCTGCTTTCTTCATC GCACTGCCTCCTTTGGTCTTTT GCAGATGTGGATCAGCAAGCAGGA CGCCTGAGTGTGTATGAGAAATG GGAATTC ATGGGGAGAGAGCCGAGAGAGC CGCTCGAG CTACTCATCATCATCATCGTAGT GTCTTCCTGCTCTGTGCGGT GGATTATCACCCTCCTCAAACG
Interleukin-6
The specific primers used for qRT-PCR were listed in Table 1. Amplification of b-actin mRNA was used as internal control. The qRT-PCR assay was carried out through IQ5 Real-time PCR System (Bio-Rad laboratories). Dissociation curve analysis of amplification products was performed at the end of each PCR reaction. The amplification was performed in a 25 ml reaction volume containing 12.5 ml of 2 SYBR Premix Ex Taq (TaKara, Japan), 1 ml sense primer and 1 ml anti-sense primer (10 mM), 2 ml of 1:5 diluted cDNA and 8.5 ml of PCR-grade water. The PCR amplification efficiency was identified according to the methods in Ref. [22]. All samples were analyzed in triplicate wells using the cycling condition as follows: 94 C for 3 min, followed by 40 cycles of 30 s at 94 C, 30 s at 60 C and 30 s at 72 C. After PCR program, the obtained data were analyzed with IQ5 Software. The baseline was set automatically by the software. The relative expression level of Ls-HMGB1 was analyzed by 2△△Ct method [23]. The results were expressed as mean ± SD, and statistical analysis was performed using SPSS software. 2.8. Production and purification of Ls-HMGB1 recombinant protein (rLsHMGB1) To obtain recombinant HMGB1 protein, Ls-HMGB1 ORF was amplified and subcloned into the pET-28a (þ) vector (Novagen,
J. Cai et al. / Fish & Shellfish Immunology 40 (2014) 539e544
USA). The primers used in this step were shown in Table 2. The constructed plasmid pET-LsHMGB1 was transformed into E.coli BL21(DE3). And the positive clone was applied for recombinant protein preparation. The recombinant BL21 (DE3) was cultured in LB-kanamycin at 37 Cwith shaking at 200 rpm. When the culture medium reached an OD600 of 0.4e0.6, IPTG was then added to the medium to a final concentration of 1 mM and incubated for another 4 h optimal time. Recombinant protein in the culture supernatant was purified using the HisTrap affinity columns (GE Healthcare, USA) according to the manufacture's instructions. Purified protein was dialyzed in PBS and concentrated with Amicon Ultra Centrifugal Filter Devices (Millipore, USA). The purified protein was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The protein concentration was measured through Braford Protein Assay kit (KeyGEN, China).
2.9. Preparation of head kidney leukocytes (HKLs) The head kidney leukocytes were prepared according to the protocol in Ref. [24] with minor modification. Briefly, the head kidney and trunk-kidney was placed on a stainless steel mesh filter (100 mm), and pressed through with 5 ml of Leibovitz's L15 medium (Invitrogen, USA) to create cell suspensions. Released cells were collected through a centrifugation (400 g for 5 min). After discarding the supernatant, 2 ml of distilled water was added to the cell pellet to lyse erythrocytes and gently mixed several times with a pipette. Subsequently, remaining head kidney leukocytes were washed twice by centrifugations with L15 medium. Finally the cells were dispersed in L15 medium containing 20% fetal bovine serum. Cell concentration and viability were determined by trypan blue dye exclusion with a hemocytometer. Viability of cells was approximately 90%.
2.10. Effect of rLsHMGB1 on interleukin-6 (Ls-IL6) mRNA expression in HKLs Primary HKLs were divided to two groups (1 106 cells/group) and were incubated with medium alone (control) or treated with 100 ng rLsHMGB1 for 12 h. Then the control and treated cells were collected for RNA preparation. Methods of RNA isolation and cDNA synthesis were described in Section 2.2. In our study, since relevant cytokines, such as TNF-a and IL-1b are not known in humphead snapper, we only examined the effect of rLs-HMGB1 on Ls-IL6 transcription in HKLs, which had been cloned in our laboratory (Accession number: JX683126). The Ls-IL6 mRNA gene expressions in different groups were examined by qRT-PCR. The primers used for Ls-IL6 amplification were shown in Table 1 b-actin was used as Table 2 Genbank accession numbers of the sequences used in this study. Genes
Species
Accession number
HMGB1
Lutjanus sanguineus Mus musculus Homo sapiens Pan troglodytes Xenopus laevis Gallus gallus Sciaenops ocellatus Anoplopoma fimbria Carassius auratus Danio rerio Salmo salar Oncorhynchus mykiss Lutjanus sanguineus
KJ783442 AAH64790 CAG33144 XP_003952431 NP_001080836 NP_990233 ADX06860 ACQ59037 AHI15743 AAI65307/BC165307 NP_001133101/NM_001139629 ACO07779/BT073355 JX683126
Interleukin-6
541
internal control. qRT-PCR and data analysis were performed as described in Section 2.7. 3. Results and discussion 3.1. Bioinformatics analysis of Ls-HMGB1 The complete cDNA sequence of Ls-HMGB1 was 1199 bp in length, including a 50 untranslated regions (UTR) of 70 bp, an open reading frame (ORF) of 630 bp and a 30 UTR of 499 bp. Ls-HMGB1 ORF encoded a 210 aa polypeptide with a predicted molecular mass of approximately 24.02 kDa. The deduced amino acid sequence shared 70e91% overall sequence identities with other reported HMGB1s. Ls-HMGB1 possessed two characteristic HMG boxes (A and B) of HMGB1 protein family, which were conserve from mammals to fish. Whereas, the C-terminus sequences showed relatively low similarities between Ls-HMGB1 and other reported fish HMGB1s. Except the consecutive Asp and Glu residues, LsHMGB1 also contained Tyr residues (Tyr 224) in C-terminus acidic region, which was different from Anoplopoma fimbria, S. salar, D. rerio. Additionally, a shorter acidic tail was found in Ls-HMGB1 compared with human HMGB1. The same phenotype was also observed in other teleost HMGB1s (Fig. 1). As an evolutionarily conserved protein, phylogenetic analysis showed that known HMGB1 proteins were classified into two subgroups (Fish subgroup and Non-Fish subgroup). As expected, Ls-HMGB1 was clustered into fish HMGB1s and had the closest distance with Sciaenops ocellatus (Fig. 2). 3.2. Tissue distribution of Ls-HMGB1 The HMGB1 gene was widely expressed in mammalian tissues, with higher levels in the lymphoid, tissue thymus, testis and neonatal liver [25]. Similar patterns were also found in reported teleost HMGB1 [17e19]. In present study, Ls-HMGB1 was ubiquitously distributed in all analyzed tissues. The mRNA expression levels in liver, head kidney, skin, kidney, gill, heart, thymus, intestine, stomach, spleen and muscle were 13.6-, 6.8-, 18.2-, 15.1-, 2.8-, 15.1-, 6.9-，3.9-, 13.3-, 2.3- and 8.1-fold compared with the expression in brain (Fig. 3), which implied that Ls-HMGB1 may play multiple roles in healthy fish. Like grass carp HMGB1b [18], LsHMGB1 exhibited the highest expression levels in skin. As we known, fish skin provided the first barrier against pathogens adhesion [26]. Moreover, HMGB1 worked as a damage-associated molecular pattern (DAMP) molecular that alerted the immune system to resist external danger [27]. So we speculated that LsHMGB1 might contribute to the “barrier” role of skin in humphead snapper. 3.3. Expression profiles of Ls-HMGB1 in head kidney (HK) response to V. harveyi and viral PAMP stimulations In red drum, HMGB1 was up-regulated upon bacterial infection and secreted by bacteria infected. And recombinant SoHMGB1 could promote HK macrophages proliferation, activation and antibacterial activity [17]. The similar results were recorded in report of goldfish HMGB1 (gHMGB1). In addition, the recombinant gHMGB1 also induced TNFa-2 and IL-1b production in goldfish macrophages, suggesting a crucial role of gHMGB1 in inflammatory regulation and antimicrobial response [19]. Our data exhibited that transcripts of Ls-HMGB1 were significantly increased at 18 h (11.8fold) after V. harveyi challenged compared with control group (Fig. 4), implied that Ls-HMGB1 was involved in host immune response to bacterial infection. In the case of Viral PAMP poly I:C stimulation, it have been demonstrated in grass carp that HMGB1
542
J. Cai et al. / Fish & Shellfish Immunology 40 (2014) 539e544
Fig. 1. Multiple alignments of Ls-HMGB1 amino acid sequence with other known HMGB1s. The black shadow region indicated identical residues. Similar amino acids are shaded in grey. The HMG domains were indicated by rounded boxes. The acidic tails were marked by dotted box. GenBank accession numbers were listed in Table 2.
Fig. 2. Phylogenetic analysis of Ls-HMGB1. Amino acid sequences of Ls-HMGB1 was marked by solid triangle. The GenBank accession numbers were listed in Table 2.
Fig. 3. Tissue distribution of Ls-HMGB1. Three parallel samples of each tissue were collected from three healthy fish. Data were expressed as a ratio to Ls-HMGB1 mRNA expression in the brain. Vertical bars represented the means ± SD. Significant difference was indicated by asterisks, *P < 0.05 or **P < 0.01.
J. Cai et al. / Fish & Shellfish Immunology 40 (2014) 539e544
543
Fig. 6. The effect of rLsHMGB1 on mRNA levels of Ls-IL6 in head kidney leukocytes. * indicate statistical difference at P < 0.05 (n ¼ 3). Fig. 4. Expression profiles of Ls-HMGB1 after different stimulation in head kidney. Data are expressed as a ratio to Ls-HMGB1 mRNA in sample from unstimulated fish. The values are shown as mean ± SD. Significant difference was indicated by asterisks, **P < 0.01.
expression can be induced by poly I:C [18]. And similar expression profile was observed in our study, significant increase (P < 0.05) of Ls-HMGB1 expression was detected at 18 h, whereas a small increase was seen at 6 h post-stimulation (Fig. 4). The data indicated a potential role of Ls-HMGB1 in innate immune response to viral infection. Given that HMGB1 was considered as an alarmin, it released rapidly once external danger stimulus and ultimately promotes homeostasis [28]. The secreted HMGB1 triggered immune responses and induce more cytokines production, such as IL1, TNF-a, IL-6 [5]. In turn, HMGB1 could be induced by cytokines or pro-inflammatory molecules production [29,30]. These findings implied that HMGB1 expression might be regulated by a signaling cascade, which could explain the expression patterns at 12 h and 24 h after stimulation. On the other hand, the increasing HMGB1 levels might cause organ damage [31]. This could be the reason why a sharp decrease of HMGB1 occurred at 24 h follow stimulus. And the assumption above needed to be confirmed in future research.
3.4. rLsHMGB1 induced Ls-IL6 expression in HKLs of L. sanguineus We evaluated induction of Ls-IL6 gene expression in HKLs treated with rLsHMGB1. Recombinant Ls-HMGB1 protein was purified at its predicted molecular weight. As shown in Fig. 5, one single band with the molecular weight of 27.84 kDa including the size of 3.82 kDa of tags was indicated by SDS-PAGE analysis. Addition of rLsHMGB1 resulted in a 6.2-fold increase of Ls-IL6 mRNA level compared with control Fig. 6. In human primary monocytes/macrophages, HMGB1 has been proved to stimulate the expression of IL-6 [5]. Given the pleiotropic roles of IL-6 in immune response and inflammation [32], our data indicated that the conserve function of LsHMGB1 in inducing proinflammatory cytokine expression and multiple roles in regulating immune response as well. 4. Conclusion In this study, a HMGB1 homolog was cloned and characterized from humphead snapper, L. sanguineus. Ls-HMGB1 contained two conserve HMG box motifs and an acidic tail, showed the highest similarity to S. ocellatus HMGB1. qRT-PCR analysis showed that LsHMGB1 expressed widely in all examined tissues and responded to bacterial/viral PAMP challenged in head-kidney. Furthermore, the stimulatory effect of rLsHMGB1 on Ls-IL6 mRNA expression was also identified in vitro. These present data indicated that Ls-HMGB1 may play an important role in immune response of L. sanguineus against bacterial/viral pathogen. Acknowledgments The authors wish to thank all the laboratory members' suggestion on this manuscript. This work was supported by Educational Commission of Guangdong Province (2012CXZD0026, 2013gjhz0008) and Science and Technology Planning Project of Guangdong Province (2012B050600029). References
Fig. 5. SDS-PAGE analysis of purified rLsHMGB1. Lane 1, protein marker; Lane 2, purified rLsHMGB1.
[1] Hardman CH, Broadhurst RW, Raine AR, Grasser KD, Thomas JO, Laue ED. Structure of the A-domain of HMG1 and its interaction with DNA as studied by heteronuclear three- and four-dimensional NMR spectroscopy. Biochemistry 1995;34(51):16596e607. [2] Bustin M. Regulation of DNA-dependent activities by the functional motifs of the high-mobility-group chromosomal proteins. Mol Cell Biol 1999;19: 5237e46. [3] Stros M. HMGB proteins: interactions with DNA and chromatin. Biochim Biophys Acta 2010;1799:101e13.
544
J. Cai et al. / Fish & Shellfish Immunology 40 (2014) 539e544
[4] Altieri F, Grillo C, Maceroni M, Chichiarelli S. DNA damage and repair: from molecular mechanisms to health implications. Antioxid Redox Signal 2008;10: 891e938. [5] Andersson U, Wang H, Palmblad K, Aveberger AC, Bloom O, ErlandssonHarris H, et al. High mobility group 1 protein (HMG-1) stimulates proinflammatory cytokine synthesis in human monocytes. J Exp Med 2000;192(4): 565e70. [6] Fiuza C, Bustin M, Talwar S, Tropea M, Gerstenberger E, Shelhamer JH, et al. Inflammation-promoting activity of HMGB1 on human microvascular endothelial cells. Blood 2003;101(7):2652e60. [7] Palumbo R, Sampaolesi M, De Marchis F, Tonlorenzi R, Colombetti S, Mondino A, et al. Extracellular HMGB1, a signal of tissue damage, induces mesoangioblast migration and proliferation. J Cell Biol 2004;164(3): 441e9. [8] Rouhiainen A, Kuja-Panula J, Wilkman E, Pakkanen J, Stenfors J, Tuominen RK, et al. Regulation of monocyte migration by amphoterin (HMGB1). Blood 2004;104(4):1174e82. [9] Messmer D, Yang H, Telusma G, Knoll F, Li J, Messmer B, et al. High mobility group box protein 1: an endogenous signal for dendritic cell maturation and Th1 polarization. J Immunol 2004;173(1):307e13. [10] Park JS, Arcaroli J, Yum HK, Yang H, Wang H, Yang KY, et al. Activation of gene expression in human neutrophils by high mobility group box 1 protein. Am J Physiol Cell Physiol 2003;284(4):C870e9. [11] Yang H, Wang H, Tracey KJ. HMG-1 rediscovered as a cytokine. Shock 2001;15(4):247e53. [12] Cui XS, Shen XH, Kim NH. High mobility group box 1 (HMGB1) is implicated in preimplantation embryo development in the mouse. Mol Reprod Dev 2008;75:1290e9. [13] Goodwin GH, Sanders C, Johns EW. A new group of chromatin-associated proteins with a high content of acidic and basic amino acids. Eur J Biochem 1973;38:14e9. [14] Pang Y, Xiao R, Liu X, Li Q. Identification and characterization of the lamprey high-mobility group box 1 gene. PLoS One 2012;7:e35755. [15] Zhao X, Kuja-Panula J, Rouhiainen A, Chen YC, Panula P, Rauvala H. High mobility group box-1 (HMGB1; amphoterin) is required for zebrafish brain development. J Biol Chem 2011;286:23200e13. [16] Wang M, Wang L, Guo Y, Zhou Z, Yi Q, Zhang D, et al. A high mobility group box 1 (HMGB1) gene from Chlamys farreri and the DNA-binding ability and pro-inflammatory activity of its recombinant protein. Fish Shellfish Immunol 2014;36(2):393e400.
[17] Zhao L, Hu YH, Sun JS, Sun L. The high mobility group box 1 protein of Sciaenops ocellatus is a secreted cytokine that stimulates macrophage activation. Dev Comp Immunol 2011a;35(10):1052e8. [18] Yang C, Peng L, Su J. Two HMGB1 genes from grass carp Ctenopharyngodon idella mediate immune responses to viral/bacterial PAMPs and GCRV challenge. Dev Comp Immunol 2013;39(3):133e46. [19] Xie J, Hodgkinson JW, Li C, Kovacevic N, Belosevic M. Identification and functional characterization of the goldfish (Carassius auratus L.) high mobility group box 1 (HMGB1) chromatin-binding protein. Dev Comp Immunol 2014;44(1):245e53. [20] Fang P, Pan HC, Lin SL, Zhang WQ, Rauvala H, Schachner M, et al. HMGB1 contributes to regeneration after spinal cord injury in adult zebrafish. Mol Neurobiol 2014;49(1):472e83. [21] Cai J, Huang Y, Wei S, Huang X, Ye F, Fu J, et al. Characterization of p38 MAPKs from orange-spotted grouper, Epinephelus coioides involved in SGIV infection. Fish Shellfish Immunol 2011;31(6):1129e36. [22] Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 2008;3(6):1101e8. [23] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2△△Ct method. Methods 2001;25:402e8. [24] Toda H, Saito Y, Koike T, Takizawa F, Araki K, Yabu T, et al. Conservation of characteristics and functions of CD4 positive lymphocytes in a teleost fish. Dev Comp Immunol 2011;35(6):650e60. [25] Mosevitsky MI, Novitskaya VA, Iogannsen MG, Zabezhinsky MA. Tissue specificity of nucleo-cytoplasmic distribution of HMG1 and HMG2 proteins and their probable functions. Eur J Biochem 1989;185(2):303e10. [26] Shephard KL. Functions for fish mucus. Rev Fish Biol Fish 1994;4:401e29. [27] Bianchi ME. HMGB1 loves company. J Leukoc Biol 2009;86(3):573e6. [28] Klune JR, Dhupar R, Cardinal J, Billiar TR, Tsung A. HMGB1: endogenous danger signaling. Mol Med 2008;14(7e8):476e84. [29] Wang H, Vishnubhakat JM, Bloom O, Zhang M, Ombrellino M, Sama A, et al. Proinflammatory cytokines(tumor necrosis factor and interleukin 1) stimulate release of high mobility group protein-1 by pituicytes. Surgery 1999;126(2): 389e92. [30] Tang D, Kang R, Zeh 3rd HJ, Lotze MT. High-mobility group box 1, oxidative stress, and disease. Antioxid Redox Signal 2011;14(7):1315e35. [31] Asavarut P, Zhao H, Gu J, Ma D. The role of HMGB1 in inflammation-mediated organ injury. Acta Anaesthesiol Taiwan 2013;51(1):28e33. [32] Hirano T. Interleukin 6 and its receptor: ten years later. Int Rev Immunol 1998;16(3e4):249e84.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Short communication
Molecular cloning and characterization of high mobility group box1 (Ls-HMGB1) from humphead snapper, Lutjanus sanguineus Jia Cai a, b, c, 1, Hongli Xia a, b, c, 1, Yucong Huang a, b, c, Yishan Lu a, b, c, Zaohe Wu b, c, d, Jichang Jian a, b, c, * a
College of Fishery, Guangdong Ocean University, Zhanjiang 524088, China Guangdong Provincial Key Laboratory of Pathogenic Biology and Epidemiology for Aquatic Economic Animals, Zhanjiang 524088, China Guangdong Key Laboratory of Control for Diseases of Aquatic Economic Animals, Zhanjiang 524088, China d Zhongkai University of Agriculture and Engineering, Guangzhou 510225, China b c
a r t i c l e i n f o
a b s t r a c t
Article history: Received 22 May 2014 Received in revised form 20 July 2014 Accepted 3 August 2014 Available online 10 August 2014
High mobility group box1 (HMGB1) is a kind of chromatin-associated nonhistone protein important for nucleosome formation, transcriptional regulation and inflammation. However, the reports about HMGB1 of marine fish were still limited. Here, we cloned and characterized a HMGB1 gene from humphead snapper, Lutjanus sanguineus (Ls-HMGB1). The Ls-HMGB1 cDNA composed of 1199 bp with a 70 bp of 50 UTR, 630 bp open reading frame (ORF) and 499 bp 30 -UTR, encoded a polypeptide of 210 amino acids (GenBank Accession No: KJ783442). Sequence alignment of Ls-HMGB1 showed the highest similarity of 91% with Sciaenops ocellatus HMGB1 protein. Quantitative real-time PCR (qRT-PCR) analysis revealed that Ls-HMGB1 had relatively high expression level in skin, kidney and heart. After Vibrio harveyi and poly I:C stimulation, transcripts of Ls-HMGB1 were significantly increased and reached to peak at 18 h p.i. The L. sanguineus interleukin-6 (Ls-IL6) transcription in HK leukocytes was significantly induced by recombinant LsHMGB1 (rLsHMGB1). These results indicated that Ls-HMGB1 may play an important role in immune response of L. sanguineus during pathogen challenge. © 2014 Published by Elsevier Ltd.
Keywords: Humphead snapper HMGB1 Interleukin-6 Immune response
1. Introduction High mobility group box1 (HMGB1) is a conserved nonhistone protein contained two HMG boxes (termed A box and B box) and an acidic C-terminal region [1]. In mammals, the nuclear HMGB1 played different roles in nucleosome structure stability, DNA mismatch repair and gene expression regulation [2e4]. Except the intracellular role, the extracellular HMGB1 was shown to function as an elicitor or mediator of inflammatory response [5e11]. To date, HMGB1 orthologues have been recorded in many vertebrate or invertebrate species [6,12e17]. In teleost fish, HMGB1 expression can be induced by bacteria [17,19], virus or viral pathogen associated molecular patterns (PAMPs) stimulation [18]. The
* Corresponding author. Fisheries College, Guangdong Ocean University, Huguang Yan East, Zhanjiang, Guangdong Province 524088, China. Tel./fax: þ86 759 2383507. E-mail address: [email protected] (J. Jian). 1 These authors contributed to the work equally and should be regarded as cofirst authors. http://dx.doi.org/10.1016/j.fsi.2014.08.004 1050-4648/© 2014 Published by Elsevier Ltd.
red drum HMGB1 (SoHMGB1) can promote monocytes/macrophages activation [17]. Additionally, HMGB1 from goldfish induces activation of NF-kB and promotes the production of cytokines, such as TNFa-2 and IL-1b [19]. On the other hand, the requirements of zebrafish HMGB1 during brain development [15] and regeneration after spinal cord injury have been documented as well [20]. But the information about HMGB1 in marine fish is still limited. Humphead snapper (Lutjanus sanguineus) is one of the most important marine fishes in the south coastal regions of China. However, diseases caused by Vibrio sp have resulted in huge economic losses in snapper farming industry. And the immune response of L. sanguineus against pathogen invasion remains largely unknown. In this study, a HMGB1 gene from L. sanguineus (Ls-HMGB1) was isolated and characterized. The tissue distribution and expression analysis after stimulation with Vibrio harveyi/ Poly I:C were investigated. Moreover, the ability of LsHMGB1 to induce expression of inflammatory cytokine Ls-IL6 was also detected. The present results contributed to expand the understanding of immune response in L. sanguineus during pathogen infection.
540
J. Cai et al. / Fish & Shellfish Immunology 40 (2014) 539e544
2. Materials and methods
2.4. Bioinformatics analysis of Ls-HMGB1
2.1. Fish
The similarity analyses of the determined nucleotide sequences and deduced amino acid sequences were performed by BLAST program (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The nucleotide and predicted amino acid sequences of Ls-HMGB1 were analyzed using Genetyx 7.0 software. Multiple-sequence alignment of the reported HMGB1 amino acid sequences was performed using ClustalX2.0 and a phylogenetic tree was constructed using the MEGA 5.0 software. The protein motif features were predicted by Simple Modular Architecture Research Tool (SMART) (http://smart. embl-heidelberg.de/)
Humphead snapper (average weight 500e600 g) were purchased from local commercial market (Zhanjiang, China). The fish were maintained in aerated sea water tank at 28 C and fed for one week prior to experimental manipulation. The fish were anesthetized using “cold-anesthetize” by dumping ice into fish bucket before killing. A series of tissues including head kidney, gill, heart, intestine, thymus, muscle, liver, skin, spleen, stomach, kidney, brain were sampled from the killed fishes and immediately frozen by liquid nitrogen, followed by storage at 80 C until used.
2.5. Tissue distribution of Ls-HMGB1 2.2. RNA isolation and cDNA synthesis Total RNA was isolated from the sampled tissues of humphead snapper using Trizol Reagent (Invitrogen) according to the manufacturer's protocol, the quality of total RNA was detected by electrophoresis on 1% agarose gel. The first-strand cDNA synthesis was carried out according to protocols of M-MLV Reverse Transcriptase (Promega, USA) after DNaseI treatment (Promega, USA). The RNA isolated from spleen was used for templates synthesis of RACE PCR through SMARTer RACE cDNA Amplification Kit (Clontech, USA) after DNaseI treatment (Promega, USA).
2.3. Amplification of Ls-HMGB1 cDNA 2.3.1. Amplification of Ls-HMGB1 fragment HMGB1 fragment was amplified using degenerated primer LsHMGB-DF, LsHMGB-DR (Table 1) designed on conserved regions of known fish HMGB1 sequences of Oncorhynchus mykiss (BT073355), Salmo salar (NM_001139629), Danio rerio (BC045917). The PCR products were purified, ligated into the pMD18-T vector (TaKaRa, Japan) and cloned. Then the positive clones were sequenced by SANGON BIOTECH (Shanghai, China).
The healthy fish were sacrificed and the gill, heart, liver, head kidney, kidney, spleen, stomach, intestine, muscle, brain, thymus and skin were collected. Total RNA was extracted using TRIzol Reagent (Invitrogen, USA) according to manufacturer's instructions. The tissue with lowest expression of Ls-HMGB1 was chose as a calibrator for calculating Ls-HGMB1 expression in the rest tissues. Expression of Ls-HMGB1 in different tissues was determined by qRT-PCR using primers shown in Table 1. 2.6. Challenge experiment The synthetic dsRNA analog polyinosinicpolycytidylic acid sodium salt (poly I:C) was purchased from Sigma Corporation (USA) and dissolved in PBS. The V. harveyi used in this study was isolated from diseased Humphead snapper and kept in our laboratory. For bacterial challenge experiment, each fish was injected intraperitoneally (i.p.) with 200 ml live V. harveyi resuspended in PBS (2 108 CFU/ml). For viral PAMP stimulation, each fish was injected with 200 ml poly I:C (1 mg/ml). The control group was injected with 200 ml PBS. Each sample contained 3 independent individuals respectively to eliminate the individual differences. Total RNA of head kidneys was isolated immediately at 0, 6, 12, 18, 24, 48 and 72 h post-injection for further analysis. 2.7. Quantitative real-time PCR (qRT-PCR) analysis
2.3.2. Rapid amplification of cDNA ends (RACE) of Ls-HMGB1 cDNA The primers used for RACE PCR were designed according to the obtained sequence in 2.3.1, the 50 and 30 ends of the Ls-HMGB1 cDNA were amplified following the manufacturer's protocol of SMARTer RACE cDNA amplification kit (Clontech, USA). The sequences of the primers used were listed in Table 1. The RACE PCR condition and assembly of Ls-HMGB1 cDNA were performed as mentioned in Ref. [21].
Table 1 Sequences of primers used in this study. Genes
Primers
Sequences (50 e30 )
HMGB1
LsHMGB-DF LsHMGB-DR LsHMGB30 GSP1 LsHMGB30 GSP2 LsHMGB50 NGSP1 LsHMGB50 NGSP2 RT- LsHMGB-F RT- LsHMGB-R RT-Actin-F RT-Actin-R pET-LsHMGB-F pET-LsHMGB-R RT- LsIL6-F RT- LsIL6-R
ATGTCSTCHTATGCHTACTTYGTSCAG CTTWTCGTACTTCTCCTTCAGCTTGG TCAAGGACCCTAATGCCCCCAAGAG CTGCTCAGAGTTCCGCCCTAAGGT TTAGGGCGGAACTCTGAGCAGAAGAT GCATTAGGGTCCTTGAACTTCTTCT ACCTCCATCTGCTTTCTTCATC GCACTGCCTCCTTTGGTCTTTT GCAGATGTGGATCAGCAAGCAGGA CGCCTGAGTGTGTATGAGAAATG GGAATTC ATGGGGAGAGAGCCGAGAGAGC CGCTCGAG CTACTCATCATCATCATCGTAGT GTCTTCCTGCTCTGTGCGGT GGATTATCACCCTCCTCAAACG
Interleukin-6
The specific primers used for qRT-PCR were listed in Table 1. Amplification of b-actin mRNA was used as internal control. The qRT-PCR assay was carried out through IQ5 Real-time PCR System (Bio-Rad laboratories). Dissociation curve analysis of amplification products was performed at the end of each PCR reaction. The amplification was performed in a 25 ml reaction volume containing 12.5 ml of 2 SYBR Premix Ex Taq (TaKara, Japan), 1 ml sense primer and 1 ml anti-sense primer (10 mM), 2 ml of 1:5 diluted cDNA and 8.5 ml of PCR-grade water. The PCR amplification efficiency was identified according to the methods in Ref. [22]. All samples were analyzed in triplicate wells using the cycling condition as follows: 94 C for 3 min, followed by 40 cycles of 30 s at 94 C, 30 s at 60 C and 30 s at 72 C. After PCR program, the obtained data were analyzed with IQ5 Software. The baseline was set automatically by the software. The relative expression level of Ls-HMGB1 was analyzed by 2△△Ct method [23]. The results were expressed as mean ± SD, and statistical analysis was performed using SPSS software. 2.8. Production and purification of Ls-HMGB1 recombinant protein (rLsHMGB1) To obtain recombinant HMGB1 protein, Ls-HMGB1 ORF was amplified and subcloned into the pET-28a (þ) vector (Novagen,
J. Cai et al. / Fish & Shellfish Immunology 40 (2014) 539e544
USA). The primers used in this step were shown in Table 2. The constructed plasmid pET-LsHMGB1 was transformed into E.coli BL21(DE3). And the positive clone was applied for recombinant protein preparation. The recombinant BL21 (DE3) was cultured in LB-kanamycin at 37 Cwith shaking at 200 rpm. When the culture medium reached an OD600 of 0.4e0.6, IPTG was then added to the medium to a final concentration of 1 mM and incubated for another 4 h optimal time. Recombinant protein in the culture supernatant was purified using the HisTrap affinity columns (GE Healthcare, USA) according to the manufacture's instructions. Purified protein was dialyzed in PBS and concentrated with Amicon Ultra Centrifugal Filter Devices (Millipore, USA). The purified protein was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The protein concentration was measured through Braford Protein Assay kit (KeyGEN, China).
2.9. Preparation of head kidney leukocytes (HKLs) The head kidney leukocytes were prepared according to the protocol in Ref. [24] with minor modification. Briefly, the head kidney and trunk-kidney was placed on a stainless steel mesh filter (100 mm), and pressed through with 5 ml of Leibovitz's L15 medium (Invitrogen, USA) to create cell suspensions. Released cells were collected through a centrifugation (400 g for 5 min). After discarding the supernatant, 2 ml of distilled water was added to the cell pellet to lyse erythrocytes and gently mixed several times with a pipette. Subsequently, remaining head kidney leukocytes were washed twice by centrifugations with L15 medium. Finally the cells were dispersed in L15 medium containing 20% fetal bovine serum. Cell concentration and viability were determined by trypan blue dye exclusion with a hemocytometer. Viability of cells was approximately 90%.
2.10. Effect of rLsHMGB1 on interleukin-6 (Ls-IL6) mRNA expression in HKLs Primary HKLs were divided to two groups (1 106 cells/group) and were incubated with medium alone (control) or treated with 100 ng rLsHMGB1 for 12 h. Then the control and treated cells were collected for RNA preparation. Methods of RNA isolation and cDNA synthesis were described in Section 2.2. In our study, since relevant cytokines, such as TNF-a and IL-1b are not known in humphead snapper, we only examined the effect of rLs-HMGB1 on Ls-IL6 transcription in HKLs, which had been cloned in our laboratory (Accession number: JX683126). The Ls-IL6 mRNA gene expressions in different groups were examined by qRT-PCR. The primers used for Ls-IL6 amplification were shown in Table 1 b-actin was used as Table 2 Genbank accession numbers of the sequences used in this study. Genes
Species
Accession number
HMGB1
Lutjanus sanguineus Mus musculus Homo sapiens Pan troglodytes Xenopus laevis Gallus gallus Sciaenops ocellatus Anoplopoma fimbria Carassius auratus Danio rerio Salmo salar Oncorhynchus mykiss Lutjanus sanguineus
KJ783442 AAH64790 CAG33144 XP_003952431 NP_001080836 NP_990233 ADX06860 ACQ59037 AHI15743 AAI65307/BC165307 NP_001133101/NM_001139629 ACO07779/BT073355 JX683126
Interleukin-6
541
internal control. qRT-PCR and data analysis were performed as described in Section 2.7. 3. Results and discussion 3.1. Bioinformatics analysis of Ls-HMGB1 The complete cDNA sequence of Ls-HMGB1 was 1199 bp in length, including a 50 untranslated regions (UTR) of 70 bp, an open reading frame (ORF) of 630 bp and a 30 UTR of 499 bp. Ls-HMGB1 ORF encoded a 210 aa polypeptide with a predicted molecular mass of approximately 24.02 kDa. The deduced amino acid sequence shared 70e91% overall sequence identities with other reported HMGB1s. Ls-HMGB1 possessed two characteristic HMG boxes (A and B) of HMGB1 protein family, which were conserve from mammals to fish. Whereas, the C-terminus sequences showed relatively low similarities between Ls-HMGB1 and other reported fish HMGB1s. Except the consecutive Asp and Glu residues, LsHMGB1 also contained Tyr residues (Tyr 224) in C-terminus acidic region, which was different from Anoplopoma fimbria, S. salar, D. rerio. Additionally, a shorter acidic tail was found in Ls-HMGB1 compared with human HMGB1. The same phenotype was also observed in other teleost HMGB1s (Fig. 1). As an evolutionarily conserved protein, phylogenetic analysis showed that known HMGB1 proteins were classified into two subgroups (Fish subgroup and Non-Fish subgroup). As expected, Ls-HMGB1 was clustered into fish HMGB1s and had the closest distance with Sciaenops ocellatus (Fig. 2). 3.2. Tissue distribution of Ls-HMGB1 The HMGB1 gene was widely expressed in mammalian tissues, with higher levels in the lymphoid, tissue thymus, testis and neonatal liver [25]. Similar patterns were also found in reported teleost HMGB1 [17e19]. In present study, Ls-HMGB1 was ubiquitously distributed in all analyzed tissues. The mRNA expression levels in liver, head kidney, skin, kidney, gill, heart, thymus, intestine, stomach, spleen and muscle were 13.6-, 6.8-, 18.2-, 15.1-, 2.8-, 15.1-, 6.9-，3.9-, 13.3-, 2.3- and 8.1-fold compared with the expression in brain (Fig. 3), which implied that Ls-HMGB1 may play multiple roles in healthy fish. Like grass carp HMGB1b [18], LsHMGB1 exhibited the highest expression levels in skin. As we known, fish skin provided the first barrier against pathogens adhesion [26]. Moreover, HMGB1 worked as a damage-associated molecular pattern (DAMP) molecular that alerted the immune system to resist external danger [27]. So we speculated that LsHMGB1 might contribute to the “barrier” role of skin in humphead snapper. 3.3. Expression profiles of Ls-HMGB1 in head kidney (HK) response to V. harveyi and viral PAMP stimulations In red drum, HMGB1 was up-regulated upon bacterial infection and secreted by bacteria infected. And recombinant SoHMGB1 could promote HK macrophages proliferation, activation and antibacterial activity [17]. The similar results were recorded in report of goldfish HMGB1 (gHMGB1). In addition, the recombinant gHMGB1 also induced TNFa-2 and IL-1b production in goldfish macrophages, suggesting a crucial role of gHMGB1 in inflammatory regulation and antimicrobial response [19]. Our data exhibited that transcripts of Ls-HMGB1 were significantly increased at 18 h (11.8fold) after V. harveyi challenged compared with control group (Fig. 4), implied that Ls-HMGB1 was involved in host immune response to bacterial infection. In the case of Viral PAMP poly I:C stimulation, it have been demonstrated in grass carp that HMGB1
542
J. Cai et al. / Fish & Shellfish Immunology 40 (2014) 539e544
Fig. 1. Multiple alignments of Ls-HMGB1 amino acid sequence with other known HMGB1s. The black shadow region indicated identical residues. Similar amino acids are shaded in grey. The HMG domains were indicated by rounded boxes. The acidic tails were marked by dotted box. GenBank accession numbers were listed in Table 2.
Fig. 2. Phylogenetic analysis of Ls-HMGB1. Amino acid sequences of Ls-HMGB1 was marked by solid triangle. The GenBank accession numbers were listed in Table 2.
Fig. 3. Tissue distribution of Ls-HMGB1. Three parallel samples of each tissue were collected from three healthy fish. Data were expressed as a ratio to Ls-HMGB1 mRNA expression in the brain. Vertical bars represented the means ± SD. Significant difference was indicated by asterisks, *P < 0.05 or **P < 0.01.
J. Cai et al. / Fish & Shellfish Immunology 40 (2014) 539e544
543
Fig. 6. The effect of rLsHMGB1 on mRNA levels of Ls-IL6 in head kidney leukocytes. * indicate statistical difference at P < 0.05 (n ¼ 3). Fig. 4. Expression profiles of Ls-HMGB1 after different stimulation in head kidney. Data are expressed as a ratio to Ls-HMGB1 mRNA in sample from unstimulated fish. The values are shown as mean ± SD. Significant difference was indicated by asterisks, **P < 0.01.
expression can be induced by poly I:C [18]. And similar expression profile was observed in our study, significant increase (P < 0.05) of Ls-HMGB1 expression was detected at 18 h, whereas a small increase was seen at 6 h post-stimulation (Fig. 4). The data indicated a potential role of Ls-HMGB1 in innate immune response to viral infection. Given that HMGB1 was considered as an alarmin, it released rapidly once external danger stimulus and ultimately promotes homeostasis [28]. The secreted HMGB1 triggered immune responses and induce more cytokines production, such as IL1, TNF-a, IL-6 [5]. In turn, HMGB1 could be induced by cytokines or pro-inflammatory molecules production [29,30]. These findings implied that HMGB1 expression might be regulated by a signaling cascade, which could explain the expression patterns at 12 h and 24 h after stimulation. On the other hand, the increasing HMGB1 levels might cause organ damage [31]. This could be the reason why a sharp decrease of HMGB1 occurred at 24 h follow stimulus. And the assumption above needed to be confirmed in future research.
3.4. rLsHMGB1 induced Ls-IL6 expression in HKLs of L. sanguineus We evaluated induction of Ls-IL6 gene expression in HKLs treated with rLsHMGB1. Recombinant Ls-HMGB1 protein was purified at its predicted molecular weight. As shown in Fig. 5, one single band with the molecular weight of 27.84 kDa including the size of 3.82 kDa of tags was indicated by SDS-PAGE analysis. Addition of rLsHMGB1 resulted in a 6.2-fold increase of Ls-IL6 mRNA level compared with control Fig. 6. In human primary monocytes/macrophages, HMGB1 has been proved to stimulate the expression of IL-6 [5]. Given the pleiotropic roles of IL-6 in immune response and inflammation [32], our data indicated that the conserve function of LsHMGB1 in inducing proinflammatory cytokine expression and multiple roles in regulating immune response as well. 4. Conclusion In this study, a HMGB1 homolog was cloned and characterized from humphead snapper, L. sanguineus. Ls-HMGB1 contained two conserve HMG box motifs and an acidic tail, showed the highest similarity to S. ocellatus HMGB1. qRT-PCR analysis showed that LsHMGB1 expressed widely in all examined tissues and responded to bacterial/viral PAMP challenged in head-kidney. Furthermore, the stimulatory effect of rLsHMGB1 on Ls-IL6 mRNA expression was also identified in vitro. These present data indicated that Ls-HMGB1 may play an important role in immune response of L. sanguineus against bacterial/viral pathogen. Acknowledgments The authors wish to thank all the laboratory members' suggestion on this manuscript. This work was supported by Educational Commission of Guangdong Province (2012CXZD0026, 2013gjhz0008) and Science and Technology Planning Project of Guangdong Province (2012B050600029). References
Fig. 5. SDS-PAGE analysis of purified rLsHMGB1. Lane 1, protein marker; Lane 2, purified rLsHMGB1.
[1] Hardman CH, Broadhurst RW, Raine AR, Grasser KD, Thomas JO, Laue ED. Structure of the A-domain of HMG1 and its interaction with DNA as studied by heteronuclear three- and four-dimensional NMR spectroscopy. Biochemistry 1995;34(51):16596e607. [2] Bustin M. Regulation of DNA-dependent activities by the functional motifs of the high-mobility-group chromosomal proteins. Mol Cell Biol 1999;19: 5237e46. [3] Stros M. HMGB proteins: interactions with DNA and chromatin. Biochim Biophys Acta 2010;1799:101e13.
544
J. Cai et al. / Fish & Shellfish Immunology 40 (2014) 539e544
[4] Altieri F, Grillo C, Maceroni M, Chichiarelli S. DNA damage and repair: from molecular mechanisms to health implications. Antioxid Redox Signal 2008;10: 891e938. [5] Andersson U, Wang H, Palmblad K, Aveberger AC, Bloom O, ErlandssonHarris H, et al. High mobility group 1 protein (HMG-1) stimulates proinflammatory cytokine synthesis in human monocytes. J Exp Med 2000;192(4): 565e70. [6] Fiuza C, Bustin M, Talwar S, Tropea M, Gerstenberger E, Shelhamer JH, et al. Inflammation-promoting activity of HMGB1 on human microvascular endothelial cells. Blood 2003;101(7):2652e60. [7] Palumbo R, Sampaolesi M, De Marchis F, Tonlorenzi R, Colombetti S, Mondino A, et al. Extracellular HMGB1, a signal of tissue damage, induces mesoangioblast migration and proliferation. J Cell Biol 2004;164(3): 441e9. [8] Rouhiainen A, Kuja-Panula J, Wilkman E, Pakkanen J, Stenfors J, Tuominen RK, et al. Regulation of monocyte migration by amphoterin (HMGB1). Blood 2004;104(4):1174e82. [9] Messmer D, Yang H, Telusma G, Knoll F, Li J, Messmer B, et al. High mobility group box protein 1: an endogenous signal for dendritic cell maturation and Th1 polarization. J Immunol 2004;173(1):307e13. [10] Park JS, Arcaroli J, Yum HK, Yang H, Wang H, Yang KY, et al. Activation of gene expression in human neutrophils by high mobility group box 1 protein. Am J Physiol Cell Physiol 2003;284(4):C870e9. [11] Yang H, Wang H, Tracey KJ. HMG-1 rediscovered as a cytokine. Shock 2001;15(4):247e53. [12] Cui XS, Shen XH, Kim NH. High mobility group box 1 (HMGB1) is implicated in preimplantation embryo development in the mouse. Mol Reprod Dev 2008;75:1290e9. [13] Goodwin GH, Sanders C, Johns EW. A new group of chromatin-associated proteins with a high content of acidic and basic amino acids. Eur J Biochem 1973;38:14e9. [14] Pang Y, Xiao R, Liu X, Li Q. Identification and characterization of the lamprey high-mobility group box 1 gene. PLoS One 2012;7:e35755. [15] Zhao X, Kuja-Panula J, Rouhiainen A, Chen YC, Panula P, Rauvala H. High mobility group box-1 (HMGB1; amphoterin) is required for zebrafish brain development. J Biol Chem 2011;286:23200e13. [16] Wang M, Wang L, Guo Y, Zhou Z, Yi Q, Zhang D, et al. A high mobility group box 1 (HMGB1) gene from Chlamys farreri and the DNA-binding ability and pro-inflammatory activity of its recombinant protein. Fish Shellfish Immunol 2014;36(2):393e400.
[17] Zhao L, Hu YH, Sun JS, Sun L. The high mobility group box 1 protein of Sciaenops ocellatus is a secreted cytokine that stimulates macrophage activation. Dev Comp Immunol 2011a;35(10):1052e8. [18] Yang C, Peng L, Su J. Two HMGB1 genes from grass carp Ctenopharyngodon idella mediate immune responses to viral/bacterial PAMPs and GCRV challenge. Dev Comp Immunol 2013;39(3):133e46. [19] Xie J, Hodgkinson JW, Li C, Kovacevic N, Belosevic M. Identification and functional characterization of the goldfish (Carassius auratus L.) high mobility group box 1 (HMGB1) chromatin-binding protein. Dev Comp Immunol 2014;44(1):245e53. [20] Fang P, Pan HC, Lin SL, Zhang WQ, Rauvala H, Schachner M, et al. HMGB1 contributes to regeneration after spinal cord injury in adult zebrafish. Mol Neurobiol 2014;49(1):472e83. [21] Cai J, Huang Y, Wei S, Huang X, Ye F, Fu J, et al. Characterization of p38 MAPKs from orange-spotted grouper, Epinephelus coioides involved in SGIV infection. Fish Shellfish Immunol 2011;31(6):1129e36. [22] Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 2008;3(6):1101e8. [23] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2△△Ct method. Methods 2001;25:402e8. [24] Toda H, Saito Y, Koike T, Takizawa F, Araki K, Yabu T, et al. Conservation of characteristics and functions of CD4 positive lymphocytes in a teleost fish. Dev Comp Immunol 2011;35(6):650e60. [25] Mosevitsky MI, Novitskaya VA, Iogannsen MG, Zabezhinsky MA. Tissue specificity of nucleo-cytoplasmic distribution of HMG1 and HMG2 proteins and their probable functions. Eur J Biochem 1989;185(2):303e10. [26] Shephard KL. Functions for fish mucus. Rev Fish Biol Fish 1994;4:401e29. [27] Bianchi ME. HMGB1 loves company. J Leukoc Biol 2009;86(3):573e6. [28] Klune JR, Dhupar R, Cardinal J, Billiar TR, Tsung A. HMGB1: endogenous danger signaling. Mol Med 2008;14(7e8):476e84. [29] Wang H, Vishnubhakat JM, Bloom O, Zhang M, Ombrellino M, Sama A, et al. Proinflammatory cytokines(tumor necrosis factor and interleukin 1) stimulate release of high mobility group protein-1 by pituicytes. Surgery 1999;126(2): 389e92. [30] Tang D, Kang R, Zeh 3rd HJ, Lotze MT. High-mobility group box 1, oxidative stress, and disease. Antioxid Redox Signal 2011;14(7):1315e35. [31] Asavarut P, Zhao H, Gu J, Ma D. The role of HMGB1 in inflammation-mediated organ injury. Acta Anaesthesiol Taiwan 2013;51(1):28e33. [32] Hirano T. Interleukin 6 and its receptor: ten years later. Int Rev Immunol 1998;16(3e4):249e84.